Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

A new endonuclease recognizing the deoxynucleotide sequence CCNNGG from the cyanobacterium Synechocystis 6701.

PubMed

Calléja, F; Tandeau de Marsac, N; Coursin, T; van Ormondt, H; de Waard, A

1985-09-25

A new sequence-specific endonuclease from the cyanobacterium Synechocystis species PCC 6701 has been purified and characterized. This enzyme, SecI, is unique in recognizing the nucleotide sequence: 5' -CCNNGG-3' 3' -GGNNCC-5' and cleaves it at the position indicated by the symbol. Two other restriction endonucleases, SecII and SecIII, found in this organism are isoschizomers of MspI and MstII, respectively.

A low molecular weight artificial RNA of unique size with multiple probe target regions

NASA Technical Reports Server (NTRS)

Pitulle, C.; Dsouza, L.; Fox, G. E.

1997-01-01

Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

PubMed

Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

2017-09-14

The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

A new endonuclease recognizing the deoxynucleotide sequence CCNNGG from the cyanobacterium Synechocystis 6701.

PubMed Central

Calléja, F; Tandeau de Marsac, N; Coursin, T; van Ormondt, H; de Waard, A

1985-01-01

A new sequence-specific endonuclease from the cyanobacterium Synechocystis species PCC 6701 has been purified and characterized. This enzyme, SecI, is unique in recognizing the nucleotide sequence: 5' -CCNNGG-3' 3' -GGNNCC-5' and cleaves it at the position indicated by the symbol. Two other restriction endonucleases, SecII and SecIII, found in this organism are isoschizomers of MspI and MstII, respectively. Images PMID:2997722

Partial bisulfite conversion for unique template sequencing

PubMed Central

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael

2018-01-01

Abstract We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. PMID:29161423

Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)

PubMed Central

Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.

1996-01-01

The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146

Finding specific RNA motifs: Function in a zeptomole world?

PubMed Central

KNIGHT, ROB; YARUS, MICHAEL

2003-01-01

We have developed a new method for estimating the abundance of any modular (piecewise) RNA motif within a longer random region. We have used this method to estimate the size of the active motifs available to modern SELEX experiments (picomoles of unique sequences) and to a plausible RNA World (zeptomoles of unique sequences: 1 zmole = 602 sequences). Unexpectedly, activities such as specific isoleucine binding are almost certainly present in zeptomoles of molecules, and even ribozymes such as self-cleavage motifs may appear (depending on assumptions about the minimal structures). The number of specified nucleotides is not the only important determinant of a motif’s rarity: The number of modules into which it is divided, and the details of this division, are also crucial. We propose three maxims for easily isolated motifs: the Maxim of Minimization, the Maxim of Multiplicity, and the Maxim of the Median. These maxims together state that selected motifs should be small and composed of as many separate, equally sized modules as possible. For evenly divided motifs with four modules, the largest accessible activity in picomole scale (1–1000 pmole) pools of length 100 is about 34 nucleotides; while for zeptomole scale (1–1000 zmole) pools it is about 20 specific nucleotides (50% probability of occurrence). This latter figure includes some ribozymes and aptamers. Consequently, an RNA metabolism apparently could have begun with only zeptomoles of RNA molecules. PMID:12554865

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Full genome sequence of Rocio virus reveal substantial variations from the prototype Rocio virus SPH 34675 sequence.

PubMed

Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A

2018-01-01

Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Molecular epidemiology demonstrated three emerging clusters of human immunodeficiency virus type 1 subtype B infection in Hong Kong.

PubMed

Leung, Tommy W C; Mak, Darwin; Wong, K H; Wang, Y; Song, Y H; Tsang, D N C; Wong, C; Shao, Y M; Lim, W L

2008-07-01

We conducted a molecular epidemiological study on newly diagnosed human immunodeficiency virus type 1 (HIV-1)-infected patients in Hong Kong to identify the epidemiological linkage of HIV-1 infection in the locality. Reverse transcription polymerase chain reaction (RT-PCR) for HIV-1 was performed on newly diagnosed HIV-1-positive sera collected from January 2002 to December 2006. PCR products correspond to the env C2V3V4 region and gag p17/p24 junction of the HIV-1 genome were nucleotide sequenced. Phylogenetic analyses performed on the acquired nucleotide sequences revealed that CRF01_AE and subtype B were the two dominant HIV-1 subtypes. Analyses also demonstrated the presence of three emerging HIV-1 clusters among the subtype B sequences in Hong Kong. Individual cluster possesses a unique cluster-specific amino acid signature for identification. Data show that one of the clusters (Cluster I) is rapidly expanding. In addition to the unique cluster-specific amino acid signature, the majority of sequences in Cluster I harbor a 6-amino acid insertion at the gag p17/p24 junction in a region that is thought to be closely associated with HIV-1 infectivity.

Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured microphage from the turkey gastrointestinal system

PubMed Central

2011-01-01

The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

Optimization of sequence alignment for simple sequence repeat regions.

PubMed

Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C

2011-07-20

Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.

Recombinatorial biases and convergent recombination determine interindividual TCRβ sharing in murine thymocytes.

PubMed

Li, Hanjie; Ye, Congting; Ji, Guoli; Wu, Xiaohui; Xiang, Zhe; Li, Yuanyue; Cao, Yonghao; Liu, Xiaolong; Douek, Daniel C; Price, David A; Han, Jiahuai

2012-09-01

Overlap of TCR repertoires among individuals provides the molecular basis for public T cell responses. By deep-sequencing the TCRβ repertoires of CD4+CD8+ thymocytes from three individual mice, we observed that a substantial degree of TCRβ overlap, comprising ∼10-15% of all unique amino acid sequences and ∼5-10% of all unique nucleotide sequences across any two individuals, is already present at this early stage of T cell development. The majority of TCRβ sharing between individual thymocyte repertoires could be attributed to the process of convergent recombination, with additional contributions likely arising from recombinatorial biases; the role of selection during intrathymic development was negligible. These results indicate that the process of TCR gene recombination is the major determinant of clonotype sharing between individuals.

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

Precise detection of de novo single nucleotide variants in human genomes.

PubMed

Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

2018-05-22

The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

PubMed Central

Park, Ji Hye

2018-01-01

Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531

Identification of common, unique and polymorphic microsatellites among 73 cyanobacterial genomes.

PubMed

Kabra, Ritika; Kapil, Aditi; Attarwala, Kherunnisa; Rai, Piyush Kant; Shanker, Asheesh

2016-04-01

Microsatellites also known as Simple Sequence Repeats are short tandem repeats of 1-6 nucleotides. These repeats are found in coding as well as non-coding regions of both prokaryotic and eukaryotic genomes and play a significant role in the study of gene regulation, genetic mapping, DNA fingerprinting and evolutionary studies. The availability of 73 complete genome sequences of cyanobacteria enabled us to mine and statistically analyze microsatellites in these genomes. The cyanobacterial microsatellites identified through bioinformatics analysis were stored in a user-friendly database named CyanoSat, which is an efficient data representation and query system designed using ASP.net. The information in CyanoSat comprises of perfect, imperfect and compound microsatellites found in coding, non-coding and coding-non-coding regions. Moreover, it contains PCR primers with 200 nucleotides long flanking region. The mined cyanobacterial microsatellites can be freely accessed at www.compubio.in/CyanoSat/home.aspx. In addition to this 82 polymorphic, 13,866 unique and 2390 common microsatellites were also detected. These microsatellites will be useful in strain identification and genetic diversity studies of cyanobacteria.

Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection

PubMed Central

KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.

2016-01-01

CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

PubMed Central

Schermerhorn, Kelly M.; Gardner, Andrew F.

2015-01-01

Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics.

PubMed

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica . All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/.

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics

PubMed Central

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica. All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/. PMID:28261563

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE PAGES

Williams, Kelly Porter; Lau, Britney Yan

2016-10-28

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Kelly Porter; Lau, Britney Yan

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.

PubMed

Alkhateeb, Abedalrhman; Rueda, Luis

2017-08-01

Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.

Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

PubMed

Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

2006-05-01

Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

Estimating the Population Mutation Rate from a de novo Assembled Bactrian Camel Genome and Cross-Species Comparison with Dromedary ESTs

PubMed Central

2014-01-01

The Bactrian camel (Camelus bactrianus) and the dromedary (Camelus dromedarius) are among the last species that have been domesticated around 3000–6000 years ago. During domestication, strong artificial (anthropogenic) selection has shaped the livestock, creating a huge amount of phenotypes and breeds. Hence, domestic animals represent a unique resource to understand the genetic basis of phenotypic variation and adaptation. Similar to its late domestication history, the Bactrian camel is also among the last livestock animals to have its genome sequenced and deciphered. As no genomic data have been available until recently, we generated a de novo assembly by shotgun sequencing of a single male Bactrian camel. We obtained 1.6 Gb genomic sequences, which correspond to more than half of the Bactrian camel’s genome. The aim of this study was to identify heterozygous single-nucleotide polymorphisms (SNPs) and to estimate population parameters and nucleotide diversity based on an individual camel. With an average 6.6-fold coverage, we detected over 116 000 heterozygous SNPs and recorded a genome-wide nucleotide diversity similar to that of other domesticated ungulates. More than 20 000 (85%) dromedary expressed sequence tags successfully aligned to our genomic draft. Our results provide a template for future association studies targeting economically relevant traits and to identify changes underlying the process of camel domestication and environmental adaptation. PMID:23454912

Mitochondrial control-region sequence variation in aboriginal Australians.

PubMed Central

van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B

1998-01-01

The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317

Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.

PubMed

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John

2010-12-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.

Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿

PubMed Central

Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John

2010-01-01

In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708

Technical Considerations for Reduced Representation Bisulfite Sequencing with Multiplexed Libraries

PubMed Central

Chatterjee, Aniruddha; Rodger, Euan J.; Stockwell, Peter A.; Weeks, Robert J.; Morison, Ian M.

2012-01-01

Reduced representation bisulfite sequencing (RRBS), which couples bisulfite conversion and next generation sequencing, is an innovative method that specifically enriches genomic regions with a high density of potential methylation sites and enables investigation of DNA methylation at single-nucleotide resolution. Recent advances in the Illumina DNA sample preparation protocol and sequencing technology have vastly improved sequencing throughput capacity. Although the new Illumina technology is now widely used, the unique challenges associated with multiplexed RRBS libraries on this platform have not been previously described. We have made modifications to the RRBS library preparation protocol to sequence multiplexed libraries on a single flow cell lane of the Illumina HiSeq 2000. Furthermore, our analysis incorporates a bioinformatics pipeline specifically designed to process bisulfite-converted sequencing reads and evaluate the output and quality of the sequencing data generated from the multiplexed libraries. We obtained an average of 42 million paired-end reads per sample for each flow-cell lane, with a high unique mapping efficiency to the reference human genome. Here we provide a roadmap of modifications, strategies, and trouble shooting approaches we implemented to optimize sequencing of multiplexed libraries on an a RRBS background. PMID:23193365

Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

PubMed

Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

2017-10-01

Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

On fuzzy semantic similarity measure for DNA coding.

PubMed

Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

2016-02-01

A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database

PubMed Central

2017-01-01

Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack. PMID:28392799

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Organization and transient expression of the gene for human U11 snRNA

PubMed Central

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

PubMed Central

2014-01-01

Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

An Outbreak of Acute Hepatitis Caused by Genotype IB Hepatitis A Viruses Contaminating the Water Supply in Thailand.

PubMed

Ruchusatsawat, Kriangsak; Wongpiyabovorn, Jongkonnee; Kawidam, Chonthicha; Thiemsing, Laddawan; Sangkitporn, Somchai; Yoshizaki, Sayaka; Tatsumi, Masashi; Takeda, Naokazu; Ishii, Koji

2016-01-01

In 2000, an outbreak of acute hepatitis A was reported in a province adjacent to Bangkok, Thailand. To investigate the cause of the 2000 hepatitis A outbreaks in Thailand using molecular epidemiological analysis. Serum and stool specimens were collected from patients who were clinically diagnosed with acute viral hepatitis. Water samples from drinking water and deep-drilled wells were also collected. These specimens were subjected to polymerase chain reaction (PCR) amplification and sequencing of the VP1/2A region of the hepatitis A virus (HAV) genome. The entire genome sequence of one of the fecal specimens was determined and phylogenetically analyzed with those of known HAV sequences. Eleven of 24 fecal specimens collected from acute viral hepatitis patients were positive as determined by semi- nested reverse transcription PCR targeting the VP1/2A region of HAV. The nucleotide sequence of these samples had an identical genotype IB sequence, suggesting that the same causative agent was present. The complete nucleotide sequence derived from one of the samples indicated that the Thai genotype IB strain should be classified in a unique phylogenetic cluster. The analysis using an adjusted odds ratio showed that the consumption of groundwater was the most likely risk factor associated with the disease. © 2017 S. Karger AG, Basel.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

The Complete Genomic Sequence of Pepper Yellow Leaf Curl Virus (PYLCV) and Its Implications for Our Understanding of Evolution Dynamics in the Genus Polerovirus

PubMed Central

Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

2013-01-01

We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range. PMID:23936244

The complete genomic sequence of pepper yellow leaf curl virus (PYLCV) and its implications for our understanding of evolution dynamics in the genus polerovirus.

PubMed

Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

2013-01-01

We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

The Unique hmuY Gene Sequence as a Specific Marker of Porphyromonas gingivalis

PubMed Central

Mackiewicz, Paweł; Radwan-Oczko, Małgorzata; Kantorowicz, Małgorzata; Chomyszyn-Gajewska, Maria; Frąszczak, Magdalena; Bielecki, Marcin; Olczak, Mariusz; Olczak, Teresa

2013-01-01

Porphyromonas gingivalis, a major etiological agent of chronic periodontitis, acquires heme from host hemoproteins using the HmuY hemophore. The aim of this study was to develop a specific P. gingivalis marker based on a hmuY gene sequence. Subgingival samples were collected from 66 patients with chronic periodontitis and 40 healthy subjects and the entire hmuY gene was analyzed in positive samples. Phylogenetic analyses demonstrated that both the amino acid sequence of the HmuY protein and the nucleotide sequence of the hmuY gene are unique among P. gingivalis strains/isolates and show low identity to sequences found in other species (below 50 and 56%, respectively). In agreement with these findings, a set of hmuY gene-based primers and standard/real-time PCR with SYBR Green chemistry allowed us to specifically detect P. gingivalis in patients with chronic periodontitis (77.3%) and healthy subjects (20%), the latter possessing lower number of P. gingivalis cells and total bacterial cells. Isolates from healthy subjects possess the hmuY gene-based nucleotide sequence pattern occurring in W83/W50/A7436 (n = 4), 381/ATCC 33277 (n = 3) or TDC60 (n = 1) strains, whereas those from patients typically have TDC60 (n = 21), W83/W50/A7436 (n = 17) and 381/ATCC 33277 (n = 13) strains. We observed a significant correlation between periodontal index of risk of infectiousness (PIRI) and the presence/absence of P. gingivalis (regardless of the hmuY gene-based sequence pattern of the isolate identified [r = 0.43; P = 0.0002] and considering particular isolate pattern [r = 0.38; P = 0.0012]). In conclusion, we demonstrated that the hmuY gene sequence or its fragments may be used as one of the molecular markers of P. gingivalis. PMID:23844074

Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

PubMed Central

Barnes, W M; Bevan, M

1983-01-01

A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

PubMed Central

Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2018-01-01

Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

Advanced Applications of Next-Generation Sequencing Technologies to Orchid Biology.

PubMed

Yeh, Chuan-Ming; Liu, Zhong-Jian; Tsai, Wen-Chieh

2018-01-01

Next-generation sequencing technologies are revolutionizing biology by permitting, transcriptome sequencing, whole-genome sequencing and resequencing, and genome-wide single nucleotide polymorphism profiling. Orchid research has benefited from this breakthrough, and a few orchid genomes are now available; new biological questions can be approached and new breeding strategies can be designed. The first part of this review describes the unique features of orchid biology. The second part provides an overview of the current next-generation sequencing platforms, many of which are already used in plant laboratories. The third part summarizes the state of orchid transcriptome and genome sequencing and illustrates current achievements. The genetic sequences currently obtained will not only provide a broad scope for the study of orchid biology, but also serves as a starting point for uncovering the mystery of orchid evolution.

DSAP: deep-sequencing small RNA analysis pipeline.

PubMed

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, M.D.; Shoffner, J.M.; Wallace, D.C.

1996-01-22

The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients ormore » 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.« less

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

PubMed

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

CRISPR regulation of intraspecies diversification by limiting IS transposition and intercellular recombination.

PubMed

Watanabe, Takayasu; Nozawa, Takashi; Aikawa, Chihiro; Amano, Atsuo; Maruyama, Fumito; Nakagawa, Ichiro

2013-01-01

Mobile genetic elements (MGEs) and genetic rearrangement are considered as major driving forces of bacterial diversification. Previous comparative genome analysis of Porphyromonas gingivalis, a pathogen related to periodontitis, implied such an important relationship. As a counterpart system to MGEs, clustered regularly interspaced short palindromic repeats (CRISPRs) in bacteria may be useful for genetic typing. We found that CRISPR typing could be a reasonable alternative to conventional methods for characterizing phylogenetic relationships among 60 highly diverse P. gingivalis isolates. Examination of genetic recombination along with multilocus sequence typing suggests the importance of such events between different isolates. MGEs appear to be strategically located at the breakpoint gaps of complicated genome rearrangements. Of these MGEs, insertion sequences (ISs) were found most frequently. CRISPR analysis identified 2,150 spacers that were clustered into 1,187 unique ones. Most of these spacers exhibited no significant nucleotide similarity to known sequences (97.6%: 1,158/1,187). Surprisingly, CRISPR spacers exhibiting high nucleotide similarity to regions of P. gingivalis genomes including ISs were predominant. The proportion of such spacers to all the unique spacers (1.6%: 19/1,187) was the highest among previous studies, suggesting novel functions for these CRISPRs. These results indicate that P. gingivalis is a bacterium with high intraspecies diversity caused by frequent insertion sequence (IS) transposition, whereas both the introduction of foreign DNA, primarily from other P. gingivalis cells, and IS transposition are limited by CRISPR interference. It is suggested that P. gingivalis CRISPRs could be an important source for understanding the role of CRISPRs in the development of bacterial diversity.

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of novel alleles of the rice blast resistance gene Pi54

NASA Astrophysics Data System (ADS)

Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.

2015-10-01

Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition

PubMed Central

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Bazire, Pascal; Beluche, Odette; Bertrand, Laurie; Besnard-Gonnet, Marielle; Bordelais, Isabelle; Boutard, Magali; Dubois, Maria; Dumont, Corinne; Ettedgui, Evelyne; Fernandez, Patricia; Garcia, Espérance; Aiach, Nathalie Giordanenco; Guerin, Thomas; Hamon, Chadia; Brun, Elodie; Lebled, Sandrine; Lenoble, Patricia; Louesse, Claudine; Mahieu, Eric; Mairey, Barbara; Martins, Nathalie; Megret, Catherine; Milani, Claire; Muanga, Jacqueline; Orvain, Céline; Payen, Emilie; Perroud, Peggy; Petit, Emmanuelle; Robert, Dominique; Ronsin, Murielle; Vacherie, Benoit; Acinas, Silvia G.; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M.; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E.; Stepanauskas, Ramunas; Sullivan, Matthew B.; Brum, Jennifer R.; Duhaime, Melissa B.; Poulos, Bonnie T.; Hurwitz, Bonnie L.; Acinas, Silvia G.; Bork, Peer; Boss, Emmanuel; Bowler, Chris; De Vargas, Colomban; Follows, Michael; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Jaillon, Olivier; Kandels-Lewis, Stefanie; Karp-Boss, Lee; Karsenti, Eric; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stéphane; Raes, Jeroen; Sardet, Christian; Sieracki, Michael E.; Speich, Sabrina; Stemmann, Lars; Sullivan, Matthew B.; Sunagawa, Shinichi; Wincker, Patrick; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-01-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009–2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world’s planktonic ecosystems. PMID:28763055

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

PubMed

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-08-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Enabling multiplexed testing of pooled donor cells through whole-genome sequencing.

PubMed

Chan, Yingleong; Chan, Ying Kai; Goodman, Daniel B; Guo, Xiaoge; Chavez, Alejandro; Lim, Elaine T; Church, George M

2018-04-19

We describe a method that enables the multiplex screening of a pool of many different donor cell lines. Our method accurately predicts each donor proportion from the pool without requiring the use of unique DNA barcodes as markers of donor identity. Instead, we take advantage of common single nucleotide polymorphisms, whole-genome sequencing, and an algorithm to calculate the proportions from the sequencing data. By testing using simulated and real data, we showed that our method robustly predicts the individual proportions from a mixed-pool of numerous donors, thus enabling the multiplexed testing of diverse donor cells en masse.More information is available at https://pgpresearch.med.harvard.edu/poolseq/.

Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

PubMed

Lathe, R

1985-05-05

Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Targeting of Repeated Sequences Unique to a Gene Results in Significant Increases in Antisense Oligonucleotide Potency

PubMed Central

Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.

2014-01-01

A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092

A population study of the minicircles in Trypanosoma cruzi: predicting guide RNAs in the absence of empirical RNA editing.

PubMed

Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R

2007-05-24

The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.

Construction of a small Mus musculus repetitive DNA library: identification of a new satellite sequence in Mus musculus.

PubMed Central

Pietras, D F; Bennett, K L; Siracusa, L D; Woodworth-Gutai, M; Chapman, V M; Gross, K W; Kane-Haas, C; Hastie, N D

1983-01-01

We report the construction of a small library of recombinant plasmids containing Mus musculus repetitive DNA inserts. The repetitive cloned fraction was derived from denatured genomic DNA by reassociation to a Cot value at which repetitive, but not unique, sequences have reannealed followed by exhaustive S1 nuclease treatment to degrade single stranded DNA. Initial characterizations of this library by colony filter hybridizations have led to the identification of a previously undetected M. musculus minor satellite as well as to clones containing M. musculus major satellite sequences. This new satellite is repeated 10-20 times less than the major satellite in the M. musculus genome. It has a repeat length of 130 nucleotides compared with the M. musculus major satellite with a repeat length of 234 nucleotides. Sequence analysis of the minor satellite has shown that it has a 29 base pair region with extensive homology to one of the major satellite repeating subunits. We also show by in situ hybridization that this minor satellite sequence is located at the centromeres and possibly the arms of at least half the M musculus chromosomes. Sequences related to the minor satellite have been found in the DNA of a related Mus species, Mus spretus, and may represent the major satellite of that species. Images PMID:6314268

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-03-01

Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

PubMed

Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

2012-02-01

Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1.

PubMed

Vaz, Paola K; Mahony, Timothy J; Hartley, Carol A; Fowler, Elizabeth V; Ficorilli, Nino; Lee, Sang W; Gilkerson, James R; Browning, Glenn F; Devlin, Joanne M

2016-01-22

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1). The MaHV-1 viral genome was sequenced using an Illumina MiSeq sequencer, de novo assembly was performed and the genome was annotated. The MaHV-1 genome was 140 kbp in length and clustered phylogenetically with the primate simplexviruses, sharing 67% nucleotide sequence identity with Human herpesviruses 1 and 2. The MaHV-1 genome contained 66 predicted open reading frames (ORFs) homologous to those in other herpesvirus genomes, but lacked homologues of UL3, UL4, UL56 and glycoprotein J. This is the first alphaherpesvirus genome that has been found to lack the UL3 and UL4 homologues. We identified six novel ORFs and confirmed their transcription by RT-PCR. This is the first genome sequence of a herpesvirus that infects metatherians, a taxonomically unique mammalian clade. Members of the Simplexvirus genus are remarkably conserved, so the absence of ORFs otherwise retained in eutherian and avian alphaherpesviruses contributes to our understanding of the Alphaherpesvirinae. Further study of metatherian herpesvirus genetics and pathogenesis provides a unique approach to understanding herpesvirus-mammalian interactions.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang

2016-06-21

Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains revealed that FZ91-30 had five mutations; two in the unique region of the VP1 protein (VP1u) and three in VP3. Sequence alignment of the Rep1 proteins revealed two amino acid alterations for FZ91-30, both of which were conserved for two pathogenic strains YY and P. Transfection of the plasmid pFZ in 11-day-old embryonated goose eggs resulted in generation of infectious virus with similar biological properties as compared with the parental strain. The amino acid mutations identified in the VP1 and Rep1 protein may contribute to the attenuation of FZ91-30 in Muscovy ducklings. Plasmid transfection in embryonated goose eggs was suitable for rescue of infectious MDPV.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

PubMed Central

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siegel, A.

Previous work had demonstrated the presence of a unique low-molecular-weight RNA component (LMC) in extracts of tobacco mosaic virus (TMV) infected tissue. Enough of this component has been isolated during the past year to ascertain that it has a molecular weight of 250,000 daltons and that it acts as an in vitro messenger for the synthesis of TMV capsid protein. Thus, we conclude that at least one monocistronic messenger RNA for a virion coded product is generated during TMV infection. Strains of TMV were classified according to nucleotide sequence homology of their RNAs. The strains fall into groups by themore » test employed. No differences were observed between strains within a group, whereas no homology was detected between groups. Using this information, it was possible, in part, to relate differences in capsid protein amino acid sequences to the degree of nomology of their nucleotide coding sequences. A study was initiated into the Pot Y virus group infection mechanism. In contrast to TMV infection, it was determined that for both tobacco etch and potato virus Y that: viral RNA synthesis is inhibited by actinomycin B and synthesis by virus-related proteins is inhibited by chloramphenicol.« less

A large outbreak of acute gastroenteritis in Shippensburg, Pennsylvania, 1972 revisited: evidence for common source exposure to a recombinant GII.Pg/GII.3 norovirus.

PubMed

Johnson, J A; Parra, G I; Levenson, E A; Green, K Y

2017-06-01

Historical outbreaks can be an important source of information in the understanding of norovirus evolution and epidemiology. Here, we revisit an outbreak of undiagnosed gastroenteritis that occurred in Shippensburg, Pennsylvania in 1972. Nearly 5000 people fell ill over the course of 10 days. Symptoms included diarrhea, vomiting, stomach cramps, and fever, lasting for a median of 24 h. Using current techniques, including next-generation sequencing of full-length viral genomic amplicons, we identified an unusual norovirus recombinant (GII.Pg/GII.3) in nine of 15 available stool samples from the outbreak. This particular recombinant virus has not been reported in recent decades, although GII.3 and GII.Pg genotypes have been detected individually in current epidemic strains. The consensus nucleotide sequences were nearly identical among the four viral genomes analysed, although each strain had three to seven positions in the genome with heterogenous non-synonymous nucleotide subpopulations. Two of these resulting amino acid polymorphisms were conserved in frequency among all four cases, consistent with common source exposure and successful transmission of a mixed viral population. Continued investigation of variant nucleotide populations and recombination events among ancestral norovirus strains such as the Shippensburg virus may provide unique insight into the origin of contemporary strains.

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

PubMed

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

Extremely low nucleotide polymorphism in Pinus krempfii Lecomte, a unique flat needle pine endemic to Vietnam

PubMed Central

Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E

2014-01-01

Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

PubMed

Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

2016-09-01

Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

Molecular Dynamics Simulations of the 136 Unique Tetranucleotide Sequences of DNA Oligonucleotides. I. Research Design and Results on d(CpG) Steps

PubMed Central

Beveridge, David L.; Barreiro, Gabriela; Byun, K. Suzie; Case, David A.; Cheatham, Thomas E.; Dixit, Surjit B.; Giudice, Emmanuel; Lankas, Filip; Lavery, Richard; Maddocks, John H.; Osman, Roman; Seibert, Eleanore; Sklenar, Heinz; Stoll, Gautier; Thayer, Kelly M.; Varnai, Péter; Young, Matthew A.

2004-01-01

We describe herein a computationally intensive project aimed at carrying out molecular dynamics (MD) simulations including water and counterions on B-DNA oligomers containing all 136 unique tetranucleotide base sequences. This initiative was undertaken by an international collaborative effort involving nine research groups, the “Ascona B-DNA Consortium” (ABC). Calculations were carried out on the 136 cases imbedded in 39 DNA oligomers with repeating tetranucleotide sequences, capped on both ends by GC pairs and each having a total length of 15 nucleotide pairs. All MD simulations were carried out using a well-defined protocol, the AMBER suite of programs, and the parm94 force field. Phase I of the ABC project involves a total of ∼0.6 μs of simulation for systems containing ∼24,000 atoms. The resulting trajectories involve 600,000 coordinate sets and represent ∼400 gigabytes of data. In this article, the research design, details of the simulation protocol, informatics issues, and the organization of the results into a web-accessible database are described. Preliminary results from 15-ns MD trajectories are presented for the d(CpG) step in its 10 unique sequence contexts, and issues of stability and convergence, the extent of quasiergodic problems, and the possibility of long-lived conformational substates are discussed. PMID:15326025

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

PubMed

Álvarez-Martos, Isabel; Ferapontova, Elena E

2017-08-05

A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Genetic variation and dynamics of infections of equid herpesvirus 5 in individual horses.

PubMed

Back, Helena; Ullman, Karin; Leijon, Mikael; Söderlund, Robert; Penell, Johanna; Ståhl, Karl; Pringle, John; Valarcher, Jean-François

2016-01-01

Equid herpesvirus 5 (EHV-5) is related to the human Epstein-Barr virus (human herpesvirus 4) and has frequently been observed in equine populations worldwide. EHV-5 was previously assumed to be low to non-pathogenic; however, studies have also related the virus to the severe lung disease equine multinodular pulmonary fibrosis (EMPF). Genetic information of EHV-5 is scanty: the whole genome was recently described and only limited nucleotide sequences are available. In this study, samples were taken twice 1 year apart from eight healthy horses at the same professional training yard and samples from a ninth horse that was diagnosed with EMPF with samples taken pre- and post-mortem to analyse partial glycoprotein B (gB) gene of EHV-5 by using next-generation sequencing. The analysis resulted in 27 partial gB gene sequences, 11 unique sequence types and five amino acid sequences. These sequences could be classified within four genotypes (I-IV) of the EHV-5 gB gene based on the degree of similarity of the nucleotide and amino acid sequences, and in this work horses were shown to be identified with up to three different genotypes simultaneously. The observations showed a range of interactions between EHV-5 and the host over time, where the same virus persists in some horses, whereas others have a more dynamic infection pattern including strains from different genotypes. This study provides insight into the genetic variation and dynamics of EHV-5, and highlights that further work is needed to understand the EHV-5 interaction with its host.

PigGIS: Pig Genomic Informatics System

PubMed Central

Ruan, Jue; Guo, Yiran; Li, Heng; Hu, Yafeng; Song, Fei; Huang, Xin; Kristiensen, Karsten; Bolund, Lars; Wang, Jun

2007-01-01

Pig Genomic Information System (PigGIS) is a web-based depository of pig (Sus scrofa) genomic learning mainly engineered for biomedical research to locate pig genes from their human homologs and position single nucleotide polymorphisms (SNPs) in different pig populations. It utilizes a variety of sequence data, including whole genome shotgun (WGS) reads and expressed sequence tags (ESTs), and achieves a successful mapping solution to the low-coverage genome problem. With the data presently available, we have identified a total of 15 700 pig consensus sequences covering 18.5 Mb of the homologous human exons. We have also recovered 18 700 SNPs and 20 800 unique 60mer oligonucleotide probes for future pig genome analyses. PigGIS can be freely accessed via the web at and . PMID:17090590

Next-Generation Sequencing of Coccidioides immitis Isolated during Cluster Investigation

PubMed Central

Engelthaler, David M.; Chiller, Tom; Schupp, James A.; Colvin, Joshua; Beckstrom-Sternberg, Stephen M.; Driebe, Elizabeth M.; Moses, Tracy; Tembe, Waibhav; Sinari, Shripad; Beckstrom-Sternberg, James S.; Christoforides, Alexis; Pearson, John V.; Carpten, John; Keim, Paul; Peterson, Ashley; Terashita, Dawn

2011-01-01

Next-generation sequencing enables use of whole-genome sequence typing (WGST) as a viable and discriminatory tool for genotyping and molecular epidemiologic analysis. We used WGST to confirm the linkage of a cluster of Coccidioides immitis isolates from 3 patients who received organ transplants from a single donor who later had positive test results for coccidioidomycosis. Isolates from the 3 patients were nearly genetically identical (a total of 3 single-nucleotide polymorphisms identified among them), thereby demonstrating direct descent of the 3 isolates from an original isolate. We used WGST to demonstrate the genotypic relatedness of C. immitis isolates that were also epidemiologically linked. Thus, WGST offers unique benefits to public health for investigation of clusters considered to be linked to a single source. PMID:21291593

Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions.

PubMed

Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F

2015-11-01

Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates displaying a unique coyote biomarker. Application of a supervised learning method, such as logic regression, to DNA sequence analysis at certain intergenic regions demonstrates that some E. coli strains may evolve to become host-specific. Copyright © 2015 Elsevier Inc. All rights reserved.

Rapid incorporation kinetics and improved fidelity of a novel class of 3'-OH unblocked reversible terminators.

PubMed

Gardner, Andrew F; Wang, Jinchun; Wu, Weidong; Karouby, Jennifer; Li, Hong; Stupi, Brian P; Jack, William E; Hersh, Megan N; Metzker, Michael L

2012-08-01

Recent developments of unique nucleotide probes have expanded our understanding of DNA polymerase function, providing many benefits to techniques involving next-generation sequencing (NGS) technologies. The cyclic reversible termination (CRT) method depends on efficient base-selective incorporation of reversible terminators by DNA polymerases. Most terminators are designed with 3'-O-blocking groups but are incorporated with low efficiency and fidelity. We have developed a novel class of 3'-OH unblocked nucleotides, called Lightning Terminators™, which have a terminating 2-nitrobenzyl moiety attached to hydroxymethylated nucleobases. A key structural feature of this photocleavable group displays a 'molecular tuning' effect with respect to single-base termination and improved nucleotide fidelity. Using Therminator DNA polymerase, we demonstrate that these 3'-OH unblocked terminators exhibit superior enzymatic performance compared to two other reversible terminators, 3'-O-amino-TTP and 3'-O-azidomethyl-TTP. Lightning Terminators show maximum incorporation rates (k(pol)) that range from 35 to 45 nt/s, comparable to the fastest NGS chemistries, yet with catalytic efficiencies (k(pol)/K(D)) comparable to natural nucleotides. Pre-steady-state kinetic studies of thymidine analogs revealed that the major determinant for improved nucleotide selectivity is a significant reduction in k(pol) by >1000-fold over TTP misincorporation. These studies highlight the importance of structure-function relationships of modified nucleotides in dictating polymerase performance.

Surface display of a massively variable lipoprotein by a Legionella diversity-generating retroelement.

PubMed

Arambula, Diego; Wong, Wenge; Medhekar, Bob A; Guo, Huatao; Gingery, Mari; Czornyj, Elizabeth; Liu, Minghsun; Dey, Sanghamitra; Ghosh, Partho; Miller, Jeff F

2013-05-14

Diversity-generating retroelements (DGRs) are a unique family of retroelements that confer selective advantages to their hosts by facilitating localized DNA sequence evolution through a specialized error-prone reverse transcription process. We characterized a DGR in Legionella pneumophila, an opportunistic human pathogen that causes Legionnaires disease. The L. pneumophila DGR is found within a horizontally acquired genomic island, and it can theoretically generate 10(26) unique nucleotide sequences in its target gene, legionella determinent target A (ldtA), creating a repertoire of 10(19) distinct proteins. Expression of the L. pneumophila DGR resulted in transfer of DNA sequence information from a template repeat to a variable repeat (VR) accompanied by adenine-specific mutagenesis of progeny VRs at the 3'end of ldtA. ldtA encodes a twin-arginine translocated lipoprotein that is anchored in the outer leaflet of the outer membrane, with its C-terminal variable region surface exposed. Related DGRs were identified in L. pneumophila clinical isolates that encode unique target proteins with homologous VRs, demonstrating the adaptability of DGR components. This work characterizes a DGR that diversifies a bacterial protein and confirms the hypothesis that DGR-mediated mutagenic homing occurs through a conserved mechanism. Comparative bioinformatics predicts that surface display of massively variable proteins is a defining feature of a subset of bacterial DGRs.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Self-organized, highly luminescent CdSe nanorod-DNA complexes.

PubMed

Artemyev, Mikhail; Kisiel, Dmitry; Abmiotko, Sergey; Antipina, Maria N; Khomutov, Gennady B; Kislov, Vladimir V; Rakhnyanskaya, Anna A

2004-09-01

DNA molecules are useful building blocks and nanotemplates for controllable fabrication of various bioinorganic nanostructures due to their unique physical-chemical properties and recognition capabilities and the synthetic availability of desired nucleotide sequences and length. We have synthesized novel DNA complexes with positively charged, highly luminescent CdSe nanorods that can be self-organized into filamentary, netlike, or spheroidal nanostructures. DNA-CdSe-nanorod filaments possess strongly linearly polarized photoluminescence due to the unidirectional orientation of nanorods along the filaments. Copyright 2004 American Chemical Society

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Complete genome sequence of a novel avian paramyxovirus isolated from wild birds in South Korea.

PubMed

Jeong, Jipseol; Kim, Youngsik; An, Injung; Wang, Seung-Jun; Kim, Yongkwan; Lee, Hyun-Jeong; Choi, Kang-Seuk; Im, Se-Pyeong; Min, Wongi; Oem, Jae-Ku; Jheong, Weonhwa

2018-01-01

A novel avian paramyxovirus (APMV), Cheonsu1510, was isolated from wild bird feces in South Korea and serologically and genetically characterized. In hemagglutination inhibition tests, antiserum against Cheonsu1510 showed low reactivity with other APMVs and vice versa. The complete genome of Cheonsu1510 comprised 15,408 nucleotides, contained six open reading frames (3'-N-P-M-F-HN-L-5'), and showed low sequence identity to other APMVs (< 63%) and a unique genomic composition. Phylogenetic analysis revealed that Cheonsu1510 was related to but distinct from APMV-1, -9, and -15. These results suggest that Cheonsu1510 represents a new APMV serotype, APMV-17.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

PubMed

Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

2008-09-01

A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

Genetic diversity and host specificity varies across three genera of blood parasites in ducks of the Pacific Americas Flyway

USGS Publications Warehouse

Reeves, Andrew B.; Smith, Matthew M.; Meixell, Brandt W.; Fleskes, Joseph P.; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus andLeucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodiumparasites infecting North American waterfowl as compared to those of the generaHaemoproteus and Leucocytozoon.

Genetic Diversity and Host Specificity Varies across Three Genera of Blood Parasites in Ducks of the Pacific Americas Flyway

PubMed Central

Reeves, Andrew B.; Smith, Mathew M.; Meixell, Brandt W.; Fleskes, Joseph P; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus and Leucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodium parasites infecting North American waterfowl as compared to those of the genera Haemoproteus and Leucocytozoon. PMID:25710468

PopHuman: the human population genomics browser

PubMed Central

Mulet, Roger; Villegas-Mirón, Pablo; Hervas, Sergi; Sanz, Esteve; Velasco, Daniel; Bertranpetit, Jaume; Laayouni, Hafid

2018-01-01

Abstract The 1000 Genomes Project (1000GP) represents the most comprehensive world-wide nucleotide variation data set so far in humans, providing the sequencing and analysis of 2504 genomes from 26 populations and reporting >84 million variants. The availability of this sequence data provides the human lineage with an invaluable resource for population genomics studies, allowing the testing of molecular population genetics hypotheses and eventually the understanding of the evolutionary dynamics of genetic variation in human populations. Here we present PopHuman, a new population genomics-oriented genome browser based on JBrowse that allows the interactive visualization and retrieval of an extensive inventory of population genetics metrics. Efficient and reliable parameter estimates have been computed using a novel pipeline that faces the unique features and limitations of the 1000GP data, and include a battery of nucleotide variation measures, divergence and linkage disequilibrium parameters, as well as different tests of neutrality, estimated in non-overlapping windows along the chromosomes and in annotated genes for all 26 populations of the 1000GP. PopHuman is open and freely available at http://pophuman.uab.cat. PMID:29059408

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

1995-01-01

Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

The sequence and de novo assembly of the giant panda genome

PubMed Central

Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

2013-01-01

Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

New Measles Genotype, Uganda

PubMed Central

Muwonge, Apollo; Nanyunja, Miriam; Bwogi, Josephine; Lowe, Luis; Liffick, Stephanie L.; Bellini, William J.; Sylvester, Sempala

2005-01-01

We report the first genetic characterization of wildtype measles viruses from Uganda. Thirty-six virus isolates from outbreaks in 6 districts were analyzed from 2000 to 2002. Analyses of sequences of the nucleoprotein (N) and hemagglutinin (H) genes showed that the Ugandan isolates were all closely related, and phylogenetic analysis indicated that these viruses were members of a unique group within clade D. Sequences of the Ugandan viruses were not closely related to any of the World Health Organization reference sequences representing the 22 currently recognized genotypes. The minimum nucleotide divergence between the Ugandan viruses and the most closely related reference strain, genotype D2, was 3.1% for the N gene and 2.6% for the H gene. Therefore, Ugandan viruses should be considered a new, proposed genotype (d10). This new sequence information will expand the utility of molecular epidemiologic techniques for describing measles transmission patterns in eastern Africa. PMID:16318690

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA

PubMed Central

Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.

1995-01-01

The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

PubMed

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-04-17

The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

PubMed Central

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-01-01

Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

PubMed Central

Howe, J G; Shu, M D

1988-01-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein. Images PMID:2839701

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

PubMed Central

Eriani, G; Dirheimer, G; Gangloff, J

1989-01-01

The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

Brief Overview of a Decade of Genome-Wide Association Studies on Primary Hypertension.

PubMed

Azam, Afifah Binti; Azizan, Elena Aisha Binti

2018-01-01

Primary hypertension is widely believed to be a complex polygenic disorder with the manifestation influenced by the interactions of genomic and environmental factors making identification of susceptibility genes a major challenge. With major advancement in high-throughput genotyping technology, genome-wide association study (GWAS) has become a powerful tool for researchers studying genetically complex diseases. GWASs work through revealing links between DNA sequence variation and a disease or trait with biomedical importance. The human genome is a very long DNA sequence which consists of billions of nucleotides arranged in a unique way. A single base-pair change in the DNA sequence is known as a single nucleotide polymorphism (SNP). With the help of modern genotyping techniques such as chip-based genotyping arrays, thousands of SNPs can be genotyped easily. Large-scale GWASs, in which more than half a million of common SNPs are genotyped and analyzed for disease association in hundreds of thousands of cases and controls, have been broadly successful in identifying SNPs associated with heart diseases, diabetes, autoimmune diseases, and psychiatric disorders. It is however still debatable whether GWAS is the best approach for hypertension. The following is a brief overview on the outcomes of a decade of GWASs on primary hypertension.

Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

PubMed

Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

2017-10-06

Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

Identification of Type A, B, E, and F Botulinum Neurotoxin Genes and of Botulinum Neurotoxigenic Clostridia by Denaturing High-Performance Liquid Chromatography

PubMed Central

Franciosa, Giovanna; Pourshaban, Manoocheher; De Luca, Alessandro; Buccino, Anna; Dallapiccola, Bruno; Aureli, Paolo

2004-01-01

Denaturing high-performance liquid chromatography (DHPLC) is a recently developed technique for rapid screening of nucleotide polymorphisms in PCR products. We used this technique for the identification of type A, B, E, and F botulinum neurotoxin genes. PCR products amplified from a conserved region of the type A, B, E, and F botulinum toxin genes from Clostridium botulinum, neurotoxigenic C. butyricum type E, and C. baratii type F strains were subjected to both DHPLC analysis and sequencing. Unique DHPLC peak profiles were obtained with each different type of botulinum toxin gene fragment, consistent with nucleotide differences observed in the related sequences. We then evaluated the ability of this technique to identify botulinal neurotoxigenic organisms at the genus and species level. A specific short region of the 16S rRNA gene which contains genus-specific and in some cases species-specific heterogeneity was amplified from botulinum neurotoxigenic clostridia and from different food-borne pathogens and subjected to DHPLC analysis. Different peak profiles were obtained for each genus and species, demonstrating that the technique could be a reliable alternative to sequencing for the rapid identification of food-borne pathogens, specifically of botulinal neurotoxigenic clostridia most frequently implicated in human botulism. PMID:15240298

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Molecular Characterization of a Novel Bovine Viral Diarrhea Virus Isolate SD-15

PubMed Central

Zhu, Lisai; Lu, Haibing; Cao, Yufeng; Gai, Xiaochun; Guo, Changming; Liu, Yajing; Liu, Jiaxu; Wang, Xinping

2016-01-01

As one of the major pathogens, bovine viral diarrhea virus caused a significant economic loss to the livestock industry worldwide. Although BVDV infections have increasingly been reported in China in recent years, the molecular aspects of those BVDV strains were barely characterized. In this study, we reported the identification and characterization of a novel BVDV isolate designated as SD-15 from cattle, which is associated with an outbreak characterized by severe hemorrhagic and mucous diarrhea with high morbidity and mortality in Shandong, China. SD-15 was revealed to be a noncytopathic BVDV, and has a complete genomic sequence of 12,285 nucleotides that contains a large open reading frame encoding 3900 amino acids. Alignment analysis showed that SD-15 has 93.8% nucleotide sequence identity with BVDV ZM-95 isolate, a previous BVDV strain isolated from pigs manifesting clinical signs and lesions resembling to classical swine fever. Phylogenetic analysis clustered SD-15 to a BVDV-1m subgenotype. Analysis of the deduced amino acid sequence of glycoproteins revealed that E2 has several highly conserved and variable regions within BVDV-1 genotypes. An additional N-glycosylation site (240NTT) was revealed exclusively in SD-15-encoded E2 in addition to four potential glycosylation sites (Asn-X-Ser/Thr) shared by all BVDV-1 genotypes. Furthermore, unique amino acid and linear epitope mutations were revealed in SD-15-encoded Erns glycoprotein compared with known BVDV-1 genotype. In conclusion, we have isolated a noncytopathic BVDV-1m strain that is associated with a disease characterized by high morbidity and mortality, revealed the complete genome sequence of the first BVDV-1m virus originated from cattle, and found a unique glycosylation site in E2 and a linear epitope mutation in Erns encoded by SD-15 strain. Those results will broaden the current understanding of BVDV infection and lay a basis for future investigation on SD-15-related pathogenesis. PMID:27764206

Genetic Diversity of Hepatitis A Virus in China: VP3-VP1-2A Genes and Evidence of Quasispecies Distribution in the Isolates

PubMed Central

Cao, Jingyuan; Zhou, Wenting; Yi, Yao; Jia, Zhiyuan; Bi, Shengli

2013-01-01

Hepatitis A virus (HAV) is the most common cause of infectious hepatitis throughout the world, spread largely by the fecal-oral route. To characterize the genetic diversity of the virus circulating in China where HAV in endemic, we selected the outbreak cases with identical sequences in VP1-2A junction region and compiled a panel of 42 isolates. The VP3-VP1-2A regions of the HAV capsid-coding genes were further sequenced and analyzed. The quasispecies distribution was evaluated by cloning the VP3 and VP1-2A genes in three clinical samples. Phylogenetic analysis demonstrated that the same genotyping results could be obtained whether using the complete VP3, VP1, or partial VP1-2A genes for analysis in this study, although some differences did exist. Most isolates clustered in sub-genotype IA, and fewer in sub-genotype IB. No amino acid mutations were found at the published neutralizing epitope sites, however, several unique amino acid substitutions in the VP3 or VP1 region were identified, with two amino acid variants closely located to the immunodominant site. Quasispecies analysis showed the mutation frequencies were in the range of 7.22x10-4 -2.33x10-3 substitutions per nucleotide for VP3, VP1, or VP1-2A. When compared with the consensus sequences, mutated nucleotide sites represented the minority of all the analyzed sequences sites. HAV replicated as a complex distribution of closely genetically related variants referred to as quasispecies, and were under negative selection. The results indicate that diverse HAV strains and quasispecies inside the viral populations are presented in China, with unique amino acid substitutions detected close to the immunodominant site, and that the possibility of antigenic escaping mutants cannot be ruled out and needs to be further analyzed. PMID:24069343

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

PubMed

Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

2005-02-01

Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Helicobacter pylori Heat Shock Protein A: Serologic Responses and Genetic Diversity

PubMed Central

Ng, Enders K. W.; Thompson, Stuart A.; Pérez-Pérez, Guillermo I.; Kansau, Imad; van der Ende, Arie; Labigne, Agnès; Sung, Joseph J. Y.; Chung, S. C. Sydney; Blaser, Martin J.

1999-01-01

Helicobacter pylori synthesizes an unusual GroES homolog, heat shock protein A (HspA). The present study was aimed at an assessment of the serological response to HspA in a group of Chinese patients with defined gastroduodenal pathologies and determination of whether diversity is present in the nucleotide sequences encoding HspA in isolates from these patients. Serum samples collected from 154 patients who had an upper gastrointestinal pathology and the presence of H. pylori defined by biopsy were tested for an immunoglobulin G (IgG) serologic response to H. pylori HspA by an enzyme linked immunosorbant assay. HspA-encoding nucleotide sequences in H. pylori isolates from 14 patients (7 seropositive and 7 seronegative for HspA) were analyzed by PCR and direct sequencing of the PCR products. The sequencing results were compared to those of 48 isolates from other parts of the world. Of the 154 known H. pylori-positive patients, 54 (35.1%) were seropositive for HspA. The A domain (GroES homology) of HspA was highly conserved in the 14 isolates tested. Although the B domain (metal-binding site unique to H. pylori) resembled that in the known major variant, particular amino acid substitutions allowed definition of an HspA variant associated with isolates from East Asia. There were no associations between patient characteristics and HspA seropositivity or amino acid sequences. We confirmed in this study that the clinical outcomes of H. pylori infection are not related to HspA antigenicity or to sequence variation. However, B-domain sequence variation may be a marker for the study of the genetic diversity of H. pylori strains of different geographic origins. PMID:10225839

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

PubMed Central

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

NASA Astrophysics Data System (ADS)

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-06-01

Mass spectrometry-based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications.

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

PubMed Central

Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro

2016-01-01

Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

PubMed Central

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-01-01

Mass spectrometry–based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications. PMID:27049631

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.

PubMed

Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei

2017-06-05

Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.

Molecular Evolution and Functional Diversification of Replication Protein A1 in Plants

PubMed Central

Aklilu, Behailu B.; Culligan, Kevin M.

2016-01-01

Replication protein A (RPA) is a heterotrimeric, single-stranded DNA binding complex required for eukaryotic DNA replication, repair, and recombination. RPA is composed of three subunits, RPA1, RPA2, and RPA3. In contrast to single RPA subunit genes generally found in animals and yeast, plants encode multiple paralogs of RPA subunits, suggesting subfunctionalization. Genetic analysis demonstrates that five Arabidopsis thaliana RPA1 paralogs (RPA1A to RPA1E) have unique and overlapping functions in DNA replication, repair, and meiosis. We hypothesize here that RPA1 subfunctionalities will be reflected in major structural and sequence differences among the paralogs. To address this, we analyzed amino acid and nucleotide sequences of RPA1 paralogs from 25 complete genomes representing a wide spectrum of plants and unicellular green algae. We find here that the plant RPA1 gene family is divided into three general groups termed RPA1A, RPA1B, and RPA1C, which likely arose from two progenitor groups in unicellular green algae. In the family Brassicaceae the RPA1B and RPA1C groups have further expanded to include two unique sub-functional paralogs RPA1D and RPA1E, respectively. In addition, RPA1 groups have unique domains, motifs, cis-elements, gene expression profiles, and pattern of conservation that are consistent with proposed functions in monocot and dicot species, including a novel C-terminal zinc-finger domain found only in plant RPA1C-like sequences. These results allow for improved prediction of RPA1 subunit functions in newly sequenced plant genomes, and potentially provide a unique molecular tool to improve classification of Brassicaceae species. PMID:26858742

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Complete chloroplast genome sequence of a major allogamous forage species, perennial ryegrass (Lolium perenne L.).

PubMed

Diekmann, Kerstin; Hodkinson, Trevor R; Wolfe, Kenneth H; van den Bekerom, Rob; Dix, Philip J; Barth, Susanne

2009-06-01

Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1-27 codons in comparison of L. perenne to other Poaceae and 1-68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT-PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.

Unique LCR variations among lineages of HPV16, 18 and 45 isolates from women with normal cervical cytology in Ghana.

PubMed

Awua, Adolf K; Adanu, Richard M K; Wiredu, Edwin K; Afari, Edwin A; Zubuch, Vanessa A; Asmah, Richard H; Severini, Alberto

2017-04-21

In addition to being useful for classification, sequence variations of human Papillomavirus (HPV) genotypes have been implicated in differential oncogenic potential and a differential association with the different histological forms of invasive cervical cancer. These associations have also been indicated for HPV genotype lineages and sub-lineages. In order to better understand the potential implications of lineage variation in the occurrence of cervical cancers in Ghana, we studied the lineages of the three most prevalent HPV genotypes among women with normal cytology as baseline to further studies. Of previously collected self- and health personnel-collected cervical specimen, 54, which were positive for HPV16, 18 and 45, were selected and the long control region (LCR) of each HPV genotype was separately amplified by a nested PCR. DNA sequences of 41 isolates obtained with the forward and reverse primers by Sanger sequencing were analysed. Nucleotide sequence variations of the HPV16 genotypes were observed at 30 positions within the LCR (7460 - 7840). Of these, 19 were the known variations for the lineages B and C (African lineages), while the other 11 positions had variations unique to the HPV16 isolates of this study. For the HPV18 isolates, the variations were at 35 positions, 22 of which were known variations of Africa lineages and the other 13 were unique variations observed for the isolates obtained in this study (at positions 7799 and 7813). HPV45 isolates had variations at 35 positions and 2 (positions 7114 and 97) were unique to the isolates of this study. This study provides the first data on the lineages of HPV 16, 18 and 45 isolates from Ghana. Although the study did not obtain full genome sequence data for a comprehensive comparison with known lineages, these genotypes were predominately of the Africa lineages and had some unique sequence variations at positions that suggest potential oncogenic implications. These data will be useful for comparison with lineages of these genotypes from women with cervical lesion and all the forms of invasive cervical cancers.

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Analysis of the transcriptome of Panax notoginseng root uncovers putative triterpene saponin-biosynthetic genes and genetic markers

PubMed Central

2011-01-01

Background Panax notoginseng (Burk) F.H. Chen is important medicinal plant of the Araliacease family. Triterpene saponins are the bioactive constituents in P. notoginseng. However, available genomic information regarding this plant is limited. Moreover, details of triterpene saponin biosynthesis in the Panax species are largely unknown. Results Using the 454 pyrosequencing technology, a one-quarter GS FLX titanium run resulted in 188,185 reads with an average length of 410 bases for P. notoginseng root. These reads were processed and assembled by 454 GS De Novo Assembler software into 30,852 unique sequences. A total of 70.2% of unique sequences were annotated by Basic Local Alignment Search Tool (BLAST) similarity searches against public sequence databases. The Kyoto Encyclopedia of Genes and Genomes (KEGG) assignment discovered 41 unique sequences representing 11 genes involved in triterpene saponin backbone biosynthesis in the 454-EST dataset. In particular, the transcript encoding dammarenediol synthase (DS), which is the first committed enzyme in the biosynthetic pathway of major triterpene saponins, is highly expressed in the root of four-year-old P. notoginseng. It is worth emphasizing that the candidate cytochrome P450 (Pn02132 and Pn00158) and UDP-glycosyltransferase (Pn00082) gene most likely to be involved in hydroxylation or glycosylation of aglycones for triterpene saponin biosynthesis were discovered from 174 cytochrome P450s and 242 glycosyltransferases by phylogenetic analysis, respectively. Putative transcription factors were detected in 906 unique sequences, including Myb, homeobox, WRKY, basic helix-loop-helix (bHLH), and other family proteins. Additionally, a total of 2,772 simple sequence repeat (SSR) were identified from 2,361 unique sequences, of which, di-nucleotide motifs were the most abundant motif. Conclusion This study is the first to present a large-scale EST dataset for P. notoginseng root acquired by next-generation sequencing (NGS) technology. The candidate genes involved in triterpene saponin biosynthesis, including the putative CYP450s and UGTs, were obtained in this study. Additionally, the identification of SSRs provided plenty of genetic makers for molecular breeding and genetics applications in this species. These data will provide information on gene discovery, transcriptional regulation and marker-assisted selection for P. notoginseng. The dataset establishes an important foundation for the study with the purpose of ensuring adequate drug resources for this species. PMID:22369100

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

The Unique Biosynthetic Route from Lupinus β-Conglutin Gene to Blad

PubMed Central

Monteiro, Sara; Freitas, Regina; Rajasekhar, Baru T.; Teixeira, Artur R.; Ferreira, Ricardo B.

2010-01-01

Background During seed germination, β-conglutin undergoes a major cycle of limited proteolysis in which many of its constituent subunits are processed into a 20 kDa polypeptide termed blad. Blad is the main component of a glycooligomer, accumulating exclusively in the cotyledons of Lupinus species, between days 4 and 12 after the onset of germination. Principal Findings The sequence of the gene encoding β-conglutin precursor (1791 nucleotides) is reported. This gene, which shares 44 to 57% similarity and 20 to 37% identity with other vicilin-like protein genes, includes several features in common with these globulins, but also specific hallmarks. Most notable is the presence of an ubiquitin interacting motif (UIM), which possibly links the unique catabolic route of β-conglutin to the ubiquitin/proteasome proteolytic pathway. Significance Blad forms through a unique route from and is a stable intermediary product of its precursor, β-conglutin, the major Lupinus seed storage protein. It is composed of 173 amino acid residues, is encoded by an intron-containing, internal fragment of the gene that codes for β-conglutin precursor (nucleotides 394 to 913) and exhibits an isoelectric point of 9.6 and a molecular mass of 20,404.85 Da. Consistent with its role as a storage protein, blad contains an extremely high proportion of the nitrogen-rich amino acids. PMID:20066045

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

PubMed

Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

2012-08-01

Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

Intricate Interactions between the Bloom-Forming Cyanobacterium Microcystis aeruginosa and Foreign Genetic Elements, Revealed by Diversified Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Signatures

PubMed Central

Kuno, Sotaro; Kaneko, Takakazu; Sako, Yoshihiko

2012-01-01

Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids. PMID:22636003

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

PubMed

Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

1993-02-01

A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

DAMe: a toolkit for the initial processing of datasets with PCR replicates of double-tagged amplicons for DNA metabarcoding analyses.

PubMed

Zepeda-Mendoza, Marie Lisandra; Bohmann, Kristine; Carmona Baez, Aldo; Gilbert, M Thomas P

2016-05-03

DNA metabarcoding is an approach for identifying multiple taxa in an environmental sample using specific genetic loci and taxa-specific primers. When combined with high-throughput sequencing it enables the taxonomic characterization of large numbers of samples in a relatively time- and cost-efficient manner. One recent laboratory development is the addition of 5'-nucleotide tags to both primers producing double-tagged amplicons and the use of multiple PCR replicates to filter erroneous sequences. However, there is currently no available toolkit for the straightforward analysis of datasets produced in this way. We present DAMe, a toolkit for the processing of datasets generated by double-tagged amplicons from multiple PCR replicates derived from an unlimited number of samples. Specifically, DAMe can be used to (i) sort amplicons by tag combination, (ii) evaluate PCR replicates dissimilarity, and (iii) filter sequences derived from sequencing/PCR errors, chimeras, and contamination. This is attained by calculating the following parameters: (i) sequence content similarity between the PCR replicates from each sample, (ii) reproducibility of each unique sequence across the PCR replicates, and (iii) copy number of the unique sequences in each PCR replicate. We showcase the insights that can be obtained using DAMe prior to taxonomic assignment, by applying it to two real datasets that vary in their complexity regarding number of samples, sequencing libraries, PCR replicates, and used tag combinations. Finally, we use a third mock dataset to demonstrate the impact and importance of filtering the sequences with DAMe. DAMe allows the user-friendly manipulation of amplicons derived from multiple samples with PCR replicates built in a single or multiple sequencing libraries. It allows the user to: (i) collapse amplicons into unique sequences and sort them by tag combination while retaining the sample identifier and copy number information, (ii) identify sequences carrying unused tag combinations, (iii) evaluate the comparability of PCR replicates of the same sample, and (iv) filter tagged amplicons from a number of PCR replicates using parameters of minimum length, copy number, and reproducibility across the PCR replicates. This enables an efficient analysis of complex datasets, and ultimately increases the ease of handling datasets from large-scale studies.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Integrated databanks access and sequence/structure analysis services at the PBIL.

PubMed

Perrière, Guy; Combet, Christophe; Penel, Simon; Blanchet, Christophe; Thioulouse, Jean; Geourjon, Christophe; Grassot, Julien; Charavay, Céline; Gouy, Manolo; Duret, Laurent; Deléage, Gilbert

2003-07-01

The World Wide Web server of the PBIL (Pôle Bioinformatique Lyonnais) provides on-line access to sequence databanks and to many tools of nucleic acid and protein sequence analyses. This server allows to query nucleotide sequence banks in the EMBL and GenBank formats and protein sequence banks in the SWISS-PROT and PIR formats. The query engine on which our data bank access is based is the ACNUC system. It allows the possibility to build complex queries to access functional zones of biological interest and to retrieve large sequence sets. Of special interest are the unique features provided by this system to query the data banks of gene families developed at the PBIL. The server also provides access to a wide range of sequence analysis methods: similarity search programs, multiple alignments, protein structure prediction and multivariate statistics. An originality of this server is the integration of these two aspects: sequence retrieval and sequence analysis. Indeed, thanks to the introduction of re-usable lists, it is possible to perform treatments on large sets of data. The PBIL server can be reached at: http://pbil.univ-lyon1.fr.

[Cloning of new acylamidase gene from Rhodococcus erythropolis and its expression in Escherichia coli].

PubMed

Lavrov, K V; Ianenko, A S

2013-10-01

The gene for new Rhodococcus erythropolis TA37 acylamidase, which possesses unique substrate specificity, has been cloned and expressed in E. coli. Substrates for this enzyme are not only simple amides, such as acetamide and propionamide, but also N-substituted amides, such as 4'-nitroacetanilide. The 1431-bp gene was expressed in E. coli BL21 (DE3) cells on pET16b plasmid under the control of a promoter of the φ 10 gene from the T7 phage. The molecular mass of recombinant acylamidase in E. coli was 55 kDa, which corresponded to that of native acylamidase from Rhodococcus erythropolis TA37. Recombinant acylamidase was able to hydrolize N-substituted amides. A search of a nucleotide database and multiple alignment revealed that acylamidase belonged to the Amidase protein family PF01425, but its nucleotide and amino acid sequences differed significantly from those of the described amidases.

Convergent evolution of marine mammals is associated with distinct substitutions in common genes

PubMed Central

Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.

2015-01-01

Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748

A novel chlorophyll a/b binding (Cab) protein gene from petunia which encodes the lower molecular weight Cab precursor protein.

PubMed

Stayton, M M; Black, M; Bedbrook, J; Dunsmuir, P

1986-12-22

The 16 petunia Cab genes which have been characterized are all closely related at the nucleotide sequence level and they encode Cab precursor polypeptides which are similar in sequence and length. Here we describe a novel petunia Cab gene which encodes a unique Cab precursor protein. This protein is a member of the smallest class of Cab precursor proteins for which no gene has previously been assigned in petunia or any other species. The features of this Cab precursor protein are that it is shorter by 2-3 amino acids than the formerly characterized Cab precursors, its transit peptide sequence is unrelated, and the mature polypeptide is significantly diverged at the functionally important N terminus from other petunia Cab proteins. Gene structure also discriminates this gene which is the only intron containing Cab gene in petunia genomic DNA.

PopHuman: the human population genomics browser.

PubMed

Casillas, Sònia; Mulet, Roger; Villegas-Mirón, Pablo; Hervas, Sergi; Sanz, Esteve; Velasco, Daniel; Bertranpetit, Jaume; Laayouni, Hafid; Barbadilla, Antonio

2018-01-04

The 1000 Genomes Project (1000GP) represents the most comprehensive world-wide nucleotide variation data set so far in humans, providing the sequencing and analysis of 2504 genomes from 26 populations and reporting >84 million variants. The availability of this sequence data provides the human lineage with an invaluable resource for population genomics studies, allowing the testing of molecular population genetics hypotheses and eventually the understanding of the evolutionary dynamics of genetic variation in human populations. Here we present PopHuman, a new population genomics-oriented genome browser based on JBrowse that allows the interactive visualization and retrieval of an extensive inventory of population genetics metrics. Efficient and reliable parameter estimates have been computed using a novel pipeline that faces the unique features and limitations of the 1000GP data, and include a battery of nucleotide variation measures, divergence and linkage disequilibrium parameters, as well as different tests of neutrality, estimated in non-overlapping windows along the chromosomes and in annotated genes for all 26 populations of the 1000GP. PopHuman is open and freely available at http://pophuman.uab.cat. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing.

PubMed

Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

2017-01-01

Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.

Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

PubMed Central

Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

2017-01-01

Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Sequence diversity and molecular evolutionary rates between buffalo and cattle.

PubMed

Moaeen-ud-Din, M; Bilal, G

2015-02-01

Identification of genes of importance regarding production traits in buffalo is impaired by a paucity of genomic resources. Choice to fill this gap is to exploit data available for cow. The cross-species application of comparative genomics tools is potential gear to investigate the buffalo genome. However, this is dependent on nucleotide sequences similarity. In this study, gene diversity between buffalo and cattle was determined using 86 gene orthologues. There was approximately 3% difference in all genes in terms of nucleotide diversity and 0.267 ± 0.134 in amino acids, indicating the possibility for successfully using cross-species strategies for genomic studies. There were significantly higher non-synonymous substitutions both in cattle and buffalo; however, there was similar difference in terms of dN- dS (4.414 versus 4.745) in buffalo and cattle, respectively. Higher rate of non-synonymous substitutions at similar level in buffalo and cattle indicated a similar positive selection pressure. Results for relative rate test were assessed with the chi-squared test. There was no significance difference on unique mutations between cattle and buffalo lineages at synonymous sites. However, there was a significance difference on unique mutations for non-synonymous sites, indicating ongoing mutagenic process that generates substitutional mutation at approximately the same rate at silent sites. Moreover, despite of common ancestry, our results indicate a different divergent time among genes of cattle and buffalo. This is the first demonstration that variable rates of molecular evolution may be present within the family Bovidae. © 2014 Blackwell Verlag GmbH.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

PubMed

Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

2017-09-30

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species

PubMed Central

Andersen, Ethan J.; Neupane, Surendra; Benson, Benjamin V.

2017-01-01

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis, we investigated nTNL orthologs in the genomes of common bean, Medicago, soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis, common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence. PMID:28973974

Homo sapiens-Specific Binding Site Variants within Brain Exclusive Enhancers Are Subject to Accelerated Divergence across Human Population.

PubMed

Zehra, Rabail; Abbasi, Amir Ali

2018-03-01

Empirical assessments of human accelerated noncoding DNA frgaments have delineated presence of many cis-regulatory elements. Enhancers make up an important category of such accelerated cis-regulatory elements that efficiently control the spatiotemporal expression of many developmental genes. Establishing plausible reasons for accelerated enhancer sequence divergence in Homo sapiens has been termed significant in various previously published studies. This acceleration by including closely related primates and archaic human data has the potential to open up evolutionary avenues for deducing present-day brain structure. This study relied on empirically confirmed brain exclusive enhancers to avoid any misjudgments about their regulatory status and categorized among them a subset of enhancers with an exceptionally accelerated rate of lineage specific divergence in humans. In this assorted set, 13 distinct transcription factor binding sites were located that possessed unique existence in humans. Three of 13 such sites belonging to transcription factors SOX2, RUNX1/3, and FOS/JUND possessed single nucleotide variants that made them unique to H. sapiens upon comparisons with Neandertal and Denisovan orthologous sequences. These variants modifying the binding sites in modern human lineage were further substantiated as single nucleotide polymorphisms via exploiting 1000 Genomes Project Phase3 data. Long range haplotype based tests laid out evidence of positive selection to be governing in African population on two of the modern human motif modifying alleles with strongest results for SOX2 binding site. In sum, our study acknowledges acceleration in noncoding regulatory landscape of the genome and highlights functional parts within it to have undergone accelerated divergence in present-day human population.

Prevalence of Intrathecal Acyclovir Resistant Virus in Herpes Simplex Encephalitis Patients.

PubMed

Mitterreiter, Johanna G; Titulaer, Maarten J; van Nierop, Gijsbert P; van Kampen, Jeroen J A; Aron, Georgina I; Osterhaus, Albert D M E; Verjans, Georges M G M; Ouwendijk, Werner J D

2016-01-01

Herpes simplex encephalitis (HSE) is a life-threatening complication of herpes simplex virus (HSV) infection. Acyclovir (ACV) is the antiviral treatment of choice, but may lead to emergence of ACV-resistant (ACVR) HSV due to mutations in the viral UL23 gene encoding for the ACV-targeted thymidine kinase (TK) protein. Here, we determined the prevalence of intrathecal ACVR-associated HSV TK mutations in HSE patients and compared TK genotypes of sequential HSV isolates in paired cerebrospinal fluid (CSF) and blister fluid of mucosal HSV lesions. Clinical samples were obtained from 12 HSE patients, encompassing 4 HSV type 1 (HSV-1) and 8 HSV-2 encephalitis patients. HSV DNA load was determined by real-time PCR and complete HSV TK gene sequences were obtained by nested PCR followed by Sanger sequencing. All HSV-1 HSE patients contained viral TK mutations encompassing 30 unique nucleotide and 13 distinct amino acid mutations. By contrast, a total of 5 unique nucleotide and 4 distinct amino acid changes were detected in 7 of 8 HSV-2 patients. Detected mutations were identified as natural polymorphisms located in non-conserved HSV TK gene regions. ACV therapy did not induce the emergence of ACVR-associated HSV TK mutations in consecutive CSF and mucocutaneous samples of 5 individual patients. Phenotypic susceptibility analysis of these mucocutaneous HSV isolates demonstrated ACV-sensitive virus in 2 HSV-1 HSE patients, whereas in two HSV-2 HSE patients ACVR virus was detected in the absence of known ACVR-associated TK mutations. In conclusion, we did not detect intrathecal ACVR-associated TK mutations in HSV isolates obtained from 12 HSE patients.

Xylanase II from an alkaliphilic thermophilic Bacillus with a distinctly different structure from other xylanases: evolutionary relationship to alkaliphilic xylanases.

PubMed

Kulkarni, N; Lakshmikumaran, M; Rao, M

1999-10-05

A 1.0 kilobase gene fragment from the genomic DNA of an alkaliphilic thermophilic Bacillus was found to code for a functional xylanase (XynII). The complete nucleotide sequence including the structural gene and the 5' and 3' flanking sequences of the xylanase gene have been determined. An open reading frame starting from ATG initiator codon comprising 402 nucleotides gave a preprotein of 133 amino acids of calculated molecular mass 14.090 kDa. The occurrence of three potential N-glycosylation sites in XynII gene is a unique feature for a gene of bacterial origin. The stop codon was followed by hairpin loop structures indicating the presence of transcription termination signals. The secondary structure analysis of XynII predicted that the polypeptide was primarily formed of beta-sheets. XynII appeared to be a member of family G/11 of xylanases based on its molecular weight and basic pI (8.0). However, sequence homology revealed similar identity with families 10 and 11 of xylanases. The conserved triad (Val-Val-Xaa, where Xaa is Asn or Asp) was identified only in the xylanases from alkaliphilic organisms. Our results implicate for the first time the concept of convergent evolution for XynII and provide a basis for research in evolutionary relationship among the xylanases from alkaliphilic and neutrophilic organisms. Copyright 1999 Academic Press.

Diversity and three-dimensional structures of the alpha Mcr of the methanogenic Archaea from the anoxic region of Tucuruí Lake, in Eastern Brazilian Amazonia

PubMed Central

Santana, Priscila Bessa; Junior, Rubens Ghilardi; Alves, Claudio Nahum; Silva, Jeronimo Lameira; McCulloch, John Anthony; Schneider, Maria Paula Cruz; da Costa da Silva, Artur

2012-01-01

Methanogenic archaeans are organisms of considerable ecological and biotechnological interest that produce methane through a restricted metabolic pathway, which culminates in the reaction catalyzed by the Methyl-coenzyme M reductase (Mcr) enzyme, and results in the release of methane. Using a metagenomic approach, the gene of the α subunit of mcr (mcrα) was isolated from sediment sample from an anoxic zone, rich in decomposing organic material, obtained from the Tucuruí hydroelectric dam reservoir in eastern Brazilian Amazonia. The partial nucleotide sequences obtained were 83 to 95% similar to those available in databases, indicating a low diversity of archaeans in the reservoir. Two orders were identified - the Methanomicrobiales, and a unique Operational Taxonomic Unit (OTU) forming a clade with the Methanosarcinales according to low bootstrap values. Homology modeling was used to determine the three-dimensional (3D) structures, for this the partial nucleotide sequence of the mcrα were isolated and translated on their partial amino acid sequences. The 3D structures of the archaean Mcrα observed in the present study varied little, and presented approximately 70% identity in comparison with the Mcrα of Methanopyrus klanderi. The results demonstrated that the community of methanogenic archaeans of the anoxic C1 region of the Tucurui reservoir is relatively homogeneous. PMID:22481885

Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.

PubMed

King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P

2016-10-01

Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Genetic association of sequence variation in exon 3 of the swine leukocyte antigen-DQA gene with piglet diarrhea in Large White, Landrace, and Duroc piglets.

PubMed

Yang, Q L; Huang, X Y; Kong, J J; Zhao, S G; Liu, L X; Gun, S B

2016-08-19

Piglet diarrhea is one of the primary factors that affects the benefits of the swine industry. Recent studies have shown that exon 2 of the swine leukocyte antigen-DQA gene is associated with piglet resistance to diarrhea; however, the contributions of additional exon coding regions of this gene remain unclear. Here, we detected and sequenced variants in the exon 3 region and examined their associations with diarrhea infection in 425 suckling piglets using the polymerase chain reaction-single-strand conformational polymorphism and sequencing analysis. The results revealed that exon 3 of the swine leukocyte antigen-DQA gene is highly polymorphic and pivotal to both diarrhea susceptibility and resistance in piglets. We identified 14 genotypes (AA, AB, BB, BC, CC, EE, EF, BE, BF, CF, DD, DH, GG, and GF) and eight alleles (A-H) that were generated by 14 nucleotide variants, eight of which were novel, and three nucleotide deletions. Statistical analyses revealed that the genotypes AB and EF were associated with resistance to diarrheal disease (P < 0.05), and the genotype DD may contribute to diarrhea susceptibility but was unique to Large White pigs (P > 0.05). These results elucidate the genetic and immunological background to piglet diarrhea, and provide useful information for resistance breeding programs.

Fabrication and characterization of a solid state nanopore with self-aligned carbon nanoelectrodes for molecular detection

NASA Astrophysics Data System (ADS)

Spinney, Patrick; Collins, Scott D.; Howitt, David G.; Smith, Rosemary L.

2012-06-01

Rapid and cost-effective DNA sequencing is a pivotal prerequisite for the genomics era. Many of the recent advances in forensics, medicine, agriculture, taxonomy, and drug discovery have paralleled critical advances in DNA sequencing technology. Nanopore modalities for DNA sequencing have recently surfaced including the electrical interrogation of protein ion channels and/or solid-state nanopores during translocation of DNA. However to date, most of this work has met with mixed success. In this work, we present a unique nanofabrication strategy that realizes an artificial nanopore articulated with carbon electrodes to sense the current modulations during the transport of DNA through the nanopore. This embodiment overcomes most of the technical difficulties inherent in other artificial nanopore embodiments and present a versatile platform for the testing of DNA single nucleotide detection. Characterization of the device using gold nanoparticles, silica nanoparticles, lambda dsDNA and 16-mer ssDNA are presented. Although single molecule DNA sequencing is still not demonstrated, the device shows a path towards this goal.

RNA metabolism in the regulation of protein synthesis in plants. Progress report, 1975-1979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Key, J L

1979-01-01

The major objectives of the research for the contract period covered by this report were (1) to gain an insight into the sequence organization of the DNA of soybean, emphasizing the arrangement of single copy or unique sequences and repetitive sequences of DNA throughout the genome, (2) to characterize soybean RNAs relative to nucleotide sequence complexity and kinetics of synthesis and turnover of poly A/sup +/ mRNA, and (3) to study ribosomal proteins directed to an analysis of possible changes in proteins which relate to the activation of 80S ribosomes and thus mRNA utilization and protein synthesis in response tomore » environmental stimuli. Even with greatly reduced funding compared to that requested, objectives 1 and 2 were substantially accomplished. Because of reduced funding and the 20-month no cost extension, relatively little progress was made on objective 3. Accordingly objectives 1 and 2 will be summarized in some detail; a brief account of progress is presented on objective 3.« less

Cleavage sites within the poliovirus capsid protein precursors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, G.R.; Anderson, C.W.; Dorner, A.J.

1982-01-01

Partial amino-terminal sequence analysis was performed on radiolabeled poliovirus capsid proteins VP1, VP2, and VP3. A computer-assisted comparison of the amino acid sequences obtained with that predicted by the nucleotide sequence of the poliovirus genome allows assignment of the amino terminus of each capsid protein to a unique position within the virus polyprotein. Sequence analysis of trypsin-digested VP4, which has a blocked amino terminus, demonstrates that VP4 is encoded at or very near to the amino terminus of the polyprotein. The gene order of the capsid proteins is VP4-VP2-VP3-VP1. Cleavage of VP0 to VP4 and VP2 is shown to occurmore » between asparagine and serine, whereas the cleavages that separate VP2/VP3 and VP3/VP1 occur between glutamine and glycine residues. This finding supports the hypothesis that the cleavage of VP0, which occurs during virion morphogenesis, is distinct from the cleavages that separate functional regions of the polyprotein.« less

Precise assignment of the heavy-strand promoter of mouse mitochondrial DNA: cognate start sites are not required for transcriptional initiation.

PubMed Central

Chang, D D; Clayton, D A

1986-01-01

Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Onda, M.; Kudo, S.; Fukuda, M.

Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

De Novo Transcriptome Sequencing Reveals Important Molecular Networks and Metabolic Pathways of the Plant, Chlorophytum borivilianum

PubMed Central

Kalra, Shikha; Puniya, Bhanwar Lal; Kulshreshtha, Deepika; Kumar, Sunil; Kaur, Jagdeep; Ramachandran, Srinivasan; Singh, Kashmir

2013-01-01

Chlorophytum borivilianum, an endangered medicinal plant species is highly recognized for its aphrodisiac properties provided by saponins present in the plant. The transcriptome information of this species is limited and only few hundred expressed sequence tags (ESTs) are available in the public databases. To gain molecular insight of this plant, high throughput transcriptome sequencing of leaf RNA was carried out using Illumina's HiSeq 2000 sequencing platform. A total of 22,161,444 single end reads were retrieved after quality filtering. Available (e.g., De-Bruijn/Eulerian graph) and in-house developed bioinformatics tools were used for assembly and annotation of transcriptome. A total of 101,141 assembled transcripts were obtained, with coverage size of 22.42 Mb and average length of 221 bp. Guanine-cytosine (GC) content was found to be 44%. Bioinformatics analysis, using non-redundant proteins, gene ontology (GO), enzyme commission (EC) and kyoto encyclopedia of genes and genomes (KEGG) databases, extracted all the known enzymes involved in saponin and flavonoid biosynthesis. Few genes of the alkaloid biosynthesis, along with anticancer and plant defense genes, were also discovered. Additionally, several cytochrome P450 (CYP450) and glycosyltransferase unique sequences were also found. We identified simple sequence repeat motifs in transcripts with an abundance of di-nucleotide simple sequence repeat (SSR; 43.1%) markers. Large scale expression profiling through Reads per Kilobase per Million mapped reads (RPKM) showed major genes involved in different metabolic pathways of the plant. Genes, expressed sequence tags (ESTs) and unique sequences from this study provide an important resource for the scientific community, interested in the molecular genetics and functional genomics of C. borivilianum. PMID:24376689

De Novo transcriptome sequencing reveals important molecular networks and metabolic pathways of the plant, Chlorophytum borivilianum.

PubMed

Kalra, Shikha; Puniya, Bhanwar Lal; Kulshreshtha, Deepika; Kumar, Sunil; Kaur, Jagdeep; Ramachandran, Srinivasan; Singh, Kashmir

2013-01-01

Chlorophytum borivilianum, an endangered medicinal plant species is highly recognized for its aphrodisiac properties provided by saponins present in the plant. The transcriptome information of this species is limited and only few hundred expressed sequence tags (ESTs) are available in the public databases. To gain molecular insight of this plant, high throughput transcriptome sequencing of leaf RNA was carried out using Illumina's HiSeq 2000 sequencing platform. A total of 22,161,444 single end reads were retrieved after quality filtering. Available (e.g., De-Bruijn/Eulerian graph) and in-house developed bioinformatics tools were used for assembly and annotation of transcriptome. A total of 101,141 assembled transcripts were obtained, with coverage size of 22.42 Mb and average length of 221 bp. Guanine-cytosine (GC) content was found to be 44%. Bioinformatics analysis, using non-redundant proteins, gene ontology (GO), enzyme commission (EC) and kyoto encyclopedia of genes and genomes (KEGG) databases, extracted all the known enzymes involved in saponin and flavonoid biosynthesis. Few genes of the alkaloid biosynthesis, along with anticancer and plant defense genes, were also discovered. Additionally, several cytochrome P450 (CYP450) and glycosyltransferase unique sequences were also found. We identified simple sequence repeat motifs in transcripts with an abundance of di-nucleotide simple sequence repeat (SSR; 43.1%) markers. Large scale expression profiling through Reads per Kilobase per Million mapped reads (RPKM) showed major genes involved in different metabolic pathways of the plant. Genes, expressed sequence tags (ESTs) and unique sequences from this study provide an important resource for the scientific community, interested in the molecular genetics and functional genomics of C. borivilianum.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Genome content analysis yields new insights into the relationship between the human malaria parasite Plasmodium falciparum and its anopheline vectors.

PubMed

Oppenheim, Sara J; Rosenfeld, Jeffrey A; DeSalle, Rob

2017-02-27

The persistent and growing gap between the availability of sequenced genomes and the ability to assign functions to sequenced genes led us to explore ways to maximize the information content of automated annotation for studies of anopheline mosquitos. Specifically, we use genome content analysis of a large number of previously sequenced anopheline mosquitos to follow the loss and gain of protein families over the evolutionary history of this group. The importance of this endeavor lies in the potential for comparative genomic studies between Anopheles and closely related non-vector species to reveal ancestral genome content dynamics involved in vector competence. In addition, comparisons within Anopheles could identify genome content changes responsible for variation in the vectorial capacity of this family of important parasite vectors. The competence and capacity of P. falciparum vectors do not appear to be phylogenetically constrained within the Anophelinae. Instead, using ancestral reconstruction methods, we suggest that a previously unexamined component of vector biology, anopheline nucleotide metabolism, may contribute to the unique status of anophelines as P. falciparum vectors. While the fitness effects of nucleotide co-option by P. falciparum parasites on their anopheline hosts are not yet known, our results suggest that anopheline genome content may be responding to selection pressure from P. falciparum. Whether this response is defensive, in an attempt to redress improper nucleotide balance resulting from P. falciparum infection, or perhaps symbiotic, resulting from an as-yet-unknown mutualism between anophelines and P. falciparum, is an open question that deserves further study. Clearly, there is a wealth of functional information to be gained from detailed manual genome annotation, yet the rapid increase in the number of available sequences means that most researchers will not have the time or resources to manually annotate all the sequence data they generate. We believe that efforts to maximize the amount of information obtained from automated annotation can help address the functional annotation deficit that most evolutionary biologists now face, and here demonstrate the value of such an approach.

Genomic characterization of Zika virus isolated from Indonesia.

PubMed

Yudhaputri, Frilasita A; Trimarsanto, Hidayat; Perkasa, Aditya; Yohan, Benediktus; Haryanto, Sotianingsih; Wiyatno, Ageng; Soebandrio, Amin; Myint, Khin Saw; Ledermann, Jeremy P; Rosenberg, Ronald; Powers, Ann M; Sasmono, R Tedjo

2017-10-01

Zika virus (ZIKV) JMB-185 strain was isolated from a febrile patient in Jambi, Indonesia in 2014. To understand its genetic characteristics, we performed whole genome sequencing using the Ion Torrent PGM platform on the supernatant of the first passage. The phylogenetic analysis showed that the isolate was not closely related to the Brazilian ZIKV associated with microcephaly or isolates from the recent Singapore Zika outbreak. Molecular evolution analysis indicated that JMB-185 strain may have been circulating in the Southeast Asia region, including Indonesia since 2000. We observed high nucleotide sequence identity between Indonesia, Thailand, Singapore, and American strains although unique amino acid substitutions were also observed. This report provides information on the genomic characteristics of Indonesian ZIKV which may be used for further studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Identification of a unique library of complex, but ordered, arrays of repetitive elements in the human genome and implication of their potential involvement in pathobiology.

PubMed

Lee, Kang-Hoon; Lee, Young-Kwan; Kwon, Deug-Nam; Chiu, Sophia; Chew, Victoria; Rah, Hyungchul; Kujawski, Gregory; Melhem, Ramzi; Hsu, Karen; Chung, Cecilia; Greenhalgh, David G; Cho, Kiho

2011-06-01

Approximately 2% of the human genome is reported to be occupied by genes. Various forms of repetitive elements (REs), both characterized and uncharacterized, are presumed to make up the vast majority of the rest of the genomes of human and other species. In conjunction with a comprehensive annotation of genes, information regarding components of genome biology, such as gene polymorphisms, non-coding RNAs, and certain REs, is found in human genome databases. However, the genome-wide profile of unique RE arrangements formed by different groups of REs has not been fully characterized yet. In this study, the entire human genome was subjected to an unbiased RE survey to establish a whole-genome profile of REs and their arrangements. Due to the limitation in query size within the bl2seq alignment program (National Center for Biotechnology Information [NCBI]) utilized for the RE survey, the entire NCBI reference human genome was fragmented into 6206 units of 0.5M nucleotides. A number of RE arrangements with varying complexities and patterns were identified throughout the genome. Each chromosome had unique profiles of RE arrangements and density, and high levels of RE density were measured near the centromere regions. Subsequently, 175 complex RE arrangements, which were selected throughout the genome, were subjected to a comparison analysis using five different human genome sequences. Interestingly, three of the five human genome databases shared the exactly same arrangement patterns and sequences for all 175 RE arrangement regions (a total of 12,765,625 nucleotides). The findings from this study demonstrate that a substantial fraction of REs in the human genome are clustered into various forms of ordered structures. Further investigations are needed to examine whether some of these ordered RE arrangements contribute to the human pathobiology as a functional genome unit. Copyright © 2011 Elsevier Inc. All rights reserved.

Sphaerospora elwhaiensis sp.n. (Myxosporea: Sphaerosporidae) from landlocked sockeye salmon Oncorhynchus nerka (Salmoniformes: Salmonidae) in Washington State, USA.

PubMed

Jones, Simon; Fiala, Ivan; Prosperi-Porta, Gina; House, Marcia; Mumford, Sonia

2011-06-01

A new species of sphaerosporid myxosporean, Sphaerospora elwhaiensis sp. n., is described from kidney of non-anadromous sockeye salmon (kokanee) Oncorhynchus nerka (Walbaum) from Lake Sutherland in the northern Olympic Peninsula, Washington, USA. Infection with the parasite was detected in 45% of 177 kokanee examined over 5 years. While conforming to the morphological criteria by which members of the genus are defined, the parasite is distinguished from congeners in salmonids of western North America by a unique combination of valvular sculpting of the myxospore, the relatively large size of the myxospore and monosporous development within the pseudoplasmodium. In addition, nucleotide sequences of the parasite's small and large subunit ribosomal RNA gene are unique. Phylogenetic analyses of these sequences suggested that the parasite is most closely related to freshwater Myxidium spp. and Zschokkella spp. The molecular data have provided further evidence for a polyphyletic association previously recognized among members of the genus and emphasize the need for a taxonomic revision of Sphaerospora Thélohan, 1892 and related genera.

Primary structure of the Aequorea victoria green-fluorescent protein.

PubMed

Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

1992-02-15

Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

Unique pathway of expression of an opal suppressor phosphoserine tRNA.

PubMed Central

Lee, B J; de la Peña, P; Tobian, J A; Zasloff, M; Hatfield, D

1987-01-01

An opal suppressor phosphoserine tRNA gene is present in single copy in the genomes of higher vertebrates. We have shown that the product of this gene functions as a suppressor in an in vitro assay, and we have proposed that it may donate a modified amino acid directly to protein in response to specific UGA codons. In this report, we show through in vitro and in vivo studies that the human and Xenopus opal suppressor phosphoserine tRNAs are synthesized by a pathway that is, to the best of our knowledge, unlike that of any known eukaryotic tRNA. The primary transcript of this gene does not contain a 5'-leader sequence; and, therefore, transcription of this suppressor is initiated at the first nucleotide within the coding sequence. The 5'-terminal triphosphate, present on the primary transcript, remains intact through 3'-terminal maturation and through subsequent transport of the tRNA to the cytoplasm. The unique biosynthetic pathway of this opal suppressor may underlie its distinctive role in eukaryotic cells. Images PMID:3114749

The mitochondrial genome sequence of Enterobius vermicularis (Nematoda: Oxyurida)--an idiosyncratic gene order and phylogenetic information for chromadorean nematodes.

PubMed

Kang, Seokha; Sultana, Tahera; Eom, Keeseon S; Park, Yung Chul; Soonthornpong, Nathan; Nadler, Steven A; Park, Joong-Ki

2009-01-15

The complete mitochondrial genome sequence was determined for the human pinworm Enterobius vermicularis (Oxyurida: Nematoda) and used to infer its phylogenetic relationship to other major groups of chromadorean nematodes. The E. vermicularis genome is a 14,010-bp circular DNA molecule that encodes 36 genes (12 proteins, 22 tRNAs, and 2 rRNAs). This mtDNA genome lacks atp8, as reported for almost all other nematode species investigated. Phylogenetic analyses (maximum parsimony, maximum likelihood, neighbor joining, and Bayesian inference) of nucleotide sequences for the 12 protein-coding genes of 25 nematode species placed E. vermicularis, a representative of the order Oxyurida, as sister to the main Ascaridida+Rhabditida group. Tree topology comparisons using statistical tests rejected an alternative hypothesis favoring a closer relationship among Ascaridida, Spirurida, and Oxyurida, which has been supported from most studies based on nuclear ribosomal DNA sequences. Unlike the relatively conserved gene arrangement found for most chromadorean taxa, E. vermicularis mtDNA gene order is very unique, not sharing similarity to any other nematode species reported to date. This lack of gene order similarity may represent idiosyncratic gene rearrangements unique to this specific lineage of the oxyurids. To more fully understand the extent of gene rearrangement and its evolutionary significance within the nematode phylogenetic framework, additional mitochondrial genomes representing a greater evolutionary diversity of species must be characterized.

Molecular characterization of subgenotype A1 (subgroup Aa) of hepatitis B virus.

PubMed

Kramvis, Anna; Kew, Michael C

2007-07-01

Subgenotypes of hepatitis B virus (HBV) were first recognized after a unique segment of genotype A was identified when sequencing the preS2/S region of southern African HBV isolates. Originally named subgroup A', subsequently called subgroup Aa (for Africa) or subgenotype A1, this subgenotype is found in South Africa, Malawi, Uganda, Tanzania, Somalia, Yemen, India, Nepal, the Philippines and Brazil. The relatively higher mean nucleotide divergence of subgenotype A1 suggests that it has been endemic and has a long evolutionary history in the populations where it prevails. Distinctive sequence characteristics could account for the high hepatitis B e-antigen (HBeAg) negativity and low HBV DNA levels in carriers of this subgenotype. Substitutions or mutations can reduce HBeAg expression at three levels: (i) 1762T1764A atthe transcriptional level; (ii) substitutions at nt 1809-1812 at the translational level; and (iii) 1862T at the post-translational level. Co-existence of 1762T1764A and nt 1809-1812 mutations reduces HBeAg expression in an additive manner. In addition, subgenotype A1 has unique sequence alterations in the transcriptional regulatory elements and the polymerase coding region. The distinct sequence characteristics of subgenotype A1 may contribute to the 4.5-fold increased risk of heptocellular carcinoma in HBV carriers infected with genotype A, which is entirely attributable to subgenotype A1.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Round and pointed-head grenadier fishes (Actinopterygii: Gadiformes) represent a single sister group: evidence from the complete mitochondrial genome sequences.

PubMed

Satoh, Takashi P; Miya, Masaki; Endo, Hiromitsu; Nishida, Mutsumi

2006-07-01

The gene order of mitochondrial genomes (mitogenomes) has been employed as a useful phylogenetic marker in various metazoan animals, because it may represent uniquely derived characters shared by members of monophyletic groups. During the course of molecular phylogenetic studies of the order Gadiformes (cods and their relatives) based on whole mitogenome sequences, we found that two deep-sea grenadiers (Squalogadus modificatus and Trachyrincus murrayi: family Macrouridae) revealed a unusually identical gene order (translocation of the tRNA(Leu (UUR))). Both are members of the same family, although their external morphologies differed so greatly (e.g., round vs. pointed head) that they have been placed in different subfamilies Macrouroidinae and Trachyrincinae, respectively. Additionally, we determined the whole mitogenome sequences of two other species, Bathygadus antrodes and Ventrifossa garmani, representing a total of four subfamilies currently recognized within Macrouridae. The latter two species also exhibited gene rearrangements, resulting in a total of three different patterns of unique gene order being observed in the four subfamilies. Partitioned Bayesian analysis was conducted using available whole mitogenome sequences from five macrourids plus five outgroups. The resultant trees clearly indicated that S. modificatus and T. murrayi formed a monophyletic group, having a sister relationship to other macrourids. Thus, monophyly of the two species with disparate head morphologies was corroborated by two different lines of evidence (nucleotide sequences and gene order). The overall topology of the present tree differed from any of the previously proposed, morphology-based phylogenetic hypotheses.

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

NASA Technical Reports Server (NTRS)

Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

1985-01-01

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

Further delineation of nonhomologous-based recombination and evidence for subtelomeric segmental duplications in 1p36 rearrangements.

PubMed

D'Angelo, Carla S; Gajecka, Marzena; Kim, Chong A; Gentles, Andrew J; Glotzbach, Caron D; Shaffer, Lisa G; Koiffmann, Célia P

2009-06-01

The mechanisms involved in the formation of subtelomeric rearrangements are now beginning to be elucidated. Breakpoint sequencing analysis of 1p36 rearrangements has made important contributions to this line of inquiry. Despite the unique architecture of segmental duplications inherent to human subtelomeres, no common mechanism has been identified thus far and different nonexclusive recombination-repair mechanisms seem to predominate. In order to gain further insights into the mechanisms of chromosome breakage, repair, and stabilization mediating subtelomeric rearrangements in humans, we investigated the constitutional rearrangements of 1p36. Cloning of the breakpoint junctions in a complex rearrangement and three non-reciprocal translocations revealed similarities at the junctions, such as microhomology of up to three nucleotides, along with no significant sequence identity in close proximity to the breakpoint regions. All the breakpoints appeared to be unique and their occurrence was limited to non-repetitive, unique DNA sequences. Several recombination- or cleavage-associated motifs that may promote non-homologous recombination were observed in close proximity to the junctions. We conclude that NHEJ is likely the mechanism of DNA repair that generates these rearrangements. Additionally, two apparently pure terminal deletions were also investigated, and the refinement of the breakpoint regions identified two distinct genomic intervals ~25-kb apart, each containing a series of 1p36 specific segmental duplications with 90-98% identity. Segmental duplications can serve as substrates for ectopic homologous recombination or stimulate genomic rearrangements.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Polyomavirus BK non-coding control region rearrangements in health and disease.

PubMed

Sharma, Preety M; Gupta, Gaurav; Vats, Abhay; Shapiro, Ron; Randhawa, Parmjeet S

2007-08-01

BK virus is an increasingly recognized pathogen in transplanted patients. DNA sequencing of this virus shows considerable genomic variability. To understand the clinical significance of rearrangements in the non-coding control region (NCCR) of BK virus (BKV), we report a meta-analysis of 507 sequences, including 40 sequences generated in our own laboratory, for associations between rearrangements and disease, tissue tropism, geographic origin, and viral genotype. NCCR rearrangements were less frequent in (a) asymptomatic BKV viruria compared to patients viral nephropathy (1.7% vs. 22.5%), and (b) viral genotype 1 compared to other genotypes (2.4% vs. 11.2%). Rearrangements were commoner in malignancy (78.6%), and Norwegians (45.7%), and less common in East Indians (0%), and Japanese (4.3%). A surprising number of rearranged sequences were reported from mononuclear cells of healthy subjects, whereas most plasma sequences were archetypal. This difference could not be related to potential recombinase activity in lymphocytes, as consensus recombination signal sequences could not be found in the NCCR region. NCCR rearrangements are neither required nor a sufficient condition to produce clinical disease. BKV nephropathy and hemorrhagic cystitis are not associated with any unique NCCR configuration or nucleotide sequence.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Multilocus sequence analysis of Thermoanaerobacter isolates reveals recombining, but differentiated, populations from geothermal springs of the Uzon Caldera, Kamchatka, Russia

PubMed Central

Wagner, Isaac D.; Varghese, Litty B.; Hemme, Christopher L.; Wiegel, Juergen

2013-01-01

Thermal environments have island-like characteristics and provide a unique opportunity to study population structure and diversity patterns of microbial taxa inhabiting these sites. Strains having ≥98% 16S rRNA gene sequence similarity to the obligately anaerobic Firmicutes Thermoanaerobacter uzonensis were isolated from seven geothermal springs, separated by up to 1600 m, within the Uzon Caldera (Kamchatka, Russian Far East). The intraspecies variation and spatial patterns of diversity for this taxon were assessed by multilocus sequence analysis (MLSA) of 106 strains. Analysis of eight protein-coding loci (gyrB, lepA, leuS, pyrG, recA, recG, rplB, and rpoB) revealed that all loci were polymorphic and that nucleotide substitutions were mostly synonymous. There were 148 variable nucleotide sites across 8003 bp concatenates of the protein-coding loci. While pairwise FST values indicated a small but significant level of genetic differentiation between most subpopulations, there was a negligible relationship between genetic divergence and spatial separation. Strains with the same allelic profile were only isolated from the same hot spring, occasionally from consecutive years, and single locus variant (SLV) sequence types were usually derived from the same spring. While recombination occurred, there was an “epidemic” population structure in which a particular T. uzonensis sequence type rose in frequency relative to the rest of the population. These results demonstrate spatial diversity patterns for an anaerobic bacterial species in a relative small geographic location and reinforce the view that terrestrial geothermal springs are excellent places to look for biogeographic diversity patterns regardless of the involved distances. PMID:23801987

Elevated Genetic Diversity in the Emerging Blueberry Pathogen Exobasidium maculosum.

PubMed

Stewart, Jane E; Brooks, Kyle; Brannen, Phillip M; Cline, William O; Brewer, Marin T

2015-01-01

Emerging diseases caused by fungi are increasing at an alarming rate. Exobasidium leaf and fruit spot of blueberry, caused by the fungus Exobasidium maculosum, is an emerging disease that has rapidly increased in prevalence throughout the southeastern USA, severely reducing fruit quality in some plantings. The objectives of this study were to determine the genetic diversity of E. maculosum in the southeastern USA to elucidate the basis of disease emergence and to investigate if populations of E. maculosum are structured by geography, host species, or tissue type. We sequenced three conserved loci from 82 isolates collected from leaves and fruit of rabbiteye blueberry (Vaccinium virgatum), highbush blueberry (V. corymbosum), and southern highbush blueberry (V. corymbosum hybrids) from commercial fields in Georgia and North Carolina, USA, and 6 isolates from lowbush blueberry (V. angustifolium) from Maine, USA, and Nova Scotia, Canada. Populations of E. maculosum from the southeastern USA and from lowbush blueberry in Maine and Nova Scotia are distinct, but do not represent unique species. No difference in genetic structure was detected between different host tissues or among different host species within the southeastern USA; however, differentiation was detected between populations in Georgia and North Carolina. Overall, E. maculosum showed extreme genetic diversity within the conserved loci with 286 segregating sites among the 1,775 sequenced nucleotides and each isolate representing a unique multilocus haplotype. However, 94% of the nucleotide substitutions were silent, so despite the high number of mutations, selective constraints have limited changes to the amino acid sequences of the housekeeping genes. Overall, these results suggest that the emergence of Exobasidium leaf and fruit spot is not due to a recent introduction or host shift, or the recent evolution of aggressive genotypes of E. maculosum, but more likely as a result of an increasing host population or an environmental change.

Elevated Genetic Diversity in the Emerging Blueberry Pathogen Exobasidium maculosum

PubMed Central

Stewart, Jane E.; Brooks, Kyle; Brannen, Phillip M.; Cline, William O.; Brewer, Marin T.

2015-01-01

Emerging diseases caused by fungi are increasing at an alarming rate. Exobasidium leaf and fruit spot of blueberry, caused by the fungus Exobasidium maculosum, is an emerging disease that has rapidly increased in prevalence throughout the southeastern USA, severely reducing fruit quality in some plantings. The objectives of this study were to determine the genetic diversity of E. maculosum in the southeastern USA to elucidate the basis of disease emergence and to investigate if populations of E. maculosum are structured by geography, host species, or tissue type. We sequenced three conserved loci from 82 isolates collected from leaves and fruit of rabbiteye blueberry (Vaccinium virgatum), highbush blueberry (V. corymbosum), and southern highbush blueberry (V. corymbosum hybrids) from commercial fields in Georgia and North Carolina, USA, and 6 isolates from lowbush blueberry (V. angustifolium) from Maine, USA, and Nova Scotia, Canada. Populations of E. maculosum from the southeastern USA and from lowbush blueberry in Maine and Nova Scotia are distinct, but do not represent unique species. No difference in genetic structure was detected between different host tissues or among different host species within the southeastern USA; however, differentiation was detected between populations in Georgia and North Carolina. Overall, E. maculosum showed extreme genetic diversity within the conserved loci with 286 segregating sites among the 1,775 sequenced nucleotides and each isolate representing a unique multilocus haplotype. However, 94% of the nucleotide substitutions were silent, so despite the high number of mutations, selective constraints have limited changes to the amino acid sequences of the housekeeping genes. Overall, these results suggest that the emergence of Exobasidium leaf and fruit spot is not due to a recent introduction or host shift, or the recent evolution of aggressive genotypes of E. maculosum, but more likely as a result of an increasing host population or an environmental change. PMID:26207812

Bov-tA short interspersed nucleotide element sequences in circulating nucleic acids from sera of cattle with bovine spongiform encephalopathy (BSE) and sera of cattle exposed to BSE.

PubMed

Schütz, Ekkehard; Urnovitz, Howard B; Iakoubov, Leonid; Schulz-Schaeffer, Walter; Wemheuer, Wilhelm; Brenig, Bertram

2005-07-01

Circulating nucleic acids (CNA) are known to be enriched in repetitive DNA sequences in humans. Here, bovine sera CNA were analyzed to determine if cell stress-related short interspersed nucleotide elements (SINEs) could be detected in sera from cattle associated with bovine spongiform encephalopathy (BSE). Nucleic acids were extracted, amplified, cloned, and sequenced from the sera of protease-resistant prion protein (PrP(res))-positive cattle (n = 2) and sera from BSE-cohort cows (n = 6); 150 out of 163 clones revealed the presence of, on average, an 80-bp sequence from the 3' region of Bov-tA SINE. A PCR protocol was developed that differentially identified SINE-associated CNA in BSE-exposed versus normal cattle. CNA were extracted from a serum vesicular fraction after controlled blood collection and processing procedures. Sera from four confirmed cases of BSE, 137 BSE-exposed cohort animals associated with eight confirmed BSE cases, and 845 healthy, PrP(res)-negative control cows were tested. All four sera from confirmed BSE cases were repeatedly reactive in the assay. BSE-exposed cohorts had a 100-fold higher occurrence of repeatedly reactive individuals per cohort (average = 63%; range = 33% to 91%), compared to healthy controls (average = 0.6%; P < 0.001). This study shows that BSE-confirmed and cohort animals possess a unique profile of SINE-associated serum CNA that can be utilized as a marker that highly correlates to BSE exposure.

Bov-tA Short Interspersed Nucleotide Element Sequences in Circulating Nucleic Acids from Sera of Cattle with Bovine Spongiform Encephalopathy (BSE) and Sera of Cattle Exposed to BSE

PubMed Central

Schütz, Ekkehard; Urnovitz, Howard B.; Iakoubov, Leonid; Schulz-Schaeffer, Walter; Wemheuer, Wilhelm; Brenig, Bertram

2005-01-01

Circulating nucleic acids (CNA) are known to be enriched in repetitive DNA sequences in humans. Here, bovine sera CNA were analyzed to determine if cell stress-related short interspersed nucleotide elements (SINEs) could be detected in sera from cattle associated with bovine spongiform encephalopathy (BSE). Nucleic acids were extracted, amplified, cloned, and sequenced from the sera of protease-resistant prion protein (PrPres)-positive cattle (n = 2) and sera from BSE-cohort cows (n = 6); 150 out of 163 clones revealed the presence of, on average, an 80-bp sequence from the 3′ region of Bov-tA SINE. A PCR protocol was developed that differentially identified SINE-associated CNA in BSE-exposed versus normal cattle. CNA were extracted from a serum vesicular fraction after controlled blood collection and processing procedures. Sera from four confirmed cases of BSE, 137 BSE-exposed cohort animals associated with eight confirmed BSE cases, and 845 healthy, PrPres-negative control cows were tested. All four sera from confirmed BSE cases were repeatedly reactive in the assay. BSE-exposed cohorts had a 100-fold higher occurrence of repeatedly reactive individuals per cohort (average = 63%; range = 33% to 91%), compared to healthy controls (average = 0.6%; P < 0.001). This study shows that BSE-confirmed and cohort animals possess a unique profile of SINE-associated serum CNA that can be utilized as a marker that highly correlates to BSE exposure. PMID:16002628

Genotypes and phylogeographical relationships of infectious hematopoietic necrosis virus in California, USA

USGS Publications Warehouse

Kelley, G.O.; Bendorf, C.M.; Yun, S.C.; Kurath, G.; Hedrick, R.P.

2007-01-01

Infectious hematopoietic necrosis virus (IHNV) contains 3 major genogroups in North America with discreet geographic ranges designated as upper (U), middle (M), and lower (L). A comprehensive genotyping of 237 IHNV isolates from hatchery and wild salmonids in California revealed 25 different sequence types (a to y) all in the L genogroup; specifically, the genogroup contained 14 sequence types that were unique to individual isolates as well as 11 sequence types representing 2 or more identical isolates. The most evident trend was the phylogenetic and geographical division of the L genogroup into 2 distinct subgroups designated as LI and LII. Isolates within Subgroup LI were primarily found within waterways linked to southern Oregon and northern California coastal rivers. Isolates in Subgroup LII were concentrated within inland valley watersheds that included the Sacramento River, San Joaquin River, and their tributaries. The temporal and spatial patterns of virus occurrence suggested that infections among adult Chinook salmon in the hatchery or that spawn in the river are a major source of virus potentially infecting other migrating or resident salmonids in California. Serum neutralization results of the California isolates of IHNV corroborated a temporal trend of sequence divergence; specifically, 2 progressive shifts in which more recent virus isolates represent new serotypes. A comparison of the estimates of divergence rates for Subgroup LI (1 ?? ICT5 mutations per nucleotide site per year) indicated stasis similar to that observed in the U genogroup, while the Subgroup LII rate (1 ?? 10 3 mutations per nucleotide site per year) suggested a more active evolution similar to that of the M genogroup. ?? Inter-Research 2007.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

PubMed Central

Ananvoranich, S; Lafontaine, D A; Perreault, J P

1999-01-01

Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad.

PubMed

Zhang, Diana; Huang, Terry; Lukeman, Philip S; Paukstelis, Paul J

2014-12-01

We have determined the 1.50 Å crystal structure of the DNA decamer, d(CCA(CNV)KGCGTGG) ((CNV)K, 3-cyanovinylcarbazole), which forms a G-quadruplex structure in the presence of Ba(2+). The structure contains several unique features including a bulged nucleotide and the first crystal structure observation of a C-tetrad. The structure reveals that water molecules mediate contacts between the divalent cations and the C-tetrad, allowing Ba(2+) ions to occupy adjacent steps in the central ion channel. One ordered Mg(2+) facilitates 3'-3' stacking of two quadruplexes in the asymmetric unit, while the bulged nucleotide mediates crystal contacts. Despite the high diffraction limit, the first four nucleotides including the (CNV)K nucleoside are disordered though they are still involved in crystal packing. This work suggests that the bulky hydrophobic groups may locally influence the formation of non-Watson-Crick structures from otherwise complementary sequences. These observations lead to the intriguing possibility that certain types of DNA damage may act as modulators of G-quadruplex formation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Application of viromics: a new approach to the understanding of viral infections in humans.

PubMed

Ramamurthy, Mageshbabu; Sankar, Sathish; Kannangai, Rajesh; Nandagopal, Balaji; Sridharan, Gopalan

2017-12-01

This review is focused at exploring the strengths of modern technology driven data compiled in the areas of virus gene sequencing, virus protein structures and their implication to viral diagnosis and therapy. The information for virome analysis (viromics) is generated by the study of viral genomes (entire nucleotide sequence) and viral genes (coding for protein). Presently, the study of viral infectious diseases in terms of etiopathogenesis and development of newer therapeutics is undergoing rapid changes. Currently, viromics relies on deep sequencing, next generation sequencing (NGS) data and public domain databases like GenBank and unique virus specific databases. Two commonly used NGS platforms: Illumina and Ion Torrent, recommend maximum fragment lengths of about 300 and 400 nucleotides for analysis respectively. Direct detection of viruses in clinical samples is now evolving using these methods. Presently, there are a considerable number of good treatment options for HBV/HIV/HCV. These viruses however show development of drug resistance. The drug susceptibility regions of the genomes are sequenced and the prediction of drug resistance is now possible from 3 public domains available on the web. This has been made possible through advances in the technology with the advent of high throughput sequencing and meta-analysis through sophisticated and easy to use software and the use of high speed computers for bioinformatics. More recently NGS technology has been improved with single-molecule real-time sequencing. Here complete long reads can be obtained with less error overcoming a limitation of the NGS which is inherently prone to software anomalies that arise in the hands of personnel without adequate training. The development in understanding the viruses in terms of their genome, pathobiology, transcriptomics and molecular epidemiology constitutes viromics. It could be stated that these developments will bring about radical changes and advancement especially in the field of antiviral therapy and diagnostic virology.

A murine host cell factor required for nicking of the dimer bridge of MVM recognizes two CG nucleotides displaced by 10 basepairs.

PubMed

Liu, Q; Astell, C R

1996-10-01

During replication of the minute virus of mice (MVM) genome, a dimer replicative form (RF) intermediate is resolved into two monomer RF molecules in such a way as to retain a unique sequence within the left hand hairpin terminus of the viral genome. Although the proposed mechanism for resolution of the dimer RF remains uncertain, it likely involves site-specific nicking of the dimer bridge. The RF contains two double-stranded copies of the viral genome joined by the extended 3' hairpin. Minor sequence asymmetries within the 3' hairpin allow the two halves of the dimer bridge to be distinguished. The A half contains the sequence [sequence: see text], whereas the B half contains the sequence [sequence: see text]. Using an in vitro assay, we show that only the B half of the MVM dimer bridge is nicked site-specifically when incubated with crude NS-1 protein (expressed in insect cells) and mouse LA9 cellular extract. When highly purified NS-1, the major nonstructural protein of MVM, is used in this nicking reaction, there is an absolute requirement for the LA9 cellular extract, suggesting a cellular factor (or factors) is (are) required. A series of mutations were created in the putative host factor binding region (HFBR) on the B half of the MVM dimer bridge adjacent to the NS-1 binding site. Nicking assays of these B half mutants showed that two CG motifs displaced by 10 nucleotides are important for nicking. Gel mobility shift assays demonstrated that a host factor(s) can bind to the HFBR of the B half of the dimer bridge and efficient binding depends on the presence of both CG motifs. Competitor DNA containing the wild-type HFBR sequence is able to specifically inhibit nicking of the B half, indicating that the host factor(s) bound to the HFBR is(are) essential for site-specific nicking to occur.

Genomics in Cardiovascular Disease

PubMed Central

Roberts, Robert; Marian, A.J.; Dandona, Sonny; Stewart, Alexandre F.R.

2013-01-01

A paradigm shift towards biology occurred in the 1990’s subsequently catalyzed by the sequencing of the human genome in 2000. The cost of DNA sequencing has gone from millions to thousands of dollars with sequencing of one’s entire genome costing only $1,000. Rapid DNA sequencing is being embraced for single gene disorders, particularly for sporadic cases and those from small families. Transmission of lethal genes such as associated with Huntington’s disease can, through in-vitro fertilization, avoid passing it on to one’s offspring. DNA sequencing will meet the challenge of elucidating the genetic predisposition for common polygenic diseases, especially in determining the function of the novel common genetic risk variants and identifying the rare variants, which may also partially ascertain the source of the missing heritability. The challenge for DNA sequencing remains great, despite human genome sequences being 99.5% identical, the 3 million single nucleotide polymorphisms (SNPs) responsible for most of the unique features add up to 60 new mutations per person which, for 7 billion people, is 420 billion mutations. It is claimed that DNA sequencing has increased 10,000 fold while information storage and retrieval only 16 fold. The physician and health user will be challenged by the convergence of two major trends, whole genome sequencing and the storage/retrieval and integration of the data. PMID:23524054

Molecular Identification of Ectomycorrhizal Mycelium in Soil Horizons

PubMed Central

Landeweert, Renske; Leeflang, Paula; Kuyper, Thom W.; Hoffland, Ellis; Rosling, Anna; Wernars, Karel; Smit, Eric

2003-01-01

Molecular identification techniques based on total DNA extraction provide a unique tool for identification of mycelium in soil. Using molecular identification techniques, the ectomycorrhizal (EM) fungal community under coniferous vegetation was analyzed. Soil samples were taken at different depths from four horizons of a podzol profile. A basidiomycete-specific primer pair (ITS1F-ITS4B) was used to amplify fungal internal transcribed spacer (ITS) sequences from total DNA extracts of the soil horizons. Amplified basidiomycete DNA was cloned and sequenced, and a selection of the obtained clones was analyzed phylogenetically. Based on sequence similarity, the fungal clone sequences were sorted into 25 different fungal groups, or operational taxonomic units (OTUs). Out of 25 basidiomycete OTUs, 7 OTUs showed high nucleotide homology (≥99%) with known EM fungal sequences and 16 were found exclusively in the mineral soil. The taxonomic positions of six OTUs remained unclear. OTU sequences were compared to sequences from morphotyped EM root tips collected from the same sites. Of the 25 OTUs, 10 OTUs had ≥98% sequence similarity with these EM root tip sequences. The present study demonstrates the use of molecular techniques to identify EM hyphae in various soil types. This approach differs from the conventional method of EM root tip identification and provides a novel approach to examine EM fungal communities in soil. PMID:12514012

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Is Life Unique?

PubMed Central

Abel, David L.

2011-01-01

Is life physicochemically unique? No. Is life unique? Yes. Life manifests innumerable formalisms that cannot be generated or explained by physicodynamics alone. Life pursues thousands of biofunctional goals, not the least of which is staying alive. Neither physicodynamics, nor evolution, pursue goals. Life is largely directed by linear digital programming and by the Prescriptive Information (PI) instantiated particularly into physicodynamically indeterminate nucleotide sequencing. Epigenomic controls only compound the sophistication of these formalisms. Life employs representationalism through the use of symbol systems. Life manifests autonomy, homeostasis far from equilibrium in the harshest of environments, positive and negative feedback mechanisms, prevention and correction of its own errors, and organization of its components into Sustained Functional Systems (SFS). Chance and necessity—heat agitation and the cause-and-effect determinism of nature’s orderliness—cannot spawn formalisms such as mathematics, language, symbol systems, coding, decoding, logic, organization (not to be confused with mere self-ordering), integration of circuits, computational success, and the pursuit of functionality. All of these characteristics of life are formal, not physical. PMID:25382119

Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection.

PubMed Central

Meyers, B C; Shen, K A; Rohani, P; Gaut, B S; Michelmore, R W

1998-01-01

Disease resistance genes in plants are often found in complex multigene families. The largest known cluster of disease resistance specificities in lettuce contains the RGC2 family of genes. We compared the sequences of nine full-length genomic copies of RGC2 representing the diversity in the cluster to determine the structure of genes within this family and to examine the evolution of its members. The transcribed regions range from at least 7.0 to 13.1 kb, and the cDNAs contain deduced open reading frames of approximately 5. 5 kb. The predicted RGC2 proteins contain a nucleotide binding site and irregular leucine-rich repeats (LRRs) that are characteristic of resistance genes cloned from other species. Unique features of the RGC2 gene products include a bipartite LRR region with >40 repeats. At least eight members of this family are transcribed. The level of sequence diversity between family members varied in different regions of the gene. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitutions was lowest in the region encoding the nucleotide binding site, which is the presumed effector domain of the protein. The LRR-encoding region showed an alternating pattern of conservation and hypervariability. This alternating pattern of variation was also found in all comparisons within families of resistance genes cloned from other species. The Ka /Ks ratios indicate that diversifying selection has resulted in increased variation at these codons. The patterns of variation support the predicted structure of LRR regions with solvent-exposed hypervariable residues that are potentially involved in binding pathogen-derived ligands. PMID:9811792

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

The role of heterologous chloroplast sequence elements in transgene integration and expression.

PubMed

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-04-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

PubMed Central

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-01-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Analysis of genomic sequences by Chaos Game Representation.

PubMed

Almeida, J S; Carriço, J A; Maretzek, A; Noble, P A; Fletcher, M

2001-05-01

Chaos Game Representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to find the coordinates for their position in a continuous space. This distribution of positions has two properties: it is unique, and the source sequence can be recovered from the coordinates such that distance between positions measures similarity between the corresponding sequences. The possibility of using the latter property to identify succession schemes have been entirely overlooked in previous studies which raises the possibility that CGR may be upgraded from a mere representation technique to a sequence modeling tool. The distribution of positions in the CGR plane were shown to be a generalization of Markov chain probability tables that accommodates non-integer orders. Therefore, Markov models are particular cases of CGR models rather than the reverse, as currently accepted. In addition, the CGR generalization has both practical (computational efficiency) and fundamental (scale independence) advantages. These results are illustrated by using Escherichia coli K-12 as a test data-set, in particular, the genes thrA, thrB and thrC of the threonine operon.

Multi-Platform Next-Generation Sequencing of the Domestic Turkey (Meleagris gallopavo): Genome Assembly and Analysis

PubMed Central

Aslam, Luqman; Beal, Kathryn; Ann Blomberg, Le; Bouffard, Pascal; Burt, David W.; Crasta, Oswald; Crooijmans, Richard P. M. A.; Cooper, Kristal; Coulombe, Roger A.; De, Supriyo; Delany, Mary E.; Dodgson, Jerry B.; Dong, Jennifer J.; Evans, Clive; Frederickson, Karin M.; Flicek, Paul; Florea, Liliana; Folkerts, Otto; Groenen, Martien A. M.; Harkins, Tim T.; Herrero, Javier; Hoffmann, Steve; Megens, Hendrik-Jan; Jiang, Andrew; de Jong, Pieter; Kaiser, Pete; Kim, Heebal; Kim, Kyu-Won; Kim, Sungwon; Langenberger, David; Lee, Mi-Kyung; Lee, Taeheon; Mane, Shrinivasrao; Marcais, Guillaume; Marz, Manja; McElroy, Audrey P.; Modise, Thero; Nefedov, Mikhail; Notredame, Cédric; Paton, Ian R.; Payne, William S.; Pertea, Geo; Prickett, Dennis; Puiu, Daniela; Qioa, Dan; Raineri, Emanuele; Ruffier, Magali; Salzberg, Steven L.; Schatz, Michael C.; Scheuring, Chantel; Schmidt, Carl J.; Schroeder, Steven; Searle, Stephen M. J.; Smith, Edward J.; Smith, Jacqueline; Sonstegard, Tad S.; Stadler, Peter F.; Tafer, Hakim; Tu, Zhijian (Jake); Van Tassell, Curtis P.; Vilella, Albert J.; Williams, Kelly P.; Yorke, James A.; Zhang, Liqing; Zhang, Hong-Bin; Zhang, Xiaojun; Zhang, Yang; Reed, Kent M.

2010-01-01

A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo). Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb) includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest. PMID:20838655

Disease surveillance of Atlantic herring: molecular characterization of hepatic coccidiosis and a morphological report of a novel intestinal coccidian

USGS Publications Warehouse

Friend, Sarah E; Lovey, J; Hershberger, Paul

2016-01-01

Surveillance for pathogens of Atlantic herring, including viral hemorrhagic septicemia virus (VHSV),Ichthyophonus hoferi, and hepatic and intestinal coccidians, was conducted from 2012 to 2016 in the NW Atlantic Ocean, New Jersey, USA. Neither VHSV nor I. hoferi was detected in any sample. Goussia clupearum was found in the livers of 40 to 78% of adult herring in varying parasite loads; however, associated pathological changes were negligible. Phylogenetic analysis based on small subunit 18S rRNA gene sequences placed G. clupearum most closely with other extraintestinal liver coccidia from the genus Calyptospora, though the G. clupearum isolates had a unique nucleotide insertion between 604 and 729 bp that did not occur in any other coccidian species. G. clupearum oocysts from Atlantic and Pacific herring were morphologically similar, though differences occurred in oocyst dimensions. Comparison of G. clupearum genetic sequences from Atlantic and Pacific herring revealed 4 nucleotide substitutions and 2 gaps in a 1749 bp region, indicating some divergence in the geographically separate populations. Pacific G. clupearum oocysts were not directly infective, suggesting that a heteroxenous life cycle is likely. Intestinal coccidiosis was described for the first time from juvenile and adult Atlantic herring. A novel intestinal coccidian species was detected based on morphological characteristics of exogenously sporulated oocysts. A unique feature in these oocysts was the presence of 3 long (15.1 ± 5.1 µm, mean ±SD) spiny projections on both ends of the oocyst. The novel morphology of this coccidian led us to tentatively name this parasite G. echinata n. sp.

Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

PubMed

Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

2018-01-01

CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

New genetic lineage within the Siberian subtype of tick-borne encephalitis virus found in Western Siberia, Russia.

PubMed

Tkachev, Sergey E; Chicherina, Galina S; Golovljova, Irina; Belokopytova, Polina S; Tikunov, Artem Yu; Zadora, Oksana V; Glupov, Victor V; Tikunova, Nina V

2017-12-01

Tick-borne encephalitis virus (TBEV), a member of the Flaviviridae family, is a causative agent of a severe neurological disease. There are three main TBEV subtypes: the European (TBEV-Eu), Far Eastern (TBEV-FE), and Siberian (TBEV-Sib). Currently, three lineages within TBEV-Sib have been recorded. In this study, the genetic and biological characteristics of a new original strain, TBEV-2871, isolated in the Novosibirsk province of Western Siberia, Russia were investigated. The strain has low neuroinvasiveness in mice. Phylogenetic analysis demonstrated that TBEV-2871 belongs to TBEV-Sib, but does not cluster with any of the TBEV-Sib lineages. The TBEV-2871 strain has 88-89% nucleotide sequence identity with the other TBEV-Sib strains, 84-86% nucleotide sequence identity with the TBEV-FE and TBEV-Eu subtypes and is genetically close to the subtype division border. The TBEV-2871 polyprotein sequence includes 43 unique amino acid substitutions, 30 of which are recorded at positions that are conserved among all TBEV subtypes. Strain TBEV-2871 and two similar but not identical isolates found in Kemerovo province, Western Siberia are separated into a new lineage tentatively named Obskaya after the name of Ob riber, in the vicinity of which the TBEV-2871 was first found. A molecular evolution investigation demonstrated that within TBEV-Sib, the Obskaya lineage likely separated 1535years ago, which is even earlier than the Baltic lineage. Copyright © 2017 Elsevier B.V. All rights reserved.

Genomic analysis of the Chinese genotype 1F rubella virus that disappeared after 2002 in China.

PubMed

Zhu, Zhen; Chen, Min-Hsin; Abernathy, Emily; Zhou, Shujie; Wang, Changyin; Icenogle, Joseph; Xu, Wenbo

2014-12-01

Genotype 1F was likely localized geographically to China as it has not been reported elsewhere. In this study, whole genome sequences of two rubella 1F virus isolates were completed. Both viruses contained 9,761 nt with a single nucleotide deletion in the intergenic region, compared to the NCBI rubella reference sequence (NC 001545). No evidence of recombination was found between 1F and other rubella viruses. The genetic distance between 1F viruses and 10 other rubella virus genotypes (1a, 1B, 1C, 1D, 1E, 1G, 1J 2A, 2B, and 2C) ranged from 3.9% to 8.6% by pairwise comparison. A region known to be hypervariable in other rubella genotypes was also the most variable region in the 1F genomes. Comparisons to all available rubella virus sequences from GenBank identified 22 nucleotide variations exclusively in 1F viruses. Among these unique variations, C9306U is located within the recommended molecular window for rubella virus genotyping assignment, could be useful to confirm 1F viruses. Using the Bayesian Markov Chain Monte Carlo (MCMC) method, the time of the most recent common ancestor for the genotype 1F was estimated between 1976 and 1995. Recent rubella molecular surveillance suggests that this indigenous strain may have circulated for less than three decades, as it has not been detected since 2002. © 2014 Wiley Periodicals, Inc.

iPro54-PseKNC: a sequence-based predictor for identifying sigma-54 promoters in prokaryote with pseudo k-tuple nucleotide composition

PubMed Central

Lin, Hao; Deng, En-Ze; Ding, Hui; Chen, Wei; Chou, Kuo-Chen

2014-01-01

The σ54 promoters are unique in prokaryotic genome and responsible for transcripting carbon and nitrogen-related genes. With the avalanche of genome sequences generated in the postgenomic age, it is highly desired to develop automated methods for rapidly and effectively identifying the σ54 promoters. Here, a predictor called ‘iPro54-PseKNC’ was developed. In the predictor, the samples of DNA sequences were formulated by a novel feature vector called ‘pseudo k-tuple nucleotide composition’, which was further optimized by the incremental feature selection procedure. The performance of iPro54-PseKNC was examined by the rigorous jackknife cross-validation tests on a stringent benchmark data set. As a user-friendly web-server, iPro54-PseKNC is freely accessible at http://lin.uestc.edu.cn/server/iPro54-PseKNC. For the convenience of the vast majority of experimental scientists, a step-by-step protocol guide was provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics that were presented in this paper just for its integrity. Meanwhile, we also discovered through an in-depth statistical analysis that the distribution of distances between the transcription start sites and the translation initiation sites were governed by the gamma distribution, which may provide a fundamental physical principle for studying the σ54 promoters. PMID:25361964

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Candida northwykensis sp. nov., a novel yeast isolated from the gut of the click beetle Melanotus villosus.

PubMed

Ravella, Sreenivas Rao; Donovan, Neil; James, Stephen A; Shivaji, Sisinthy; Arunasri, Kotakonda; Bond, Christopher J; Roberts, Ian N; Hobbs, Phil J

2011-08-01

Two yeast morphotypes, BET 4(T) and BET 7, were isolated from the gut of click beetle Melanotus villosus. Click beetles were collected from the decaying timber within the woodlands of North Wyke Research, South West England, UK (latitude, 50°46'29″N; longitude, 3°55'23″W). Morphotype BET 7 was identified as Debaryomyces hansenii, and the other morphotype, BET 4(T), was found to differ from Priceomyces castillae and Priceomyces haplophilus, its closest phylogenetic neighbours, by 5.0% with respect to the nucleotide sequence of the D1/D2 domain of the large-subunit (LSU) rRNA gene, and by 8.0% with respect to the ribosomal internal-transcribed spacer (ITS) region. BET 4(T) also differ from P. castillae and P. haplophilus in a number of different phenotypic characteristics. Thus, based on the unique nucleotide sequences of its D1/D2 domain and ITS region, its physiological characteristics and an inability to sporulate, strain BET 4(T) is assigned the status of a new species of Candida, for which the name Candida northwykensis sp. nov., is proposed. The type strain is BET 4(T) (NCYC 3525(T) = CBS 11370(T)).

Prehistoric introduction of domestic pigs onto the Okinawa Islands: ancient mitochondrial DNA evidence.

PubMed

Watanobe, Takuma; Ishiguro, Naotaka; Nakano, Masuo; Takamiya, Hiroto; Matsui, Akira; Hongo, Hitomi

2002-08-01

Ancient DNAs of Sus scrofa specimens excavated from archaeological sites on the Okinawa islands were examined to clarify the genetic relationships among prehistoric Sus scrofa, modern wild boars and domestic pigs inhabiting the Ryukyu archipelago, the Japanese islands, and the Asian continent. We extracted remain DNA from 161 bone specimens excavated from 12 archaeological sites on the Okinawa islands and successfully amplified mitochondrial DNA control region fragments from 33 of 161 specimens. Pairwise difference between prehistoric and modern S. scrofa nucleotide sequences showed that haplotypes of the East Asian domestic pig lineage were found from archaeological specimens together with Ryukyu wild boars native to the Ryukyu archipelago. Phylogenetic analysis of 14 ancient sequences (11 haplotypes; 574 bp) indicated that S. scrofa specimens from two Yayoi-Heian sites (Kitahara and Ara shellmiddens) and two Recent Times sites (Wakuta Kiln and Kiyuna sites) are grouped with modern East Asian domestic pigs. Sus scrofa specimens from Shimizu shellmidden (Yayoi-Heian Period) were very closely related to modern Sus scrofa riukiuanus but had a unique nucleotide insertion, indicating that the population is genetically distinct from the lineage of modern Ryukyu wild boars. This genetic evidence suggests that domestic pigs from the Asian continent were introduced to the Okinawa islands in the early Yayoi-Heian period (1700-2000 BP), or earlier.

Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

PubMed

Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

2016-06-01

Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

Regulation of nucleic acid and protein synthesis: a background study related to the biological effects of radiation. Final report on research activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

High-Throughput Block Optical DNA Sequence Identification.

PubMed

Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

2018-01-01

Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

Rat prostatic steroid binding protein: DNA sequence and transcript maps of the two C3 genes.

PubMed Central

Hurst, H C; Parker, M G

1983-01-01

In the rat there are two non-allelic genes C3(1) and C3(2) for the C3 polypeptide of prostatic steroid binding protein. We have cloned and sequenced both genes and show that only C3(1) is responsible for the production of authentic C3. Although there is a marked difference in their transcriptional activity, the two genes share extensive DNA sequence homology there being only one base difference from nucleotide - 235 to within the first intron. Transcript mapping has shown that there are two distinct C3 transcripts which share a unique 3' terminus but have 5' termini 38 bases apart each preceded by a 'TATA' box homology. Interestingly, an identical repetitive element is present just upstream of both genes. Both families of transcripts, which are produced in a ratio of 18:1, are coordinately regulated by testosterone. Images Fig. 3. Fig. 4. Fig. 5. PMID:6685625

Genetic epidemiology of pharmacogenetic variants in South East Asian Malays using whole-genome sequences.

PubMed

Sivadas, A; Salleh, M Z; Teh, L K; Scaria, V

2017-10-01

Expanding the scope of pharmacogenomic research by including multiple global populations is integral to building robust evidence for its clinical translation. Deep whole-genome sequencing of diverse ethnic populations provides a unique opportunity to study rare and common pharmacogenomic markers that often vary in frequency across populations. In this study, we aim to build a diverse map of pharmacogenetic variants in South East Asian (SEA) Malay population using deep whole-genome sequences of 100 healthy SEA Malay individuals. We investigated the allelic diversity of potentially deleterious pharmacogenomic variants in SEA Malay population. Our analysis revealed 227 common and 466 rare potentially functional single nucleotide variants (SNVs) in 437 pharmacogenomic genes involved in drug metabolism, transport and target genes, including 74 novel variants. This study has created one of the most comprehensive maps of pharmacogenetic markers in any population from whole genomes and will hugely benefit pharmacogenomic investigations and drug dosage recommendations in SEA Malays.

The Genomic Observatories Metadatabase (GeOMe): A new repository for field and sampling event metadata associated with genetic samples.

PubMed

Deck, John; Gaither, Michelle R; Ewing, Rodney; Bird, Christopher E; Davies, Neil; Meyer, Christopher; Riginos, Cynthia; Toonen, Robert J; Crandall, Eric D

2017-08-01

The Genomic Observatories Metadatabase (GeOMe, http://www.geome-db.org/) is an open access repository for geographic and ecological metadata associated with biosamples and genetic data. Whereas public databases have served as vital repositories for nucleotide sequences, they do not accession all the metadata required for ecological or evolutionary analyses. GeOMe fills this need, providing a user-friendly, web-based interface for both data contributors and data recipients. The interface allows data contributors to create a customized yet standard-compliant spreadsheet that captures the temporal and geospatial context of each biosample. These metadata are then validated and permanently linked to archived genetic data stored in the National Center for Biotechnology Information's (NCBI's) Sequence Read Archive (SRA) via unique persistent identifiers. By linking ecologically and evolutionarily relevant metadata with publicly archived sequence data in a structured manner, GeOMe sets a gold standard for data management in biodiversity science.

The Genomic Observatories Metadatabase (GeOMe): A new repository for field and sampling event metadata associated with genetic samples

PubMed Central

Deck, John; Gaither, Michelle R.; Ewing, Rodney; Bird, Christopher E.; Davies, Neil; Meyer, Christopher; Riginos, Cynthia; Toonen, Robert J.; Crandall, Eric D.

2017-01-01

The Genomic Observatories Metadatabase (GeOMe, http://www.geome-db.org/) is an open access repository for geographic and ecological metadata associated with biosamples and genetic data. Whereas public databases have served as vital repositories for nucleotide sequences, they do not accession all the metadata required for ecological or evolutionary analyses. GeOMe fills this need, providing a user-friendly, web-based interface for both data contributors and data recipients. The interface allows data contributors to create a customized yet standard-compliant spreadsheet that captures the temporal and geospatial context of each biosample. These metadata are then validated and permanently linked to archived genetic data stored in the National Center for Biotechnology Information’s (NCBI’s) Sequence Read Archive (SRA) via unique persistent identifiers. By linking ecologically and evolutionarily relevant metadata with publicly archived sequence data in a structured manner, GeOMe sets a gold standard for data management in biodiversity science. PMID:28771471

Enterobacter cloacae with a novel variant of ACT AmpC beta-lactamase originating from glaucous gull (Larus hyperboreus) in Svalbard.

PubMed

Literak, Ivan; Manga, Ivan; Wojczulanis-Jakubas, Katarzyna; Chroma, Magdalena; Jamborova, Ivana; Dobiasova, Hana; Sedlakova, Miroslava Htoutou; Cizek, Alois

2014-07-16

We aimed at Escherichia coli and Enterobacter cloacae isolates resistant to cephalosporins and fluoroquinolones and Salmonella isolates in wild birds in Arctic Svalbard, Norway. Cloacal swabs of little auks (Alle alle, n=215) and samples of faeces of glaucous gulls (Larus hyperboreus, n=15) were examined. Inducible production of AmpC enzyme was detected in E. cloacae KW218 isolate. Sequence analysis of the 1146 bp PCR product of the ampC gene from this isolate revealed 99% sequence homology with the blaACT-14 and blaACT-5 AmpC beta-lactamase genes. Four, respectively six of the identified single nucleotide polymorphisms generated amino acid substitutions in the amino acid chain. As the ampC sequence polymorphism in the investigated E. cloacae strain was identified as unique, we revealed a novel variant of the ampC beta-lactamase gene blaACT-23. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular Cloning and Expression of Three Polygalacturonase cDNAs from the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Allen, Margaret L.; Mertens, Jeffrey A.

2008-01-01

Three unique cDNAs encoding putative polygalacturonase enzymes were isolated from the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois) (Hemiptera: Miridae). The three nucleotide sequences were dissimilar to one another, but the deduced amino acid sequences were similar to each other and to other polygalacturonases from insects, fungi, plants, and bacteria. Four conserved segments characteristic of polygalacturonases were present, but with some notable semiconservative substitutions. Two of four expected disulfide bridge—forming cysteine pairs were present. All three inferred protein translations included predicted signal sequences of 17 to 20 amino acids. Amplification of genomic DNA identified an intron in one of the genes, Llpg1, in the 5′ untranslated region. Semiquantitative RT-PCR revealed expression in all stages of the insect except the eggs. Expression in adults, male and female, was highly variable, indicating a family of highly inducible and diverse enzymes adapted to the generalist polyphagous nature of this important pest. PMID:20233096

Using high-throughput barcode sequencing to efficiently map connectomes

PubMed Central

Peikon, Ian D.; Kebschull, Justus M.; Vagin, Vasily V.; Ravens, Diana I.; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R.; Bressan, Dario

2017-01-01

Abstract The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision—a ‘connectome’—is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence—an RNA ‘barcode’—which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. PMID:28449067

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Genome analysis of canine astroviruses reveals genetic heterogeneity and suggests possible inter-species transmission.

PubMed

Mihalov-Kovács, Eszter; Martella, Vito; Lanave, Gianvito; Bodnar, Livia; Fehér, Enikő; Marton, Szilvia; Kemenesi, Gábor; Jakab, Ferenc; Bányai, Krisztián

2017-03-15

Canine astrovirus RNA was detected in the stools of 17/63 (26.9%) samples, using either a broadly reactive consensus RT-PCR for astroviruses or random RT-PCR coupled with massive deep sequencing. The complete or nearly complete genome sequence of five canine astroviruses was reconstructed that allowed mapping the genome organization and to investigate the genetic diversity of these viruses. The genome was about 6.6kb in length and contained three open reading frames (ORFs) flanked by a 5' UTR, and a 3' UTR plus a poly-A tail. ORF1a and ORF1b overlapped by 43 nucleotides while the ORF2 overlapped by 8 nucleotides with the 3' end of ORF1b. Upon genome comparison, four strains (HUN/2012/2, HUN/2012/6, HUN/2012/115, and HUN/2012/135) were more related genetically to each other and to UK canine astroviruses (88-96% nt identity), whilst strain HUN/2012/126 was more divergent (75-76% nt identity). In the ORF1b and ORF2, strains HUN/2012/2, HUN/2012/6, and HUN/2012/135 were related genetically to other canine astroviruses identified formerly in Europe and China, whereas strain HUN/2012/126 was related genetically to a divergent canine astrovirus strain, ITA/2010/Zoid. For one canine astrovirus, HUN/2012/8, only a 3.2kb portion of the genome, at the 3' end, could be determined. Interestingly, this strain possessed unique genetic signatures (including a longer ORF1b/ORF2 overlap and a longer 3'UTR) and it was divergent in both ORF1b and ORF2 from all other canine astroviruses, with the highest nucleotide sequence identity (68% and 63%, respectively) to a mink astrovirus, thus suggesting a possible event of interspecies transmission. The genetic heterogeneity of canine astroviruses may pose a challenge for the diagnostics and for future prophylaxis strategies. Copyright © 2016 Elsevier B.V. All rights reserved.

Rabbit haemorrhagic disease virus 2 (RHDV2) outbreak in Azores: Disclosure of common genetic markers and phylogenetic segregation within the European strains.

PubMed

Duarte, Margarida; Carvalho, Carina; Bernardo, Susana; Barros, Sílvia Vanessa; Benevides, Sandra; Flor, Lídia; Monteiro, Madalena; Marques, Isabel; Henriques, Margarida; Barros, Sílvia C; Fagulha, Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

2015-10-01

Rabbit haemorrhagic disease virus 2 (RHDV2) is widespread in several countries of Western Europe, but it has not been introduced to other continents. However, between late 2014 and early 2015, the presence of RHDV2 was confirmed outside of the European continent, in the Azores, initially in the islands of Graciosa, Flores, S. Jorge and Terceira. In this study we report the subsequent detection of RHDV2 in wild rabbits from the islands of Faial, St. Maria and S. Miguel, and display the necropsy and microscopic examination data obtained, which showed lesions similar to those induced by classical strains of RHDV, with severe affection of lungs and liver. We also disclose the result of a genetic investigation carried out with RHDV2 positive samples from wild rabbits found dead in the seven islands. Partial vp60 sequences were amplified from 27 tissue samples. Nucleotide analysis showed that the Azorean strains are closely related to each other, sharing a high genetic identity (>99.15%). None of the obtained sequences were identical to any RHDV2 sequence publically known, hampering a clue for the source of the outbreaks. However, Bayesian and maximum likelihood phylogenetic analyses disclosed that Azorean strains are more closely related to a few strains from Southern Portugal than with any others presently known. In the analysed region comprising the terminal 942 nucleotides of the vp60 gene, four new single nucleotide polymorphisms (SNP) were identified. Based on the present data, these four SNPs, which are unique in the strains from Azores, may constitute putative molecular geographic markers for Azorean RHDV2 strains, if they persist in the future. One of these variations is a non-synonymous substitution that involves the replacement of one amino acid in a hypervariable region of the capsid protein. Copyright © 2015 Elsevier B.V. All rights reserved.

NEBNext Direct: A Novel, Rapid, Hybridization-Based Approach for the Capture and Library Conversion of Genomic Regions of Interest.

PubMed

Emerman, Amy B; Bowman, Sarah K; Barry, Andrew; Henig, Noa; Patel, Kruti M; Gardner, Andrew F; Hendrickson, Cynthia L

2017-07-05

Next-generation sequencing (NGS) is a powerful tool for genomic studies, translational research, and clinical diagnostics that enables the detection of single nucleotide polymorphisms, insertions and deletions, copy number variations, and other genetic variations. Target enrichment technologies improve the efficiency of NGS by only sequencing regions of interest, which reduces sequencing costs while increasing coverage of the selected targets. Here we present NEBNext Direct ® , a hybridization-based, target-enrichment approach that addresses many of the shortcomings of traditional target-enrichment methods. This approach features a simple, 7-hr workflow that uses enzymatic removal of off-target sequences to achieve a high specificity for regions of interest. Additionally, unique molecular identifiers are incorporated for the identification and filtering of PCR duplicates. The same protocol can be used across a wide range of input amounts, input types, and panel sizes, enabling NEBNext Direct to be broadly applicable across a wide variety of research and diagnostic needs. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Using high-throughput barcode sequencing to efficiently map connectomes.

PubMed

Peikon, Ian D; Kebschull, Justus M; Vagin, Vasily V; Ravens, Diana I; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R; Bressan, Dario; Zador, Anthony M

2017-07-07

The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision-a 'connectome'-is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence-an RNA 'barcode'-which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates

PubMed Central

Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.

2001-01-01

Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Characterization of a new apscaviroid from American persimmon.

PubMed

Ito, Takao; Suzaki, Koichi; Nakano, Masaaki; Sato, Akihiko

2013-12-01

A unique circular molecule of 358 nucleotides was detected in American persimmon (Diospyros virginiana L.). The molecule was graft-transmissible and had genetic characteristics of members of the genus Apscaviroid. It had the highest sequence similarity (72-73 %) to citrus viroid VI (CVd-VI) and formed a clade with CVd-VI, citrus dwarfing viroid, and apple dimple fruit viroid in a phylogenetic tree. The molecule was not detected in citrus, unlike CVd-VI, which infects citrus and persimmon, and it was genetically distant from persimmon latent viroid, which infects persimmon only. The genetic and biological features indicated that the molecule may be a member of a new apscaviroid species.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

The Medicago sativa gene index 1.2: a web-accessible gene expression atlas for investigating expression differences between Medicago sativa subspecies.

PubMed

O'Rourke, Jamie A; Fu, Fengli; Bucciarelli, Bruna; Yang, S Sam; Samac, Deborah A; Lamb, JoAnn F S; Monteros, Maria J; Graham, Michelle A; Gronwald, John W; Krom, Nick; Li, Jun; Dai, Xinbin; Zhao, Patrick X; Vance, Carroll P

2015-07-07

Alfalfa (Medicago sativa L.) is the primary forage legume crop species in the United States and plays essential economic and ecological roles in agricultural systems across the country. Modern alfalfa is the result of hybridization between tetraploid M. sativa ssp. sativa and M. sativa ssp. falcata. Due to its large and complex genome, there are few genomic resources available for alfalfa improvement. A de novo transcriptome assembly from two alfalfa subspecies, M. sativa ssp. sativa (B47) and M. sativa ssp. falcata (F56) was developed using Illumina RNA-seq technology. Transcripts from roots, nitrogen-fixing root nodules, leaves, flowers, elongating stem internodes, and post-elongation stem internodes were assembled into the Medicago sativa Gene Index 1.2 (MSGI 1.2) representing 112,626 unique transcript sequences. Nodule-specific and transcripts involved in cell wall biosynthesis were identified. Statistical analyses identified 20,447 transcripts differentially expressed between the two subspecies. Pair-wise comparisons of each tissue combination identified 58,932 sequences differentially expressed in B47 and 69,143 sequences differentially expressed in F56. Comparing transcript abundance in floral tissues of B47 and F56 identified expression differences in sequences involved in anthocyanin and carotenoid synthesis, which determine flower pigmentation. Single nucleotide polymorphisms (SNPs) unique to each M. sativa subspecies (110,241) were identified. The Medicago sativa Gene Index 1.2 increases the expressed sequence data available for alfalfa by ninefold and can be expanded as additional experiments are performed. The MSGI 1.2 transcriptome sequences, annotations, expression profiles, and SNPs were assembled into the Alfalfa Gene Index and Expression Database (AGED) at http://plantgrn.noble.org/AGED/ , a publicly available genomic resource for alfalfa improvement and legume research.

The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.

2005-02-01

We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similarmore » to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.« less

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Molecular characterization of KGH, the first human isolate of rabies virus in Korea.

PubMed

Park, Jun-Sun; Kim, Chi-Kyeong; Kim, Su Yeon; Ju, Young Ran

2013-04-01

The complete genome sequence of the KGH strain of the first human rabies virus, which was isolated from a skin biopsy of a patient with rabies, whose symptoms developed due to bites from a raccoon dog in 2001. The size of the KGH strain genome was determined to be 11,928 nucleotides (nt) with a leader sequence of 58 nt, nucleoprotein gene of 1,353 nt, phosphoprotein gene of 894 nt, matrix protein gene of 609 nt, glycoprotein gene of 1,575 nt, RNA-dependent RNA polymerase gene of 6,384 nt, and trailer region of 69 nt. Sequence similarity was compared with 39 fully sequenced rabies virus genomes currently available, and the result showed 70.6-91.6 % at the nucleotide level, and 82.8-97.9 % at the amino acid level. The deduced amino acids in the viral protein were compared with those of other rabies viruses, and various functional regions were investigated. As a result, we found that the KGH strain only had a unique amino acid substitution that was identified to be associated either with host immune response and pathogenicity in the N protein, or with a related region regulating STAT1 in the P protein, and related to pathogenicity in G protein. Based on phylogenetic analyses using the complete genome of 39 rabies viruses, the KGH strain was determined to be closely related with the NNV-RAB-H strain and transplant rabies virus serotype 1, which are Indian isolates, and was confirmed to belong to the Arctic-like 2 clade. The KGH strain was most closely related to the SKRRD0204HC and SKRRD0205HC strain when compared with Korean animal isolates, which was separated around the same time and place, and belonged to the Gangwon III subgroup.

Complete Genome Sequence of Yersinis pestis Strains Antiqua and Nepa1516: Evidence of Gene Reduction in an Emerging Pathogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, Patrick S; Hu, Ping; Malfatti, Stephanie

2006-01-01

Yersinia pestis, the causative agent of bubonic and pneumonic plagues, has undergone detailed study at the molecular level. To further investigate the genomic diversity among this group and to help characterize lineages of the plague organism that have no sequenced members, we present here the genomes of two isolates of the ''classical'' antiqua biovar, strains Antiqua and Nepal516. The genomes of Antiqua and Nepal516 are 4.7 Mb and 4.5 Mb and encode 4,138 and 3,956 open reading frames, respectively. Though both strains belong to one of the three classical biovars, they represent separate lineages defined by recent phylogenetic studies. Wemore » compare all five currently sequenced Y. pestis genomes and the corresponding features in Yersinia pseudotuberculosis. There are strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. We found 453 single nucleotide polymorphisms in protein-coding regions, which were used to assess the evolutionary relationships of these Y. pestis strains. Gene reduction analysis revealed that the gene deletion processes are under selective pressure, and many of the inactivations are probably related to the organism's interaction with its host environment. The results presented here clearly demonstrate the differences between the two biovar antiqua lineages and support the notion that grouping Y. pestis strains based strictly on the classical definition of biovars (predicated upon two biochemical assays) does not accurately reflect the phylogenetic relationships within this species. A comparison of four virulent Y. pestis strains with the human-avirulent strain 91001 provides further insight into the genetic basis of virulence to humans.« less

The detection and phylogenetic analysis of the alkane 1-monooxygenase gene of members of the genus Rhodococcus.

PubMed

Táncsics, András; Benedek, Tibor; Szoboszlay, Sándor; Veres, Péter G; Farkas, Milán; Máthé, István; Márialigeti, Károly; Kukolya, József; Lányi, Szabolcs; Kriszt, Balázs

2015-02-01

Naturally occurring and anthropogenic petroleum hydrocarbons are potential carbon sources for many bacteria. The AlkB-related alkane hydroxylases, which are integral membrane non-heme iron enzymes, play a key role in the microbial degradation of many of these hydrocarbons. Several members of the genus Rhodococcus are well-known alkane degraders and are known to harbor multiple alkB genes encoding for different alkane 1-monooxygenases. In the present study, 48 Rhodococcus strains, representing 35 species of the genus, were investigated to find out whether there was a dominant type of alkB gene widespread among species of the genus that could be used as a phylogenetic marker. Phylogenetic analysis of rhodococcal alkB gene sequences indicated that a certain type of alkB gene was present in almost every member of the genus Rhodococcus. These alkB genes were common in a unique nucleotide sequence stretch absent from other types of rhodococcal alkB genes that encoded a conserved amino acid motif: WLG(I/V/L)D(G/D)GL. The sequence identity of the targeted alkB gene in Rhodococcus ranged from 78.5 to 99.2% and showed higher nucleotide sequence variation at the inter-species level compared to the 16S rRNA gene (93.9-99.8%). The results indicated that the alkB gene type investigated might be applicable for: (i) differentiating closely related Rhodococcus species, (ii) properly assigning environmental isolates to existing Rhodococcus species, and finally (iii) assessing whether a new Rhodococcus isolate represents a novel species of the genus. Copyright © 2014 Elsevier GmbH. All rights reserved.

Xylella taiwanensis sp. nov., causing pear leaf scorch disease.

PubMed

Su, C-C; Deng, W-L; Jan, F-J; Chang, C-J; Huang, H; Shih, H-T; Chen, J

2016-11-01

A Gram-stain-negative, nutritionally fastidious bacterium (PLS229T) causing pear leaf scorch was identified in Taiwan and previously grouped into Xylella fastidiosa. Yet, significant variations between PLS229T and Xylellafastidiosa were noted. In this study, PLS229T was evaluated phenotypically and genotypically against representative strains of Xylellafastidiosa, including strains of the currently known subspecies of Xylellafastidiosa, Xylella fastidiosa subsp. multiplex and 'Xylella fastidiosasubsp.pauca'. Because of the difficulty of in vitro culture characterization, emphases were made to utilize the available whole-genome sequence information. The average nucleotide identity (ANI) values, an alternative for DNA-DNA hybridization relatedness, between PLS229T and Xylellafastidiosa were 83.4-83.9 %, significantly lower than the bacterial species threshold of 95 %. In contrast, sequence similarity of 16S rRNA genes was greater than 98 %, higher than the 97 % threshold to justify if two bacterial strains belong to different species. The uniqueness of PLS229T was also evident by observing only about 87 % similarity in the sequence of the 16S-23S internal transcribed spacer (ITS) between PLS229T and strains of Xylellafastidiosa, discovering significant single nucleotide polymorphisms at 18 randomly selected housekeeping gene loci, observing a distinct fatty acid profile for PLS229T compared with Xylellafastidiosa, and PLS229T having different observable phenotypes, such as different susceptibility to antibiotics. A phylogenetic tree derived from 16S rRNA gene sequences showed a distinct PLS229T phyletic lineage positioning it between Xylellafastidiosa and members of the genus Xanthomonas. On the basis of these data, a novel species, Xylella taiwanensis sp. nov. is proposed. The type strain is PLS229T (=BCRC 80915T=JCM 31187T).

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

PubMed

Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

PubMed Central

Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha—an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia. PMID:27755612

VKCDB: voltage-gated K+ channel database updated and upgraded.

PubMed

Gallin, Warren J; Boutet, Patrick A

2011-01-01

The Voltage-gated K(+) Channel DataBase (VKCDB) (http://vkcdb.biology.ualberta.ca) makes a comprehensive set of sequence data readily available for phylogenetic and comparative analysis. The current update contains 2063 entries for full-length or nearly full-length unique channel sequences from Bacteria (477), Archaea (18) and Eukaryotes (1568), an increase from 346 solely eukaryotic entries in the original release. In addition to protein sequences for channels, corresponding nucleotide sequences of the open reading frames corresponding to the amino acid sequences are now available and can be extracted in parallel with sets of protein sequences. Channels are categorized into subfamilies by phylogenetic analysis and by using hidden Markov model analyses. Although the raw database contains a number of fragmentary, duplicated, obsolete and non-channel sequences that were collected in early steps of data collection, the web interface will only return entries that have been validated as likely K(+) channels. The retrieval function of the web interface allows retrieval of entries that contain a substantial fraction of the core structural elements of VKCs, fragmentary entries, or both. The full database can be downloaded as either a MySQL dump or as an XML dump from the web site. We have now implemented automated updates at quarterly intervals.

Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.

PubMed

Robinson, N J; Robinson, P J; Gupta, A; Bleasby, A J; Whitton, B A; Morby, A P

1995-03-11

An octameric palindrome (5'-GCGATCGC-3') is abundant in cyanobacterial sequences within databases (GenBank/EMBL) and was designated HIP1 (highly iterated palindrome). The frequency of occurrence of all 256 octameric palindromes has now been determined in sub-databases revealing large and unique over-representation of HIP1 in cyanobacterial entries. DNA sequences from other bacteria were searched for any over-represented octameric palindromes analogous to HIP1. Only two sequences were identified, in the genomes of a thermophile and halophilic archaebacteria, although these were less abundant than HIP1 in cyanobacteria and relate to codon usage. To test the proposed widespread distribution of HIP1 in DNA from the cyanobacterium Synechococcus PCC 6301, randomly selected genomic clones were partly sequenced. HIP1 constituted 2.5% of the novel sequences, equivalent to a site on average once every 320 nucleotides. An oligonucleotide including HIP1 was also tested in PCR. Multiple products were obtained using template DNA from cyanobacterial strains in which HIP1 is abundant in known sequences, and some strains generated characteristic HIP-PCR banding patterns. However, analysis of DNA from one strain (not previously represented in databases) by random sequencing, HIP-PCR and Pvul digestion, confirms that not all cyanobacterial genomes are rich in HIP1.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

The minute virus of mice (MVM) nonstructural protein NS1 induces nicking of MVM DNA at a unique site of the right-end telomere in both hairpin and duplex conformations in vitro.

PubMed

Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J

1997-10-01

The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torella, JP; Boehm, CR; Lienert, F

2013-12-28

In vitro recombination methods have enabled one-step construction of large DNA sequences from multiple parts. Although synthetic biological circuits can in principle be assembled in the same fashion, they typically contain repeated sequence elements such as standard promoters and terminators that interfere with homologous recombination. Here we use a computational approach to design synthetic, biologically inactive unique nucleotide sequences (UNSes) that facilitate accurate ordered assembly. Importantly, our designed UNSes make it possible to assemble parts with repeated terminator and insulator sequences, and thereby create insulated functional genetic circuits in bacteria and mammalian cells. Using UNS-guided assembly to construct repeating promoter-gene-terminatormore » parts, we systematically varied gene expression to optimize production of a deoxychromoviridans biosynthetic pathway in Escherichia coli. We then used this system to construct complex eukaryotic AND-logic gates for genomic integration into embryonic stem cells. Construction was performed by using a standardized series of UNS-bearing BioBrick-compatible vectors, which enable modular assembly and facilitate reuse of individual parts. UNS-guided isothermal assembly is broadly applicable to the construction and optimization of genetic circuits and particularly those requiring tight insulation, such as complex biosynthetic pathways, sensors, counters and logic gates.« less

Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH).

PubMed

Ohmido, Nobuko; Fukui, Kiichi; Kinoshita, Toshiro

2010-01-01

Fluorescence in situ hybridization (FISH) is an effective method for the physical mapping of genes and repetitive DNA sequences on chromosomes. Physical mapping of unique nucleotide sequences on specific rice chromosome regions was performed using a combination of chromosome identification and highly sensitive FISH. Increases in the detection sensitivity of smaller DNA sequences and improvements in spatial resolution have ushered in a new phase in FISH technology. Thus, it is now possible to perform in situ hybridization on somatic chromosomes, pachytene chromosomes, and even on extended DNA fibers (EDFs). Pachytene-FISH allows the integration of genetic linkage maps and quantitative chromosome maps. Visualization methods using FISH can reveal the spatial organization of the centromere, heterochromatin/euchromatin, and the terminal structures of rice chromosomes. Furthermore, EDF-FISH and the DNA combing technique can resolve a spatial distance of 1 kb between adjacent DNA sequences, and the detection of even a 300-bp target is now feasible. The copy numbers of various repetitive sequences and the sizes of various DNA molecules were quantitatively measured using the molecular combing technique. This review describes the significance of these advances in molecular cytology in rice and discusses future applications in plant studies using visualization techniques.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Distant neighbor base sequence context effects in human nucleotide excision repair of a benzo[a]pyrene-derived DNA lesion

PubMed Central

Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.

2010-01-01

Summary The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N2-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5′-C-C-A-T-C-G*-C-T-A-C-C-3′ (CG*C-I), and 5′-C-A-C3-A4-C5-G*-C-A-C-A-C-3′ (CG*C-II). We utilized gel electrophoresis to compare the extent of DNA bending, and molecular dynamics (MD) simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6 ± 0.2 times greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while MD simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, namely, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our prior findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N2-dG lesions, flexible bends and enlarged minor groove widths (Cai et al. (2009) J. Mol. Biol., 385: 30–44) constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. PMID:20399214

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Draft genome analysis provides insights into the fiber yield, crude protein biosynthesis, and vegetative growth of domesticated ramie (Boehmeria nivea L. Gaud).

PubMed

Liu, Chan; Zeng, Liangbin; Zhu, Siyuan; Wu, Lingqing; Wang, Yanzhou; Tang, Shouwei; Wang, Hongwu; Zheng, Xia; Zhao, Jian; Chen, Xiaorong; Dai, Qiuzhong; Liu, Touming

2017-11-15

Plentiful bast fiber, a high crude protein content, and vigorous vegetative growth make ramie a popular fiber and forage crop. Here, we report the draft genome of ramie, along with a genomic comparison and evolutionary analysis. The draft genome contained a sequence of approximately 335.6 Mb with 42,463 predicted genes. A high-density genetic map with 4,338 single nucleotide polymorphisms (SNPs) was developed and used to anchor the genome sequence, thus, creating an integrated genetic and physical map containing a 58.2-Mb genome sequence and 4,304 molecular markers. A genomic comparison identified 1,075 unique gene families in ramie, containing 4,082 genes. Among these unique genes, five were cellulose synthase genes that were specifically expressed in stem bark, and 3 encoded a WAT1-related protein, suggesting that they are probably related to high bast fiber yield. An evolutionary analysis detected 106 positively selected genes, 22 of which were related to nitrogen metabolism, indicating that they are probably responsible for the crude protein content and vegetative growth of domesticated varieties. This study is the first to characterize the genome and develop a high-density genetic map of ramie and provides a basis for the genetic and molecular study of this crop. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Rhodotorula svalbardensis sp. nov., a novel yeast species isolated from cryoconite holes of Ny-Ålesund, Arctic.

PubMed

Singh, Purnima; Singh, Shiv M; Tsuji, Masaharu; Prasad, Gandham S; Hoshino, Tamotsu

2014-02-01

A psychrophilic yeast species was isolated from glacier cryoconite holes of Svalbard. Nucleotide sequences of the strains were studied using D1/D2 domain, ITS region and partial sequences of mitochondrial cytochrome b gene. The strains belonged to a clade of psychrophilic yeasts, but showed marked differences from related species in the D1/D2 domain and biochemical characters. Effects of temperature, salt and media on growth of the cultures were also studied. Screening of the cultures for amylase, cellulase, protease, lipase, urease and catalase activities was carried out. The strains expressed high amylase and lipase activities. Freeze tolerance ability of the isolates indicated the formation of unique hexagonal ice crystal structures due to presence of 'antifreeze proteins' (AFPs). FAME analysis of cultures showed a unique trend of increase in unsaturated fatty acids with decrease in temperature. The major fatty acids recorded were oleic acid, linoleic acid, linolenic acid, palmitic acid, stearic acid, myristic acid and pentadecanoic acid. Based on sequence data and, physiological and morphological properties of the strains, we propose a novel species, Rhodotorula svalbardensis and designate strains MLB-I (CCP-II) and CRY-YB-1 (CBS 12863, JCM 19699, JCM 19700, MTCC 10952) as its type strains (Etymology: sval.bar.den'sis. N.L. fem. adj. svalbardensis pertaining to Svalbard). Copyright © 2014 Elsevier Inc. All rights reserved.

Single molecule counting and assessment of random molecular tagging errors with transposable giga-scale error-correcting barcodes.

PubMed

Lau, Billy T; Ji, Hanlee P

2017-09-21

RNA-Seq measures gene expression by counting sequence reads belonging to unique cDNA fragments. Molecular barcodes commonly in the form of random nucleotides were recently introduced to improve gene expression measures by detecting amplification duplicates, but are susceptible to errors generated during PCR and sequencing. This results in false positive counts, leading to inaccurate transcriptome quantification especially at low input and single-cell RNA amounts where the total number of molecules present is minuscule. To address this issue, we demonstrated the systematic identification of molecular species using transposable error-correcting barcodes that are exponentially expanded to tens of billions of unique labels. We experimentally showed random-mer molecular barcodes suffer from substantial and persistent errors that are difficult to resolve. To assess our method's performance, we applied it to the analysis of known reference RNA standards. By including an inline random-mer molecular barcode, we systematically characterized the presence of sequence errors in random-mer molecular barcodes. We observed that such errors are extensive and become more dominant at low input amounts. We described the first study to use transposable molecular barcodes and its use for studying random-mer molecular barcode errors. Extensive errors found in random-mer molecular barcodes may warrant the use of error correcting barcodes for transcriptome analysis as input amounts decrease.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei.

PubMed

Saroj, Dina B; Dengeti, Shrinivas N; Aher, Supriya; Gupta, Anil K

2015-06-01

Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Phylogeny and evolution of plant cyclic nucleotide-gated ion channel (CNGC) gene family and functional analyses of tomato CNGCs

PubMed Central

Saand, Mumtaz Ali; Xu, You-Ping; Munyampundu, Jean-Pierre; Li, Wen; Zhang, Xuan-Rui; Cai, Xin-Zhong

2015-01-01

Cyclic nucleotide-gated ion channels (CNGCs) are calcium-permeable channels that are involved in various biological functions. Nevertheless, phylogeny and function of plant CNGCs are not well understood. In this study, 333 CNGC genes from 15 plant species were identified using comprehensive bioinformatics approaches. Extensive bioinformatics analyses demonstrated that CNGCs of Group IVa were distinct to those of other groups in gene structure and amino acid sequence of cyclic nucleotide-binding domain. A CNGC-specific motif that recognizes all identified plant CNGCs was generated. Phylogenetic analysis indicated that CNGC proteins of flowering plant species formed five groups. However, CNGCs of the non-vascular plant Physcomitrella patens clustered only in two groups (IVa and IVb), while those of the vascular non-flowering plant Selaginella moellendorffii gathered in four (IVa, IVb, I and II). These data suggest that Group IV CNGCs are most ancient and Group III CNGCs are most recently evolved in flowering plants. Furthermore, silencing analyses revealed that a set of CNGC genes might be involved in disease resistance and abiotic stress responses in tomato and function of SlCNGCs does not correlate with the group that they are belonging to. Our results indicate that Group IVa CNGCs are structurally but not functionally unique among plant CNGCs. PMID:26546226

Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation.

PubMed

Flick, R; Hobom, G

1999-10-01

The influenza virus RNA (vRNA) promoter structure is known to consist of the 5'- and 3'-terminal sequences of the RNA, within very narrow boundaries of 16 and 15 nucleotides, respectively. A complete set of single nucleotide substitutions led to the previously proposed model of a binary hooked or 'corkscrew' conformation for the vRNA promoter when it interacts with the viral polymerase. This functional structure is confirmed here with a complete set of complementary double substitutions, of both the regular A:U and G:C type and also the G:U type of base-pair exchanges. The proposed structure consists of a six base-pair RNA rod in the distal element in conjunction with two stem-loop structures of two short-range base-pairs (positions 2-9; 3-8). These support an exposed tetranucleotide loop within each branch of the proximal element, in an overall oblique organization due to a central unpaired A residue at position 10 in the 5' sequence. Long-range base-pairing between the entire 5' and 3' branches, as required for an unmodified 'panhandle' model, has been excluded for the proximal element, while it is known to represent the mode of interaction within the distal element. A large number of short-range base-pair exchanges in the proximal element constitute promoter-up mutations, which show activities several times above that of the wild-type in reporter gene assays. The unique overall conformation and rather few invariant nucleotides appear to be the core elements in vRNA recognition by polymerase and also in viral ribonucleoprotein packaging, to allow discrimination against the background of other RNA molecules in the cell.

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

PubMed Central

2011-01-01

Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

Genetic homogeneity of Clostridium botulinum type A1 strains with unique toxin gene clusters.

PubMed

Raphael, Brian H; Luquez, Carolina; McCroskey, Loretta M; Joseph, Lavin A; Jacobson, Mark J; Johnson, Eric A; Maslanka, Susan E; Andreadis, Joanne D

2008-07-01

A group of five clonally related Clostridium botulinum type A strains isolated from different sources over a period of nearly 40 years harbored several conserved genetic properties. These strains contained a variant bont/A1 with five nucleotide polymorphisms compared to the gene in C. botulinum strain ATCC 3502. The strains also had a common toxin gene cluster composition (ha-/orfX+) similar to that associated with bont/A in type A strains containing an unexpressed bont/B [termed A(B) strains]. However, bont/B was not identified in the strains examined. Comparative genomic hybridization demonstrated identical genomic content among the strains relative to C. botulinum strain ATCC 3502. In addition, microarray data demonstrated the absence of several genes flanking the toxin gene cluster among the ha-/orfX+ A1 strains, suggesting the presence of genomic rearrangements with respect to this region compared to the C. botulinum ATCC 3502 strain. All five strains were shown to have identical flaA variable region nucleotide sequences. The pulsed-field gel electrophoresis patterns of the strains were indistinguishable when digested with SmaI, and a shift in the size of at least one band was observed in a single strain when digested with XhoI. These results demonstrate surprising genomic homogeneity among a cluster of unique C. botulinum type A strains of diverse origin.

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification

PubMed Central

Schouten, Jan P.; McElgunn, Cathal J.; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-01-01

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down’s syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50–70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences. PMID:12060695

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification.

PubMed

Schouten, Jan P; McElgunn, Cathal J; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-06-15

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down's syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50-70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences.

Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.

PubMed

Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M

2015-01-01

Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, Emilio; Worsham, Patricia; Bearden, S.

2007-01-01

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, E; Worsham, P; Bearden, S

2007-01-05

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

PubMed

Herold, Keith E; Rasooly, Avraham

2003-12-01

Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

Characterization of 47 MHC class I sequences in Filipino cynomolgus macaques

PubMed Central

Campbell, Kevin J.; Detmer, Ann M.; Karl, Julie A.; Wiseman, Roger W.; Blasky, Alex J.; Hughes, Austin L.; Bimber, Benjamin N.; O’Connor, Shelby L.; O’Connor, David H.

2009-01-01

Cynomolgus macaques (Macaca fascicularis) provide increasingly common models for infectious disease research. Several geographically distinct populations of these macaques from Southeast Asia and the Indian Ocean island of Mauritius are available for pathogenesis studies. Though host genetics may profoundly impact results of such studies, similarities and differences between populations are often overlooked. In this study we identified 47 full-length MHC class I nucleotide sequences in 16 cynomolgus macaques of Filipino origin. The majority of MHC class I sequences characterized (39 of 47) were unique to this regional population. However, we discovered eight sequences with perfect identity and six sequences with close similarity to previously defined MHC class I sequences from other macaque populations. We identified two ancestral MHC haplotypes that appear to be shared between Filipino and Mauritian cynomolgus macaques, notably a Mafa-B haplotype that has previously been shown to protect Mauritian cynomolgus macaques against challenge with a simian/human immunodeficiency virus, SHIV89.6P. We also identified a Filipino cynomolgus macaque MHC class I sequence for which the predicted protein sequence differs from Mamu-B*17 by a single amino acid. This is important because Mamu-B*17 is strongly associated with protection against simian immunodeficiency virus (SIV) challenge in Indian rhesus macaques. These findings have implications for the evolutionary history of Filipino cynomolgus macaques as well as for the use of this model in SIV/SHIV research protocols. PMID:19107381

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Cloning and characterization of the mouse XPAC gene.

PubMed Central

van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H

1994-01-01

Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648

An Evaluation of Putative Sympatric Speciation within Limnanthes (Limnanthaceae)

PubMed Central

Meyers, Stephen C.; Liston, Aaron; Meinke, Robert

2012-01-01

Limnanthes floccosa ssp. floccosa and L. floccosa ssp. grandiflora are two of five subspecies within Limnanthes floccosa endemic to vernal pools in southern Oregon and northern California. Three seasons of monitoring natural populations have quantified that L. floccosa ssp. grandiflora is always found growing sympatrically with L. floccosa ssp. floccosa and that their flowering times overlap considerably. Despite their subspecific rank within the same species crossing experiments have confirmed that their F1 hybrids are sterile. An analysis of twelve microsatellite markers, with unique alleles in each taxon, also shows exceedingly low levels of gene flow between populations of the two subspecies. Due to the lack of previous phylogenetic resolution among L. floccosa subspecies, we used Illumina next generation sequencing to identify single nucleotide polymorphisms from genomic DNA libraries of L. floccosa ssp. floccosa and L. floccosa ssp. grandiflora. These data were used to identify single nucleotide polymorphisms in the chloroplast, mitochondrial, and nuclear genomes. From these variable loci, a total of 2772 bp was obtained using Sanger sequencing of ten individuals representing all subspecies of L. floccosa and an outgroup. The resulting phylogenetic reconstruction was fully resolved. Our results indicate that although L. floccosa ssp. floccosa and L. floccosa ssp. grandiflora are closely related, they are not sister taxa and therefore likely did not diverge as a result of a sympatric speciation event. PMID:22563502

Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

PubMed

Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

2015-06-19

Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

PubMed

Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

2016-10-01

A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

Identification of amino acid changes in the envelope glycoproteins of bovine viral diarrhea viruses isolated from alpaca that may be involved in host adaptation.

PubMed

Neill, John D; Dubovi, Edward J; Ridpath, Julia F

2015-09-30

Bovine viral diarrhea viruses (BVDV) are most commonly associated with infections of cattle. However, BVDV are often isolated from closely related ruminants with a number of BVDV-1b viruses being isolated from alpacas that were both acutely and persistently infected. The complete nucleotide sequence of the open reading frame of eleven alpaca-adapted BVDV isolates and the region encoding the envelope glycoproteins of an additional three isolates were determined. With the exception of one, all alpaca isolates were >99.2% similar at the nucleotide level. The Hercules isolate was more divergent, with 95.7% sequence identity to the other viruses. Sequence similarity of the 14 viruses indicated they were isolates of a single BVDV strain that had adapted to and were circulating through alpaca herds. Hercules was a more distantly related strain that has been isolated only once in Canada and represented a separate adaptation event that possessed the same adaptive changes. Comparison of amino acid sequences of alpaca and bovine-derived BVDV strains revealed three regions with amino acid sequences unique to all alpaca isolates. The first contained two small in-frame deletions near the N-terminus of the E2 glycoprotein. The second was found near the C-terminus of the E2 protein where four altered amino acids were located within a 30 amino acid domain that participates in E2 homodimerization. The third region contained three variable amino acids in the C-terminus of the E(rns) within the amphipathic helix membrane anchor. These changes were found in the polar side of the amphipathic helix and resulted in an increased charge within the polar face. Titration of bovine and alpaca viruses in both bovine and alpaca cells indicated that with increased charge in the amphipathic helix, the ability to infect alpaca cells also increased. Published by Elsevier B.V.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

PubMed

Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

2014-09-11

The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic dataset is a useful resource for molecular genetic studies of the koala, for evolutionary genetic studies of marsupials, for validation and annotation of the koala genome sequence, and for investigation of koala retrovirus. Annotated transcripts can be browsed and queried at http://koalagenome.org.

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Genomic insights from whole genome sequencing of four clonal outbreak Campylobacter jejuni assessed within the global C. jejuni population.

PubMed

Clark, Clifford G; Berry, Chrystal; Walker, Matthew; Petkau, Aaron; Barker, Dillon O R; Guan, Cai; Reimer, Aleisha; Taboada, Eduardo N

2016-12-03

Whole genome sequencing (WGS) is useful for determining clusters of human cases, investigating outbreaks, and defining the population genetics of bacteria. It also provides information about other aspects of bacterial biology, including classical typing results, virulence, and adaptive strategies of the organism. Cell culture invasion and protein expression patterns of four related multilocus sequence type 21 (ST21) C. jejuni isolates from a significant Canadian water-borne outbreak were previously associated with the presence of a CJIE1 prophage. Whole genome sequencing was used to examine the genetic diversity among these isolates and confirm that previous observations could be attributed to differential prophage carriage. Moreover, we sought to determine the presence of genome sequences that could be used as surrogate markers to delineate outbreak-associated isolates. Differential carriage of the CJIE1 prophage was identified as the major genetic difference among the four outbreak isolates. High quality single-nucleotide variant (hqSNV) and core genome multilocus sequence typing (cgMLST) clustered these isolates within expanded datasets consisting of additional C. jejuni strains. The number and location of homopolymeric tract regions was identical in all four outbreak isolates but differed from all other C. jejuni examined. Comparative genomics and PCR amplification enabled the identification of large chromosomal inversions of approximately 93 kb and 388 kb within the outbreak isolates associated with transducer-like proteins containing long nucleotide repeat sequences. The 93-kb inversion was characteristic of the outbreak-associated isolates, and the gene content of this inverted region displayed high synteny with the reference strain. The four outbreak isolates were clonally derived and differed mainly in the presence of the CJIE1 prophage, validating earlier findings linking the prophage to phenotypic differences in virulence assays and protein expression. The identification of large, genetically syntenous chromosomal inversions in the genomes of outbreak-associated isolates provided a unique method for discriminating outbreak isolates from the background population. Transducer-like proteins appear to be associated with the chromosomal inversions. CgMLST and hqSNV analysis also effectively delineated the outbreak isolates within the larger C. jejuni population structure.

Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

PubMed Central

Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

2017-01-01

ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Whole-genome sequencing reveals clonal expansion of multiresistant Staphylococcus haemolyticus in European hospitals.

PubMed

Cavanagh, Jorunn Pauline; Hjerde, Erik; Holden, Matthew T G; Kahlke, Tim; Klingenberg, Claus; Flægstad, Trond; Parkhill, Julian; Bentley, Stephen D; Sollid, Johanna U Ericson

2014-11-01

Staphylococcus haemolyticus is an emerging cause of nosocomial infections, primarily affecting immunocompromised patients. A comparative genomic analysis was performed on clinical S. haemolyticus isolates to investigate their genetic relationship and explore the coding sequences with respect to antimicrobial resistance determinants and putative hospital adaptation. Whole-genome sequencing was performed on 134 isolates of S. haemolyticus from geographically diverse origins (Belgium, 2; Germany, 10; Japan, 13; Norway, 54; Spain, 2; Switzerland, 43; UK, 9; USA, 1). Each genome was individually assembled. Protein coding sequences (CDSs) were predicted and homologous genes were categorized into three types: Type I, core genes, homologues present in all strains; Type II, unique core genes, homologues shared by only a subgroup of strains; and Type III, unique genes, strain-specific CDSs. The phylogenetic relationship between the isolates was built from variable sites in the form of single nucleotide polymorphisms (SNPs) in the core genome and used to construct a maximum likelihood phylogeny. SNPs in the genome core regions divided the isolates into one major group of 126 isolates and one minor group of isolates with highly diverse genomes. The major group was further subdivided into seven clades (A-G), of which four (A-D) encompassed isolates only from Europe. Antimicrobial multiresistance was observed in 77.7% of the collection. High levels of homologous recombination were detected in genes involved in adherence, staphylococcal host adaptation and bacterial cell communication. The presence of several successful and highly resistant clones underlines the adaptive potential of this opportunistic pathogen. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

Whole-genome sequencing reveals clonal expansion of multiresistant Staphylococcus haemolyticus in European hospitals

PubMed Central

Cavanagh, Jorunn Pauline; Hjerde, Erik; Holden, Matthew T. G.; Kahlke, Tim; Klingenberg, Claus; Flægstad, Trond; Parkhill, Julian; Bentley, Stephen D.; Sollid, Johanna U. Ericson

2014-01-01

Objectives Staphylococcus haemolyticus is an emerging cause of nosocomial infections, primarily affecting immunocompromised patients. A comparative genomic analysis was performed on clinical S. haemolyticus isolates to investigate their genetic relationship and explore the coding sequences with respect to antimicrobial resistance determinants and putative hospital adaptation. Methods Whole-genome sequencing was performed on 134 isolates of S. haemolyticus from geographically diverse origins (Belgium, 2; Germany, 10; Japan, 13; Norway, 54; Spain, 2; Switzerland, 43; UK, 9; USA, 1). Each genome was individually assembled. Protein coding sequences (CDSs) were predicted and homologous genes were categorized into three types: Type I, core genes, homologues present in all strains; Type II, unique core genes, homologues shared by only a subgroup of strains; and Type III, unique genes, strain-specific CDSs. The phylogenetic relationship between the isolates was built from variable sites in the form of single nucleotide polymorphisms (SNPs) in the core genome and used to construct a maximum likelihood phylogeny. Results SNPs in the genome core regions divided the isolates into one major group of 126 isolates and one minor group of isolates with highly diverse genomes. The major group was further subdivided into seven clades (A–G), of which four (A–D) encompassed isolates only from Europe. Antimicrobial multiresistance was observed in 77.7% of the collection. High levels of homologous recombination were detected in genes involved in adherence, staphylococcal host adaptation and bacterial cell communication. Conclusions The presence of several successful and highly resistant clones underlines the adaptive potential of this opportunistic pathogen. PMID:25038069

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

PubMed

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

Genome-wide re-sequencing of multidrug-resistant Mycobacterium leprae Airaku-3.

PubMed

Singh, P; Benjak, A; Carat, S; Kai, M; Busso, P; Avanzi, C; Paniz-Mondolfi, A; Peter, C; Harshman, K; Rougemont, J; Matsuoka, M; Cole, S T

2014-10-01

Genotyping and molecular characterization of drug resistance mechanisms in Mycobacterium leprae enables disease transmission and drug resistance trends to be monitored. In the present study, we performed genome-wide analysis of Airaku-3, a multidrug-resistant strain with an unknown mechanism of resistance to rifampicin. We identified 12 unique non-synonymous single-nucleotide polymorphisms (SNPs) including two in the transporter-encoding ctpC and ctpI genes. In addition, two SNPs were found that improve the resolution of SNP-based genotyping, particularly for Venezuelan and South East Asian strains of M. leprae. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Complete mitochondrial genome of Ostrea denselamellosa (Bivalvia, Ostreidae).

PubMed

Yu, Hong; Kong, Lingfeng; Li, Qi

2016-01-01

The complete mitochondrial (mt) genome of the flat oyster, Ostrea denselamellosa, was determined using Long-PCR and genome walking techniques in this study. The total length of the mt genome sequence of O. denselamellosa was 16,227 bp, which is the smallest reported Ostreidae mt genome to date. It contained 12 protein-coding genes (lacking of ATP8), 23 transfer RNA genes, and two ribosomal RNA genes. A bias towards a higher representation of nucleotides A and T (60.7%) was detected in the mt genome of O. denselamellosa. The rrnL was split into two fragments (3' half, 711 bp; 5' half, 509 bp), which seems to be the unique characteristics of Ostreidae mt genomes.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Analysis of the Highly Diverse Gene Borders in Ebola Virus Reveals a Distinct Mechanism of Transcriptional Regulation

PubMed Central

Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki

2014-01-01

ABSTRACT Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. IMPORTANCE Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3′ end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. PMID:25142600

Analysis of the highly diverse gene borders in Ebola virus reveals a distinct mechanism of transcriptional regulation.

PubMed

Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki; Mühlberger, Elke

2014-11-01

Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Neisseria arctica sp. nov. isolated from nonviable eggs of greater white-fronted geese (Anser albifrons) in Arctic Alaska

USGS Publications Warehouse

Hansen, Cristina M.; Himschoot, Elizabeth; Hare, Rebekah F.; Meixell, Brandt W.; Van Hemert, Caroline R.; Hueffer, Karsten

2017-01-01

During the summers of 2013 and 2014, isolates of a novel Gram-negative coccus in the Neisseria genus were obtained from the contents of nonviable greater white-fronted goose (Anser albifrons) eggs on the Arctic Coastal Plain of Alaska. We used a polyphasic approach to determine whether these isolates represent a novel species. 16S rRNA gene sequences, 23S rRNA gene sequences, and chaperonin 60 gene sequences suggested that these Alaskan isolates are members of a distinct species that is most closely related to Neisseria canis, N. animaloris, and N. shayeganii. Analysis of the rplF gene additionally showed that our isolates are unique and most closely related to N. weaveri. Average nucleotide identity of the whole genome sequence of our type strain was between 71.5% and 74.6% compared to close relatives, further supporting designation as a novel species. Fatty acid methyl ester analysis showed a predominance of C14:0, C16:0, and C16:1ω7c fatty acids. Finally, biochemical characteristics distinguished our isolates from other Neisseria species. The name Neisseria arctica (type strain KH1503T = ATCC TSD-57T = DSM 103136T) is proposed.

The genomes and comparative genomics of Lactobacillus delbrueckii phages.

PubMed

Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

2011-07-01

Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

Sequencing and De Novo Assembly of the Toxicodendron radicans (Poison Ivy) Transcriptome

PubMed Central

Kim, Gunjune

2017-01-01

Contact with poison ivy plants is widely dreaded because they produce a natural product called urushiol that is responsible for allergenic contact delayed-dermatitis symptoms lasting for weeks. For this reason, the catchphrase most associated with poison ivy is “leaves of three, let it be”, which serves the purpose of both identification and an appeal for avoidance. Ironically, despite this notoriety, there is a dearth of specific knowledge about nearly all other aspects of poison ivy physiology and ecology. As a means of gaining a more molecular-oriented understanding of poison ivy physiology and ecology, Next Generation DNA sequencing technology was used to develop poison ivy root and leaf RNA-seq transcriptome resources. De novo assembled transcriptomes were analyzed to generate a core set of high quality expressed transcripts present in poison ivy tissue. The predicted protein sequences were evaluated for similarity to SwissProt homologs and InterProScan domains, as well as assigned both GO terms and KEGG annotations. Over 23,000 simple sequence repeats were identified in the transcriptome, and corresponding oligo nucleotide primer pairs were designed. A pan-transcriptome analysis of existing Anacardiaceae transcriptomes revealed conserved and unique transcripts among these species. PMID:29125533

Sequencing and De Novo Assembly of the Toxicodendron radicans (Poison Ivy) Transcriptome.

PubMed

Weisberg, Alexandra J; Kim, Gunjune; Westwood, James H; Jelesko, John G

2017-11-10

Contact with poison ivy plants is widely dreaded because they produce a natural product called urushiol that is responsible for allergenic contact delayed-dermatitis symptoms lasting for weeks. For this reason, the catchphrase most associated with poison ivy is "leaves of three, let it be", which serves the purpose of both identification and an appeal for avoidance. Ironically, despite this notoriety, there is a dearth of specific knowledge about nearly all other aspects of poison ivy physiology and ecology. As a means of gaining a more molecular-oriented understanding of poison ivy physiology and ecology, Next Generation DNA sequencing technology was used to develop poison ivy root and leaf RNA-seq transcriptome resources. De novo assembled transcriptomes were analyzed to generate a core set of high quality expressed transcripts present in poison ivy tissue. The predicted protein sequences were evaluated for similarity to SwissProt homologs and InterProScan domains, as well as assigned both GO terms and KEGG annotations. Over 23,000 simple sequence repeats were identified in the transcriptome, and corresponding oligo nucleotide primer pairs were designed. A pan-transcriptome analysis of existing Anacardiaceae transcriptomes revealed conserved and unique transcripts among these species.

First complete mitochondrial genome sequence from a box jellyfish reveals a highly fragmented linear architecture and insights into telomere evolution.

PubMed

Smith, David Roy; Kayal, Ehsan; Yanagihara, Angel A; Collins, Allen G; Pirro, Stacy; Keeling, Patrick J

2012-01-01

Animal mitochondrial DNAs (mtDNAs) are typically single circular chromosomes, with the exception of those from medusozoan cnidarians (jellyfish and hydroids), which are linear and sometimes fragmented. Most medusozoans have linear monomeric or linear bipartite mitochondrial genomes, but preliminary data have suggested that box jellyfish (cubozoans) have mtDNAs that consist of many linear chromosomes. Here, we present the complete mtDNA sequence from the winged box jellyfish Alatina moseri (the first from a cubozoan). This genome contains unprecedented levels of fragmentation: 18 unique genes distributed over eight 2.9- to 4.6-kb linear chromosomes. The telomeres are identical within and between chromosomes, and recombination between subtelomeric sequences has led to many genes initiating or terminating with sequences from other genes (the most extreme case being 150 nt of a ribosomal RNA containing the 5' end of nad2), providing evidence for a gene conversion-based model of telomere evolution. The silent-site nucleotide variation within the A. moseri mtDNA is among the highest observed from a eukaryotic genome and may be associated with elevated rates of recombination.

ReadXplorer—visualization and analysis of mapped sequences

PubMed Central

Hilker, Rolf; Stadermann, Kai Bernd; Doppmeier, Daniel; Kalinowski, Jörn; Stoye, Jens; Straube, Jasmin; Winnebald, Jörn; Goesmann, Alexander

2014-01-01

Motivation: Fast algorithms and well-arranged visualizations are required for the comprehensive analysis of the ever-growing size of genomic and transcriptomic next-generation sequencing data. Results: ReadXplorer is a software offering straightforward visualization and extensive analysis functions for genomic and transcriptomic DNA sequences mapped on a reference. A unique specialty of ReadXplorer is the quality classification of the read mappings. It is incorporated in all analysis functions and displayed in ReadXplorer's various synchronized data viewers for (i) the reference sequence, its base coverage as (ii) normalizable plot and (iii) histogram, (iv) read alignments and (v) read pairs. ReadXplorer's analysis capability covers RNA secondary structure prediction, single nucleotide polymorphism and deletion–insertion polymorphism detection, genomic feature and general coverage analysis. Especially for RNA-Seq data, it offers differential gene expression analysis, transcription start site and operon detection as well as RPKM value and read count calculations. Furthermore, ReadXplorer can combine or superimpose coverage of different datasets. Availability and implementation: ReadXplorer is available as open-source software at http://www.readxplorer.org along with a detailed manual. Contact: rhilker@mikrobio.med.uni-giessen.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24790157

Population diversity of Diaphorina citri (Hemiptera: Liviidae) in China based on whole mitochondrial genome sequences.

PubMed

Wu, Fengnian; Jiang, Hongyan; Beattie, G Andrew C; Holford, Paul; Chen, Jianchi; Wallis, Christopher M; Zheng, Zheng; Deng, Xiaoling; Cen, Yijing

2018-04-24

Diaphorina citri (Asian citrus psyllid; ACP) transmits 'Candidatus Liberibacter asiaticus' associated with citrus Huanglongbing (HLB). ACP has been reported in 11 provinces/regions in China, yet its population diversity remains unclear. In this study, we evaluated ACP population diversity in China using representative whole mitochondrial genome (mitogenome) sequences. Additional mitogenome sequences outside China were also acquired and evaluated. The sizes of the 27 ACP mitogenome sequences ranged from 14 986 to 15 030 bp. Along with three previously published mitogenome sequences, the 30 sequences formed three major mitochondrial groups (MGs): MG1, present in southwestern China and occurring at elevations above 1000 m; MG2, present in southeastern China and Southeast Asia (Cambodia, Indonesia, Malaysia, and Vietnam) and occurring at elevations below 180 m; and MG3, present in the USA and Pakistan. Single nucleotide polymorphisms in five genes (cox2, atp8, nad3, nad1 and rrnL) contributed mostly in the ACP diversity. Among these genes, rrnL had the most variation. Mitogenome sequences analyses revealed two major phylogenetic groups of ACP present in China as well as a possible unique group present currently in Pakistan and the USA. The information could have significant implications for current ACP control and HLB management. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

PubMed

Livingston, B T; Shaw, R; Bailey, A; Wilt, F

1991-12-01

In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Blind prediction of noncanonical RNA structure at atomic accuracy.

PubMed

Watkins, Andrew M; Geniesse, Caleb; Kladwang, Wipapat; Zakrevsky, Paul; Jaeger, Luc; Das, Rhiju

2018-05-01

Prediction of RNA structure from nucleotide sequence remains an unsolved grand challenge of biochemistry and requires distinct concepts from protein structure prediction. Despite extensive algorithmic development in recent years, modeling of noncanonical base pairs of new RNA structural motifs has not been achieved in blind challenges. We report a stepwise Monte Carlo (SWM) method with a unique add-and-delete move set that enables predictions of noncanonical base pairs of complex RNA structures. A benchmark of 82 diverse motifs establishes the method's general ability to recover noncanonical pairs ab initio, including multistrand motifs that have been refractory to prior approaches. In a blind challenge, SWM models predicted nucleotide-resolution chemical mapping and compensatory mutagenesis experiments for three in vitro selected tetraloop/receptors with previously unsolved structures (C7.2, C7.10, and R1). As a final test, SWM blindly and correctly predicted all noncanonical pairs of a Zika virus double pseudoknot during a recent community-wide RNA-Puzzle. Stepwise structure formation, as encoded in the SWM method, enables modeling of noncanonical RNA structure in a variety of previously intractable problems.

Genetic and biochemical impairment of mitochondrial complex I activity in a family with Leber hereditary optic neuropathy and hereditary spastic dystonia

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Vries, D.D.; Oost, B.A. van; Went, L.N.

1996-04-01

A rare form of Leber hereditary optic neuropathy (LHON) that is associated with hereditary spastic dystonia has been studied in a large Dutch family. Neuropathy and ophthalmological lesions were present together in some family members, whereas only one type of abnormality was found in others. mtDNA mutations previously reported in LHON were not present. Sequence analysis of the protein-coding mitochondrial genes revealed two previously unreported mtDNA mutations. A heteroplasmic A{yields}G transition at nucleotide position 11696 in the ND4 gene resulted in the substitution of an isoleucine for valine at amino acid position 312. A second mutation, a homoplasmic T{yields}A transitionmore » at nucleotide position 14596 in the ND6 gene, resulted in the substitution of a methionine for the isoleucine at amino acid residue 26. Biochemical analysis of a muscle biopsy revealed a severe complex I deficiency, providing a link between these unique mtDNA mutations and this rare, complex phenotype including Leber optic neuropathy. 80 refs., 2 figs., 3 tabs.« less

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.