Epidemiologic Analysis of Onychomycosis in the San Diego Pediatric Population.

PubMed

Totri, Christine R; Feldstein, Stephanie; Admani, Shehla; Friedlander, Sheila F; Eichenfield, Lawrence F

2017-01-01

Onychomycosis (OM) is thought to be a rare disease in children, although there are few epidemiologic studies. This 3-year retrospective case series of nearly 400 children seen at Rady Children's Hospital-San Diego (RCHSD) describes the characteristics of OM found in this pediatric population. From 2011 to 2013, the Pediatric and Adolescent Dermatology Clinic at RCHSD saw a total of 36,634 unique patients, of whom 433 were unique patients with OM. Thirty-four patients met exclusion criteria, leaving 399 (1.1%) with a diagnosis of OM by a pediatric dermatologist. Nail cultures were obtained in 242 cases (60.7%), 116 (48.0%) of which were positive. Trichophyton rubrum was the most commonly isolated pathogen, responsible for 106 cases (91.3%) of positive cultures in the cohort. Our study provides important regional information regarding epidemiologic data in pediatric onychomycosis, highlighting the diagnostic methods most commonly used and the pathogens most frequently encountered in our practice. © 2016 Wiley Periodicals, Inc.

A unique tripartite collision tumor of the esophagus

PubMed Central

Schizas, Dimitrios; Michalinos, Adamantios; Alexandrou, Paraskevi; Moris, Demetrios; Baliou, Evangelia; Tsilimigras, Diamantis; Throupis, Theodore; Liakakos, Theodore

2017-01-01

Abstract Rationale: We report a unique case of a tripartite esophageal collision tumor consisting of three separate histologic types. Patients concerns: Therapeutic dilemmas on the proper treatment of those rare neoplasms remain unanswered considering both proper surgical therapy and adjuvant therapy. Diagnose: In this paper, we report a unique case of a patient with a tripartite esophageal collision tumor consisting of a small cell carcinoma, an adenocarcinoma of medium differentiation and a signet ring cell carcinoma. Diagnosis is difficult as clinical presentation of the patient was undistinguishable from other, commoner tumor types. Interventions: The patient's diagnostic and therapeutic course along with available data on the collisions tumor's biological behavior and treatment are briefly discussed. Outcomes: Esophagectomy is the best treatment options for these patients. Unique nature of this tumor demands aggresive oncologic treatment. Lessons: Collision tumors are rare neoplasms consisting of distinct cell populations developing in juxtaposition to one another without any areas of intermingling. Various cell types can be found. However, collision neoplasms of the esophagus combining adenomatous and neuroendocrine components are exceedingly rare, with only 5 cases described to date in the literature. Given their rarity, limited information is available on their tumorigenesis, biological behavior and clinical course. In general, these tumors are aggressive neoplasms and significantly affect patient treatment and prognosis. PMID:29245236

Population-based incidence and comparative demographics of community-associated and healthcare-associated Escherichia coli bloodstream infection in Auckland, New Zealand, 2005-2011.

PubMed

Williamson, Deborah A; Lim, Alwin; Wiles, Siouxsie; Roberts, Sally A; Freeman, Joshua T

2013-08-21

Escherichia coli is a major human pathogen, both in community and healthcare settings. To date however, relatively few studies have defined the population burden of E. coli bloodstream infections. Such information is important in informing strategies around treatment and prevention of these serious infections. Against this background, we performed a retrospective, population-based observational study of all cases of E. coli bacteremia in patients presenting to our hospital between January 2005 and December 2011. Auckland District Health Board is a tertiary-level, university-affiliated institution serving a population of approximately 500,000, within a larger metropolitan population of 1.4 million. We identified all patients with an episode of bloodstream infection due to E. coli over the study period. A unique episode was defined as the first positive E. coli blood culture taken from the same patient within a thirty-day period. Standard definitions were used to classify episodes into community- or healthcare-associated E. coli bacteremia. Demographic information was obtained for all patients, including: age; gender; ethnicity; length of stay (days); requirement for intensive care admission and all-cause, in-patient mortality. A total of 1507 patients had a unique episode of E. coli bacteremia over the study period. The overall average annual incidence of E. coli bacteremia was 52 per 100,000 population, and was highest in the under one year and over 65-year age groups. When stratified by ethnicity, rates were highest in Pacific Peoples and Māori (83 and 62 per 100,000 population respectively). The incidence of community-onset E. coli bacteremia increased significantly over the study period. The overall in-hospital mortality rate was 9% (135/1507), and was significantly higher in patients who had a hospital-onset E. coli bacteremia. Our work provides valuable baseline data on the incidence of E. coli bacteremia in our locale. The incidence was higher that that described from other developed countries, with significant demographic variation, most notably in ethnic-specific incidence rates. Future work should assess the possible reasons for this disparity.

Population-based incidence and comparative demographics of community-associated and healthcare-associated Escherichia coli bloodstream infection in Auckland, New Zealand, 2005 – 2011

PubMed Central

2013-01-01

Background Escherichia coli is a major human pathogen, both in community and healthcare settings. To date however, relatively few studies have defined the population burden of E. coli bloodstream infections. Such information is important in informing strategies around treatment and prevention of these serious infections. Against this background, we performed a retrospective, population-based observational study of all cases of E. coli bacteremia in patients presenting to our hospital between January 2005 and December 2011. Methods Auckland District Health Board is a tertiary-level, university-affiliated institution serving a population of approximately 500,000, within a larger metropolitan population of 1.4 million. We identified all patients with an episode of bloodstream infection due to E. coli over the study period. A unique episode was defined as the first positive E. coli blood culture taken from the same patient within a thirty-day period. Standard definitions were used to classify episodes into community- or healthcare-associated E. coli bacteremia. Demographic information was obtained for all patients, including: age; gender; ethnicity; length of stay (days); requirement for intensive care admission and all-cause, in-patient mortality. Results A total of 1507 patients had a unique episode of E. coli bacteremia over the study period. The overall average annual incidence of E. coli bacteremia was 52 per 100,000 population, and was highest in the under one year and over 65-year age groups. When stratified by ethnicity, rates were highest in Pacific Peoples and Māori (83 and 62 per 100,000 population respectively). The incidence of community-onset E. coli bacteremia increased significantly over the study period. The overall in-hospital mortality rate was 9% (135/1507), and was significantly higher in patients who had a hospital-onset E. coli bacteremia. Conclusions Our work provides valuable baseline data on the incidence of E. coli bacteremia in our locale. The incidence was higher that that described from other developed countries, with significant demographic variation, most notably in ethnic-specific incidence rates. Future work should assess the possible reasons for this disparity. PMID:23964864

Provision of Patient-Centered Transgender Care.

PubMed

Selix, Nancy W; Rowniak, Stefan

2016-11-01

Transgender individuals have unique health care needs and experience health disparities. There is an increased need for transgender health care services and primary care for this underserved population. However, provision of appropriate health care services for transgender persons requires cultural competency and skill on the part of the health care provider, and providers need specific skills to address the needs of this population. A review of the literature was performed by accessing CINAHL, PsycINFO, and PubMed databases. Pertinent research was extracted and reviewed for relevance. References in these publications were reviewed to identify additional publications that address primary prevention, secondary prevention, and tertiary care of transgender individuals. Articles that include prevention, screening, and treatment of health problems of transgender persons were identified. Research on the health needs of the transgender population is limited. Whenever available, research findings that address this unique population should be incorporated into clinical practice. When research evidence is not available to address the unique needs of transgender individuals, research and clinical care guidelines from the general population may be applied for health screening and maintenance. This article provides information about primary care services for transgender individuals and seeks to improve awareness of the health disparities this underserved population experiences. Simple solutions to modify clinical settings to enhance care are provided. © 2016 by the American College of Nurse-Midwives.

Leveraging the "living laboratory": on the emergence of the entrepreneurial hospital.

PubMed

French, Martin; Miller, Fiona Alice

2012-08-01

For years, scholars have debated the "commercial ethos" in higher education, and the rise of the entrepreneurial university. But what of the "entrepreneurial hospital"? Largely unnoticed by scholars, this unique organisational form differs from the entrepreneurial university in some significant ways, not least in its capacity to use its innovations, and to count patients-and even patient populations-amongst its human capital. Accordingly, this article provides an initial conceptualisation of the entrepreneurial hospital, along with an exploration of its larger implications. Using twenty-six semi-structured interviews with key-informants (2008-2009), who work in two networked organisations within a single academic health science system in a Canadian province, our analysis identifies distinctive characteristics of an entrepreneurial hospital. Informed by grounded theory, especially situational analysis, we derive from our data an illustration of potentially incommensurate understandings of the entrepreneurial hospital's resources. On one hand, our study participants view patients and patient populations as a resource for research, linking its value to the contribution it can make to improved, more cost-effective care. On the other hand, some also see commercial potential in this resource. In both cases, exploitation is accompanied by perceived obligations to make proper use of patient populations, and to "give back" to the public-at-large, including through the entrepreneurial search for new ways of mobilising the resources of publicly-funded health care. Thus, a key task of the entrepreneurial hospital is to invent and mediate new uses for its care infrastructure and the unique resource constituted by patient populations. By drawing together care and research in new ways, the entrepreneurial hospital promises increased capacity for biomedical innovation. Yet, as it invents and mediates new uses for patient populations and health care infrastructure, the entrepreneurial hospital stands to significantly redefine both systems of care and the bonds of social solidarity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Innovative CF program responds to the unique needs of adults.

PubMed

2006-03-01

The median age of survival among CF patients has risen from 14 to nearly 40 over the past three decades, but these individuals have many different medical and psychosocial needs than the pediatric population. To better meet these needs, Atlanta-based Emory University Medical School has developed a distinct program for adult patients that provides multidisciplinary care to older CF patients from throughout the Southeast.

Trauma patients who present in a delayed fashion: a unique and challenging population.

PubMed

Kao, Mary J; Nunez, Hector; Monaghan, Sean F; Heffernan, Daithi S; Adams, Charles A; Lueckel, Stephanie N; Stephen, Andrew H

2017-02-01

A proportion of trauma patients present for evaluation in a delayed fashion after injury, likely due to a variety of medical and nonmedical reasons. There has been little investigation into the characteristics and outcomes of trauma patients who present delayed. We hypothesize that trauma patients who present in a delayed fashion are a unique population at risk of increased trauma-related complications. This was a retrospective review from 2010-2015 at a Level I trauma center. Patients were termed delayed if they presented >24 hours after injury. Patients admitted within 24 hours of their injury were the comparison group. Charts were reviewed for demographics, mechanism, comorbidities, complications and outcomes. A subgroup analysis was done on patients who suffered falls. During the 5-y period, 11,705 patients were admitted. A total of 588 patients (5%) presented >24 h after their injury. Patients in the delayed group were older (65 versus 55 y, P < 0.001) and more likely to have psychiatric comorbidities (33% vs. 24%, P = 0.0001) than the control group. They were also more likely to suffer substance withdrawal (8.9% vs. 4.1%, P < 0.001) but had toxicology testing for drugs and alcohol done at significantly lower rates. Patients that presented delayed after falls were similar in age and injury severity score (ISS) but more likely to suffer substance withdrawal when compared to those with falls that presented within 24 hours. Patients with falls that presented delayed had toxicology testing at significantly lower rates than the comparison group. Trauma patients that present to the hospital in a delayed fashion have unique characteristics and are more likely to suffer negative outcomes including substance withdrawal. Future goals will include exploring strategies for early intervention, such as automatic withdrawal monitoring and social work referral for all patients who present in a delayed fashion. Copyright © 2016 Elsevier Inc. All rights reserved.

Betel quid chewing leads to the development of unique de novo malignancies in liver transplant recipients, a retrospective single center study in Taiwan.

PubMed

Chen, Yi-Chan; Cheng, Chih-Hsien; Wang, Yu-Chao; Wu, Ting-Jun; Chou, Hong-Shiue; Chan, Kun-Ming; Lee, Wei-Chen; Lee, Chen-Fang; Soong, Ruey Shyang

2016-09-01

Orthotopic liver transplantation (OLT) is the choice of treatment not only for end-stage liver disease and acute liver failure but also for hepatocellular carcinoma (HCC). The development of de novo malignancies after liver transplantation plays an important role in late mortality; the incidence of late mortality has increased owing to improved survival. The incidence of de novo malignancies is 2.3% to 25%, which is 2 to 3 times that of malignancies in the general population. The most commonly reported de novo malignancies in solid organs are skin cancer, Karposi sarcoma, and colon cancer according to the frequency of exposure to a specific carcinogen. We hypothesized that exposure to different carcinogens would change the distribution of de novo malignancies among patients after OLT. In Taiwan, 10% of the population is exposed to a unique carcinogen, the betel quid, which is associated with a high incidence of head and neck cancer (HNC) among the Taiwanese population.From 2004 to 2014, we retrospectively reviewed 484 cases post-OLT at our institution and 16 patients with 17 de novo malignancies were identified. Most of the patients had HNC, which is in contrast to previous literature reports.Univariate and multivariate analyses identified betel quid chewing as the main leading factor for HNC in the Taiwanese population.Routine screening of the oral mucosa in patients with the habit of betel quid chewing is recommended in Taiwan for the early detection of HNC. Routine screening with aggressive treatment after diagnosis of HNC in patients with the habit of chewing betel quid, who underwent OLT, resulted in good patient prognosis.

Outcomes of Surgery for Stress Urinary Incontinence in the Older Woman

PubMed Central

Ellington, David R.; Erekson, Elisabeth A.; Richter, Holly E.

2015-01-01

Synopsis As population demographics continue to evolve, specifics on age-related outcomes of stress urinary incontinence interventions will be critical to patient counseling and management planning. Understanding medical factors unique to older woman and their lower urinary tract condition will allow caregivers to optimize surgical outcomes, both physical and functional, and minimize complications within this population. PMID:26476111

Heart failure in patients with kidney disease.

PubMed

Tuegel, Courtney; Bansal, Nisha

2017-12-01

Heart failure (HF) is a leading cause of morbidity and mortality in patients with chronic kidney disease (CKD), and the population of CKD patients with concurrent HF continues to grow. The accurate diagnosis of HF is challenging in patients with CKD in part due to a lack of validated imaging and biomarkers specifically in this population. The pathophysiology between the heart and the kidneys is complex and bidirectional. Patients with CKD have greater prevalence of traditional HF risk factors as well as unique kidney-specific risk factors including malnutrition, acid-base alterations, uraemic toxins, bone mineral changes, anemia and myocardial stunning. These risk factors also contribute to the decline of kidney function seen in patients with subclinical and clinical HF. More targeted HF therapies may improve outcomes in patients with kidney disease as current HF therapies are underutilised in this population. Further work is also needed to develop novel HF therapies for the CKD population. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Dermatological diseases in patients with chronic kidney disease.

PubMed

Gagnon1, Amy L; Desai, Tejas

2013-04-01

There are a variety of dermatological diseases that are more commonly seen in patients with chronic kidney disease (CKD) and renal transplants than the general population. Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science has been searched. Some cutaneous diseases are clearly unique to this population. Of them, Lindsay's Nails, xerosis cutis, dryness of the skin, nephrogenic systemic fibrosis and acquired perforating dermatosis have been described in chronic kidney disease patients. The most common malignancy found in all transplant recipients is non-melanoma skin cancer. It is important for patients and physicians to recognize the manifestations of skin disease in patients suffering from chronic kidney disease to mitigate the morbidity associated with these conditions.

Assessing the ability of comorbidity indexes to capture comorbid disease in the inpatient rehabilitation burn injury population.

PubMed

Slocum, Chloe S; Goldstein, Richard; DiVita, Margaret A; Mix, Jacqueline; Niewczyk, Paulette; Gerrard, Paul; Sheridan, Robert; Kowalske, Karen J; Zafonte, Ross; Ryan, Colleen M; Schneider, Jeffrey C

2015-05-01

Burn patients exhibit comorbidities that influence outcomes. This study examines whether existing comorbidity measures capture comorbidities in the burn inpatient rehabilitation population. Data were obtained from the Uniform Data System for Medical Rehabilitation from 2002 to 2011 for adults with burn injury. International Classification of Diseases, 9th Revision, codes were used to assess three comorbidity measures (Charlson Comorbidity Index, Elixhauser Comorbidity Index, Centers for Medicare and Medicaid Services Comorbidity Tiers). The number of subjects and unique comorbidity codes (>1% of frequency) captured by each comorbidity measure was calculated. The study included 5347 patients with a median total body surface area burn decile of 20%-29%, mean age of 51.6 yrs, and mean number of comorbidities of 7.6. There were 2809 unique International Classification of Diseases, 9th Revision, comorbidity codes. The Charlson Comorbidity Index, Elixhauser Comorbidity Index, and Centers for Medicare and Medicaid Services Comorbidity Tiers did not capture 67%, 27%, and 58% of the subjects, respectively. There were 107 unique comorbidities that occurred with a frequency of greater than 1%. Of these, 67% were not captured in all three comorbidity measures. Commonly used comorbidity indexes do not reflect the extent of comorbid disease in the burn rehabilitation population. Future work is needed to assess the need for comorbidity indexes specific to the inpatient rehabilitation setting.

Interventions for Detrusor Overactivity: The Case for Multimodal Therapy

PubMed Central

Dmochowski, Roger

2002-01-01

Viable therapeutic alternatives for the management of overactive bladder (OAB) have recently evolved that provide satisfactory symptomatic control for the majority of patients. However, the presupposition that interventions exist as stand-alone entities is not representative of experience in unique populations with the therapeutic benefit of combination therapy, using components drawn from behavioral, physiotherapeutic, neuromodulatory, and, if necessary, surgical alternatives. Even in populations relatively refractory to therapy, the use of multimodal therapy yields additive benefits for patients with OAB symptoms. Herein is detailed the evidence supporting the concept that multimodal therapy provides optimal benefit to patients suffering from this symptom complex. PMID:16986017

Economic Evaluation of Quality Improvement Interventions Designed to Prevent Hospital Readmission: A Systematic Review and Meta-analysis.

PubMed

Nuckols, Teryl K; Keeler, Emmett; Morton, Sally; Anderson, Laura; Doyle, Brian J; Pevnick, Joshua; Booth, Marika; Shanman, Roberta; Arifkhanova, Aziza; Shekelle, Paul

2017-07-01

Quality improvement (QI) interventions can reduce hospital readmission, but little is known about their economic value. To systematically review economic evaluations of QI interventions designed to reduce readmissions. Databases searched included PubMed, Econlit, the Centre for Reviews & Dissemination Economic Evaluations, New York Academy of Medicine's Grey Literature Report, and Worldcat (January 2004 to July 2016). Dual reviewers selected English-language studies from high-income countries that evaluated organizational or structural changes to reduce hospital readmission, and that reported program and readmission-related costs. Dual reviewers extracted intervention characteristics, study design, clinical effectiveness, study quality, economic perspective, and costs. We calculated the risk difference and net costs to the health system in 2015 US dollars. Weighted least-squares regression analyses tested predictors of the risk difference and net costs. Main outcomes measures included the risk difference in readmission rates and incremental net cost. This systematic review and data analysis is reported in accordance with Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines. Of 5205 articles, 50 unique studies were eligible, including 25 studies in populations limited to heart failure (HF) that included 5768 patients, 21 in general populations that included 10 445 patients, and 4 in unique populations. Fifteen studies lasted up to 30 days while most others lasted 6 to 24 months. Based on regression analyses, readmissions declined by an average of 12.1% among patients with HF (95% CI, 8.3%-15.9%; P < .001; based on 22 studies with complete data) and by 6.3% among general populations (95% CI, 4.0%-8.7%; P < .001; 18 studies). The mean net savings to the health system per patient was $972 among patients with HF (95% CI, -$642 to $2586; P = .23; 24 studies), and the mean net loss was $169 among general populations (95% CI, -$2610 to $2949; P = .90; 21 studies), reflecting nonsignificant differences. Among general populations, interventions that engaged patients and caregivers were associated with greater net savings ($1714 vs -$6568; P = .006). Multicomponent QI interventions can be effective at reducing readmissions relative to the status quo, but net costs vary. Interventions that engage general populations of patients and their caregivers may offer greater value to the health system, but the implications for patients and caregivers are unknown.

Medical tourism in India.

PubMed

Gupta, Vijay; Das, Poonam

2012-06-01

The term 'medical tourism' is under debate because health care is a serious business and rarely do patients combine the two. India is uniquely placed by virtue of its skilled manpower, common language, diverse medical conditions that doctors deal with, the volume of patients, and a large nonresident Indian population overseas. Medical tourism requires dedicated services to alleviate the anxiety of foreign patients. These include translation, currency conversion, travel, visa, posttreatment care system,and accommodation of patient relatives during and after treatment.

Mercy health promoters: a paradigm for implementing third world practices for resource-poor conditions of the developed world.

PubMed

Clark, Peter A; Surry, Luke

2007-03-01

The foreign-born population in the United States, according to the "Current Populations Report" published in 2004, is estimated to exceed 33.5 million, or "11.7 percent of the U.S. population". The increase in foreign-born peoples and their need for health care is a complicated issue facing many cities, health systems and hospitals. Over the course of the past few years Mercy Hospital of Philadelphia has treated increasing numbers of foreign-born African patients. The majority have been presenting in the late stages of disease. The increase of foreign-born documented and undocumented African patients seen by Mercy Hospital seems to reflect a foreign-born population "boom" in Philadelphia over the past decade. To meet the needs of this growing population, the Mercy Hospital Task Force on African Immigration designed a program that centers on the developing world concept of "Health Promoters". This program is intended to serve as one possible solution for hospitals to cost-effectively manage the care of this growing percentage of foreign-born individuals in the population. This notion of a "Health Promoter" program in Philadelphia is unique as one of those rare occasions when a developing world concept is being utilized in a developed world environment. It is also unique in that it can serve as a paradigm for other hospitals in the United States to meet the growing need of health care for the undocumented population.

The use of focus groups in the development of the PROMIS Pediatrics Item Bank

PubMed Central

Walsh, Tasanee R.; Irwin, Debra E.; Meier, Andrea; Varni, James W.; DeWalt, Darren A.

2008-01-01

Objective To understand differences in perceptions of patient reported outcome domains between children with asthma and children from the general population. We used this information in the development of patient-reported outcome items for the Patient Reported Outcomes Measurement Information System Pediatrics project. Methods We conducted focus groups composed of ethnically, racially, and geographically diverse youth (8-12, 13-17 years) from the general population and youth with asthma. We performed content analysis to identify important themes. Results We identified five unique and different challenges that may confront youth with asthma as compared to general population youth: 1) They experience more difficulties when participating in physical activities; 2) They may experience anxiety about having an asthma attack at anytime and anywhere; 3) They may experience sleep disturbances and fatigue secondary to their asthma symptoms; 4) Their health condition has a greater effect on their emotional well-being and interpersonal relationships; and 5) Youth with asthma report that asthma often leaves them with insufficient energy to complete their school activities, especially physical activities. Conclusions The results confirm unique experiences for children with asthma across a broad range of health domains and enhance the breadth of all domains when creating an item bank. PMID:18427951

Patients with knee osteoarthritis demonstrate improved gait pattern and reduced pain following a non-invasive biomechanical therapy: a prospective multi-centre study on Singaporean population.

PubMed

Elbaz, Avi; Mor, Amit; Segal, Ganit; Aloni, Yoav; Teo, Yee Hong; Teo, Yee Sze; Das-De, Shamal; Yeo, Seng Jin

2014-01-02

Previous studies have shown the effect of a unique therapy with a non-invasive biomechanical foot-worn device (AposTherapy) on Caucasian western population suffering from knee osteoarthritis. The purpose of the current study was to evaluate the effect of this therapy on the level of symptoms and gait patterns in a multi-ethnic Singaporean population suffering from knee osteoarthritis. Fifty-eight patients with bilateral medial compartment knee osteoarthritis participated in the study. All patients underwent a computerized gait test and completed two self-assessment questionnaires (WOMAC and SF-36). The biomechanical device was calibrated to each patient, and therapy commenced. Changes in gait patterns and self-assessment questionnaires were reassessed after 3 and 6 months of therapy. A significant improvement was seen in all of the gait parameters following 6 months of therapy. Specifically, gait velocity increased by 15.9%, step length increased by 10.3%, stance phase decreased by 5.9% and single limb support phase increased by 2.7%. In addition, pain, stiffness and functional limitation significantly decreased by 68.3%, 66.7% and 75.6%, respectively. SF-36 physical score and mental score also increased significantly following 6 months of therapy (46.1% and 22.4%, respectively) (P < 0.05 for all parameters). Singaporean population with medial compartment knee osteoarthritis demonstrated improved gait patterns, reported alleviation in symptoms and improved function and quality of life following 6 months of therapy with a unique biomechanical device. Registration number NCT01562652.

Operative Treatment of Traumatic Hallux Valgus in Elite Athletes.

PubMed

Covell, D Jeff; Lareau, Craig R; Anderson, Robert B

2017-06-01

Traumatic hallux valgus is an increasingly common injury in the athletic population and represents a unique variant of turf toe. Failure to appropriately recognize and treat these injuries can lead to continued pain, decreased performance, progressive deformities, and ultimately degeneration of the hallux metatarsophalangeal joint. Limited literature currently exists to assist in the diagnosis, management, and operative treatment. Nineteen patients were reviewed in this series, including 12 National Football League, 6 college, and 1 high school player who was a college prospect. The average age for all patients at the time of surgery was 24.4 years (range, 19-33 years). Return to play and complications were evaluated. Overall, good operative results were obtained, with 74% of patients returning to their preinjury level of play at an average recovery time of 3.4 months. Traumatic hallux valgus is an increasingly common injury in the athletic population and represents a unique variant of turf toe. The impact of this injury cannot be overstated, as one-quarter of players were unable to return to play. Level IV, case series.

Informed consent for clinical trials of deep brain stimulation in psychiatric disease: challenges and implications for trial design.

PubMed

Lipsman, Nir; Giacobbe, Peter; Bernstein, Mark; Lozano, Andres M

2012-02-01

Advances in neuromodulation and an improved understanding of the anatomy and circuitry of psychopathology have led to a resurgence of interest in surgery for psychiatric disease. Clinical trials exploring deep brain stimulation (DBS), a focally targeted, adjustable and reversible form of neurosurgery, are being developed to address the use of this technology in highly selected patient populations. Psychiatric patients deemed eligible for surgical intervention, such as DBS, typically meet stringent inclusion criteria, including demonstrated severity, chronicity and a failure of conventional therapy. Although a humanitarian device exemption by the US Food and Drug Administration exists for its use in obsessive-compulsive disorder, DBS remains a largely experimental treatment in the psychiatric context, with its use currently limited to clinical trials and investigative studies. The combination of a patient population at the limits of conventional therapy and a novel technology in a new indication poses interesting challenges to the informed consent process as it relates to clinical trial enrollment. These challenges can be divided into those that relate to the patient, their disease and the technology, with each illustrating how traditional conceptualisations of research consent may be inadequate in the surgical psychiatry context. With specific reference to risk analysis, patient autonomy, voluntariness and the duty of the clinician-researcher, this paper will discuss the unique challenges that clinical trials of surgery for refractory psychiatric disease present to the consent process. Recommendations are also made for an ethical approach to clinical trial consent acquisition in this unique patient population.

Naming unique entities in the semantic variant of primary progressive aphasia and Alzheimer's disease: Towards a better understanding of the semantic impairment.

PubMed

Montembeault, M; Brambati, S M; Joubert, S; Boukadi, M; Chapleau, M; Laforce, R Jr; Wilson, M A; Macoir, J; Rouleau, I

2017-01-27

While the semantic variant of primary progressive aphasia (svPPA) is characterized by a predominant semantic memory impairment, episodic memory impairments are the clinical hallmark of Alzheimer's disease (AD). However, AD patients also present with semantic deficits, which are more severe for semantically unique entities (e.g. a famous person) than for common concepts (e.g. a beaver). Previous studies in these patient populations have largely focused on famous-person naming. Therefore, we aimed to evaluate if these impairments also extend to other semantically unique entities such as famous places and famous logos. In this study, 13 AD patients, 9 svPPA patients, and 12 cognitively unimpaired elderly subjects (CTRL) were tested with a picture-naming test of non-unique entities (Boston Naming Test) and three experimental tests of semantically unique entities assessing naming of famous persons, places, and logos. Both clinical groups were overall more impaired at naming semantically unique entities than non-unique entities. Naming impairments in AD and svPPA extended to the other types of semantically unique entities, since a CTRL>AD>svPPA pattern was found on the performance of all naming tests. Naming famous places and famous persons appeared to be most impaired in svPPA, and both specific and general semantic knowledge for these entities were affected in these patients. Although AD patients were most significantly impaired on famous-person naming, only their specific semantic knowledge was impaired, while general knowledge was preserved. Post-hoc neuroimaging analyses also showed that famous-person naming impairments in AD correlated with atrophy in the temporo-parietal junction, a region functionally associated with lexical access. In line with previous studies, svPPA patients' impairment in both naming and semantic knowledge suggest a more profound semantic impairment, while naming impairments in AD may arise to a greater extent from impaired lexical access, even though semantic impairment for specific knowledge is also present. These results highlight the critical importance of developing and using a variety of semantically-unique-entity naming tests in neuropsychological assessments of patients with neurodegenerative diseases, which may unveil different patterns of lexical-semantic deficits. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fillers in the skin of color population.

PubMed

Heath, Candrice R; Taylor, Susan C

2011-05-01

The skin of color population in the United States is rapidly growing and the cosmetic industry is responding to the demand for skin of color targeted treatments. The aging face in skin of color patients has a unique pattern that can be successfully augmented by dermal fillers. Though many subjects with skin of color were not included in the pre-market dermal filler clinical trials, some post-market studies have examined the safety and risks of adverse events in this population. The safety data from a selection of these studies was examined. Though pigmentary changes occurred, there have been no reports of keloid development. Developing a patient-specific care plan and instituting close follow up is emphasized.

Decontamination of the pediatric patient.

PubMed

Zhao, Xian; Dughly, Omar; Simpson, Joelle

2016-06-01

This article will review current guidelines for decontamination procedures for chemical, biological, and radiologic exposures with a focus on pediatric specific considerations. There has been a global increase in terrorist incidents that expose large populations to toxic agents associated with significant morbidity and mortality. The pathophysiology, treatment, and management of these toxic exposures may be unfamiliar to the healthcare provider. Additionally, children are particularly vulnerable to terrorist threats as they have unique anatomical, physiological, psychological, and developmental characteristics distinct from the adult population. Because pediatric patients are at greater risk than the general population, providers should be prepared to deliver age-appropriate care. Additionally, the ideal decontamination protocol is designed to maintain family units to maximize efficiency and minimize psychological trauma.

Patient-centered medical homes for patients with disabilities.

PubMed

Hernandez, Brigida; Damiani, Marco; Wang, T Arthur; Driscoll, Carolyn; Dellabella, Peter; LePera, Nicole; Mentari, Michael

2015-01-01

The patient-centered medical home is an innovative approach to improve health care outcomes. To address the unique needs of patients with intellectual and developmental disabilities (IDDs), a large health care provider reevaluated the National Committee for Quality Assurance's 6 medical home standards: (a) enhance access and continuity, (b) identify and manage patient populations, (c) plan and manage care, (d) provide self-care and community support, (e) track and coordinate care, and (f) measure and improve performance. This article describes issues to consider when serving patients with IDDs.

Dignity and Distress towards the End of Life across Four Non-Cancer Populations

PubMed Central

Chochinov, Harvey Max

2016-01-01

Objective The purpose of this study was to identify four non-cancer populations that might benefit from a palliative approach; and describe and compare the prevalence and patterns of dignity related distress across these diverse clinical populations. Design A prospective, multi-site approach was used. Setting Outpatient clinics, inpatient facilities or personal care homes, located in Winnipeg, Manitoba and Edmonton, Alberta, Canada. Participants Patients with advanced Amyotrophic Lateral Sclerosis (ALS), Chronic Obstructive Pulmonary Disease (COPD), End Stage Renal Disease (ESRD); and the institutionalized alert frail elderly. Main Outcome Measure In addition to standardized measures of physical, psychological and spiritual aspects of patient experience, the Patient Dignity Inventory (PDI). Results Between February 2009 and December 2012, 404 participants were recruited (ALS, 101; COPD, 100; ESRD, 101; and frail elderly, 102). Depending on group designation, 35% to 58% died within one year of taking part in the study. While moderate to severe loss of sense of dignity did not differ significantly across the four study populations (4–11%), the number of PDI items reported as problematic was significantly different i.e. ALS 6.2 (5.2), COPD 5.6 (5.9), frail elderly 3.0 (4.4) and ESRD 2.3 (3.9) [p < .0001]. Each of the study populations also revealed unique and distinct patterns of physical, psychological and existential distress. Conclusion People with ALS, COPD, ESRD and the frail elderly face unique challenges as they move towards the end of life. Knowing the intricacies of distress and how they differ across these groups broadens our understanding of end-of-life experience within non-cancer populations and how best to meet their palliative care needs. PMID:26808530

Optimizing care for the obese patient in interventional radiology

PubMed Central

Aberle, Dwight; Charles, Hearns; Hodak, Steven; O’Neill, Daniel; Oklu, Rahmi; Deipolyi, Amy R.

2017-01-01

With the rising epidemic of obesity, interventional radiologists are treating increasing numbers of obese patients, as comorbidities associated with obesity preclude more invasive treatments. These patients are at heightened risk of vascular and oncologic disease, both of which often require interventional radiology care. Obese patients pose unique challenges in imaging, technical feasibility, and periprocedural monitoring. This review describes the technical and clinical challenges posed by this population, with proposed methods to mitigate these challenges and optimize care. PMID:28082253

Dermatological diseases in patients with chronic kidney disease

PubMed Central

Gagnon1, Amy L.; Desai, Tejas

2013-01-01

Context: There are a variety of dermatological diseases that are more commonly seen in patients with chronic kidney disease (CKD) and renal transplants than the general population. Evidence Acquisitions: Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science has been searched. Results: Some cutaneous diseases are clearly unique to this population. Of them, Lindsay’s Nails, xerosis cutis, dryness of the skin, nephrogenic systemic fibrosis and acquired perforating dermatosis have been described in chronic kidney disease patients. The most common malignancy found in all transplant recipients is non-melanoma skin cancer. Conclusions: It is important for patients and physicians to recognize the manifestations of skin disease in patients suffering from chronic kidney disease to mitigate the morbidity associated with these conditions. PMID:24475435

Aging in the United States: Opportunities and Challenges for Otolaryngology-Head and Neck Surgery.

PubMed

Chiu, Brandon L; Pinto, Jayant M

2018-05-17

The number of Americans over the age of 65 has been growing much faster than the overall population's growth rate. These changes can be largely attributed to the improvement in life expectancy. This demographic shift yields a unique and exciting opportunity to provide both expedient and cost-efficient care to a growing patient population. Copyright © 2018 Elsevier Inc. All rights reserved.

Impact of depression on the intensity of patient navigation for women with abnormal cancer screenings.

PubMed

De La Cruz, Ignacio I; Freund, Karen M; Battaglia, Tracy A; Chen, Clara A; Bak, Sharon; Kalish, Richard; Lottero, Barbara; Egan, Patrick; Heeren, Tim; Kronman, Andrea C

2014-02-01

Patient navigation is increasingly being used to support vulnerable patients to receive timely and quality medical care. We sought to understand whether patients with depression utilize additional patient navigation services after abnormal cancer screening. We compared depressed and non-depressed women using three different measures of intensity of patient navigation: number of patient-navigator encounters, encounter time, and number of unique barriers to care. The study population consisted of 1,455 women who received navigation after abnormal screening for breast or cervical cancer at one of six community health centers in Boston. Navigators spent a median of 60-75 minutes over one or two encounters per participant, with 49% of participants having one or more documented barrier to care. Depressed women did not differ in total numbers of encounters, encounter time, or unique barriers compared with non-depressed women. Our findings suggest that pre-existing depression does not predict which women will utilize additional navigation services.

A strong association between HLA-DR9 and gelatin allergy in the Japanese population.

PubMed

Kumagai, T; Yamanaka, T; Wataya, Y; Saito, A; Okui, T; Yano, S; Tsutsumi, H; Chiba, S; Wakisaka, A

2001-04-30

The frequency of HLA class I and II phenotypes was determined among 23 patients with positive gelatin IgE, eight of whom developed anaphylaxis, 18 patients who did not have gelatin IgE but who experienced non-immediate reactions after exposure to gelatin. HLA-DR9, which is unique to Orientals, was present in 56.5% of the gelatin IgE positive patients, as compared to control population frequency of 24% (P < 0.002). In the non-immediate reaction group, who did not generate IgE, phenotype distribution resembled controls. HLA-DR9 positive individuals have a relative risk of 4.1 for developing gelatin allergy with positive IgE.

Implementing a pediatric obesity care guideline in a freestanding children's hospital to improve child safety and hospital preparedness.

PubMed

Porter, Renee M; Thrasher, Jodi; Krebs, Nancy F

2012-12-01

Medical and surgical care of children with severe obesity is complicated and requires recognition of the problem, appropriate equipment, and safe management. There is little literature describing patient, provider, and institutional needs for the severely obese pediatric patient. Nonetheless, the limited data suggest 3 broad categories of needs unique to this population: (a) airway management, (b) drug dosing and pharmacology, and (c) equipment and infrastructure. We describe an opportunity at the Children's Hospital Colorado to better prepare and optimize care for this patient population by creation of a Pediatric Obesity Care Guideline that focused on key areas of quality and safety. Copyright © 2012 Elsevier Inc. All rights reserved.

A unique case of recurrent metachronous volvulus of the gastrointestinal tract.

PubMed

Avgerinos, Dimitrios V; Llaguna, Omar H; Friedman, Richard L

2009-12-01

Colonic volvulus is an uncommon disease that predisposes patients to bowel obstruction in both the adult and pediatric population. The international literature offers few reports of synchronous or metachronous volvulus of 2 organs of the gastrointestinal tract. We describe a unique case of a patient who presented with recurrent metachronous volvulus of the sigmoid colon, cecum, and stomach. The patient underwent multiple operations for bowel obstruction, lysis of adhesions, and colon resection. The interesting intraoperative findings were a very long mesentery and peritoneal attachments of the intraabdominal gastrointestinal organs that made the stomach and colon extremely mobile and thus susceptible to volvulus. Prophylactic pexis of the cecum and the stomach during the first operation, in light of the elongated mesentery, may have prevented the subsequent episodes of volvulus.

Lead Toxicity in the Pediatric Patient with Sickle Cell Disease: Unique Risks and Management.

PubMed

Jung, Josephine Misun; Peddinti, Radhika

2018-01-01

Lead toxicity is the result of lead ingestion, one of the most common ingestions in the pediatric population. Nationwide and statewide efforts to recognize and curtail this epidemic have led to declining rates of toxicity. In patients with sickle cell disease (SCD), lead toxicity can be an elusive diagnosis due to overlapping symptom profiles, and inconsistent follow-up with a primary care physician can make the diagnosis even more difficult. In this article, two illustrative cases of lead toxicity in patients with SCD are described. The discussion reviews the current risk factors, screening, and inpatient management of lead toxicity, as well as describing the unique and sometimes confounding presentations of lead toxicity versus sickle cell crisis. [Pediatr Ann. 2018;47(1):e36-e40.]. Copyright 2018, SLACK Incorporated.

Addressing the healthcare needs of older Lesbian, Gay, Bisexual, and Transgender patients in medical school curricula: a call to action.

PubMed

Cannon, Sophie M; Shukla, Vipul; Vanderbilt, Allison A

2017-01-01

Medical students matriculating in the coming years will be faced with treating an expansive increase in the population of older lesbian, gay, bisexual, and transgender (LGBT) patients. While these patients face healthcare concerns similar to their non-LGBT aging peers, the older LGBT community has distinct healthcare needs and faces well-documented healthcare disparities. In order to reduce these healthcare barriers, medical school curricula must prepare and educate future physicians to treat this population while providing high quality, culturally-competent care. This article addresses some of the unique healthcare needs of the aging LGBT population with an emphasis on social concerns and healthcare disparities. It provides additional curricular recommendations to aid in the progressive augmentation of medical school curricula. Liaison Committee on Medical Education (LCME); LGBT: Lesbian, gay, bisexual, transgender.

From Pulmonary Embolism to Inflammatory Bowel Disease; Give Tunnel Vision up.

PubMed

Tajdini, Masih; Hosseini, Seyed Mohammad Reza

2016-01-01

Inflammatory bowel disease (IBD) is a multisystem disorder with gastrointestinal tract involvement. These patients have the higher risk for thromboembolic events compared to normal population. This report describes a unique case of pulmonary embolism as a first manifestation of inflammatory bowel disease.

Acute free-floating carotid artery thrombus causing stroke in a young patient: unique etiology and management using endovascular approach.

PubMed

Tan, Ai Peng; Taneja, Manish; Seah, Boon Heng; Leong, Hoe Nam; Venketasubramanian, Narayanaswamy

2014-01-01

Atherosclerotic disease accounts for 20%-30% of strokes in the general population. In young adults, it is an unexpected event and its causes involve diverse pathologies. Herein, we describe a unique case of acute embolic stroke in a young adult patient due to the presence of a large clot in the right common and internal carotid arteries, as a result of an extrinsic cause. Surgical clot retrieval was considered unsafe at that point in time in view of the active inflammatory changes surrounding the affected vessels. This was eventually treated with a novel endovascular technique, a unique alternative to open surgery, with excellent clinical outcome. To our knowledge, the penumbra system has never been used for thrombus removal in a nonacute setting. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

External validation of a risk assessment model for venous thromboembolism in the hospitalised acutely-ill medical patient (VTE-VALOURR).

PubMed

Mahan, Charles E; Liu, Yang; Turpie, A Graham; Vu, Jennifer T; Heddle, Nancy; Cook, Richard J; Dairkee, Undaleeb; Spyropoulos, Alex C

2014-10-01

Venous thromboembolic (VTE) risk assessment remains an important issue in hospitalised, acutely-ill medical patients, and several VTE risk assessment models (RAM) have been proposed. The purpose of this large retrospective cohort study was to externally validate the IMPROVE RAM using a large database of three acute care hospitals. We studied 41,486 hospitalisations (28,744 unique patients) with 1,240 VTE hospitalisations (1,135 unique patients) in the VTE cohort and 40,246 VTE-free hospitalisations (27,609 unique patients) in the control cohort. After chart review, 139 unique VTE patients were identified and 278 randomly-selected matched patients in the control cohort. Seven independent VTE risk factors as part of the RAM in the derivation cohort were identified. In the validation cohort, the incidence of VTE was 0.20%; 95% confidence interval (CI) 0.18-0.22, 1.04%; 95%CI 0.88-1.25, and 4.15%; 95%CI 2.79-8.12 in the low, moderate, and high VTE risk groups, respectively, which compared to rates of 0.45%, 1.3%, and 4.74% in the three risk categories of the derivation cohort. For the derivation and validation cohorts, the total percentage of patients in low, moderate and high VTE risk occurred in 68.6% vs 63.3%, 24.8% vs 31.1%, and 6.5% vs 5.5%, respectively. Overall, the area under the receiver-operator characteristics curve for the validation cohort was 0.7731. In conclusion, the IMPROVE RAM can accurately identify medical patients at low, moderate, and high VTE risk. This will tailor future thromboprophylactic strategies in this population as well as identify particularly high VTE risk patients in whom multimodal or more intensive prophylaxis may be beneficial.

Identifying solutions to medication adherence in the visually impaired elderly.

PubMed

Smith, Miranda; Bailey, Trista

2014-02-01

Adults older than 65 years of age with vision impairment are more likely to have difficulty managing medications compared with people having normal vision. This patient population has difficulty reading medication information and may take the wrong medication or incorrect doses of medication, resulting in serious consequences, including overdose or inadequate treatment of health problems. Visually impaired patients report increased anxiety related to medication management and must rely on others to obtain necessary drug information. Pharmacists have a unique opportunity to pursue accurate medication adherence in this special population. This article reviews literature illustrating how severe medication mismanagement can occur in the visually impaired elderly and presents resources and solutions for pharmacists to take a larger role in adherence management in this population.

Association of Serum Triglyceride to HDL Cholesterol Ratio with All-Cause and Cardiovascular Mortality in Incident Hemodialysis Patients.

PubMed

Chang, Tae Ik; Streja, Elani; Soohoo, Melissa; Kim, Tae Woo; Rhee, Connie M; Kovesdy, Csaba P; Kashyap, Moti L; Vaziri, Nosratola D; Kalantar-Zadeh, Kamyar; Moradi, Hamid

2017-04-03

Elevated serum triglyceride/HDL cholesterol (TG/HDL-C) ratio has been identified as a risk factor for cardiovascular (CV) disease and mortality in the general population. However, the association of this important clinical index with mortality has not been fully evaluated in patients with ESRD on maintenance hemodialysis (MHD). We hypothesized that the association of serum TG/HDL-C ratio with all-cause and CV mortality in patients with ESRD on MHD is different from the general population. We studied the association of serum TG/HDL-C ratio with all-cause and CV mortality in a nationally representative cohort of 50,673 patients on incident hemodialysis between January 1, 2007 and December 31, 2011. Association of baseline and time-varying TG/HDL-C ratios with mortality was assessed using Cox proportional hazard regression models, with adjustment for multiple variables, including statin therapy. During the median follow-up of 19 months (interquartile range, 11-32 months), 12,778 all-cause deaths and 4541 CV deaths occurred, respectively. We found that the 10th decile group (reference: sixth deciles of TG/HDL-C ratios) had significantly lower risk of all-cause mortality (hazard ratio, 0.91 [95% confidence interval, 0.83 to 0.99] in baseline and 0.86 [95% confidence interval, 0.79 to 0.94] in time-varying models) and CV mortality (hazard ratio, 0.83 [95% confidence interval, 0.72 to 0.96] in baseline and 0.77 [95% confidence interval, 0.66 to 0.90] in time-varying models). These associations remained consistent and significant across various subgroups. Contrary to the general population, elevated TG/HDL-C ratio was associated with better CV and overall survival in patients on hemodialysis. Our findings provide further support that the nature of CV disease and mortality in patients with ESRD is unique and distinct from other patient populations. Hence, it is vital that future studies focus on identifying risk factors unique to patients on MHD and decipher the underlying mechanisms responsible for poor outcomes in patients with ESRD. Copyright © 2017 by the American Society of Nephrology.

Association of Serum Triglyceride to HDL Cholesterol Ratio with All-Cause and Cardiovascular Mortality in Incident Hemodialysis Patients

PubMed Central

Chang, Tae Ik; Streja, Elani; Soohoo, Melissa; Kim, Tae Woo; Rhee, Connie M.; Kovesdy, Csaba P.; Kashyap, Moti L.; Vaziri, Nosratola D.; Kalantar-Zadeh, Kamyar

2017-01-01

Background and objectives Elevated serum triglyceride/HDL cholesterol (TG/HDL-C) ratio has been identified as a risk factor for cardiovascular (CV) disease and mortality in the general population. However, the association of this important clinical index with mortality has not been fully evaluated in patients with ESRD on maintenance hemodialysis (MHD). We hypothesized that the association of serum TG/HDL-C ratio with all-cause and CV mortality in patients with ESRD on MHD is different from the general population. Design, setting, participants, & measurements We studied the association of serum TG/HDL-C ratio with all-cause and CV mortality in a nationally representative cohort of 50,673 patients on incident hemodialysis between January 1, 2007 and December 31, 2011. Association of baseline and time-varying TG/HDL-C ratios with mortality was assessed using Cox proportional hazard regression models, with adjustment for multiple variables, including statin therapy. Results During the median follow-up of 19 months (interquartile range, 11–32 months), 12,778 all-cause deaths and 4541 CV deaths occurred, respectively. We found that the 10th decile group (reference: sixth deciles of TG/HDL-C ratios) had significantly lower risk of all-cause mortality (hazard ratio, 0.91 [95% confidence interval, 0.83 to 0.99] in baseline and 0.86 [95% confidence interval, 0.79 to 0.94] in time-varying models) and CV mortality (hazard ratio, 0.83 [95% confidence interval, 0.72 to 0.96] in baseline and 0.77 [95% confidence interval, 0.66 to 0.90] in time-varying models). These associations remained consistent and significant across various subgroups. Conclusions Contrary to the general population, elevated TG/HDL-C ratio was associated with better CV and overall survival in patients on hemodialysis. Our findings provide further support that the nature of CV disease and mortality in patients with ESRD is unique and distinct from other patient populations. Hence, it is vital that future studies focus on identifying risk factors unique to patients on MHD and decipher the underlying mechanisms responsible for poor outcomes in patients with ESRD. PMID:28193609

A Unique Cause of Intestinal and Splenic Infarction in a Sickle Cell Trait Patient

PubMed Central

Asfaw, Sofya H.; Falk, Gavin A.; Morris-Stiff, Gareth; Tuthill, Ralph J.; Moorman, Matthew L.; Samotowka, Michael A.

2013-01-01

Sickle-cell trait is a common genetic abnormality in the African American population. A sickle-cell crisis in a patient with sickle-cell trait is uncommon at best. Abdominal painful crises are typical of patients with sickle cell anemia. The treatment for an abdominal painful crisis is usually medical and rarely surgical. We present the case of a cocaine-induced sickle-cell crisis in a sickle-cell trait patient that resulted in splenic, intestinal, and cerebral infarctions and multisystem organ failure necessitating a splenectomy, subtotal colectomy, and small bowel resection. This case highlights the diagnostic dilemma that abdominal pain can present in the sickle-cell population and illustrates the importance of recognizing the potential for traditionally medically managed illnesses to become surgical emergencies. PMID:23738181

A unique cause of intestinal and splenic infarction in a sickle cell trait patient.

PubMed

Asfaw, Sofya H; Falk, Gavin A; Morris-Stiff, Gareth; Tuthill, Ralph J; Moorman, Matthew L; Samotowka, Michael A

2013-01-01

Sickle-cell trait is a common genetic abnormality in the African American population. A sickle-cell crisis in a patient with sickle-cell trait is uncommon at best. Abdominal painful crises are typical of patients with sickle cell anemia. The treatment for an abdominal painful crisis is usually medical and rarely surgical. We present the case of a cocaine-induced sickle-cell crisis in a sickle-cell trait patient that resulted in splenic, intestinal, and cerebral infarctions and multisystem organ failure necessitating a splenectomy, subtotal colectomy, and small bowel resection. This case highlights the diagnostic dilemma that abdominal pain can present in the sickle-cell population and illustrates the importance of recognizing the potential for traditionally medically managed illnesses to become surgical emergencies.

Total knee arthroplasty in a patient with diastrophic dwarfism.

PubMed

Crowley, Robin L; Haas, Richard E

2010-10-01

Diastrophic dwarfism is an autosomal recessive disease that predominantly occurs in the Finnish population (1 in 33,000) but has been known to occur worldwide. Affected patients present with multiple cartilaginous anomalies and early degeneration of weight-bearing joints. Once past infancy, life expectancy is favorable and patients may undergo multiple surgical procedures throughout their lifetime to repair .or replace affected joints. The characteristic short trunk of these patients in addition to scoliosis, cervical kyphosis, and involvement of articular cartilages can create unique ventilation and airway challenges for anesthesia providers involved in their care.

Clinical chronic rhinosinusitis outcomes in pediatric patients with cystic fibrosis

PubMed Central

2017-01-01

Objectives Chronic rhinosinusitis and nasal polyposis are common conditions in cystic fibrosis (CF). Approximately 2–3% of pediatric CF patients per year have sinus disease requiring surgery. It has been well established that there is a significant negative impact on quality of life associated with chronic rhinosinusitis (CRS) in the non‐CF patient population. However, the impact of CRS on the pediatric CF population remains uncertain. The purpose of this article is to review the current state of outcome measures for CRS in pediatric CF patients. Data Sources PubMed and EMBASE literature review Methods PubMed and EMBASE electronic databases were searched using Boolean searches that incorporated mesh headings and plain language for quality of life, symptom evaluation, pediatric patients, and sinusitis/rhinosinusitis. Studies were included if the study primarily evaluated a pediatric Cystic Fibrosis‐Chronic Rhinosinusitis (CF‐CRS) population and the primary outcome measure was quality of life evaluation. Results The search yielded 34 unique articles. A total of 7 articles met inclusion criteria Conclusions Despite the high frequency of chronic rhinosinusitis in the pediatric CF patient population, its impact on quality of life is not well understood. Currently there is a lack of a validated disease specific quality of life instruments available to assess the impact of CRS on the pediatric CF patient population. Level of Evidence 5. PMID:29094071

When symptoms don't fit: a case series of conversion disorder in the pediatric otolaryngology practice.

PubMed

Caulley, Lisa; Kohlert, Scott; Gandy, Hazen; Olds, Janet; Bromwich, Matthew

2018-05-29

Conversion disorder refers to functional bodily impairments that can be precipitated by high stress situations including trauma and surgery. Symptoms of conversion disorder may mimic or complicate otolaryngology diseases in the pediatric population. In this report, the authors describe 3 cases of conversion disorder that presented to a pediatric otolaryngology-head and neck surgery practice. This report highlights a unique population of patients who have not previously been investigated. The clinical presentation and management of these cases are discussed in detail. Non-organic otolaryngology symptoms of conversion disorder in the pediatric population are reviewed. In addition, we discuss the challenges faced by clinicians in appropriately identifying and treating these patients and present an approach to management of their care. In this report, the authors highlight the importance of considering psychogenic illnesses in patients with atypical clinical presentations of otolaryngology disorders.

Bladder cancer in patients with spinal cord injury.

PubMed

Hess, Marika J; Zhan, Ellen H; Foo, Dominic K; Yalla, Subbarao V

2003-01-01

The incidence of bladder cancer in spinal cord injury (SCI) is 16 to 28 times higher than that in the general population. The objective of this study was to investigate the characteristics of bladder cancer that are unique to the SCI population. Retrospective review. The charts of 16 patients diagnosed with bladder cancer from 1982 to 2001 were reviewed for type of cancer, exposure to risk factors, presenting symptoms, and survival time. The presenting manifestations were gross hematuria in 14 patients, papillary urethral growth in 1 patient, and acute obstructive renal failure in 1 patient. The diagnosis was made on initial cystoscopic evaluation in 16 patients; 3 patients required further evaluation. Eight of the 11 screening cytologies were suspicious for a malignancy prior to the diagnosis. Seven patients had transitional cell carcinoma, 6 patients had squamous cell carcinoma (SCCA), and 3 patients had both. The bladder wasmanaged with chronic indwelling catheter in 12 patients. Nine patients died of bladder cancer metastases and the remaining 3 patients died of other causes. Six patients survived 5 years or more; 4 were still alive at the completion of this study. Gross hematuria in individuals with SCI warrants aggressive assessment for bladder cancer. Chronic indwelling catheter, smoking, and renal and bladder stones are important risk factors for cancer. The incidence of SCCA in the SCI popullation is much higher than in the general population. Cystoscopic and cytologic evaluation in patients with advanced disease may fail to confirm the diagnosis in a high proportion of patients.

Unique challenges of hospice for patients with heart failure: A qualitative study of hospice clinicians.

PubMed

Lum, Hillary D; Jones, Jacqueline; Lahoff, Dana; Allen, Larry A; Bekelman, David B; Kutner, Jean S; Matlock, Daniel D

2015-09-01

Patients with heart failure have end-of-life care needs that may benefit from hospice care. The goal of this descriptive study was to understand hospice clinicians' perspectives on the unique aspects of caring for patients with heart failure to inform approaches to improving end-of-life care. This qualitative study explored experiences, observations, and perspectives of hospice clinicians regarding hospice care for patients with heart failure. Thirteen hospice clinicians from a variety of professional disciplines and clinical roles, diverse geographic regions, and varying lengths of time working in hospice participated in semistructured interviews. Through team-based, iterative qualitative analysis, we identified 3 major themes. Hospice clinicians identified 3 themes regarding care for patients with heart failure. First, care for patients with heart failure involves clinical complexity and a tailored approach to cardiac medications and advanced cardiac technologies. Second, hospice clinicians describe the difficulty patients with heart failure have in trusting hospice care due to patient optimism, prognostic uncertainty, and reliance on prehospice health care providers. Third, hospice clinicians described opportunities to improve heart failure-specific hospice care, highlighting the desire for collaboration with referring cardiologists. From a hospice clinician perspective, caring for patients with heart failure is unique compared with other hospice populations. This study suggests potential opportunities for hospice clinicians and referring providers who seek to collaborate to improve care for patients with heart failure during the transition to hospice care. Published by Elsevier Inc.

Inhaled Pulmonary Vasodilators: Are There Indications Within the Pediatric ICU?

PubMed

Kuch, Bradley A; Saville, Alvin L; Sanchez De Toledo, Joan; Venkataraman, Shekhar T

2017-06-01

Inhaled nitric oxide (INO) is only FDA-cleared for neonates (> 34 weeks gestation) with hypoxic respiratory failure-associated pulmonary hypertension. Off-label use of INO is common in the pediatric population despite a lack of evidence regarding survival benefit, questioning whether the therapy should be considered outside the neonatal period. A lack of definitive evidence combined with increasing health-care costs has led to the use of less costly inhaled prostacyclin as an alternative to INO, presenting unique patient safety concerns. We evaluate the current evidence and patient safety considerations regarding inhaled pulmonary vasodilators in the pediatric population. Copyright © 2017 by Daedalus Enterprises.

Mercy health promoter: A paradigm for just health care

PubMed Central

Clark, Peter A.; Schadt, Sam

2013-01-01

The foreign-born population in the United States, according to the “Current Populations Report” published in 2010, is estimated to exceed 39.9 million, or “12.9 percent of the U.S. population.” The increase in foreign-born peoples and their need for health care is a complicated issue facing many cities, health systems and hospitals. Over the course of the past few years Mercy Hospital of Philadelphia has treated increasing numbers of foreign-born African patients. The majority have been presenting in the late stages of disease. The increase of foreign-born documented and undocumented African patients seen by Mercy Hospitals seems to reflect a foreign-born population “boom” in Philadelphia over the past decade. To meet the needs of this growing population, the Mercy Hospital Task Force on African Immigration and the Institute of Catholic Bioethics at Saint Joseph’s University designed a program that centers on the third world concept of “Health Promoters.” This program is intended to serve as one possible solution for hospitals to cost-effectively manage the care of this growing percentage of foreign-born individuals in the population. This notion of a “Health Promoter” program in Philadelphia is unique as one of those rare occasions when a third world concept is being utilized in a first world environment. It is also unique in that it can serve as a paradigm for other hospitals in the United States to meet the growing need of health care for the undocumented population. As of November 2012 the Mercy Hospital of Philadelphia clinic became operative for patients who were referred from the Health Promoter clinics. To date, a total of forty-two patients have actively participated in the screenings, sixteen of which have been referred to Mercy Hospital of Philadelphia clinic for further evaluation. More than 75% of patient referrals were a result of high blood pressure. According to the American Medical Association, readings of 140–159 mmHg and above are indicative of stage 1 hypertension. Among those who presented at the Health Promoter screenings the mean systolic pressure for males was 140 mmHg and for females was 140.48 mmHg. PMID:24084364

Stakeholder assessment of comparative effectiveness research needs for Medicaid populations.

PubMed

Fischer, Michael A; Allen-Coleman, Cora; Farrell, Stephen F; Schneeweiss, Sebastian

2015-09-01

Patients, providers and policy-makers rely heavily on comparative effectiveness research (CER) when making complex, real-world medical decisions. In particular, Medicaid providers and policy-makers face unique challenges in decision-making because their program cares for traditionally underserved populations, especially children, pregnant women and people with mental illness. Because these patient populations have generally been underrepresented in research discussions, CER questions for these groups may be understudied. To address this problem, the Agency for Healthcare Research and Quality commissioned our team to work with Medicaid Medical Directors and other stakeholders to identify relevant CER questions. Through an iterative process of topic identification and refinement, we developed relevant, feasible and actionable questions based on issues affecting Medicaid programs nationwide. We describe challenges and limitations and provide recommendations for future stakeholder engagement.

Stakeholder assessment of comparative effectiveness research needs for Medicaid populations

PubMed Central

Fischer, Michael A; Allen-Coleman, Cora; Farrell, Stephen F; Schneeweiss, Sebastian

2015-01-01

Patients, providers and policy-makers rely heavily on comparative effectiveness research (CER) when making complex, real-world medical decisions. In particular, Medicaid providers and policy-makers face unique challenges in decision-making because their program cares for traditionally underserved populations, especially children, pregnant women and people with mental illness. Because these patient populations have generally been underrepresented in research discussions, CER questions for these groups may be understudied. To address this problem, the Agency for Healthcare Research and Quality commissioned our team to work with Medicaid Medical Directors and other stakeholders to identify relevant CER questions. Through an iterative process of topic identification and refinement, we developed relevant, feasible and actionable questions based on issues affecting Medicaid programs nationwide. We describe challenges and limitations and provide recommendations for future stakeholder engagement. PMID:26388438

Challenges in the Management of Geriatric Trauma: A Case Report.

PubMed

Gaebel, Ashley; Keiser, Megan

This article describes geriatric trauma and commonly associated difficulties emphasizing both the epidemiology and assessment of geriatric trauma. There is little data guiding decisions for trauma patients 65 years or older, as there are many unique characteristics to the geriatric population, including comorbidities, medications, and the aging physiology. The geriatric population in the United States has been steadily climbing for the last 20 years and is projected to continue on this trend. Although each patient presents differently, there remains a need for the consistent utilization of standard guidelines to help dictate care for geriatric patients, particularly for patients not receiving care at a trauma center. This review uses a case study about an elderly woman with many comorbidities, followed by a comprehensive discussion of geriatric trauma and the challenges that result from a lack of guideline utilization to direct management.

Osteoporosis in older persons: current pharmacotherapy and future directions.

PubMed

Duque, Gustavo

2013-10-01

Osteopororic fractures are highly prevalent in older persons having catastrophic consequences in their quality of life and increasing disability and mortality in this population. The mechanisms of osteoporosis in older persons are unique in terms of cellular changes and response to osteoporosis treatment. Therefore, specifically targeted treatments are required in this particular population. This paper provides an overview on the particular mechanisms of osteoporosis in older persons and the current and future therapeutic strategies to improve bone mass and prevent fractures in this population. Osteoporosis in older persons (especially in the old-old) has a unique pathophysiology that predisposes them to fractures thus having catastrophic consequences. Identification of patients at risk followed by therapies targeted to their cellular changes is pivotal to close the care gap observed in osteoporosis, predominantly in the older population. The treatment of osteoporosis has evolved from daily to yearly dosing thus facilitating compliance and effectiveness. It is expected that future biologically targeted treatments will have a similar separate dosing regime with better anti-fracture efficacy and lower incidence of side effects.

Management of Herpes Simplex Virus Keratitis in the Pediatric Population.

PubMed

Vadoothker, Saujanya; Andrews, Laura; Jeng, Bennie H; Levin, Moran Roni

2018-05-14

Herpes simplex virus (HSV) keratitis is a highly prevalent and visually-disabling disease in both the pediatric and adult population. While many studies have investigated the treatment of HSV keratitis in adult patients, few have focused on managing this condition in children. Children are at particularly high risk for visual morbidity due to unique challenges in diagnosis and treatment, and the often more aggressive disease course that results in corneal scarring, and subsequently amblyopia. This review presents the pathogenesis and most current recommendations for the medical and surgical management of HSV keratitis in the pediatric population.

Creating LGBTQ-Inclusive Care and Work Environments.

PubMed

Jones-Schenk, Jan

2018-04-01

In considering the full depth of inclusion in care and work environments (and developing inclusive engagement skills for lesbian, gay, bisexual, transgender, queer or questioning [LGBTQ] patients and their families), professional development leaders must bring these discussions and shared learnings into the open. Understanding the LGBTQ population's unique needs is essential to providing personalized health care, and inclusive work environments help to foster more inclusive care for this population. J Contin Educ Nurs. 2018;49(4):151-153. Copyright 2018, SLACK Incorporated.

Systematic Review of Falls in Older Adults with Cancer

PubMed Central

Wildes, Tanya M; Dua, Priya; Fowler, Susan A.; Miller, J. Philip; Carpenter, Christopher R.; Avidan, Michael S.; Stark, Susan

2014-01-01

Objectives lder adults frequently experience falls, at great cost to themselves and society. Older adults with cancer may be at greater risk for falls and have unique risk factors. Materials and Methods We undertook a systematic review of the available medical literature to examine the current evidence regarding factors associated with falls in older adults with cancer. PubMed, Embase, CINAHL, CENTRAL, DARE, Cochrane Database of Systematic Reviews and clinical trials.gov were searched using standardized terms for concepts of oncology/cancer, people 60 and older, screening, falls and diagnosis. Eligible studies included cohort or case-control studies or clinical trials in which all patients, or a subgroup of patients, had a diagnosis of cancer and in which falls were either the primary or secondary outcome. Results We identified 31 studies that met our inclusion criteria. Several studies suggest that falls are more common in older adults with a diagnosis of cancer than those without. Among the 11 studies that explored factors associated with outpatient falls, some risk factors for falls established in the general population were also associated with falls in older adults with cancer, including dependence in activities of daily living and prior falls. Other factors associated with falls in a general population, such as age, polypharmacy and opioid use, were not predictive of falls among oncology populations. Falls among older adults with cancer in the inpatient setting were associated with established risk factors for falls in people without cancer, but also with factors unique to an oncology population, such as brain metastases. Conclusions Falls in older adults with cancer are more common than in the general population, and are associated with risk factors unique to people with cancer. Further study is needed to establish methods of screening older adults with cancer for fall risk and ultimately implement interventions to reduce their risk of falls. Identifying which older adults with cancer are at greater risk for falls is a requisite step to ultimately intervene and prevent falls in this vulnerable population. PMID:25454770

Commentary: Precision science and patient-centered care.

PubMed

Clancy, Carolyn M

2011-06-01

Patient-centered outcomes research (PCOR), also known as comparative effectiveness research, offers new opportunities and challenges for academic health centers (AHCs). The author of this commentary summarizes the contributions of some of the articles in this issue that focus on PCOR, and she emphasizes the unique features of this distinctive type of research, which are longitudinal patient follow-up, the inclusion of patient-reported outcomes, and the dynamic interaction among all stakeholders throughout all phases of research.The author advocates that researchers engaged in comparative effectiveness research make every effort, and explore innovative means, to accelerate the translation of their research findings into practice. The opportunities to close the gaps between what physicians and medical scientists do and what they know, to support clinicians and patients who are working together in order to rapidly identify the best option for a unique individual, and to lead the way in addressing barriers to achieving personalized, patient-centered care should engage key members of AHCs in comparative effectiveness research, so that these institutions become a vital link connecting biomedical innovation and its precision application in diverse communities and populations.

Understanding the autistic dental patient.

PubMed

Green, Danielle; Flanagan, Dennis

2008-01-01

Autism spectrum disorder (ASD) is one of many pervasive developmental disorders (PDD); others include Rett syndrome, childhood disintegrative disorder (also known as Heller's syndrome), pervasive developmental disorder not otherwise specified (PDD-NOS), and the higher functioning Asperger's syndrome. Because ASD is the most common of the developmental disabilities, it is not unusual for dentists to have ASD patients among their patient population. As the name indicates, ASD varies widely in its clinical manifestations; however, dentists are likely to encounter difficulties with communication and socialization. Although communication may be difficult, it is not impossible. A thorough understanding of this complex neurological disorder and displaying patience are vital for the dentist. This article seeks to familiarize readers with ASD characteristics and co-morbid conditions that may affect dental treatment and provide some management strategies for this unique population.

Familial aggregation of age-related macular degeneration in the Utah population.

PubMed

Luo, Ling; Harmon, Jennifer; Yang, Xian; Chen, Haoyu; Patel, Shrena; Mineau, Geraldine; Yang, Zhenglin; Constantine, Ryan; Buehler, Jeanette; Kaminoh, Yuuki; Ma, Xiang; Wong, Tien Y; Zhang, Maonian; Zhang, Kang

2008-02-01

We examined familial aggregation and risk of age-related macular degeneration in the Utah population using a population-based case-control study. Over one million unique patient records were searched within the University of Utah Health Sciences Center and the Utah Population Database (UPDB), identifying 4764 patients with AMD. Specialized kinship analysis software was used to test for familial aggregation of disease, estimate the magnitude of familial risks, and identify families at high risk for disease. The population-attributable risk (PAR) for AMD was calculated to be 0.34. Recurrence risks in relatives indicate increased relative risks in siblings (2.95), first cousins (1.29), second cousins (1.13), and parents (5.66) of affected cases. There were 16 extended large families with AMD identified for potential use in genetic studies. Each family had five or more living affected members. The familial aggregation of AMD shown in this study exemplifies the merit of the UPDB and supports recent research demonstrating significant genetic contribution to disease development and progression.

Globalization of pediatric transplantation: The risk of tuberculosis or not tuberculosis.

PubMed

McCulloch, Mignon; Lin, Philana Ling

2017-05-01

The risk of TB among pediatric SOT recipients increases as the globalization of medical care continues to broaden. Unlike adults, children and especially infants are more susceptible to TB as a complication after transplantation. Little data exist regarding the true incidence of TB and the optimal risk-based management of this very vulnerable population. Here, we highlight the theoretical and practical issues that complicate the management of these patients and pose some questions that should be addressed when managing these patients. More data are needed to provide optimal guidance of the best diagnostic and management practices to this unique population. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Obesity and heart failure with preserved ejection fraction: A growing problem.

PubMed

Prenner, Stuart B; Mather, Paul J

2017-12-14

Heart Failure with Preserved Ejection Fraction (HFpEF) is increasing in prevalence due to the aging of the United States population as well as the current obesity epidemic. While obesity is very common in patients with HFpEF, obesity may represent a specific phenotype of HFpEF characterized by unique hemodynamics and structural abnormalities. Obesity induces a systemic inflammatory response that may contribute to myocardial fibrosis and endothelial dysfunction. The most obese patients continue to be excluded from HFpEF clinical trials, and thus ongoing research is needed to determine the role of pharmacologic and interventional approaches in this growing population. Copyright © 2017 Elsevier Inc. All rights reserved.

A new perspective on nonprescription statins: an opportunity for patient education and involvement.

PubMed

Fuster, Valentin

2007-09-01

Education of the public and encouragement of patients' involvement in their own health care have been repeatedly proved effective means of increasing health awareness, promoting lifestyle modifications, and improving early disease detection in a variety of clinical scenarios. Despite substantial efforts from different public and private organizations to educate the population on cardiovascular risk, coronary heart disease remains the leading cause of death in the United States, and its prevalence continues to grow. Therefore, alternative approaches with the potential to elicit a meaningful impact in the community deserve consideration. A nonprescription statin program could provide consumers with a tool of proved benefit in cardiovascular risk prevention. The magnitude of the target population (millions of subjects with intermediate to high risk), as well as the safety and efficacy profile of lovastatin 20 mg, support the consideration of this drug for "over-the-counter" availability. Moreover, a nonprescription statin program could represent a unique opportunity not only to enhance patients' involvement in primary prevention but also to reinforce the education of the public and to encourage interaction with health care providers. The success of such a program will undoubtedly require precise labeling of the risks and benefits of the therapy, as well as active support and participation from major medical organizations. In conclusion, nonprescription statin availability, through enhanced unique patients' involvement, offers the potential for enormous public health benefit.

Population pharmacokinetics of recombinant coagulation factor VIII-SingleChain in patients with severe hemophilia A.

PubMed

Zhang, Y; Roberts, J; Tortorici, M; Veldman, A; St Ledger, K; Feussner, A; Sidhu, J

2017-06-01

Essentials rVIII-SingleChain is a unique recombinant factor VIII (FVIII) molecule. A population pharmacokinetic model was based on FVIII activity of severe hemophilia A patients. The model was used to simulate factor VIII activity-time profiles for various dosing scenarios. The model supports prolonged dosing of rVIII-SingleChain with intervals of up to twice per week. Background Single-chain recombinant coagulation factor VIII (rVIII-SingleChain) is a unique recombinant coagulation factor VIII molecule. Objectives To: (i) characterize the population pharmacokinetics (PK) of rVIII-SingleChain in patients with severe hemophilia A; (ii) identify correlates of variability in rVIII-SingleChain PK; and (iii) simulate various dosing scenarios of rVIII-SingleChain. Patients/Methods A population PK model was developed, based on FVIII activity levels of 130 patients with severe hemophilia A (n = 91 for ≥ 12-65 years; n = 39 for < 12 years) who had participated in a single-dose PK investigation with rVIII-SingleChain 50 IU kg -1 . PK sampling was performed for up to 96 h. Results A two-compartment population PK model with first-order elimination adequately described FVIII activity. Body weight and predose level of von Willebrand factor were significant covariates on clearance, and body weight was a significant covariate on the central distribution volume. Simulations using the model with various dosing scenarios estimated that > 85% and > 93% of patients were predicted to maintain FVIII activity level above 1 IU dL -1 , at all times with three-times-weekly dosing (given on days 0, 2, and 4.5) at the lowest (20 IU kg -1 ) and highest (50 IU kg -1 ) doses, respectively. For twice weekly dosing (days 0 and 3.5) of 50 IU kg -1 rVIII-SingleChain, 62-80% of patients across all ages were predicted to maintain a FVIII activity level above 1 IU dL -1 at day 7. Conclusions The population PK model adequately characterized rVIII-SingleChain PK, and the model can be utilized to simulate FVIII activity-time profiles for various dosing scenarios. © 2017 The Authors. Journal of Thrombosis and Haemostasis published by Wiley Periodicals, Inc. on behalf of International Society on Thrombosis and Haemostasis.

Three-dimensional analysis of the uniqueness of the anterior dentition in orthodontically treated patients and twins.

PubMed

Franco, A; Willems, G; Souza, P H C; Tanaka, O M; Coucke, W; Thevissen, P

2017-04-01

Dental uniqueness can be proven if no perfect match in pair-wise morphological comparisons of human dentitions is detected. Establishing these comparisons in a worldwide random population is practically unfeasible due to the need for a large and representative sample size. Sample stratification is an option to reduce sample size. The present study investigated the uniqueness of the human dentition in randomly selected subjects (Group 1), orthodontically treated patients (Group 2), twins (Group 3), and orthodontically treated twins (Group 4) in comparison with a threshold control sample of identical dentitions (Group 5). The samples consisted of digital cast files (DCF) obtained through extraoral 3D scanning. A total of 2.013 pair-wise morphological comparisons were performed (Group 1 n=110, Group 2 n=1.711, Group 3 n=172, Group 4 n=10, Group 5 n=10) with Geomagic Studio ® (3D Systems ® , Rock Hill, SC, USA) software package. Comparisons within groups were performed quantifying the morphological differences between DCF in Euclidean distances. Comparisons between groups were established applying One-way ANOVA. To ensure fair comparisons a post-hoc Power Analysis was performed. ROC analysis was applied to distinguish unique from non-unique dentures. Identical DCF were not detected within the experimental groups (from 1 to 4). The most similar DCF had Euclidian distance of 5.19mm in Group 1, 2.06mm in Group 2, 2.03mm in Group 3, and 1.88mm in Group 4. Groups 2 and 3 were statistically different from Group 5 (p<0.05). Statistically significant difference between Group 4 and 5 revealed to be possible including more pair-wise comparisons in both groups. The ROC analysis revealed sensitivity rate of 80% and specificity between 66.7% and 81.6%. Evidence to sustain the uniqueness of the human dentition in random and stratified populations was observed in the present study. Further studies testing the influence of the quantity of tooth material on morphological difference between dentitions and its impact on uniqueness remain necessary. Copyright © 2017 Elsevier B.V. All rights reserved.

"Rewarding and challenging at the same time": emergency medicine residents' experiences caring for patients who are homeless.

PubMed

Doran, Kelly M; Curry, Leslie A; Vashi, Anita A; Platis, Stephanie; Rowe, Michael; Gang, Maureen; Vaca, Federico E

2014-06-01

The objectives were to examine how emergency medicine (EM) residents learn to care for patients in the emergency department (ED) who are homeless and how providing care for patients who are homeless influences residents' education and professional development as emergency physicians. We conducted in-depth, one-on-one interviews with EM residents from two programs. A random sample of residents stratified by training year was selected from each site. Interviews were digitally recorded and professionally transcribed. A team of researchers with diverse content-relevant expertise reviewed transcripts independently and applied codes to text segments using a grounded theory approach. The team met regularly to reconcile differences in code interpretations. Data collection and analysis occurred iteratively, and interviews continued until theoretical saturation was achieved. Three recurring themes emerged from 23 resident interviews. First, residents learn unique aspects of EM by caring for patients who are homeless. This learning encompasses both specific knowledge and skills (e.g., disease processes infrequently seen in other populations) and professional development as an emergency physician (e.g., the core value of service in EM). Second, residents learn how to care for patients who are homeless through experience and informal teaching rather than through a formal curriculum. Residents noted little formal curricular time dedicated to homelessness and instead learned during clinical shifts through personal experience and by observing more senior physicians. One unique method of learning was through stories of "misses," in which patients who were homeless had bad outcomes. Third, caring for patients who are homeless affects residents emotionally in complex, multifaceted ways. Emotions were dominated by feelings of frustration. This frustration was often related to feelings of futility in truly helping homeless patients, particularly for patients who were frequent visitors to the ED and who had concomitant alcohol dependence. Caring for ED patients who are homeless is an important part of EM residency training. Our findings suggest the need for increased formal curricular time dedicated to the unique medical and social challenges inherent in treating patients who are homeless, as well as enhanced support and resources to improve the ability of residents to care for this vulnerable population. Future research is needed to determine if such interventions improve EM resident education and, ultimately, result in improved care for ED patients who are homeless. © 2014 by the Society for Academic Emergency Medicine.

Addressing Barriers to Shared Decision Making Among Latino LGBTQ Patients and Healthcare Providers in Clinical Settings.

PubMed

Baig, Arshiya A; Lopez, Fanny Y; DeMeester, Rachel H; Jia, Justin L; Peek, Monica E; Vela, Monica B

2016-10-01

Effective shared decision making (SDM) between patients and healthcare providers has been positively associated with health outcomes. However, little is known about the SDM process between Latino patients who identify as lesbian, gay, bisexual, transgender, or queer (LGBTQ), and their healthcare providers. Our review of the literature identified unique aspects of Latino LGBTQ persons' culture, health beliefs, and experiences that may affect their ability to engage in SDM with their healthcare providers. Further research needs to examine Latino LGBTQ patient-provider experiences with SDM and develop tools that can better facilitate SDM in this patient population.

Cancer and Scleroderma: A Paraneoplastic Disease with Implications for Malignancy Screening

PubMed Central

Shah, Ami A.; Rosen, Livia Casciola

2015-01-01

Purpose of review Recent data suggest a paraneoplastic mechanism of scleroderma pathogenesis in unique subsets of scleroderma patients. In this article, we review these data, explore potential links between cancer and scleroderma, and propose an approach to malignancy screening in scleroderma. Recent findings Emerging data have demonstrated that patients with scleroderma and RNA polymerase III autoantibodies have a significantly increased risk of cancer within a few years of scleroderma onset. Genetic alterations in the gene encoding RNA polymerase III (POLR3A) have been identified, and patients with somatic mutations in POLR3A have evidence of mutation specific T cell immune responses with generation of cross-reactive RNA polymerase III autoantibodies. These data strongly suggest that scleroderma is a by-product of anti-tumor immune responses in some patients. Additional epidemiologic data demonstrate that patients developing scleroderma at older ages may also have a short cancer-scleroderma interval, suggestive of paraneoplastic disease. Summary Scleroderma may be a paraneoplastic disease in unique patient subsets. Aggressive malignancy screening in these patients may aid in early cancer detection. Further study is required to determine whether cancer therapy could improve scleroderma outcomes in this patient population. PMID:26352736

Strategies for improved French-language health services: Perspectives of family physicians in northeastern Ontario.

PubMed

Gauthier, Alain P; Timony, Patrick E; Serresse, Suzanne; Goodale, Natalie; Prpic, Jason

2015-08-01

To identify strategies to improve the quality of health services for Francophone patients. A series of semistructured key informant interviews. Northeastern Ontario. Participants A total of 18 physicians were interviewed. Ten physicians were interviewed in French, 7 physicians were women, and 10 physicians were located in urban communities. Purposive and snowball sampling strategies were used to conduct a series of semistructured key informant interviews with family physicians practising in communities with a large Francophone population. Principles of grounded theory were applied, guided by a framework for patient-professional communication. Results were inductively derived following an iterative data collection–data analysis process and were analyzed using a detailed thematic approach. Respondents identified several strategies for providing high-quality French-language health services. Some were unique to non–French-speaking physicians (eg, using appropriate interpreter services), some were unique to French-speaking physicians (eg, using a flexible dialect), and some strategies were common to all physicians serving French populations (eg, hiring bilingual staff or having pamphlets and posters in both French and English). Physicians interviewed for this study provided high-quality health care by attributing substantial importance to effective communication. While linguistic patient-to-physician concordance is ideal, it might not always be possible. Thus, conscious efforts to attenuate communication barriers are necessary, and several effective strategies exist.

Sex Trafficking Assessment and Resources (STAR) for Pediatric Attendings in Rhode Island.

PubMed

Moore, Jessica L; Baird, Grayson; Goldberg, Amy P

2016-09-01

Domestic minor sex trafficking (DMST) victims have unique medical and mental health needs and present frequently for medical attention. Little is known about the reported training, screening, comfort and knowledge of DMST among pediatricians in Rhode Island who likely encounter these patient victims without knowing. An anonymous electronic survey sent to Rhode Island Hospital staff physicians from November 2014 through January 2015. Of the 109 participants, the majority reported no training, screened no patients for DMST in the past year, did not know any resources available and had limited knowledge and comfort with this pediatric patient population. Rhode Island pediatricians of various specialties do not feel adequately prepared to identify and respond to a DMST patient population. These findings inform the need for increased training and education on DMST in our medical community. [Full article available at http://rimed.org/rimedicaljournal-2016-09.asp, free with no login].

Using Meta-analyses for Comparative Effectiveness Research

PubMed Central

Ruppar, Todd M.; Phillips, Lorraine J.; Chase, Jo-Ana D.

2012-01-01

Comparative effectiveness research seeks to identify the most effective interventions for particular patient populations. Meta-analysis is an especially valuable form of comparative effectiveness research because it emphasizes the magnitude of intervention effects rather than relying on tests of statistical significance among primary studies. Overall effects can be calculated for diverse clinical and patient-centered variables to determine the outcome patterns. Moderator analyses compare intervention characteristics among primary studies by determining if effect sizes vary among studies with different intervention characteristics. Intervention effectiveness can be linked to patient characteristics to provide evidence for patient-centered care. Moderator analyses often answer questions never posed by primary studies because neither multiple intervention characteristics nor populations are compared in single primary studies. Thus meta-analyses provide unique contributions to knowledge. Although meta-analysis is a powerful comparative effectiveness strategy, methodological challenges and limitations in primary research must be acknowledged to interpret findings. PMID:22789450

Fertility Preservation in Pediatric and Adolescent Oncology Patients: The Decision-Making Process of Parents.

PubMed

Li, Nancy; Jayasinghe, Yasmin; Kemertzis, Matthew A; Moore, Paddy; Peate, Michelle

2017-06-01

Decisions surrounding fertility preservation (FP) in children, adolescents, and adults can be difficult due to the distress of a cancer diagnosis, time constraints for decision-making, and lack of efficacy data. This review examines the decision-making process of oncology patients and their parents (if patients are in the pediatric or adolescent population) to better understand experiences of decisional conflict and regret. Two electronic databases, Embase and Pubmed, were searched using the terms (Decision-making OR Conflict (Psychology) OR Decision regret) AND (Freezing OR Oocyte OR Ovarian tissue OR Semen preservation OR Fertility preservation OR Cryopreservation) AND (Neoplasms OR Cancer OR Chemotherapy OR Drug therapy OR Radiotherapy). Medical Subject Heading terms were utilized where possible. Included articles discussed FP decision-making from the patient's perspective. Thirty-five articles discussing FP decision-making were included (24 in the adult population, 11 in the pediatric and adolescent population). Key themes from these articles included the following: factors considered in FP decision-making, decision-making in established procedures and experimental procedures, decisional conflict and regret, the perceived importance of information, adolescent involvement in decision-making, and ethical considerations in the pediatric population. Unique ethical issues arise in the pediatric and adolescent population. Considering that the decision to pursue FP is known to be difficult in the adult population, decisional conflict and regret may be greater for parents who are making the decision for their child.

Vulnerable Population Challenges in the Transformation of Cancer Care.

PubMed

Meneses, Karen; Landier, Wendy; Dionne-Odom, J Nicholas

2016-05-01

To consider current trends and future strategies that will bring about change in cancer care delivery for vulnerable populations. Institute of Medicine reports, literature review, clinical practice observations and experiences. Vulnerable populations are older adults, both minorities and the underserved, children, and individuals at end of life. These groups pose unique challenges that require health system changes and innovative nursing models to assure access to patient-centered care in the future. In the future, attention to the needs of vulnerable populations, the growing aging cancer population and the improved outcomes in the pediatric and adolescent cancer population will all require new nursing services and models of care. System changes where nursing roles are critical to support the transition to earlier palliative care are projected. Copyright © 2016 Elsevier Inc. All rights reserved.

Living donor lobar lung transplantation: a longstanding concept being revisited with the same old NEMESIS.

PubMed

Hayes, Don; Baker, Peter B

2014-06-01

Living donor lobar lung transplantation (LDLLT) has been successfully used in select patient populations. A 29-year-old male, who underwent bilateral LDLLT 12 years earlier with allografts donated by father and paternal uncle, developed bronchiolitis obliterans syndrome at distinctly different rates. LDLLT can be done successfully with unique management issues.

Development of a Spanish language fertility educational brochure for pediatric oncology families.

PubMed

Murphy, D; Kashal, P; Quinn, G P; Sawczyn, K K; Termuhlen, A M

2014-08-01

Education materials detailing fertility preservation options geared towards pediatric oncology patients are inadequately available, particularly materials that are culturally tailored. An English language pediatric fertility preservation brochure was developed in 2011, and given the significance of family building among Hispanics, it is important to transcreate materials for these audiences using learner verification to explore the unique preferences of the population. Qualitative face-to-face interviews and focus groups. Spanish-speaking patients (n = 10), parents (n = 10), and healthcare providers (n = 5). Suggestions for revisions were tested with focus groups of the same population (N = 16). Design, readability, likelihood to read, and overall opinion. Feedback was organized into 2 distinct themes: design and reader action. Overall the majority of parents and patients wanted personal accounts of other patients who had undergone fertility preservation, as well as photos of actual patients. The medical terminology in the brochure was acceptable and understood by most. The majority of participants who preferred the design with vivid colors and patterns explained this was because that brochure also contained more relevant information; however, both brochures had identical information. Many participants explained they would be receptive to receiving the brochure and the reproductive health information should be reinforced throughout cancer care. A learner verification approach to create pediatric educational materials can judiciously identify unique preferences for information. These results will be utilized to educate Spanish-speaking pediatric oncology patients and their parents to improve decision-making processes regarding future parenthood. Copyright © 2014 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

Growth hormone receptor deficiency (Laron syndrome): clinical and genetic characteristics.

PubMed

Guevara-Aguirre, J; Rosenbloom, A L; Vaccarello, M A; Fielder, P J; de la Vega, A; Diamond, F B; Rosenfeld, R G

1991-01-01

Approximately 60 cases of GHRD (Laron syndrome) were reported before 1990 and half of these were from Israel. We have described 47 additional patients from an inbred population of South Ecuador and have emphasized certain clinical features including: markedly advanced osseous maturation for height age; normal body proportions in childhood but child-like proportions in adults; much greater deviation of stature than head size, giving an appearance of large cranium and small facies; underweight in childhood despite the appearance of obesity and true obesity in adulthood; blue scleras; and limited elbow extension. The Ecuadorean patients differed markedly and most importantly from the other large concentration, in Israel, by being of normal or superior intelligence, suggesting a unique linkage in the Ecuadorean population. The Ecuadorean population also differed in that those patients coming from Loja province had a markedly skewed sex ratio (19 females: 2 males), while those from El Oro province had a normal sex distribution (14 females: 12 males). The phenotypic similarity between the El Oro and Loja patients indicates that this abnormal sex distribution is not a direct result of the GHRD.

Young women with PD: a group work experience.

PubMed

Posen, J; Moore, O; Tassa, D S; Ginzburg, K; Drory, M; Giladi, N

2000-01-01

Parkinson's Disease (PD) prior to the age of 40 affects between 5-10% of the PD population. The psychosocial changes that patients with early PD encounter, may be more devastating and disabling than the actual motor disability. The paper describes a unique experience in groupwork with young female PD patients treated in the Movement Disorders Unit of the Tel Aviv Sourasky Medical Center. The paper focuses on the special issues which characterized this group's experience: stigma, body and sexual image, and personality traits.

The high frequency of juvenile Huntington's chorea in South Africa

PubMed Central

Hayden, M R; Macgregor, J M; Saffer, D S; Beighton, P H

1982-01-01

During a national investigation concerning all patients with Huntington's chorea in South Africa, 17 affected children, comprising 7·7% of the patients in the survey, were identified. Although the frequency of juvenile Huntington's chorea in the white community was equal to that reported from around the world, the frequency was much higher in the population of mixed ancestry. It is possible that this unique situation is related to the genetic constitution of this latter group. PMID:6210776

Improving population management through pharmacist-primary care integration: a pilot study.

PubMed

Kennedy, Amanda G; Chen, Harry; Corriveau, Michele; MacLean, Charles D

2015-02-01

Pharmacists have unique skills that may benefit primary care practices. The objective of this demonstration project was to determine the impact of integrating pharmacists into patient-centered medical homes, with a focus on population management. Pharmacists were partnered into 5 primary care practices in Vermont 1 day per week to provide direct patient care, population-based medication management, and prescriber education. The main measures included a description of drug therapy problems identified and cost avoidance models. The pharmacists identified 708 drug therapy problems through direct patient care (336/708; 47.5%), population-based strategies (276/708; 38.9%), and education (96/708; 13.6%). Common population-based strategies included adjusting doses and discontinuing unnecessary medications. Pharmacists' recommendations to correct drug therapy problems were accepted by prescribers 86% of the time, when data about acceptance were known. Of the 49 recommendations not accepted, 47/49 (96%) were population-based and 2/49 (4%) were related to direct patient care. The cost avoidance model suggests $2.11 in cost was avoided for every $1.00 spent on a pharmacist ($373,092/$176,690). There was clear value in integrating pharmacists into primary care teams. Their inclusion prevented adverse drug events, avoided costs, and improved patient outcomes. Primary care providers should consider pharmacists well suited to offer direct patient care, population-based management, and prescriber education to their practices. To be successful, pharmacists must have full permission to document findings in the primary care practices' electronic health records. Given that many pharmacist services do not involve billable activities, sustainability requires identifying alternative funding mechanisms that do not rely on a traditional fee-for-service approach.

Readability of online patient education materials from the AAOS web site.

PubMed

Sabharwal, Sanjeev; Badarudeen, Sameer; Unes Kunju, Shebna

2008-05-01

One of the goals of the American Academy of Orthopaedic Surgeons (AAOS) is to disseminate patient education materials that suit the readability skills of the patient population. According to standard guidelines from healthcare organizations, the readability of patient education materials should be no higher than the sixth-grade level. We hypothesized the readability level of patient education materials available on the AAOS Web site would be higher than the recommended grade level, regardless when the material was available online. Readability scores of all articles from the AAOS Internet-based patient information Web site, "Your Orthopaedic Connection," were determined using the Flesch-Kincaid grade formula. The mean Flesch-Kincaid grade level of the 426 unique articles was 10.43. Only 10 (2%) of the articles had the recommended readability level of sixth grade or lower. The readability of the articles did not change with time. Our findings suggest the majority of the patient education materials available on the AAOS Web site had readability scores that may be too difficult for comprehension by a substantial portion of the patient population.

Readability of Online Patient Education Materials From the AAOS Web Site

PubMed Central

Badarudeen, Sameer; Unes Kunju, Shebna

2008-01-01

One of the goals of the American Academy of Orthopaedic Surgeons (AAOS) is to disseminate patient education materials that suit the readability skills of the patient population. According to standard guidelines from healthcare organizations, the readability of patient education materials should be no higher than the sixth-grade level. We hypothesized the readability level of patient education materials available on the AAOS Web site would be higher than the recommended grade level, regardless when the material was available online. Readability scores of all articles from the AAOS Internet-based patient information Web site, “Your Orthopaedic Connection,” were determined using the Flesch-Kincaid grade formula. The mean Flesch-Kincaid grade level of the 426 unique articles was 10.43. Only 10 (2%) of the articles had the recommended readability level of sixth grade or lower. The readability of the articles did not change with time. Our findings suggest the majority of the patient education materials available on the AAOS Web site had readability scores that may be too difficult for comprehension by a substantial portion of the patient population. PMID:18324452

Unpaid hospital bills: evidence from Florida.

PubMed

Campbell, E S

1992-01-01

Most of what we know about the population generating uncompensated care is inferred from data on the uninsured population. The use of insurance status as an indicator for potential charity patients is justifiable considering the lack of alternative information. This study directly examines uncompensated hospital care using a unique data set generated from a special survey conducted in Florida. A selection model estimated using these data explains who is likely to default on their bill and what amount will be left unpaid. The results provide a clearer picture of the uncompensated hospital care problem.

Choosing Between MRI and CT Imaging in the Adult with Congenital Heart Disease.

PubMed

Bonnichsen, Crystal; Ammash, Naser

2016-05-01

Improvements in the outcomes of surgical and catheter-based interventions and medical therapy have led to a growing population of adult patients with congenital heart disease. Adult patients with previously undiagnosed congenital heart disease or those previously palliated or repaired may have challenging echocardiographic examinations. Understanding the distinct anatomic and hemodynamic features of the congenital anomaly and quantifying ventricular function and valvular dysfunction plays an important role in the management of these patients. Rapid advances in imaging technology with magnetic resonance imaging (MRI) and computed tomography angiography (CTA) allow for improved visualization of complex cardiac anatomy in the evaluation of this unique patient population. Although echocardiography remains the most widely used imaging tool to evaluate congenital heart disease, alternative and, at times, complimentary imaging modalities should be considered. When caring for adults with congenital heart disease, it is important to choose the proper imaging study that can answer the clinical question with the highest quality images, lowest risk to the patient, and in a cost-efficient manner.

Addressing Barriers to Shared Decision Making Among Latino LGBTQ Patients and Healthcare Providers in Clinical Settings

PubMed Central

Lopez, Fanny Y.; DeMeester, Rachel H.; Jia, Justin L.; Peek, Monica E.; Vela, Monica B.

2016-01-01

Abstract Effective shared decision making (SDM) between patients and healthcare providers has been positively associated with health outcomes. However, little is known about the SDM process between Latino patients who identify as lesbian, gay, bisexual, transgender, or queer (LGBTQ), and their healthcare providers. Our review of the literature identified unique aspects of Latino LGBTQ persons’ culture, health beliefs, and experiences that may affect their ability to engage in SDM with their healthcare providers. Further research needs to examine Latino LGBTQ patient–provider experiences with SDM and develop tools that can better facilitate SDM in this patient population. PMID:27617356

Resistance Patterns and Clinical Significance of Candida Colonization and Infection in Combat-Related Injured Patients From Iraq and Afghanistan

PubMed Central

Blyth, Dana M.; Mende, Katrin; Weintrob, Amy C.; Beckius, Miriam L.; Zera, Wendy C.; Bradley, William; Lu, Dan; Tribble, David R.; Murray, Clinton K.

2014-01-01

Background  Penetrating wounds with environmental contamination are associated with a range of infectious complications, including fungus. This is the first study to examine the epidemiology, resistance patterns, and outcomes of Candida infections and colonization in United States military patients injured in Iraq and Afghanistan. Methods  Clinical information associated with initial unique and serial Candida isolates collected from patients (June 2009–October 2013) through the Trauma Infectious Disease Outcomes Study (TIDOS) was evaluated. Susceptibilities were performed using Sensititre YeastOne (YO-9) plates and interpreted by Clinical Laboratory and Standards Institute (CLSI) and adjusted-European Committee on Antimicrobial Susceptibility Testing (EUCAST) criteria. Results  The analysis included 127 patients with 131 unique Candida isolates, of which 102 were Candida albicans and 29 non-albicans Candida spp. Overall, 99% of patients were male with a median age of 23 and an injury severity score of 22. Injuries were primarily due to blasts (77%) and sustained among personnel serving in Afghanistan (89%). There was a median of 7 days from injury to Candida isolation, and 74 isolates were associated with infection. In the multivariate analysis, non-albicans Candida spp were associated with prior antifungal exposure, blood isolates, and wound isolates (P < .01). Nonsusceptibility by CLSI and EUCAST criteria was associated with non-albicans Candida spp (P < .05). Patients with Candida isolation had a 7.1% mortality rate, compared with 1.4% from the overall TIDOS population. Conclusions  Candida isolation from patients with penetrating war injuries may identify a population at higher risk for death. Prospective studies are needed to determine whether targeted antifungals and surgical management will affect this mortality rate. PMID:25734177

The effect of behavioral intervention on the psychological distress of Holocaust survivors with cancer.

PubMed

Baider, L; Peretz, T; Kaplan De-Nour, A

1997-01-01

This study describes a particular psychological intervention offered to a unique self-selected population of cancer patients who, 50 years earlier, had experienced the extreme trauma of the Holocaust. A total of 45 patients in follow-up at the Outpatient Clinic of the Oncology Department at the Hadassah University Hospital were approached. Two self-reports were administered: the Brief Symptom Inventory to assess psychological distress, and the Impact of Events Scale to assess intrusion and avoidance. There was a significant decrease in distress by the specific short-term psychological intervention used in this traumatized population. However, 3 months later the improvement virtually disappeared. This study failed to demonstrate a long-lasting effect of behavioral intervention upon Holocaust survivors with cancer.

Community meetings on a military inpatient psychiatric unit: a question of balance.

PubMed

Lange, C L; Bradley, J C

2001-01-01

Community meetings are a mainstay of any inpatient psychiatric unit. Although they differ in frequency, attendance, leadership, and size, they all maintain a similar purpose of acculturating the members to the values of the ward and encouraging responsible behavior and effective communication. The military inpatient psychiatric unit is no different, although it does have several unique factors that affect the management of the community meeting. Specifically, these factors are the inherent military rank structure, which often conflicts with the rank of staff and other patients, the incorporation of a civilian population into a military culture, and a greater focus on patient transitions from military to civilian society. We describe and discuss the common variables of community meetings, elucidate how the military aspects affect the meeting, and offer potential suggestions for the management of this unique large dynamic group.

Urticaria Multiforme

PubMed Central

Bernardo, Sebastian G.; Kovalerchik, Olga; Ahmad, Moneeb

2013-01-01

Urticaria multiforme is a benign cutaneous hypersensitivity reaction seen in pediatric patients that is characterized by the acute and transient onset of blanchable, annular, polycyclic, erythematous wheals with dusky, ecchymotic centers in association with acral edema. It is most commonly misdiagnosed as erythema multiforme, a serum-sickness-like reaction, or urticarial vasculitis. Since these three diagnoses represent distinct clinical entities with unique prognoses and management strategies, it is important that physicians distinguish urticaria multiforme from its clinical mimics in order to optimize patient care. By performing a thorough history and physical examination, the astute clinician can make the correct diagnosis and develop an appropriate, effective treatment plan while avoiding unnecessary biopsies and laboratory evaluations. The authors report a case of urticaria multiforme in a four-year-old girl in order to emphasize the distinctive morphological manifestations of this rare, albeit unique, disease seen in the pediatric population. PMID:23556035

Pediatric facial fractures as a result of gunshot injuries: an examination of associated injuries and trends in management.

PubMed

Hoppe, Ian C; Kordahi, Anthony M; Paik, Angie M; Lee, Edward S; Granick, Mark S

2014-03-01

Facial fractures are relatively uncommon in the pediatric population, especially those inflicted as a result of interpersonal violence in the form of gunshot injuries. Few studies have examined the unique management of such high-energy injuries in the pediatric population. Oftentimes the resultant damage to soft tissue and bony structures is so great that it challenges the previously accepted standards in the management of pediatric facial fractures. This study will examine a level 1 trauma center's experience with these unique injuries. A retrospective review of all facial fractures occurring in a pediatric population (those 18 years of age or younger) as a result of gunshot wounds in a level 1 trauma center in an urban environment was performed for the years 2000 to 2012. Descriptive information was collected regarding each case as well as information regarding concomitant injuries, treatment modalities, and selected outcomes. During this time period, there were 3147 facial fractures treated at our institution, 353 of which were in pediatric patients. Of these, 17 were the results of gunshot wounds. Three patients were excluded due to insufficient data, leaving a total of 14 patients. The average age of patients was 16.5 (range 14-18); all patients were African-American males. The most common fracture was that of the mandible (n = 10), with 2 of those patients exhibiting panfacial fractures. The average Glasgow Coma Scale on admission was 13.5 (range 3-15). Six of the patients were intubated in the emergency department. The most common concomitant injury was a skull fracture (n = 3), followed by cervical spine fractures (n = 2) and intracranial hemorrhages (n = 2). All patients were admitted to the hospital for reasons other than fracture management. Seven patients ultimately went to the operating room for fracture management. The treatment modalities employed were conservative management with closed techniques (n = 11), rigid internal fixation (n = 2), and the use of an external fixator device (n = 1). Minimal to no soft-tissue debridement was performed in 10 of the 14 patients, 2 of which presented between 6 months and 10 years post-injury with soft-tissue complications related to retained material. The mean hospital length of stay was 8.2 days (range 1-18 days). One patient expired. Pediatric facial fractures as a result of gunshot wounds represent a unique and fortunately rare entity that presents a challenge to all disciplines involved in treatment. In our patients, there was a tendency towards conservative management, with only 3 patients undergoing some form of fixation and only 7 undergoing some form of operative debridement. Concomitant injuries and the high-energy nature of gunshot wounds often preclude traditional management with rigid fixation to ensure adequate bony healing. However, it is important to adequately debride devitalized soft tissue and remove all foreign material to avoid future soft tissue-related complications.

Genome-wide DNA methylation profile identified a unique set of differentially methylated immune genes in oral squamous cell carcinoma patients in India.

PubMed

Basu, Baidehi; Chakraborty, Joyeeta; Chandra, Aditi; Katarkar, Atul; Baldevbhai, Jadav Ritesh Kumar; Dhar Chowdhury, Debjit; Ray, Jay Gopal; Chaudhuri, Keya; Chatterjee, Raghunath

2017-01-01

Oral squamous cell carcinoma (OSCC) is one of the common malignancies in Southeast Asia. Epigenetic changes, mainly the altered DNA methylation, have been implicated in many cancers. Considering the varied environmental and genotoxic exposures among the Indian population, we conducted a genome-wide DNA methylation study on paired tumor and adjacent normal tissues of ten well-differentiated OSCC patients and validated in an additional 53 well-differentiated OSCC and adjacent normal samples. Genome-wide DNA methylation analysis identified several novel differentially methylated regions associated with OSCC. Hypermethylation is primarily enriched in the CpG-rich regions, while hypomethylation is mainly in the open sea. Distinct epigenetic drifts for hypo- and hypermethylation across CpG islands suggested independent mechanisms of hypo- and hypermethylation in OSCC development. Aberrant DNA methylation in the promoter regions are concomitant with gene expression. Hypomethylation of immune genes reflect the lymphocyte infiltration into the tumor microenvironment. Comparison of methylome data with 312 TCGA HNSCC samples identified a unique set of hypomethylated promoters among the OSCC patients in India. Pathway analysis of unique hypomethylated promoters indicated that the OSCC patients in India induce an anti-tumor T cell response, with mobilization of T lymphocytes in the neoplastic environment. Survival analysis of these epigenetically regulated immune genes suggested their prominent role in OSCC progression. Our study identified a unique set of hypomethylated regions, enriched in the promoters of immune response genes, and indicated the presence of a strong immune component in the tumor microenvironment. These methylation changes may serve as potential molecular markers to define risk and to monitor the prognosis of OSCC patients in India.

Uveal Melanoma Mimicking Advanced Coats' Disease in a Young Patient.

PubMed

Gupta, Naina; Terrell, William; Schoenfield, Lynn; Kirsch, Claudia; Cebulla, Colleen M

2016-04-01

To report a case and the unique histopathology of a necrotic uveal melanoma mimicking advanced Coats' disease in a young adult. A 26-year-old male presented with a blind, painful eye, total exudative retinal detachment, and bulbous aneurysms consistent with Coats' disease. No masses were visualized on ultrasound or CT scan, and the patient underwent enucleation of the eye. Histopathology of the involved eye confirmed a necrotic uveal melanoma with persistent spindle cells forming a collar around residual tumor vessels. Careful consideration is needed in approaching any patient with a blind, painful eye and opaque media, even in younger populations.

Social Media and the Adolescent and Young Adult (AYA) patient with Cancer

PubMed Central

Perales, Miguel-Angel; Drake, Emily K; Pemmaraju, Naveen; Wood, William A

2016-01-01

Over 70,000 adolescent and young adults aged 15 to 39 years (AYA) are diagnosed with cancer each year in the US. The National Cancer Institute (NCI) has identified AYA cancer patients as a unique population. The most common cancers in this age group include tumors typically seen in pediatric patients such as acute lymphoblastic leukemia (ALL) and brain tumors, as well as cancers more typically seen in adult patients such as breast cancer and melanoma. In addition, some cancers have their highest incidence in AYA patients, such as Hodgkin Lymphoma, testicular cancer and bone tumors. AYA patients face additional unique issues due to their age, not just questions about treatment choices due to lack of data, but also questions about fertility, relationships, loss of autonomy, and interruptions in school/work with potentially significant financial complications. This age group also has very high rates of social media usage with up to 90% of adults aged 18 to 29 using social networking sites. In this review, we will describe the use of social media in AYAs with cancer and highlight some of the online resources for AYAs. PMID:26893061

Social Media and the Adolescent and Young Adult (AYA) Patient with Cancer.

PubMed

Perales, Miguel-Angel; Drake, Emily K; Pemmaraju, Naveen; Wood, William A

2016-12-01

Over 70,000 adolescent and young adults (AYA) aged 15 to 39 years are diagnosed with cancer each year in the US. The National Cancer Institute (NCI) has identified AYA cancer patients as a unique population. The most common cancers in this age group include tumors typically seen in pediatric patients such as acute lymphoblastic leukemia (ALL) and brain tumors, as well as cancers more typically seen in adult patients such as breast cancer and melanoma. In addition, some cancers have their highest incidence in AYA patients, such as Hodgkin Lymphoma, testicular cancer, and bone tumors. AYA patients face additional unique issues due to their age, not just questions about treatment choices due to lack of data but also questions about fertility, relationships, loss of autonomy, and interruptions in school/work with potentially significant financial complications. This age group also has very high rates of social media usage with up to 90 % of adults aged 18 to 29 using social networking sites. In this review, we will describe the use of social media in AYAs with cancer and highlight some of the online resources for AYAs.

Thymic cyst: a fourth branchial cleft anomaly.

PubMed

Nayan, Smriti; MacLean, Jonathan; Sommer, Doron

2010-01-01

We report a unique case of a fourth branchial cleft cyst found within the thymus of an adult patient. In the literature to date, there have been no reports of such a finding in the adult population. These anomalies can often cause recurrent acute suppurative thyroiditis or recurrent deep neck abscesses. Delay in recognizing the underlying etiology can lead to significant complications.

Epidemiology of trauma deaths in an urban level-1 trauma center predominantly among African Americans--implications for prevention.

PubMed Central

Lyn-Sue, Jerome; Siram, Suryanarayana; Williams, Daniel; Mezghebe, Haile

2006-01-01

This is a retrospective review to determine demographics, presentation and injury characteristics of trauma deaths at Howard University Hospital over an 1-year period (1994-2005) and to make recommendations for education and prevention in the community based on our findings. Data was obtained from the Howard University Hospital trauma registry. From the study period 1994-2005, there was a total of 365 trauma deaths. The injuries sustained were mainly intentional, which accounted for almost 75% of cases--the majority of deaths being due to penetrating injuries. There was an almost two-fold increase in trauma deaths on Saturdays compared to the rest of the week. The demographics of our study population were similar to those reported in the trauma literature. These were younger patients and predominantly male. Unique to our population was the overwhelming predominance of African-American patients (90%). With these unique features, injury prevention would be better served focusing on social and community prevention and education rather than the usual methods of blunt-trauma prevention--e.g., pedestrian- and motor-vehicle-oriented policies, which may be more beneficial in other trauma systems. PMID:17225838

Population pharmacokinetic approach to evaluate the effect of CYP2D6, CYP3A, ABCB1, POR and NR1I2 genotypes on donepezil clearance

PubMed Central

Noetzli, Muriel; Guidi, Monia; Ebbing, Karsten; Eyer, Stephan; Wilhelm, Laurence; Michon, Agnès; Thomazic, Valérie; Stancu, Ioana; Alnawaqil, Abdel-Messieh; Bula, Christophe; Zumbach, Serge; Gaillard, Michel; Giannakopoulos, Panteleimon; von Gunten, Armin; Csajka, Chantal; Eap, Chin B

2014-01-01

Aims A large interindividual variability in plasma concentrations has been reported in patients treated with donepezil, the most frequently prescribed antidementia drug. We aimed to evaluate clinical and genetic factors influencing donepezil disposition in a patient population recruited from a naturalistic setting. Methods A population pharmacokinetic study was performed including data from 129 older patients treated with donepezil. The patients were genotyped for common polymorphisms in the metabolic enzymes CYP2D6 and CYP3A, in the electron transferring protein POR and the nuclear factor NR1I2 involved in CYP activity and expression, and in the drug transporter ABCB1. Results The average donepezil clearance was 7.3 l h−1 with a 30% interindividual variability. Gender markedly influenced donepezil clearance (P < 0.01). Functional alleles of CYP2D6 were identified as unique significant genetic covariate for donepezil clearance (P < 0.01), with poor metabolizers and ultrarapid metabolizers demonstrating, respectively, a 32% slower and a 67% faster donepezil elimination compared with extensive metabolizers. Conclusion The pharmacokinetic parameters of donepezil were well described by the developed population model. Functional alleles of CYP2D6 significantly contributed to the variability in donepezil disposition in the patient population and should be further investigated in the context of individual dose optimization to improve clinical outcome and tolerability of the treatment. PMID:24433464

Population pharmacokinetic approach to evaluate the effect of CYP2D6, CYP3A, ABCB1, POR and NR1I2 genotypes on donepezil clearance.

PubMed

Noetzli, Muriel; Guidi, Monia; Ebbing, Karsten; Eyer, Stephan; Wilhelm, Laurence; Michon, Agnès; Thomazic, Valérie; Stancu, Ioana; Alnawaqil, Abdel-Messieh; Bula, Christophe; Zumbach, Serge; Gaillard, Michel; Giannakopoulos, Panteleimon; von Gunten, Armin; Csajka, Chantal; Eap, Chin B

2014-07-01

A large interindividual variability in plasma concentrations has been reported in patients treated with donepezil, the most frequently prescribed antidementia drug. We aimed to evaluate clinical and genetic factors influencing donepezil disposition in a patient population recruited from a naturalistic setting. A population pharmacokinetic study was performed including data from 129 older patients treated with donepezil. The patients were genotyped for common polymorphisms in the metabolic enzymes CYP2D6 and CYP3A, in the electron transferring protein POR and the nuclear factor NR1I2 involved in CYP activity and expression, and in the drug transporter ABCB1. The average donepezil clearance was 7.3 l h(-1) with a 30% interindividual variability. Gender markedly influenced donepezil clearance (P < 0.01). Functional alleles of CYP2D6 were identified as unique significant genetic covariate for donepezil clearance (P < 0.01), with poor metabolizers and ultrarapid metabolizers demonstrating, respectively, a 32% slower and a 67% faster donepezil elimination compared with extensive metabolizers. The pharmacokinetic parameters of donepezil were well described by the developed population model. Functional alleles of CYP2D6 significantly contributed to the variability in donepezil disposition in the patient population and should be further investigated in the context of individual dose optimization to improve clinical outcome and tolerability of the treatment. © 2014 The British Pharmacological Society.

Cytomorphology of non-small cell lung carcinoma with anaplastic lymphoma kinase gene rearrangement.

PubMed

Toll, Adam D; Maleki, Zahra

2015-01-01

Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase demonstrating activating mutations in several malignancies including a subset (1-5%) of non-small cell lung carcinomas (NSCLC). Prior work examining, the histologic features of these tumors found a spectrum of findings, notably a solid/acinar pattern, as well as a mucinous cribriform pattern. We present the first study to date describing the cytomorphology of NSCLC harboring ALK rearrangements. A retrospective database search was conducted to identify cytologic specimens of NSCLC demonstrating ALK rearrangement. Cytogenetic analysis was performed with fluorescence in situ hybridization. A total of 12 patients were identified, 10 with available material. Cellular morphology and smear background was evaluated in the study group, as well as control cases lacking ALK rearrangement. A total of 25 specimens from 10 patients were obtained. Five patients never smoked, and four patients had a remote smoking history. ALK rearrangements were identified in cells with unique cytologic characteristics. All cases demonstrated moderate to poor differentiation with a predominance of single cells showing anisonucleosis and frequent intracytoplasmic neutrophils. The control cases showed cells with smaller, less pleomorphic nuclei, and smaller nucleoli with more clusters/tissue fragments. Several unique cytomorphologic features were consistently identified in the study population relative to the control population and include a prominence of single, markedly enlarged tumor cells with plasmacytoid features and anisonucleosis, as well as intracytoplasmic neutrophils. Larger studies are warranted to confirm our preliminary findings, as these features may help establish a more cost-effective means to select patients being tested for ALK mutational analysis. © 2014 Wiley Periodicals, Inc.

Fluorescent Photo-conversion: A second chance to label unique cells.

PubMed

Mellott, Adam J; Shinogle, Heather E; Moore, David S; Detamore, Michael S

2015-03-01

Not all cells behave uniformly after treatment in tissue engineering studies. In fact, some treated cells display no signs of treatment or show unique characteristics not consistent with other treated cells. What if the "unique" cells could be isolated from a treated population, and further studied? Photo-convertible reporter proteins, such as Dendra2 , allow for the ability to selectively identify unique cells with a secondary label within a primary labeled treated population. In the current study, select cells were identified and labeled through photo-conversion of Dendra2 -transfected human Wharton's Jelly cells (hWJCs) for the first time. Robust photo-conversion of green-to-red fluorescence was achieved consistently in arbitrarily selected cells, allowing for precise cell identification of select hWJCs. The current study demonstrates a method that offers investigators the opportunity to selectively label and identify unique cells within a treated population for further study or isolation from the treatment population. Photo-convertible reporter proteins, such as Dendra2 , offer the ability over non-photo-convertible reporter proteins, such as green fluorescent protein, to analyze unique individual cells within a treated population, which allows investigators to gain more meaningful information on how a treatment affects all cells within a target population.

Post-sampling mortality and non-response patterns in the English Cancer Patient Experience Survey: Implications for epidemiological studies based on surveys of cancer patients.

PubMed

Abel, Gary A; Saunders, Catherine L; Lyratzopoulos, Georgios

2016-04-01

Surveys of the experience of cancer patients are increasingly being introduced in different countries and used in cancer epidemiology research. Sampling processes, post-sampling mortality and survey non-response can influence the representativeness of cancer patient surveys. We examined predictors of post-sampling mortality and non-response among patients initially included in the sampling frame of the English Cancer Patient Experience Survey. We also compared the respondents' diagnostic case-mix to other relevant populations of cancer patients, including incident and prevalent cases. Of 109,477 initially sampled cancer patients, 6273 (5.7%) died between sampling and survey mail-out. Older age and diagnosis of brain, lung and pancreatic cancer were associated with higher risk of post-sampling mortality. The overall response rate was 67% (67,713 respondents), being >70% for the most affluent patients and those diagnosed with colon or breast cancer and <50% for Asian or Black patients, those under 35 and those diagnosed with brain cancer. The diagnostic case-mix of respondents varied substantially from incident or prevalent cancer cases. Respondents to the English Cancer Patient Experience Survey represent a population of recently treated cancer survivors. Although patient survey data can provide unique insights for improving cancer care quality, features of survey populations need to be acknowledged when analysing and interpreting findings from studies using such data. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Founder haplotype analysis of Fanconi anemia in the Korean population finds common ancestral haplotypes for a FANCG variant.

PubMed

Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun

2015-05-01

A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.

Strategies for improved French-language health services

PubMed Central

Gauthier, Alain P.; Timony, Patrick E.; Serresse, Suzanne; Goodale, Natalie; Prpic, Jason

2015-01-01

Abstract Objective To identify strategies to improve the quality of health services for Francophone patients. Design A series of semistructured key informant interviews. Setting Northeastern Ontario. Participants A total of 18 physicians were interviewed. Ten physicians were interviewed in French, 7 physicians were women, and 10 physicians were located in urban communities. Methods Purposive and snowball sampling strategies were used to conduct a series of semistructured key informant interviews with family physicians practising in communities with a large Francophone population. Principles of grounded theory were applied, guided by a framework for patient-professional communication. Results were inductively derived following an iterative data collection–data analysis process and were analyzed using a detailed thematic approach. Main findings Respondents identified several strategies for providing high-quality French-language health services. Some were unique to non–French-speaking physicians (eg, using appropriate interpreter services), some were unique to French-speaking physicians (eg, using a flexible dialect), and some strategies were common to all physicians serving French populations (eg, hiring bilingual staff or having pamphlets and posters in both French and English). Conclusion Physicians interviewed for this study provided high-quality health care by attributing substantial importance to effective communication. While linguistic patient-to-physician concordance is ideal, it might not always be possible. Thus, conscious efforts to attenuate communication barriers are necessary, and several effective strategies exist. PMID:26505060

Diabetes mellitus increases the risk of ruptured abdominal aortic aneurysms.

PubMed

Wierzba, Waldemar; Sliwczynski, Andrzej; Pinkas, Jaroslaw; Jawien, Arkadiusz; Karnafel, Waldemar

2017-09-01

The publication is a polemical response to reports that present data that diabetes reduces the risk of rupture of abdominal aortic aneurysm (AAA). The study analyzed all cases of developing AAA in patients with and without diabetes in 2012 in Poland. Data for the analysis were obtained with a unique and complete resources of the National Health Fund (NFZ) and population data from the Central Statistical Office (GUS). In Poland during 2012 2,227,453 patients with diabetes were treated, 975,364 males and 1,252,089 females. The incidence of AAA without rupture in patients without diabetes calculated per 100,000 of the non-diabetes general population was 25.0 +/- 9.0 in males and 5.6 +/- 2.3 in females. The incidence of ruptured AAA in the general population without diabetes was 3.6 +/- 0.9 in males, and 0.6 +/- 0.3 in females calculated per 100,000 of inhabitants without diabetes. The incidence of AAA without rupture in patients with diabetes was 184.897 +/- 70.653 in males and 35.364 +/- 24.925 in females calculated per 100,000 of patients diagnosed with diabetes. The incidence of ruptured AAA in patients with diabetes was 21.090 +/- 6.050 in males and 5.170 +/- 3.053 in females calculated per 100,000 of patients diagnosed with diabetes. The incidence rate for ruptured AAA in 2012 in Poland is statistically higher both in females and males in the population with diabetes. The incidence rate for AAA without rupture in 2012 in Poland is statistically higher in patients diagnosed with diabetes.

The CDC Hemophilia A Mutation Project (CHAMP) Mutation List: a New Online Resource

PubMed Central

Payne, Amanda B.; Miller, Connie H.; Kelly, Fiona M.; Soucie, J. Michael; Hooper, W. Craig

2015-01-01

Genotyping efforts in hemophilia A (HA) populations in many countries have identified large numbers of unique mutations in the Factor VIII gene (F8). To assist HA researchers conducting genotyping analyses, we have developed a listing of F8 mutations including those listed in existing locus-specific databases as well as those identified in patient populations and reported in the literature. Each mutation was reviewed and uniquely identified using Human Genome Variation Society (HGVS) nomenclature standards for coding DNA and predicted protein changes as well as traditional nomenclature based on the mature, processed protein. Listings also include the associated hemophilia severity classified by International Society of Thrombosis and Haemostasis (ISTH) criteria, associations of the mutations with inhibitors, and reference information. The mutation list currently contains 2,537 unique mutations known to cause HA. HA severity caused by the mutation is available for 2,022 mutations (80%) and information on inhibitors is available for 1,816 mutations (72%). The CDC Hemophilia A Mutation Project (CHAMP) Mutation List is available at http://www.cdc.gov/hemophiliamutations for download and search and will be updated quarterly based on periodic literature reviews and submitted reports. PMID:23280990

Tumor-initiating CD49f cells are a hallmark of chemoresistant triple negative breast cancer.

PubMed

Gomez-Miragaya, Jorge; González-Suárez, Eva

2017-01-01

Taxanes are mainstay treatment of triple negative breast cancer (TNBC) patients but resistance often develops. Using TNBC patient-derived orthoxenografts (PDX) we have recently discovered that a CD49f+ chemoresistant population with tumor-initiating ability is present in sensitive tumors and expands in tumors that have acquired resistance. Importantly, sensitivity to taxanes is recovered after long-term drug interruption. The characterization of this chemoresistant CD49f+ cells provides a unique opportunity to identify novel targets for the treatment of chemoresistant TNBC.

Telehealth, Mobile Applications, and Wearable Devices are Expanding Cancer Care Beyond Walls.

PubMed

Cannon, Carol

2018-05-01

To review telehealth solutions, mobile applications, and wearable devices that are currently impacting patients, caregivers, and providers who work in the oncology setting. A literature search was conducted using the terms (Telehealth, Mobile Health, mHealth, Wearable Devices) + (Oncology, Cancer Care). There are many current applications of telehealth and mobile health in the oncology setting. Nurses who care for patients with cancer should be aware of the pervasiveness and impact of telehealth and mobile health to this unique population. Copyright © 2018 Elsevier Inc. All rights reserved.

Genetic testing in congenital heart disease: ethical considerations.

PubMed

Lin, Kimberly Y; D'Alessandro, Lisa C A; Goldmuntz, Elizabeth

2013-01-01

On March 16, 2012, the Ethics of the Heart 2012: Ethical and Policy Challenges in Pediatric and Adult Congenital Heart Disease Conference took place in Philadelphia, Pennsylvania. The first session focused on the ethics surrounding genetic testing in patients with congenital heart disease. Summarized here is the introductory presentation given by Dr Elizabeth Goldmuntz entitled "The Role of Genetic Testing in Congenital Heart Disease," followed by a case presentation given by Dr Lisa D'Alessandro. The case and the panel discussion that ensued highlight several ethical principles and challenges in this unique patient population.

Scalable Clinical Decision Support for Individualized Cancer Risk Management | Informatics Technology for Cancer Research (ITCR)

Cancer.gov

We will build a scalable clinical decision support (CDS) platform that helps clinicians and patients select cancer screening strategies that are best suited to each individual. This kind of CDS is important because increased evidence supports personalizing cancer screening decisions according to each individual's unique cancer risks. While a highly desired goal, individualizing screening at a population scale requires the implementation of patient-specific risk assessments for several types of cancer. This is quite challenging in today's overwhelmed primary care environment.

Practice recommendations for pain assessment by self-report with African American older adults.

PubMed

Booker, Staja Star; Pasero, Chris; Herr, Keela A

2015-01-01

Despite decades of education and clinical practice guidelines underscoring disparities in pain management, pain continues to be inadequately managed in older African American adults as a result of patient, provider, and systems factors. Critical factors influencing pain assessment in older African American adults has not been extensively examined, contributing to a lack of data to inform health care providers' knowledge on culturally-responsive pain assessment in older African Americans. Assessing pain in older African Americans is unique because differences in language, cultural beliefs, and practices moderate how they report and express pain. This paper presents an overview of patient-provider factors that affect pain assessment in older African Americans with a focus on this population's unique cultural beliefs and practices. Recommendations for best practices for performance of a culturally-responsive pain assessment with older African Americans are provided. Copyright © 2015 Elsevier Inc. All rights reserved.

How I treat acute lymphoblastic leukemia in older adolescents and young adults

PubMed Central

Curran, Emily

2015-01-01

At the intersection between children and older adults, the care of adolescent and young adult (AYA) patients with acute lymphoblastic leukemia (ALL) poses unique challenges and issues beyond those faced by other age groups. Although the survival of AYA patients is inferior to younger children, growing evidence suggests that AYA patients have improved outcomes, with disease-free survival rates of 60% to 70%, when treated with pediatric-based approaches. A holistic approach, incorporating a multidisciplinary team, is a key component of successful treatment of these AYA patients. With the appropriate support and management of toxicities during and following treatment, these regimens are well tolerated in the AYA population. Even with the significant progress that has been made during the last decade, patients with persistence of minimal residual disease (MRD) during intensive therapy still have a poor prognosis. With new insights into disease pathogenesis in AYA ALL and the availability of disease-specific kinase inhibitors and novel targeted antibodies, future studies will focus on individualized therapy to eradicate MRD and result in further improvements in survival. This case-based review will discuss the biology, pharmacology, and psychosocial aspects of AYA patients with ALL, highlighting our current approach to the management of these unique patients. PMID:25805810

How I treat acute lymphoblastic leukemia in older adolescents and young adults.

PubMed

Curran, Emily; Stock, Wendy

2015-06-11

At the intersection between children and older adults, the care of adolescent and young adult (AYA) patients with acute lymphoblastic leukemia (ALL) poses unique challenges and issues beyond those faced by other age groups. Although the survival of AYA patients is inferior to younger children, growing evidence suggests that AYA patients have improved outcomes, with disease-free survival rates of 60% to 70%, when treated with pediatric-based approaches. A holistic approach, incorporating a multidisciplinary team, is a key component of successful treatment of these AYA patients. With the appropriate support and management of toxicities during and following treatment, these regimens are well tolerated in the AYA population. Even with the significant progress that has been made during the last decade, patients with persistence of minimal residual disease (MRD) during intensive therapy still have a poor prognosis. With new insights into disease pathogenesis in AYA ALL and the availability of disease-specific kinase inhibitors and novel targeted antibodies, future studies will focus on individualized therapy to eradicate MRD and result in further improvements in survival. This case-based review will discuss the biology, pharmacology, and psychosocial aspects of AYA patients with ALL, highlighting our current approach to the management of these unique patients. © 2015 by The American Society of Hematology.

Standardization in laboratory medicine: Adoption of common reference intervals to the Croatian population.

PubMed

Flegar-Meštrić, Zlata; Perkov, Sonja; Radeljak, Andrea

2016-03-26

Considering the fact that the results of laboratory tests provide useful information about the state of health of patients, determination of reference value is considered an intrinsic part in the development of laboratory medicine. There are still huge differences in the analytical methods used as well as in the associated reference intervals which could consequently significantly affect the proper assessment of patient health. In a constant effort to increase the quality of patients' care, there are numerous international initiatives for standardization and/or harmonization of laboratory diagnostics in order to achieve maximum comparability of laboratory test results and improve patient safety. Through the standardization and harmonization processes of analytical methods the ability to create unique reference intervals is achieved. Such reference intervals could be applied globally in all laboratories using methods traceable to the same reference measuring system and analysing the biological samples from the populations with similar socio-demographic and ethnic characteristics. In this review we outlined the results of the harmonization processes in Croatia in the field of population based reference intervals for clinically relevant blood and serum constituents which are in accordance with ongoing activity for worldwide standardization and harmonization based on traceability in laboratory medicine.

Ethnic and Gender Considerations in the Use of Facial Injectables: African-American Patients.

PubMed

Burgess, Cheryl; Awosika, Olabola

2015-11-01

The United States is becoming increasingly more diverse as the nonwhite population continues to rise faster than ever. By 2044, the US Census Bureau projects that greater than 50% of the US population will be of nonwhite descent. Ethnic patients are the quickest growing portion of the cosmetic procedures market, with African-Americans comprising 7.1% of the 22% of ethnic minorities who received cosmetic procedures in the United States in 2014. The cosmetic concerns and natural features of this ethnic population are unique and guided by differing structural and aging processes than their white counterparts. As people of color increasingly seek nonsurgical cosmetic procedures, dermatologists and cosmetic surgeons must become aware that the Westernized look does not necessarily constitute beauty in these diverse people. The use of specialized aesthetic approaches and understanding of cultural and ethnic-specific features are warranted in the treatment of these patients. This article will review the key principles to consider when treating African-American patients, including the average facial structure of African-Americans, the impact of their ethnicity on aging and structure of face, and soft-tissue augmentation strategies specific to African-American skin.

Ethnic identities and lifestyles in a multi-ethnic cancer patient population.

PubMed

Gotay, Carolyn Cook; Holup, Joan

2004-09-01

This report examined ethnic identity in 367 recently diagnosed cancer patients in Hawai'i's primary ethnic groups: Japanese, Hawaiians, Europeans, and Filipinos. The study assessed ethnic self-identify; definitions of and participation in different ethnic lifestyles; and relationships between measures of ethnic self-identity, lifestyle, and other indicators of ethnic and cultural affiliations. Results indicated that medical record-based ethnic indicators were well linked to individual self-reports of family pedigree. Self-descriptors included non-standard terms such as "American" and "Local," and respondents reported following between five and six different ethnically-associated ways of life. Multivariate analysis indicated that ethnic self-identity made a unique contribution that went beyond standard ethnic and acculturative markers in explaining lifestyles. This study provides strong support for multiculturalism in this ethnically heterogeneous population.

Real-time measurement of blood pressure with Nexfin in a patient with thalidomide-related phocomelia.

PubMed

Earle, Rosie; Vaghadia, Himat; Shanahan, Enda; Tang, Raymond; Sawka, Andrew

2016-11-01

We report the novel application of photoplethysmographic technology with the Nexfin HD monitor for real-time measurement of blood pressure (BP) in a patient with tetraamelia. The patient was a 58-year-old man with tetraamelia secondary to thalidomide exposure in utero, who presented for surgical excision of a maxillary schwannoma. Because difficulty of cuff use on rudimentary limbs and failure to gain invasive arterial access due to abnormalities of limb vasculature, this population is known to pose some unique challenges for BP measurement. Nexfin may offer an alternative noninvasive method to detect BP in patients with phocomelia during the perioperative period. Copyright © 2016 Elsevier Inc. All rights reserved.

Making a Medical Home for IBD Patients.

PubMed

Kosinski, Lawrence R; Brill, Joel; Regueiro, Miguel

2017-05-01

The transformation from fee for service to fee for value requires structural changes to the way gastroenterologists manage patients with inflammatory bowel disease (IBD). A team-based approach using technology to engage patients is necessary for success. The Patient-Centered Medical Home (PCMH) represents a unique model that brings together these essential features. This paper describes how the PCMH model has been successfully applied to the management of patients with IBD. A review of the literature and three examples of IBD PCMH initiatives are presented in this document: they demonstrate how outcomes can be improved under the PCMH model. Population health and value-based payments will mold and shape how we can position our GI practices. The specialty medical home is an ideal way to begin this transition.

Oncology disease management.

PubMed

Fetterolf, Donald E; Terry, Rachel

2007-02-01

Oncologic conditions are ubiquitous medical illnesses that present a particular challenge for medical management programs designed to address quality and cost issues in patient populations. Disease management strategies represent a reasonable and effective approach for employers and health plans in their arsenal of health management strategies. Multiple reasons exist for the development of specialized disease management programs that deal with cancer patients, some unique to this group of individuals. Health plans and/or employers have solid justification for addressing these issues directly through programs developed specifically to work with cancer patients. Whether developed within a health plan, or "carved out" to an external vendor, proper evaluation of outcomes is essential.

Esophageal eosinophilia is increased in rural areas with low population density: results from a national pathology database.

PubMed

Jensen, Elizabeth T; Hoffman, Kate; Shaheen, Nicholas J; Genta, Robert M; Dellon, Evan S

2014-05-01

Eosinophilic esophagitis (EoE) is an increasingly prevalent chronic disease arising from an allergy/immune-mediated process. Generally, the risk of atopic disease differs in rural and urban environments. The relationship between population density and EoE is unknown. Our aim was to assess the relationship between EoE and population density. We conducted a cross-sectional, case-control study of patients with esophageal biopsies in a US national pathology database between January 2009 and June 2012 to assess the relationship between population density and EoE. Using geographic information systems, the population density (individuals per square mile) was determined for each patient zip code. The odds of esophageal eosinophilia and EoE were estimated for each quintile of population density and adjusted for potential confounders. Sensitivity analyses were conducted with varying case definitions and to evaluate the potential for bias from endoscopy volume and patient factors. Of 292,621 unique patients in the source population, 89,754 had normal esophageal biopsies and 14,381 had esophageal eosinophilia with ≥15 eosinophils per high-power field. The odds of having esophageal eosinophilia increased with decreasing population density (P for trend <0.001). Compared with those in the highest quintile of population density, odds of having esophageal eosinophilia were significantly higher among those in the lowest quintile of population density (adjusted odds ratio (aOR) 1.27, 95% confidence interval (CI): 1.18, 1.36). A similar dose-response trend was observed across case definitions with increased odds of EoE in the lowest population density quintile (aOR 1.59, 95% CI: 1.45-1.76). Estimates were robust to sensitivity analyses. Population density is strongly and inversely associated with esophageal eosinophilia and EoE. This association is robust to varying case definitions and adjustment factors. Environmental exposures that are more prominent in rural areas may be relevant to the pathogenesis of EoE.

Esophageal eosinophilia is increased in rural areas with low population density: Results from a national pathology database

PubMed Central

Jensen, Elizabeth T.; Hoffman, Kate; Shaheen, Nicholas J.; Genta, Robert M.; Dellon, Evan S.

2015-01-01

Objectives Eosinophilic esophagitis (EoE) is an increasingly prevalent chronic disease arising from an allergy/immune-mediated process. Generally, the risk of atopic disease differs in rural and urban environments. The relationship between population density and EoE is unknown. Our aim was to assess the relationship between EoE and population density. Methods : We conducted a cross-sectional, case-control study of patients with esophageal biopsies in a U.S. national pathology database between January 2009 and June 2012 to assess the relationship between population density and EoE. Using Geographic Information Systems (GIS), the population density (individuals/mile2) was determined for each patient zip code. The odds of esophageal eosinophilia and EoE were estimated for each quintile of population density and adjusted for potential confounders. Sensitivity analyses were conducted with varying case definitions and to evaluate the potential for bias from endoscopy volume and patient factors. Results Of 292,621 unique patients in the source population, 89,754 had normal esophageal biopsies and 14,381 had esophageal eosinophilia with ≥15 eosinophils per high-power field (eos/hpf). The odds of esophageal eosinophilia increased with decreasing population density (p for trend < 0.001). Compared to those in the highest quintile of population density, odds of esophageal eosinophilia were significantly higher amongst those in the lowest quintile of population density (aOR 1.27, 95% CI: 1.18, 1.36). A similar dose-response trend was observed across case definitions with odds of EoE increased in the lowest population density quintile (aOR 1.59, 95% CI: 1.45-1.76). Estimates were robust to sensitivity analyses. Conclusions Population density is strongly and inversely associated with esophageal eosinophilia and EoE. This association is robust to varying case definitions and adjustment factors. Environmental exposures more prominent in rural areas may be relevant to the pathogenesis of EoE. PMID:24667575

Mid-term study of transcatheter aortic valve implantation in an Asian population with severe aortic stenosis: two-year Valve Academic Research Consortium-2 outcomes

PubMed Central

Chew, Nicholas; Hon, Jimmy Kim Fatt; Yip, Wei Luen James; Chan, Siew Pang; Poh, Kian-Keong; Kong, William Kok-Fai; Teoh, Kristine Leok Kheng; Yeo, Tiong Cheng; Tan, Huay Cheem; Tay, Edgar Lik Wui

2017-01-01

INTRODUCTION Transcatheter aortic valve implantation (TAVI) is an effective treatment for high-risk or inoperative patients with severe aortic stenosis. Given the unique characteristics of Asian populations, questions regarding mid-term outcomes in Asians undergoing TAVI have yet to be addressed. We evaluated the two-year clinical outcomes of TAVI in an Asian population using Valve Academic Research Consortium-2 definitions. METHODS This prospective study recruited 59 patients from a major academic medical centre in Singapore. The main outcomes were two-year survival rates, peri-procedural complications, symptom improvement, valvular function and assessment of learning curve. RESULTS Mean age was 76.8 years (61.0% male), mean body surface area 1.6 m2 and mean logistic EuroSCORE 18.7%. Survival was 93.2%, 86.0% and 79.1% at 30 days, one year and two years, respectively. At 30 days post TAVI, the rate of stroke was 1.7%, life-threatening bleeding 5.1%, acute kidney injury 25.0%, major vascular complication 5.1%, and new permanent pacemaker implantation 6.8%. 29.3% of TAVI patients were rehospitalised (47.1% cardiovascular-related) within one year. These composite outcomes were measured: device success (93.2%); early safety (79.7%); clinical efficacy (66.1%); and time-related valve safety (84.7%). Univariate analysis found these predictors of two-year all-cause mortality: logistic EuroSCORE (hazard ratio [HR] 1.07; p < 0.001); baseline estimated glomerular filtration rate (HR 0.97; p = 0.048); and acute kidney injury (HR 5.33; p = 0.022). Multivariate analysis identified non-transfemoral TAVI as a predictor of cardiovascular-related two-year mortality (HR 14.64; p = 0.008). CONCLUSION Despite the unique clinical differences in Asian populations, this registry demonstrated favourable mid-term clinical and safety outcomes in Asians undergoing TAVI. PMID:27516113

Mid-term study of transcatheter aortic valve implantation in an Asian population with severe aortic stenosis: two-year Valve Academic Research Consortium-2 outcomes.

PubMed

Chew, Nicholas; Hon, Jimmy Kim Fatt; Yip, Wei Luen James; Chan, Siew Pang; Poh, Kian-Keong; Kong, William Kok-Fai; Teoh, Kristine Leok Kheng; Yeo, Tiong Cheng; Tan, Huay Cheem; Tay, Edgar Lik Wui

2017-09-01

Transcatheter aortic valve implantation (TAVI) is an effective treatment for high-risk or inoperative patients with severe aortic stenosis. Given the unique characteristics of Asian populations, questions regarding mid-term outcomes in Asians undergoing TAVI have yet to be addressed. We evaluated the two-year clinical outcomes of TAVI in an Asian population using Valve Academic Research Consortium-2 definitions. This prospective study recruited 59 patients from a major academic medical centre in Singapore. The main outcomes were two-year survival rates, peri-procedural complications, symptom improvement, valvular function and assessment of learning curve. Mean age was 76.8 years (61.0% male), mean body surface area 1.6 m 2 and mean logistic EuroSCORE 18.7%. Survival was 93.2%, 86.0% and 79.1% at 30 days, one year and two years, respectively. At 30 days post TAVI, the rate of stroke was 1.7%, life-threatening bleeding 5.1%, acute kidney injury 25.0%, major vascular complication 5.1%, and new permanent pacemaker implantation 6.8%. 29.3% of TAVI patients were rehospitalised (47.1% cardiovascular-related) within one year. These composite outcomes were measured: device success (93.2%); early safety (79.7%); clinical efficacy (66.1%); and time-related valve safety (84.7%). Univariate analysis found these predictors of two-year all-cause mortality: logistic EuroSCORE (hazard ratio [HR] 1.07; p < 0.001); baseline estimated glomerular filtration rate (HR 0.97; p = 0.048); and acute kidney injury (HR 5.33; p = 0.022). Multivariate analysis identified non-transfemoral TAVI as a predictor of cardiovascular-related two-year mortality (HR 14.64; p = 0.008). Despite the unique clinical differences in Asian populations, this registry demonstrated favourable mid-term clinical and safety outcomes in Asians undergoing TAVI. Copyright: © Singapore Medical Association

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moureau-Zabotto, Laurence, E-mail: moureaul@ipc.unicancer.fr; Ortholan, Cecile; Hannoun-Levi, Jean-Michel

Purpose: To assess retrospectively the clinical outcome in anal cancer patients, with lymph node involvement, treated with split-course radiation therapy and receiving a boost through external beam radiation therapy (EBRT) or brachytherapy (BCT). Methods and Materials: From 2000 to 2005, among 229 patients with invasive nonmetastatic anal squamous cell carcinoma, a selected group of 99 patients, with lymph node involvement, was studied. Tumor staging reported was T1 in 4 patients, T2 in 16 patients, T3 in 49 patients, T4 in 16 patients, and T unknown in 14 patients and as N1 in 67 patients and N2/N3 in 32 patients. Patientsmore » underwent a first course of EBRT (mean dose, 45.1 Gy) followed by a boost (mean dose, 18 Gy) using EBRT (50 patients) or BCT (49 patients). All characteristics of patients and tumors were well balanced between the BCT and EBRT groups. Prognostic factors of cumulative rate of local recurrence (CRLR), cumulative rate of distant (including nodal) recurrence (CRDR), colostomy-free survival (CFS) rate, and overall survival (OS) rate were analyzed for the overall population and according to the nodal status classification. Results: The median follow-up was 71.5 months. The 5-year CRLR, CRDR, CFS rate, and OS rate were 21%, 19%, 63%, and 74.4%, respectively. In the overall population, the type of node involvement (N1 vs N2/N3) was the unique independent prognostic factor for CRLR. In N1 patients, by use of multivariate analysis, BCT boost was the unique prognostic factor for CRLR (4% for BCT vs 31% for EBRT; hazard ratio, 0.08; P=.042). No studied factors were significantly associated with CRDR, CFS, and OS. No difference with regard to boost technique and any other factor studied was observed in N2/N3 patients for any kind of recurrence. Conclusion: In anal cancer, even in the case of initial perirectal node invasion, BCT boost is superior to EBRT boost for CRLR, without an influence on OS, suggesting that N1 status should not be a contraindication to use of a BCT boost technique, as well as emphasizing the important of investigating the benefit of BCT boost in prospective randomized trials.« less

Hashimoto's thyroiditis with heterogeneous antithyrotropin receptor antibodies: unique epitopes may contribute to the regulation of thyroid function by the antibodies.

PubMed

Akamizu, T; Kohn, L D; Hiratani, H; Saijo, M; Tahara, K; Nakao, K

2000-06-01

Blocking-type TSH-binding inhibitor Igs (TBIIs) are known to cause hypothyroidism and an atrophic thyroid gland in patients with primary myxedema. They can block the activity of thyroid-stimulating antibodies (TSAbs) in Graves' patients as well as the activity of TSH. The majority of the epitopes for these blocking-type TBIIs have been, and are shown herein, to be present on the C-terminal region of the extracellular domain of the human TSH receptor (TSHR), whereas those for Graves' TSAbs are on the N-terminus. We report on a patient with Hashimoto's thyroiditis who suffered from mild hypothyroidism and a moderately sized goiter. Her serum had a potent blocking-type TBII and a weak TSAb in human and porcine TSHR systems. Using human TSHR/lutropin-CG receptor chimeras, we determined that the functional epitope of her blocking-type TBII was uniquely present on the N-terminal, rather than the C-terminal, region of the extracellular domain of the TSHR, unlike the case for blocking-type TBIIs in primary myxedema patients. The epitope of her TSAb was also unusual. Although the functional epitopes of most TSAbs are known to involve the N-terminal region of the receptor, her TSAb epitope did not seem to be present solely on the N- or C-terminus of the extracellular domain of the receptor. Blocking-type TBIIs from patients with primary myxedema blocked her TSAb activity as well as stimulation by TSH; her blocking-type TBII was able to only partially block her TSAb. In contrast, her blocking-type TBII almost completely blocked TSAbs from Graves' patients. Thus, we suggest that the unique epitopes of this patient's heterogeneous population of TSH receptor antibodies, at least in part, contribute to regulation of her thyroid function.

Eligibility of real-life patients with COPD for inclusion in trials of inhaled long-acting bronchodilator therapy.

PubMed

Halpin, David M G; Kerkhof, Marjan; Soriano, Joan B; Mikkelsen, Helga; Price, David B

2016-09-23

Management guidelines of chronic obstructive pulmonary disease (COPD) are mainly based on results of randomised controlled trials (RCTs), but some authors have suggested limited representativeness of patients included in these trials. No previous studies have applied the full range of selection criteria to a broad COPD patient population in a real-life setting. We identified all RCTs of inhaled long-acting bronchodilator therapy, during 1999-2013, at ClinicalTrials.gov and translated trial selection criteria into definitions compatible with electronic medical records. Eligibility was calculated for each RCT by applying these criteria to a uniquely representative, well-characterised population of patients with COPD from the Optimum Patient Care Research Database (OPCRD). Median eligibility of 36 893 patients with COPD for participation in 31 RCTs was 23 % (interquartile range 12-38). Two studies of olodaterol showed the highest eligibility of 55 and 58 %. Conversely, the lowest eligibility was observed in two studies that required a history of exacerbations in the past year (3.5 and 3.9 %). For the patient subgroup with modified Medical Research Council score ≥2, the overall median eligibility was 27 %. By applying an extensive range of RCT selection criteria to a large, representative COPD patient population, this study highlights that the interpretation of results from RCTs must take into account that RCT participants are variably, but generally more representative of patients in the community than previously believed.

Dynamic feature analysis of vector-based images for neuropsychological testing

NASA Astrophysics Data System (ADS)

Smith, Stephen L.; Cervantes, Basilio R.

1998-07-01

The dynamic properties of human motor activities, such as those observed in the course of drawing simple geometric shapes, are considerably more complex and often more informative than the goal to be achieved; in this case a static line drawing. This paper demonstrates how these dynamic properties may be used to provide a means of assessing a patient's visuo-spatial ability -- an important component of neuropsychological testing. The work described here provides a quantitative assessment of visuo-spatial ability, whilst preserving the conventional test environment. Results will be presented for a clinical population of long-term haemodialysis patients and test population comprises three groups of children (1) 7-8 years, (2) 9-10 years and (3) 11-12 years, all of which have no known neurological dysfunction. Ten new dynamic measurements extracted from patient responses in conjunction with one static feature deduced from earlier work describe a patient's visuo-spatial ability in a quantitative manner with sensitivity not previously attainable. The dynamic feature measurements in isolation provide a unique means of tracking a patient's approach to motor activities and could prove useful in monitoring a child' visuo-motor development.

The Confused Oncologic Patient: A Rational Clinical Approach

PubMed Central

Nolan, Craig; DeAngelis, Lisa M.

2017-01-01

Purpose of review The purpose of this review is to provide a practical clinical approach to confusion in the patient with cancer. Confusion in the cancer population has a broader differential diagnosis than in the general medical population. The clinician must consider the usual differential diagnoses as well as causes unique to the cancer patient including direct complications from the cancer and indirect complications related to cancer treatment. Recent findings In the recent age of precision medicine, the oncologist now utilizes the genomic profile of both the patient and the tumor to provide advanced biologic therapies including targeted anticancer drugs, antiangiogenic agents, and immunotherapy. Such advances carry with them an emerging pattern of neurotoxicity which, although less well described in the literature, is now an important consideration to the clinical approach to confusion in cancer patients. Summary Confusion is the most common neurologic complication in cancer and is associated with significant morbidity, mortality, and prolonged hospital stays resulting in increased health care costs. Early recognition and treatment of delirium is essential to improve clinical outcomes. PMID:27676278

Unique Study Designs in Nephrology: N-of-1 Trials and Other Designs.

PubMed

Samuel, Joyce P; Bell, Cynthia S

2016-11-01

Alternatives to the traditional parallel-group trial design may be required to answer clinical questions in special populations, rare conditions, or with limited resources. N-of-1 trials are a unique trial design which can inform personalized evidence-based decisions for the patient when data from traditional clinical trials are lacking or not generalizable. A concise overview of factorial design, cluster randomization, adaptive designs, crossover studies, and n-of-1 trials will be provided along with pertinent examples in nephrology. The indication for analysis strategies such as equivalence and noninferiority trials will be discussed, as well as analytic pitfalls. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Chiropractic care of musculoskeletal disorders in a unique population within Canadian community health centers.

PubMed

Garner, Michael J; Aker, Peter; Balon, Jeff; Birmingham, Michael; Moher, David; Keenan, Dirk; Manga, Pran

2007-01-01

This study was part of a larger demonstration project integrating chiropractic care into publicly funded Canadian community health centers. This pre/post study investigated the effectiveness of chiropractic care in reducing pain and disability as well as improving general health status in a unique population of urban, low-income, and multiethnic patients with musculoskeletal (MSK) complaints. All patients who presented to one of two community health center-based chiropractic clinics with MSK complaints between August 2004 and December 2005 were recruited to participate in this study. Outcomes were assessed by a general health measure (Short Form-12), a pain scale (VAS), and site-specific disability indexes (Roland-Morris Questionnaire and Neck Disability Index), which were administered before and after a 12-week treatment period. Three hundred twenty-four patients with MSK conditions were recruited into the study, and 259 (80.0%) of them were followed to the study's conclusion. Clinically important and statistically significant positive changes were observed for all outcomes (Short Form-12: physical composite score mean change = 4.9, 95% confidence interval [CI] = 3.8-6.0; VAS: current pain mean change = 2.3, 95% CI = 1.9-2.6; Neck Disability Index: mean change = 6.8, 95% CI = 5.4-8.1; Roland-Morris Questionnaire: mean change = 4.3, 95% CI = 3.6-5.1). No adverse events were reported. Patients of low socioeconomic status face barriers to accessing chiropractic services. This study suggests that chiropractic care reduces pain and disability as well as improves general health status in patients with MSK conditions. Further studies using a more robust methodology are needed to investigate the efficacy and cost-effectiveness of introducing chiropractic care into publicly funded health care facilities.

Gender Dysphoria in the Military.

PubMed

Ford, Shannon; Schnitzlein, Carla

2017-11-07

With the announcement that members of the military who identify as transgender are allowed to serve openly, the need for Department of Defense behavioral health providers to be comfortable in the assessment, diagnosis, and treatment of this population becomes quickly evident. This population has been seeking care in the community and standards have been developed to help guide decision-making, but a comparable document does not exist for the military population. Previously published papers were written in anticipation of the policy allowing for open service. The civilian sector has treatment guidelines and evidence supporting the same for reference. There is no similar document for the military population, likely due to the recent change and ongoing development. This paper attempts to provide an overview of the recent Department of Defense policy and walks the reader through key considerations when providing care to a transgender member of the military as it relates to those who are currently serving in the military through the use of a case example. The military transgender population faces some unique challenges due to the need to balance readiness and deployability with medically necessary health care. Also complicating patient care is that policy development is ongoing-as of this publication, the decision has not yet been made regarding how people who identify as transgender will access into the military nor is there final approval regarding coverage for surgical procedures. Unique circumstances of this population are brought up to generate more discussion and encourage further evaluation and refinement of the process.

'Known unknowns - examining the burden of neurocognitive impairment in the end-stage renal failure population'.

PubMed

Wilson, Scott; Dhar, Arup; Tregaskis, Peter; Lambert, Gavin; Barton, David; Walker, Rowan

2018-01-18

The burden of neurocognitive impairment (NCI) in patients receiving maintenance dialysis represents a spectrum of deficits across multiple cognitive domains which are associated with hospitalisation, reduced quality-of-life, mortality and forced decision-making around dialysis withdrawal. Point prevalence data suggests that dialysis patients manifest NCI at rates 3-5 fold higher than the general population with executive function the most commonly affected cognitive domain. The unique physiology of the renal failure state and maintenance dialysis appears to drive an excess of vascular dementia subtype compared to the general population where classical Alzheimer's disease predominates. Despite the absence of evidence based cost-effective therapies for NCI, detecting it in this population creates opportunity to proactively personalise care through education, supported decision making and targeted communication strategies to cover specific areas of deficit and help define goals of care. This review discusses NCI in the dialysis setting, including developments in the definition of neurocognitive impairment, dialysis-specific epidemiology across modalities, screening strategies and opportunities for dialysis providers in this space. This article is protected by copyright. All rights reserved.

Burn Wound Healing and Treatment: Review and Advancements

DTIC Science & Technology

2015-06-12

different days post burn. Burns. 2009;35:36–45. 176. Ogden CL, Carroll MD, Kit BK, Flegal KM. Prevalence of childhood and adult obesity in the United...invasive imaging modalities into the routine treatment of burn wounds. Obese patients As the obese population continues to grow [176], new treatment...approaches will be required. Obese burn pa- tients present with a variety of unique characteristics that include: increased rates of diabetes

Enhancing medication adherence: in older adults with bipolar disorder.

PubMed

Depp, Colin A; Lebowitz, Barry D

2007-06-01

The number of older adults with bipolar disorder is increasing, yet little is known about the optimal clinical management of these patients. Medication adherence is a vital to effective long-term treatment of these patients; thus enhancement of adherence is often an important clinical goal. We reviewed available evidence about the characteristics of later-life bipolar disorder along with behavioral and organizational strategies to enhance adherence in this population. Based on available data, cognitive impairment, medical comorbidity, and functional limitations are frequent and are likely to impact treatment adherence in this population. In terms of treatment, there have been no placebo-controlled randomized clinical trials of medications or psychosocial interventions for this population. Based on extrapolation from intervention research on younger adults with bipolar disorder and older adults with other chronic illness, psychosocial interventions that reduce effortful cognitive processing in managing medications and reduce organizational barriers to adherence may be beneficial in enhancing adherence in this population. Much more research needs to be done to understand the impact of aging on bipolar disorder, along with optimization of treatment. Interventions to enhance adherence in this population need to be adapted to fit with the unique needs of older adults with bipolar disorder.

Adult congenital heart disease in Greece: Preliminary data from the CHALLENGE registry.

PubMed

Giannakoulas, G; Vasiliadis, K; Frogoudaki, A; Ntellos, C; Tzifa, A; Brili, S; Manginas, A; Papaphylactou, M; Parcharidou, D; Kampouridis, N; Pitsis, A; Chamaidi, A; Kolios, M; Papadopoulos, G; Douras, A; Davlouros, P; Ntiloudi, D; Karvounis, H; Kalangos, A; Tsioufis, C; Rammos, S

2017-10-15

The majority of patients with congenital heart disease (CHD), nowadays, survives into adulthood and is faced with long-term complications. We aimed to study the basic demographic and clinical characteristics of adult patients with congenital heart disease (ACHD) in Greece. A registry named CHALLENGE (Adult Congenital Heart Disease Registry. A registry from Hellenic Cardiology Society) was initiated in January 2012. Patients with structural CHD older than 16years old were enrolled by 16 specialized centers nationwide. Out of a population of 2115 patients with ACHD, who have been registered, (mean age 38years (SD 16), 52% women), 47% were classified as suffering from mild, 37% from moderate and 15% from severe ACHD. Atrial septal defect (ASD) was the most prevalent diagnosis (33%). The vast majority of ACHD patients (92%) was asymptomatic or mildly symptomatic (NYHA class I/II). The most symptomatic patients were suffering from an ASD, most often the elderly or those under targeted therapy for pulmonary arterial hypertension. Elderly patients (>60years old) accounted for 12% of the ACHD population. Half of patients had undergone at least one open-heart surgery, while 39% were under cardiac medications (15% under antiarrhythmic drugs, 16% under anticoagulants, 16% under medications for heart failure and 4% under targeted therapy for pulmonary arterial hypertension). ACHD patients are an emerging patient population and national prospective registries such as CHALLENGE are of unique importance in order to identify the ongoing needs of these patients and match them with the appropriate resource allocation. Copyright © 2017 Elsevier B.V. All rights reserved.

Difference in drug resistance patterns between minor HIV-1 populations in cerebrospinal fluid and plasma.

PubMed

Bergroth, T; Ekici, H; Gisslén, M; Hagberg, L; Sönnerborg, A

2009-02-01

The aim of the study was to determine to what extent unique drug resistance patterns appear in minor and major HIV-1 quasispecies in cerebrospinal fluid (CSF) as compared with blood. Forty-four plasma and CSF samples from 13 multi-treatment-experienced patients, seven of whom provided longitudinal samples, were included in the study. The subjects had failed antiretroviral therapy including lamivudine. The reverse transcriptase (RT) gene was examined by selective real-time polymerase chain reaction (SPCR), which can detect M184I/V mutants down to 0.2% of the viral population. SPCR revealed differences at amino acid position 184 in the plasma/CSF populations in 12 paired samples from eight patients. One plasma sample was positive by SPCR where direct sequencing showed wild-type M184. The other 11 paired samples showed quantitative differences in the mixed populations of the mutant or wild-type M184 quasispecies. Differences in other resistance-associated mutations between plasma and CSF viruses were also found by direct sequencing. In multi-treatment-experienced patients with therapy failure, differences in drug resistance patterns were found frequently between plasma and CSF in both minor and major viral populations. To what extent this was a true biological phenomenon remains to be established, and the clinical relevance of these findings is yet to be determined.

Experience with ibrutinib for first-line use in patients with chronic lymphocytic leukemia.

PubMed

Itchaki, Gilad; Brown, Jennifer R

2018-01-01

Ibrutinib is the first in-class, orally administered, Bruton's tyrosine kinase (BTK) inhibitor that abrogates the critical signaling downstream of the B-cell receptor (BCR). This signaling is required for B-cell survival, proliferation and interaction with the microenvironment. Ibrutinib proved active in preclinical models of lymphoproliferative diseases and achieved impressive response rates in heavily pretreated relapsed and refractory (R/R) patients with chronic lymphocytic leukemia (CLL). Ibrutinib prolonged survival compared to standard therapy and mitigated the effect of most poor prognostic factors in CLL, thus becoming the main therapeutic option in high-risk populations. Moreover, compared with standard chemoimmunotherapy (CIT) for adults, ibrutinib causes fewer cytopenias and infections, while having its own unique toxicity profile. Its efficacy in relapsed patients as well as its tolerability have led to its increased use in previously untreated patients, especially in those with poor prognostic markers and/or the elderly. This review elaborates on ibrutinib's unique toxicity profile and the mechanisms of acquired resistance leading to progression on ibrutinib, since both are critical for understanding the obstacles to its first-line use. We will further evaluate the data from ongoing clinical trials in this setting and explore future options for combination therapy.

Unique Characteristics of Adolescent and Young Adult Acute Lymphoblastic Leukemia, Breast Cancer, and Colon Cancer

PubMed Central

Seibel, Nita L.; Blair, Donald G.; Albritton, Karen; Hayes-Lattin, Brandon

2011-01-01

Each year in the United States, nearly 70 000 individuals between the ages of 15 and 40 years are diagnosed with cancer. Although overall cancer survival rates among pediatric and older adult patients have increased in recent decades, there has been little improvement in survival of adolescent and young adult (AYA) cancer patients since 1975 when collected data became adequate to evaluate this issue. In 2006, the AYA Oncology Progress Review Group made recommendations for addressing the needs of this population that were later implemented by the LIVESTRONG Young Adult Alliance. One of their overriding questions was whether the cancers seen in AYA patients were biologically different than the same cancers in adult and/or pediatric patients. On June 9–10, 2009, the National Cancer Institute (NCI) and the Lance Armstrong Foundation (LAF) convened a workshop in Bethesda, MD, entitled “Unique Characteristics of AYA Cancers: Focus on Acute Lymphocytic Leukemia (ALL), Breast Cancer and Colon Cancer” that aimed to examine the current state of basic and translational research on these cancers and to discuss the next steps to improve their prognosis and treatment. PMID:21436065

Cultural Sensitivity and Challenges in Management of the Transgender Patient With ESRD in Transplantation.

PubMed

Hoch, Deborah Ann; Bulman, Maya; McMahon, Dorn W

2016-03-01

Transgender patients with end-stage renal disease (ESRD) present with specific challenges during the transplant evaluation, perioperative management, and postoperative phase of care. Demographic information, health-care records, chosen name, and gender identity along with documentation of specific health-care needs can become a challenge when gender assigned at birth is incongruent with the patients gender identity. Medical care involves addressing the end-organ disease as well as addressing those aspects of care specific to the transgender patient. This review article provides information on defining transgender, the impact of ESRD, and transgender in the transplant process and considerations in the throughout phases of care. Current recommendations for management of this unique population are provided. © 2016, NATCO.

Immunogenicity of Mycobacterium leprae unique antigens in leprosy endemic populations in Asia and Africa.

PubMed

Bobosha, Kidist; Van Der Ploeg-Van Schip, Jolien J; Zewdie, Martha; Sapkota, Bishwa Raj; Hagge, Deanna A; Franken, Kees L M C; Inbiale, Wondmagegn; Aseffa, Abraham; Ottenhoff, Tom H M; Geluk, Annemieke

2011-12-01

Ongoing transmission of leprosy is evident from the stable disease incidence in high burden areas. Tools for early detection of Mycobacterium leprae (M. leprae) infection, particularly in sub-clinically infected individuals, are urgently required to reduce transmission. Following the sequencing of the M. leprae genome, many M. leprae-unique candidate proteins have been identified, several of which have been tested for induction of M. leprae specific T cell responses in different leprosy endemic areas. In this study, 21 M. leprae-unique proteins and 10 peptide pools covering the complete sequence of five M. leprae-unique proteins (ML0576, ML1989, ML1990, ML2283, and ML2567) were evaluated in 160 individuals in Nepal and Ethiopia. These included: tuberculoid and borderline tuberculoid (TT/BT), borderline borderline and borderline lepromatous (BB/BL) leprosy patients; healthy household contacts (HHC); tuberculosis (TB) patients and endemic controls (EC). Immunogenicity of the proteins was determined by IFN-gamma secretion via stimulation of PBMC in 6 days lymphocyte stimulation tests (LST) or in whole blood assays (WBA). In LST, BB/BL patients (40%) responded to ML0573 and ML1601 whereas ML1604 was most immunogenic in TT/BT (35%) and HHC (36%). Additionally, significant numbers of EC displayed IFN-gamma production in response to ML0573 (54%), ML1601 (50%) and ML1604 (54%). TB patients on the other hand, hardly responded to any of the proteins except for ML1989. Comparison of IFN-gamma responses to ML0121, ML0141 and ML0188 for TT/BT patients showed specific increase in diluted 6 days WBA compared to the undiluted 24 hours WBA, whereas EC showed a reduced response in the diluted WBA, which may indicate detection of disease-specific responses in the 6 days WBA. In summary, identification of multiple M. leprae proteins inducing M. leprae-specific T cell responses in groups at high risk of developing leprosy may contribute to improve early detection for M. leprae infection.

Autistic children and anesthesia: is their perioperative experience different?

PubMed

Arnold, Brook; Elliott, Anila; Laohamroonvorapongse, Dean; Hanna, John; Norvell, Daniel; Koh, Jeffrey

2015-11-01

Children with autism spectrum disorders (ASD) are an increasingly common patient population in the perioperative setting. Children with ASD present with abnormal development in social interaction, communication, and stereotyped patterns of behavior and may be more prone to elevated perioperative anxiety. The perioperative experience for these patients is complex and presents a unique challenge for clinicians. The aim of the current study was to provide a further understanding of the premedication patterns and perioperative experiences of children with ASD in comparison to children without ASD. Using a retrospective cohort study design, medical records were evaluated for patients with and without ASD undergoing general anesthesia for dental rehabilitation from 2006-2011. The following objectives were measured and compared: (i) premedication patterns and (ii) complications, pain, anesthetic type, PACU time, and time to discharge. To compare categorical variables, the chi-square test was used. Bivariate and multivariable analyses were performed to control for potential confounding as a result of baseline differences between the two groups. A total of 121 ASD patients and 881 non-ASD patients were identified. When controlling for age, weight, and gender, children in the ASD group were more likely to have nonstandard premedication types (P < 0.0001), while children without ASD were more likely to have standard premedication types (P < 0.0001). No significant group differences were identified in regards to the other outcome measures. Other than a significant difference in the premedication type and route, we found that children with ASD seemed to have similar perioperative experiences as non-ASD subjects. It was especially interesting to find that their postoperative period did not pose any special challenges. There is much to be learned about this unique patient population, and a more in-depth prospective evaluation is warranted to help better delineate the best approach to caring for these patients. © 2015 John Wiley & Sons Ltd.

Data-Driven Healthcare: Challenges and Opportunities for Interactive Visualization.

PubMed

Gotz, David; Borland, David

2016-01-01

The healthcare industry's widespread digitization efforts are reshaping one of the largest sectors of the world's economy. This transformation is enabling systems that promise to use ever-improving data-driven evidence to help doctors make more precise diagnoses, institutions identify at risk patients for intervention, clinicians develop more personalized treatment plans, and researchers better understand medical outcomes within complex patient populations. Given the scale and complexity of the data required to achieve these goals, advanced data visualization tools have the potential to play a critical role. This article reviews a number of visualization challenges unique to the healthcare discipline.

Hereditary spastic paraplegia in Greece: characterisation of a previously unexplored population using next-generation sequencing.

PubMed

Lynch, David S; Koutsis, Georgios; Tucci, Arianna; Panas, Marios; Baklou, Markella; Breza, Marianthi; Karadima, Georgia; Houlden, Henry

2016-06-01

Hereditary Spastic Paraplegia (HSP) is a syndrome characterised by lower limb spasticity, occurring alone or in association with other neurological manifestations, such as cognitive impairment, seizures, ataxia or neuropathy. HSP occurs worldwide, with different populations having different frequencies of causative genes. The Greek population has not yet been characterised. The purpose of this study was to describe the clinical presentation and molecular epidemiology of the largest cohort of HSP in Greece, comprising 54 patients from 40 families. We used a targeted next-generation sequencing (NGS) approach to genetically assess a proband from each family. We made a genetic diagnosis in >50% of cases and identified 11 novel variants. Variants in SPAST and KIF5A were the most common causes of autosomal dominant HSP, whereas SPG11 and CYP7B1 were the most common cause of autosomal recessive HSP. We identified a novel variant in SPG11, which led to disease with later onset and may be unique to the Greek population and report the first nonsense mutation in KIF5A. Interestingly, the frequency of HSP mutations in the Greek population, which is relatively isolated, was very similar to other European populations. We confirm that NGS approaches are an efficient diagnostic tool and should be employed early in the assessment of HSP patients.

Cancer and the LGBTQ Population: Quantitative and Qualitative Results from an Oncology Providers' Survey on Knowledge, Attitudes, and Practice Behaviors.

PubMed

Tamargo, Christina L; Quinn, Gwendolyn P; Sanchez, Julian A; Schabath, Matthew B

2017-10-07

Despite growing social acceptance, the LGBTQ population continues to face barriers to healthcare including fear of stigmatization by healthcare providers, and providers' lack of knowledge about LGBTQ-specific health issues. This analysis focuses on the assessment of quantitative and qualitative responses from a subset of providers who identified as specialists that treat one or more of the seven cancers that may be disproportionate in LGBTQ patients. A 32-item web-based survey was emailed to 388 oncology providers at a single institution. The survey assessed: demographics, knowledge, attitudes, and practice behaviors. Oncology providers specializing in seven cancer types had poor knowledge of LGBTQ-specific health needs, with fewer than half of the surveyed providers (49.5%) correctly answering knowledge questions. Most providers had overall positive attitudes toward LGBTQ patients, with 91.7% agreeing they would be comfortable treating this population, and would support education and/or training on LGBTQ-related cancer health issues. Results suggest that despite generally positive attitudes toward the LGBTQ population, oncology providers who treat cancer types most prevalent among the population, lack knowledge of their unique health issues. Knowledge and practice behaviors may improve with enhanced education and training on this population's specific needs.

Innovative research methods for studying treatments for rare diseases: methodological review.

PubMed

Gagne, Joshua J; Thompson, Lauren; O'Keefe, Kelly; Kesselheim, Aaron S

2014-11-24

To examine methods for generating evidence on health outcomes in patients with rare diseases. Methodological review of existing literature. PubMed, Embase, and Academic Search Premier searched for articles describing innovative approaches to randomized trial design and analysis methods and methods for conducting observational research in patients with rare diseases. We assessed information related to the proposed methods, the specific rare disease being studied, and outcomes from the application of the methods. We summarize methods with respect to their advantages in studying health outcomes in rare diseases and provide examples of their application. We identified 46 articles that proposed or described methods for studying patient health outcomes in rare diseases. Articles covered a wide range of rare diseases and most (72%) were published in 2008 or later. We identified 16 research strategies for studying rare disease. Innovative clinical trial methods minimize sample size requirements (n=4) and maximize the proportion of patients who receive active treatment (n=2), strategies crucial to studying small populations of patients with limited treatment choices. No studies describing unique methods for conducting observational studies in patients with rare diseases were identified. Though numerous studies apply unique clinical trial designs and considerations to assess patient health outcomes in rare diseases, less attention has been paid to innovative methods for studying rare diseases using observational data. © Gagne et al 2014.

[OSTEOPOROSIS AND DIABETES - IN WHICH WAY ARE THEY RELATED?

PubMed

Tell-Lebanon, Osnat; Rotman-Pikielny, Pnina

2016-11-01

Diabetes and osteoporosis are common diseases with growing prevalence in the aging population. Many recent studies have reported an association between diabetes mellitus and an increased osteoporotic fracture rate. Compared to control subjects, decreased bone mineral density has been observed in patients with type 1 diabetes mellitus, while those with type 2 diabetes display a unique skeletal phenotype of increased bone mineral density, but impaired architectural structure and mineral properties. Accumulation of advanced glycation end products changes collagen structure and suppression of bone turnover causes impairment of repair and adaptation mechanisms. These seem to be significant factors impairing bone strength. In addition, longer disease duration, disease complications, insulin use and increased falls, as well as the use of drugs like thiazolidinediones for treatment, are all reported risk factors for fractures among patients with diabetes. Conventional diagnostic tools, including DXA measurements and the fracture risk assessment (FRAX) tool, seem to underestimate fracture risk so that for every FRAX, the actual risk of fracture is higher in the diabetic patient. Despite the unique pathophysiology of bone disease in patients with diabetes, as far as we know, existing drug treatments for osteoporosis are as effective as in patients without diabetes. Therefore, physicians should be aware of the higher risk for osteoporotic fracture among patients with diabetes and treat them according to the clinical algorithms used for all patients.

A collaborative case study: The Office of Native Medicine.

PubMed

Joe, Jennie R; Young, Robert S; Moses, Jill; Knoki-Wilson, Ursula; Dennison, Johnson

2016-01-01

National concerns about reducing the persistent health disparities found among varying racial and ethnic populations have led to initiatives to improve health care delivery systems. Many of these initiatives also promote the cultural competence of health care providers as a way to meet unique patient needs that go beyond immediate health problems, and to account for other critical components of patient care, such as health literacy, health beliefs and behaviors, and cultural practices. This case study describes a patient-centered care model developed by the Chinle Comprehensive Health Care Facility on the Navajo Reservation in Arizona, a model that has added a cadre of traditional tribal practitioners as part of its hospital and other clinical service resources.

Opioid addiction, diversion, and abuse in chronic and cancer pain.

PubMed

Kata, Vijay; Novitch, Matthew B; Jones, Mark R; Anyama, Best O; Helander, Erik M; Kaye, Alan D

2018-06-01

The primary cause of overdose death in the United States is related to pharmaceutical opioids. A few particular populations that struggle with adverse outcomes related to opioid abuse are those in palliative care, those with chronic pain, and those receiving pain treatments secondary to cancer or chemotherapy. There have been massive efforts to decrease the use of opioid abuse in patient care in a gestalt manner, but palliative care provides unique challenges in applying these reduction tactics used by other specialties. We explore behavioral interventions, provider education, alternative pain management techniques, postmarketing surveillance, and abuse-deterrent formulas as emerging methods to counteract opioid abuse in these populations.

Face-to-face communication between patients and family physicians in Canada: A scoping review.

PubMed

Armas, Alana; Meyer, Samantha B; Corbett, Kitty K; Pearce, Alex R

2018-05-01

Patient-provider communication is critical in primary care. Canada's unique health system, population distribution, and cultural context suggest there is value in addressing the topic in the Canadian context. We conducted a scoping review to synthesize recent Canadian literature to inform practice in primary care settings and identify research agendas for patient-provider communication in Canada. Using Arksey and O'Malley's framework we searched four literature databases: Medline, Web of Science, CINAHL and EMBASE. We extracted 21,932 articles published between 2010 and 2017. A total of 108 articles met the inclusion criteria. The articles were analyzed qualitatively using thematic analysis to identify major themes. Four major themes were identified: information sharing, relationships, health system challenges, and development and use of communication tools. Our review identified a need for Canadian research regarding: communication in primary care with Aboriginal, immigrant, and rural populations; the impact of medical tourism on primary care; and how to improve communication to facilitate continuity of care. Challenges providers face in primary care in Canada include: communicating with linguistically and culturally diverse populations; addressing issues that emerge with the rise of medical tourism; a need for decision aids to improve communication with patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Essential trace elements in amyotrophic lateral sclerosis (ALS): Results in a population of a risk area of Italy.

PubMed

Forte, Giovanni; Bocca, Beatrice; Oggiano, Riccardo; Clemente, Simonetta; Asara, Yolande; Sotgiu, Maria Alessandra; Farace, Cristiano; Montella, Andrea; Fois, Alessandro Giuseppe; Malaguarnera, Michele; Pirina, Pietro; Madeddu, Roberto

2017-09-01

Sardinian (Italy) island population has a uniquely high incidence of amyotrophic lateral sclerosis (ALS). Essential trace element levels in blood, hair, and urine of ALS Sardinian patients were investigated in search of valid biomarkers to recognize and predict ALS. Six elements (Ca, Cu, Fe, Mg, Se, and Zn) were measured in 34 patients compared to 30 age- and sex-matched healthy controls by a validated method. Levels of Ca and Cu in blood and of Se and Zn in hair were significantly higher in ALS than in controls, while urinary excretion of Mg and Se was significantly decreased. The selected cut-off concentrations for these biomarkers may distinguish patients with or without ALS with sufficient sensitivity and specificity. Many positive (as Se-Cu and Se-Zn) and negative associations (as Ca-Mg and Ca-Zn) between elements suggested that multiple metals involved in multiple mechanisms have a role in the ALS degeneration.

Body mass index in ambulatory cerebral palsy patients.

PubMed

Feeley, Brian T; Gollapudi, Kiran; Otsuka, Norman Y

2007-05-01

Malnutrition is a common problem in children with cerebral palsy. Although malnutrition is often recognized in patients with severe cerebral palsy, it can be unrecognized in less severely affected patients. The consequences of malnutrition are serious, and include decreased muscle strength, poor immune status, and depressed cerebral functioning. Low body mass index has been used as a marker for malnutrition. The purpose of this study was to determine which patients in an ambulatory cerebral palsy patient population were at risk for low body mass index. A retrospective chart review was performed on 75 patients. Age, sex, height, weight, type of cerebral palsy, and functional status [gross motor functional classification system (GMFCS) level] was recorded from the chart. Descriptive statistics with bivariate and multivariate regression analyses were performed. Thirty-eight boys and 37 girls with an average age of 8.11 years were included in the study. Unique to our patient population, all cerebral palsy patients were independent ambulators. Patients with quadriplegic cerebral palsy had a significantly lower body mass index than those with diplegic and hemiplegic cerebral palsy. Patients with a GMFCS III had significantly lower body mass index than those with GMFCS I and II. When multivariate regression analysis to control for age and sex was performed, low body mass index remained associated with quadriplegic cerebral palsy and GMFCS III. Malnutrition is a common health problem in patients with cerebral palsy, leading to significant morbidity in multiple organ systems. We found that in an ambulatory cerebral palsy population, patients with lower functional status or quadriplegia had significantly lower body mass index, suggesting that even highly functioning ambulatory cerebral palsy patients are at risk for malnutrition.

Fluorescent Photo-conversion: A second chance to label unique cells

PubMed Central

Mellott, Adam J.; Shinogle, Heather E.; Moore, David S.; Detamore, Michael S.

2014-01-01

Not all cells behave uniformly after treatment in tissue engineering studies. In fact, some treated cells display no signs of treatment or show unique characteristics not consistent with other treated cells. What if the “unique” cells could be isolated from a treated population, and further studied? Photo-convertible reporter proteins, such as Dendra2, allow for the ability to selectively identify unique cells with a secondary label within a primary labeled treated population. In the current study, select cells were identified and labeled through photo-conversion of Dendra2-transfected human Wharton's Jelly cells (hWJCs) for the first time. Robust photo-conversion of green-to-red fluorescence was achieved consistently in arbitrarily selected cells, allowing for precise cell identification of select hWJCs. The current study demonstrates a method that offers investigators the opportunity to selectively label and identify unique cells within a treated population for further study or isolation from the treatment population. Photo-convertible reporter proteins, such as Dendra2, offer the ability over non-photo-convertible reporter proteins, such as green fluorescent protein, to analyze unique individual cells within a treated population, which allows investigators to gain more meaningful information on how a treatment affects all cells within a target population. PMID:25914756

Standardization in laboratory medicine: Adoption of common reference intervals to the Croatian population

PubMed Central

Flegar-Meštrić, Zlata; Perkov, Sonja; Radeljak, Andrea

2016-01-01

Considering the fact that the results of laboratory tests provide useful information about the state of health of patients, determination of reference value is considered an intrinsic part in the development of laboratory medicine. There are still huge differences in the analytical methods used as well as in the associated reference intervals which could consequently significantly affect the proper assessment of patient health. In a constant effort to increase the quality of patients’ care, there are numerous international initiatives for standardization and/or harmonization of laboratory diagnostics in order to achieve maximum comparability of laboratory test results and improve patient safety. Through the standardization and harmonization processes of analytical methods the ability to create unique reference intervals is achieved. Such reference intervals could be applied globally in all laboratories using methods traceable to the same reference measuring system and analysing the biological samples from the populations with similar socio-demographic and ethnic characteristics. In this review we outlined the results of the harmonization processes in Croatia in the field of population based reference intervals for clinically relevant blood and serum constituents which are in accordance with ongoing activity for worldwide standardization and harmonization based on traceability in laboratory medicine. PMID:27019800

Towards improved migraine management: Determining potential trigger factors in individual patients.

PubMed

Peris, Francesc; Donoghue, Stephen; Torres, Ferran; Mian, Alec; Wöber, Christian

2017-04-01

Background Certain chronic diseases such as migraine result in episodic, debilitating attacks for which neither cause nor timing is well understood. Historically, possible triggers were identified through analysis of aggregated data from populations of patients. However, triggers common in populations may not be wholly responsible for an individual's attacks. To explore this hypothesis we developed a method to identify individual 'potential trigger' profiles and analysed the degree of inter-individual variation. Methods We applied N = 1 statistical analysis to a 326-migraine-patient database from a study in which patients used paper-based diaries for 90 days to track 33 factors (potential triggers or premonitory symptoms) associated with their migraine attacks. For each patient, univariate associations between factors and migraine events were analysed using Cox proportional hazards models. Results We generated individual factor-attack association profiles for 87% of the patients. The average number of factors associated with attacks was four per patient: Factor profiles were highly individual and were unique in 85% of patients with at least one identified association. Conclusion Accurate identification of individual factor-attack profiles is a prerequisite for testing which are true triggers and for development of trigger avoidance or desensitisation strategies. Our methodology represents a necessary development toward this goal.

Cochlear Implantation in the Very Young Child: Issues Unique to the Under-1 Population

PubMed Central

Cosetti, Maura; Roland, J. Thomas

2010-01-01

Since the advent of cochlear implantation, candidacy criteria have slowly broadened to include increasingly younger patients. Spurred by evidence demonstrating both perioperative safety and significantly increased speech and language benefit with early auditory intervention, children younger than 12 months of age are now being successfully implanted at many centers. This review highlights the unique challenges involved in cochlear implantation in the very young child, specifically diagnosis and certainty of testing, anesthetic risk, surgical technique, intraoperative testing and postoperative programming, long-term safety, development of receptive and expressive language, and outcomes of speech perception. Overall, the current body of literature indicates that cochlear implantation prior to 1 year of age is both safe and efficacious. PMID:20483813

The incidence of cerebrovascular accidents and second brain tumors in patients with pituitary adenoma: a population-based study.

PubMed

Brown, Paul D; Blanchard, Miran; Jethwa, Krishan; Flemming, Kelly D; Brown, Cerise A; Kline, Robert W; Jacobson, Debra J; St Sauver, Jennifer; Pollock, Bruce E; Garces, Yolanda I; Stafford, Scott L; Link, Michael J; Erickson, Dana; Foote, Robert L; Laack, Nadia N I

2014-03-01

To assess the risk of cerebrovascular accidents (CVAs) and second brain tumors (SBTs) in patients with pituitary adenoma after surgery or radiotherapy. A cohort of 143 people from Olmsted County, who were diagnosed with pituitary adenoma between 1933 and 2000, was studied. Only patients from Olmsted County were included because of the unique nature of medical care in Olmsted County, which allows the ascertainment of virtually all cases of pituitary adenoma for this community's residents and comparisons to the general population in the county. Surgical resection was performed in 76 patients, 29 patients underwent radiotherapy (with 21 undergoing both surgery and radiotherapy), 5 patients were reirradiated, and 59 patients were managed conservatively and observed. Median follow-up was 15.5 years. There was no difference in CVA-free survival between treatment groups. On univariate analysis age > 60 years (hazard ratio [HR], 11.93; 95% CI, 6.26-23.03; P < .001); male sex (HR, 3.67; 95% CI, 2.03-6.84; P < .001), and reirradiation (HR, 3.41; 95% CI, 1.05-9.68; P = .04) were associated with worse CVA-free survival. In multivariate analysis, only age > 60 years was associated with worse CVA-free survival. Compared with the general population, there was a 4-fold increase in the rate of CVAs in pituitary adenoma patients (HR, 4.2; 95% CI, 2.8-6.1). Two patients developed SBT (an irradiated patient and a surgically managed patient). CVA is a significant risk for patients with pituitary tumors, but treatment does not seem to impact the risk. Even with long-term follow-up, SBTs are a rare event regardless of treatment modality.

The incidence of cerebrovascular accidents and second brain tumors in patients with pituitary adenoma: a population-based study

PubMed Central

Brown, Paul D.; Blanchard, Miran; Jethwa, Krishan; Flemming, Kelly D.; Brown, Cerise A.; Kline, Robert W.; Jacobson, Debra J.; St. Sauver, Jennifer; Pollock, Bruce E.; Garces, Yolanda I.; Stafford, Scott L.; Link, Michael J.; Erickson, Dana; Foote, Robert L.; Laack, Nadia N.I.

2014-01-01

Background To assess the risk of cerebrovascular accidents (CVAs) and second brain tumors (SBTs) in patients with pituitary adenoma after surgery or radiotherapy. Methods A cohort of 143 people from Olmsted County, who were diagnosed with pituitary adenoma between 1933 and 2000, was studied. Only patients from Olmsted County were included because of the unique nature of medical care in Olmsted County, which allows the ascertainment of virtually all cases of pituitary adenoma for this community's residents and comparisons to the general population in the county. Surgical resection was performed in 76 patients, 29 patients underwent radiotherapy (with 21 undergoing both surgery and radiotherapy), 5 patients were reirradiated, and 59 patients were managed conservatively and observed. Results Median follow-up was 15.5 years. There was no difference in CVA-free survival between treatment groups. On univariate analysis age > 60 years (hazard ratio [HR], 11.93; 95% CI, 6.26–23.03; P < .001); male sex (HR, 3.67; 95% CI, 2.03–6.84; P < .001), and reirradiation (HR, 3.41; 95% CI, 1.05–9.68; P = .04) were associated with worse CVA-free survival. In multivariate analysis, only age > 60 years was associated with worse CVA-free survival. Compared with the general population, there was a 4-fold increase in the rate of CVAs in pituitary adenoma patients (HR, 4.2; 95% CI, 2.8–6.1). Two patients developed SBT (an irradiated patient and a surgically managed patient). Conclusion CVA is a significant risk for patients with pituitary tumors, but treatment does not seem to impact the risk. Even with long-term follow-up, SBTs are a rare event regardless of treatment modality. PMID:26034611

Comparative effectiveness studies examining patient-reported outcomes among children with cleft lip and/or palate: a systematic review.

PubMed

Ranganathan, Kavitha; Vercler, Christian J; Warschausky, Seth A; MacEachern, Mark P; Buchman, Steven R; Waljee, Jennifer F

2015-01-01

Health care policy makers are increasingly encouraging comparative effectiveness research. Little is known regarding comparative studies among children with cleft lip and/or palate. Cleft lip and/or palate profoundly influences self-perception and social functioning, and patient-reported outcomes provide a unique perspective on the success of reconstruction. The purpose of this study was to systematically review the literature regarding patient-reported outcomes among patients with cleft lip and/or palate. The authors reviewed articles from MEDLINE, Embase, and PsycInfo that examined the use of patient-reported outcome instruments for cleft lip and/or palate. Studies of patients with cleft lip and/or palate across any age that described the use of patient-completed measures in patient and control populations were included. A research librarian confirmed the search, and two independent, blinded reviewers performed full-text review. The authors identified 1979 articles and selected 30 for inclusion. Forty-two different assessment tools were used to analyze factors such as self-esteem, behavior, and social support. The Strengths and Difficulties Questionnaire was most commonly used (n = 7), followed by the Childhood Experience Questionnaire (n = 5), and the Satisfaction with Appearance survey (n = 4). Barriers to analysis included lack of standardization of survey administration, effect of publication bias, and variations in patient populations between individual studies. Comparative studies of patient-reported outcomes among patients with cleft lip and/or palate are infrequent. Many instruments exist to measure patient-reported outcomes in this population, but no specific standard exists. Identifying efficient and targeted forms of instrument selection and administration will enhance comparative studies among children with cleft lip and/or palate. Diagnostic, III.

The hutterite variant of Treacher Collins syndrome: a 28-year-old story solved.

PubMed

Caluseriu, Oana; Lowry, Brian R; McLeod, Ross; Lamont, Ryan; Parboosingh, Jillian S; Bernier, Francois P; Innes, A Micheil

2013-11-01

Treacher Collins syndrome (TCS), the best known form of mandibulofacial dysostosis (MFD) comprises a recognizable pattern of anomalies. In 1985, Lowry et al. reported on two Hutterite sisters born to apparently unaffected parents with TCS, raising the possibility of an autosomal recessive (AR) variant of TCS, subsequently given a unique Mendelian Inheritance of Man (MIM) number (248390). Recently, biallelic mutations in POLR1C were found in TCS patients, confirming AR TCS as a distinct entity. The Hutterites, an endogamous Anabaptist group, like other genetically isolated populations, provide a powerful resource for mapping AR disorders. We elected to study the molecular basis of TCS in the Hutterite population including the original kindred described in 1985, and another unrelated Hutterite patient. Prior to starting this study, a TCOF1 mutation had apparently been excluded in the original family at two outside institutions. We hypothesized that an AR variant of TCS was present in the three Hutterite patients, but homozygosity mapping did not show convincing evidence of shared regions between the affected individuals. TCOF1 analysis was undertaken and mutations were found in the three affected patients and an unaffected parent. These data show that the initial Hutterite family reported with AR TCS in fact has classic TCS due to a TCOF1 mutation, despite recent data confirming the existence of AR TCS in other populations. These results have significant counseling implications for the affected families in the Hutterite population and in the population at large. © 2013 Wiley Periodicals, Inc. © 2013 Wiley Periodicals, Inc.

The Frequent Fliers of New Mexico: Hospital Readmissions among the Homeless Population.

PubMed

Dirmyer, Victoria F

2016-07-01

It is estimated that there are 1.7 million homeless individuals in the United States; 36% are families with children under the age of 18. Due to lack of resources, individuals who are homeless frequent emergency departments for immediate health care needs. The aim of this study was to examine a homeless population over a 3-year time period who were admitted to an Albuquerque area hospital at any time during the time period. A comparison of demographic characteristics as well as hospitalization characteristics between two populations was analyzed: individuals who were homeless and had a 30-day readmission compared to those that did not have a 30-day readmission. There were 850 unique homeless patients that were admitted to an Albuquerque area hospital during the 3-year time period. The mean age was 43.8 years with the majority of the population being male. The 3-year average 30-day readmission rate was 30.1%. Multivariate regression analysis indicated that homeless patients older than 19 years, individuals with more than 1 admission during the time period, and individuals who left against medical advice had increased odds of a 30-day readmission. Individuals who were homeless who were admitted for respiratory conditions or cardiovascular disease had decreased odds of a 30-day readmission compared to patients admitted for neuropsychiatric conditions. In New Mexico, patients who were homeless experienced a high 30-day readmission rate. These results suggest a need for further research into the healthcare needs of this population and how to improve discharge protocols to prevent future readmissions.

Quality of life in adolescent and young adult cancer patients: a systematic review of the literature

PubMed Central

Quinn, Gwendolyn P; Gonçalves, Vânia; Sehovic, Ivana; Bowman, Meghan L; Reed, Damon R

2015-01-01

Introduction Adolescent and young adult (AYA) cancer survivors experience many unique challenges and quality of life (QoL) effects that persist beyond cancer diagnosis and treatment. Due to continuous improvements in technology and cancer treatments resulting in improved survival rates, the identification of late effects, survivorship issues, and QoL is moving to the forefront of cancer research. The goal of this systematic review was to identify key psychosocial factors impacting QoL in AYA oncology populations. Methods A systematic review of the literature was conducted using combinations of these phrases or keywords: “adolescent and young adult or AYA” AND “health outcomes OR quality of life OR psychology” AND “neoplasm OR cancer OR oncology”. A total of 35 articles were included in this review. Studies were classified into two categories: AYA perceptions and stakeholder perceptions. Results AYA cancer survivors were more likely to have “worse” or impaired QoL compared with the general population, regardless of other demographic factors. AYAs described both positive and negatives experiences with their medical care, the educational information received, and the supportive care services. Although health care professionals were likely to underestimate or misjudge the health preferences and support needs of AYAs, these perceptions varied across disciplines and levels of experience. Conclusion The literature is lacking in sufficient evidence-based interventions to improve QoL in AYA cancer populations. Further, the tools to adequately measure QoL in this population are also unsatisfactory. The literature, however, consistently shows agreement regarding the unique needs of this population, indicating a trend toward health care standardization within age ranges or life stages. We suggest the need for AYA-specific programs in health care institutions that comprise a multidisciplinary team that addresses all the unique medical and QoL needs of AYAs. PMID:25733941

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

Domain Management Approach to Heart Failure in the Geriatric Patient: Present and Future.

PubMed

Gorodeski, Eiran Z; Goyal, Parag; Hummel, Scott L; Krishnaswami, Ashok; Goodlin, Sarah J; Hart, Linda L; Forman, Daniel E; Wenger, Nanette K; Kirkpatrick, James N; Alexander, Karen P

2018-05-01

Heart failure (HF) is a quintessential geriatric cardiovascular condition, with more than 50% of hospitalizations occurring in adults age 75 years or older. In older patients, HF is closely linked to processes inherent to aging, which include cellular and structural changes to the myocardium, vasculature, and skeletal muscle. In addition, HF cannot be considered in isolation of physical functioning, or without the social, psychological, and behavioral dimensions of illness. The role of frailty, depression, cognitive impairment, nutrition, and goals of care are each uniquely relevant to the implementation and success of medical therapy. In this paper, we discuss a model of caring for older adults with HF through a 4-domain framework that can address the unique multidimensional needs and vulnerabilities of this population. We believe that clinicians who embrace this approach can improve health outcomes for older adults with HF. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

A Phosphorylated Cytoplasmic Autoantigen, GW182, Associates with a Unique Population of Human mRNAs within Novel Cytoplasmic Speckles

PubMed Central

Eystathioy, Theophany; Chan, Edward K. L.; Tenenbaum, Scott A.; Keene, Jack D.; Griffith, Kevin; Fritzler, Marvin J.

2002-01-01

A novel human cellular structure has been identified that contains a unique autoimmune antigen and multiple messenger RNAs. This complex was discovered using an autoimmune serum from a patient with motor and sensory neuropathy and contains a protein of 182 kDa. The gene and cDNA encoding the protein indicated an open reading frame with glycine-tryptophan (GW) repeats and a single RNA recognition motif. Both the patient's serum and a rabbit serum raised against the recombinant GW protein costained discrete cytoplasmic speckles designated as GW bodies (GWBs) that do not overlap with the Golgi complex, endosomes, lysosomes, or peroxisomes. The mRNAs associated with GW182 represent a clustered set of transcripts that are presumed to reside within the GW complexes. We propose that the GW ribonucleoprotein complex is involved in the posttranscriptional regulation of gene expression by sequestering a specific subset of gene transcripts involved in cell growth and homeostasis. PMID:11950943

Wilderness Preparticipation Evaluation and Considerations for Special Populations.

PubMed

Joy, Elizabeth; Van Baak, Karin; Dec, Katherine L; Semakula, Barbara; Cardin, Ashlea D; Lemery, Jay; Wortley, George C; Yaron, Michael; Madden, Christopher

2015-12-01

Children, older adults, disabled and special needs athletes, and female athletes who participate in outdoor and wilderness sports and activities each face unique risks. For children and adolescents traveling to high altitude, the preparticipation physical evaluation should focus on risk assessment, prevention strategies, early recognition of altitude-related symptoms, management plans, and appropriate follow-up. As the risk and prevalence of chronic disease increases with age, both older patients and providers need to be aware of disease and medication-specific risks relative to wilderness sport and activity participation. Disabled and special needs athletes benefit from careful pre-event planning for the potential medical issues and equipment modifications that may affect their health in wilderness environments. Issues that demand special consideration for female adventurers include pregnancy, contraceptive use, menses, and ferritin levels at altitude. A careful preparticipation evaluation that factors in unique, population- specific risks will help special populations stay healthy and safe on wilderness adventures. The PubMed and SportDiscus databases were searched in 2014 using both MeSH terms and text words and include peer-reviewed English language articles from 1977 to 2014. Additional information was accessed from Web-based sources to produce this narrative review on preparticipation evaluation for special populations undertaking wilderness adventures. Key words include children, adolescent, pediatric, seniors, elderly, disabled, special needs, female, athlete, preparticipiation examination, wilderness medicine, and sports. Copyright © 2015. Published by Elsevier Inc.

Psychological comorbidities and their relationship to self-reported handicap in samples of dizzy patients.

PubMed

Piker, Erin G; Jacobson, Gary P; McCaslin, Devin L; Grantham, Sarah L

2008-04-01

Factors such as anxiety, depression, somatic awareness, autonomic symptoms, and differences in coping strategies are known to affect dizziness handicap. We studied these factors in 63 consecutive "dizzy" patients. This sample was subgrouped into normals and patients with benign paroxysmal positional vertigo, compensated and uncompensated unilateral peripheral vestibular system impairment, or abnormal vestibular evoked myogenic potential as a single significant diagnostic finding. Results showed that (1) anxiety and depression occur with greater frequency in dizzy patients than in the normal population; (2) the magnitude of anxiety, depression, somatization, and autonomic symptoms does not differ significantly in subgroups of patients; (3) women tended to report greater handicap and somatic/autonomic symptoms; and (4) Dizziness Handicap Inventory total scores were correlated with patients' complaints of somatic/autonomic symptoms, anxiety, depression, and coping strategies. These findings suggest that self-reported measures represent unique pieces of information important for the management of dizzy patients.

The Otolaryngologist's Role in Providing Gender-Affirming Care: An Opportunity for Improved Education and Training.

PubMed

Chaiet, Scott R; Yoshikawa, Noriko; Sturm, Angela; Flanary, Valerie; Ishman, Stacey; Streed, Carl G

2018-06-01

Currently, there are limited resources and training available for otolaryngologists and otolaryngology practice personnel to provide gender-affirming care for transgender or gender nonconforming patients. This unique patient population may present to our offices for gender-specific care or with complaints of the ear, nose, and throat unrelated to gender identity. Our current practice has unintentional but direct consequences on our patients care, as transgender patients often report negative experiences in the healthcare setting related to their gender identity. The absence of resources and training is also seen in other specialties. Physicians who create an environment where patients of all gender identities feel welcome can better meet their patients' health care needs. In addition, otolaryngologists can play a role in easing the gender dysphoria experienced by transgender patients. We suggest educational content should be created for and made available to otolaryngologists and office staff to provide gender-affirming care.

Comparative analyses of population-scale phenomic data in electronic medical records reveal race-specific disease networks

PubMed Central

Glicksberg, Benjamin S.; Li, Li; Badgeley, Marcus A.; Shameer, Khader; Kosoy, Roman; Beckmann, Noam D.; Pho, Nam; Hakenberg, Jörg; Ma, Meng; Ayers, Kristin L.; Hoffman, Gabriel E.; Dan Li, Shuyu; Schadt, Eric E.; Patel, Chirag J.; Chen, Rong; Dudley, Joel T.

2016-01-01

Motivation: Underrepresentation of racial groups represents an important challenge and major gap in phenomics research. Most of the current human phenomics research is based primarily on European populations; hence it is an important challenge to expand it to consider other population groups. One approach is to utilize data from EMR databases that contain patient data from diverse demographics and ancestries. The implications of this racial underrepresentation of data can be profound regarding effects on the healthcare delivery and actionability. To the best of our knowledge, our work is the first attempt to perform comparative, population-scale analyses of disease networks across three different populations, namely Caucasian (EA), African American (AA) and Hispanic/Latino (HL). Results: We compared susceptibility profiles and temporal connectivity patterns for 1988 diseases and 37 282 disease pairs represented in a clinical population of 1 025 573 patients. Accordingly, we revealed appreciable differences in disease susceptibility, temporal patterns, network structure and underlying disease connections between EA, AA and HL populations. We found 2158 significantly comorbid diseases for the EA cohort, 3265 for AA and 672 for HL. We further outlined key disease pair associations unique to each population as well as categorical enrichments of these pairs. Finally, we identified 51 key ‘hub’ diseases that are the focal points in the race-centric networks and of particular clinical importance. Incorporating race-specific disease comorbidity patterns will produce a more accurate and complete picture of the disease landscape overall and could support more precise understanding of disease relationships and patient management towards improved clinical outcomes. Contacts: rong.chen@mssm.edu or joel.dudley@mssm.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27307606

Residual Cardiovascular Risk in Chronic Kidney Disease: Role of High-density Lipoprotein

PubMed Central

Kon, Valentina; Yang, Haichun; Fazio, Sergio

2016-01-01

Although reducing low-density lipoprotein-cholesterol (LDL-C) levels with lipid-lowering agents (statins) decreases cardiovascular disease (CVD) risk, a substantial residual risk (up to 70% of baseline) remains after treatment in most patient populations. High-density lipoprotein (HDL) is a potential contributor to residual risk, and low HDL-cholesterol (HDL-C) is an established risk factor for CVD. However, in contrast to conventional lipid-lowering therapies, recent studies show that pharmacologic increases in HDL-C levels do not bring about clinical benefits. These observations have given rise to the concept of dysfunctional HDL where increases in serum HDL-C may not be beneficial because HDL loss of function is not corrected by or even intensified by the therapy. Chronic kidney disease (CKD) increases CVD risk, and patients whose CKD progresses to end-stage renal disease (ESRD) requiring dialysis are at the highest CVD risk of any patient type studied. The ESRD population is also unique in its lack of significant benefit from standard lipid-lowering interventions. Recent studies indicate that HDL-C levels do not predict CVD in the CKD population. Moreover, CKD profoundly alters metabolism and composition of HDL particles and impairs their protective effects on functions such as cellular cholesterol efflux, endothelial protection, and control of inflammation and oxidation. Thus, CKD-induced perturbations in HDL may contribute to the excess CVD in CKD patients. Understanding the mechanisms of vascular protection in renal disease can present new therapeutic targets for intervention in this population. PMID:26009251

Who consults chiropractors in Victoria, Australia?: Reasons for attending, general health and lifestyle habits of chiropractic patients.

PubMed

Charity, Melanie J; Britt, Helena C; Walker, Bruce F; Gunn, Jane M; Forsdike-Young, Kirsty; Polus, Barbara I; French, Simon D

2016-01-01

COAST (Chiropractic Observational and Analysis STudy) reported the clinical practices of chiropractors. The aims of this study were to: 1) describe the chiropractic patient demographic and health characteristics; 2) describe patient-stated reasons for visiting a chiropractor; 3) describe chiropractic patient lifestyle characteristics; 4) compare, where possible, chiropractic patient characteristics to the general Australian population. Fifty-two chiropractors in Victoria, Australia, provided information for up to 100 consecutive encounters. If patients attended more than once during the 100 encounters, only data from their first encounter were included in this study. Where possible patient characteristics were compared with the general Australian population. Data were collected from December 2010 to September 2012. Data were provided for 4464 encounters, representing 3287 unique individuals. The majority of chiropractic encounters were for musculoskeletal conditions or for wellness/maintenance. The majority of patient comorbidities were musculoskeletal, circulatory or endocrine/metabolic in nature. Eight hundred chiropractic patients (57 %, 95 % CI: 53-61) described their self-reported health as excellent or very good and 138 patients (10 %, 95 % CI: 8-12) as fair or poor. Seventy-one percent of adult male patients (18 years and older), and 53 % of adult female patients, were overweight or obese. Fourteen percent (n = 188, 95 % CI: 12-16) were current smokers and 27 % (n = 359, 95 % CI: 24-31) did not meet Australian alcohol consumption guidelines. Less than half of the chiropractic patients participated in vigorous exercise at least twice per week. Approximately 20 % ate one serving of vegetables or less each day, and approximately 50 % ate one serve of fruit or less each day. Compared to the general Australian population, chiropractic patients were less likely to smoke, less likely to be obese and more likely to describe their health in positive terms. However, many patients were less likely to meet alcohol consumption guidelines, drinking more than is recommended. In general, chiropractic patients had more positive health and lifestyle characteristics than the Australian population. However, there were a significant proportion of chiropractic patients who did not meet guideline recommendations about lifestyle habits and there is an opportunity for chiropractors to reinforce public health messages with their patients.

Sleep Disorders in Adult Sickle Cell Patients

PubMed Central

Sharma, Sunil; Efird, Jimmy T.; Knupp, Charles; Kadali, Renuka; Liles, Darla; Shiue, Kristin; Boettger, Peter; Quan, Stuart F.

2015-01-01

Study Objectives: While sleep apnea has been studied in children with sickle cell disease (SCD), little is known about sleep disorders in adult sickle cell patients. The objective of this study was to evaluate sleep disordered breathing and its polysomnographic characteristics in adult patients with sickle cell disease. Methods: The analysis cohort included 32 consecutive adult SCD patients who underwent a comprehensive sleep evaluation and overnight polysomnography in an accredited sleep center after reporting symptoms suggesting disordered sleep or an Epworth Sleepiness Scale score ≥ 10. Epworth score, sleep parameters, comorbid conditions, and narcotic use were reviewed and compared in patients with and without sleep disordered breathing. SCD complication rates in the two groups also were compared. Results: In adult SCD patients who underwent overnight polysomnography, we report a high prevalence (44%) of sleep disordered breathing. Disease severity was mild to moderate (mean apnea-hypopnea index = 17/h (95% CI: 10–24/h). Concomitant sleep disorders, including insomnia complaints (57%) and delayed sleep-phase syndrome (57%), also were common in this population. In this limited cohort, we did not find increased SCD complications associated with sleep disordered breathing in adult patients with sickle cell disease. Conclusions: A high burden of sleep disordered breathing and other sleep-related complaints were identified in the adult sickle cell population. Our results provide important information on this unique population. Citation: Sharma S, Efird JT, Knupp C, Kadali R, Liles D, Shiue K, Boettger P, Quan SF. Sleep disorders in adult sickle cell patients. J Clin Sleep Med 2015;11(3):219–223. PMID:25515282

Dog ownership and dog walking to promote physical activity and health in patients.

PubMed

Epping, Jacqueline N

2011-07-01

Lack of physical activity is a significant risk factor for many chronic diseases and conditions and is associated with significant medical costs. Approximately half of adults and more than a third of adolescents and youth in the United States do not achieve recommended levels of physical activity. Effective population-level strategies are needed to promote activities that are practical, accessible, and sustainable and that can reach a large proportion of the population. Dog walking may be such a strategy. Walking is popular, easy, and sustainable and has a low risk of injury. Owning dogs confers many health benefits, and dog walking, in particular, can help promote physical activity and improve health. Physicians and other health care providers can play a unique and integral role in promoting physical activity among patients by recommending dog walking both to dog owners and to non-dog owners as a purposeful, enjoyable, and sustainable form of regular physical activity.

Penile fracture seems more likely during sex under stressful situations.

PubMed

Kramer, Andrew C

2011-12-01

The unusual event of penile fracture occurs when there is a disruption of the tunica albuginea surrounding engorged erectile tissue during aggressive sexual behavior. There is often an audible crack and rapid detumescence with subcutaneous hemorrhage that follows. Medical literature has described the etiology and treatment of penile fracture. We report the remarkably unusual social situations of a series of patients who sustained this unique injury. We conducted a retrospective chart review of 16 patients whose injury was severe enough to require surgical repair at the University of Maryland between 2007 and 2011. Particular attention was paid to the intake interview in the emergency department and the postoperative chart notes by the attending urologist to ascertain out-of-the-ordinary social situations in which the injury was sustained. The occurrence of penile fracture is sufficiently rare that the author was able to interact personally with most of the patients. The patients were remarkably forthcoming with the personal social dynamics of the sexual encounter. Half of these penile fracture patients sustained the injury during an extramarital affair. Only three patients sustained the injury in a bedroom; the remainder was in out-of-the-ordinary locations for sexual intercourse, e.g., cars, elevator, the workplace, and public restrooms. Penile fracture patients appear to be a unique population of men who are having sexual intercourse under stressful situations. Extramarital affairs and out-of-the-ordinary locations appear common in patients sustaining this relatively rare injury. © 2011 International Society for Sexual Medicine.

A case report of crusted scabies in an adult patient with Down syndrome.

PubMed

Nagsuk, Phillips; Moore, Rachel; Lopez, Lisa

2015-08-15

Crusted (Norwegian) scabies is a severe manifestation of the contagious skin infection caused by Sarcoptes scabiei. Crusted scabies has been well described in patients with known immunocompromised states. Treatment may be complicated by delayed diagnosis and/or inadequate treatment. This infection may not rank highly on one's differential diagnosis in the absence of an immunocompromised state, highlighting the uniqueness of the case being presented. Several papers describe immunocompromised children with Down syndrome who are infected with crusted scabies. We present a case of infection in an adult with Down syndrome without evidence of an immunocompromised state. Our patient came to us with a 13-month history of progressively worsening symptoms, the last 4-6 weeks of that time period being most dramatic, despite various treatments. We performed tissue biopsy, culture, and laboratory evaluations, which revealed numerous mites and bacterial superinfection. Crusted scabies infection may occur in adult age individuals with Down syndrome regardless of immune status, leading us to encourage practitioners to consider this condition when presented with patients of this population. We also highlight the need for further exploration of disease prevalence in this patient population.

Ten years of major equestrian injury: are we addressing functional outcomes?

PubMed Central

Ball, Jill E; Ball, Chad G; Mulloy, Robert H; Datta, Indraneel; Kirkpatrick, Andrew W

2009-01-01

Background Horseback riding is considered more dangerous than motorcycle riding, skiing, automobile racing, football and rugby. The integral role of rehabilitation therapy in the recovery of patients who have sustained a major horse-related injury is previously not described. The goals of this paper were to (1) define the incidence and pattern of severe equestrian trauma, (2) identify the current level of in-patient rehabilitation services, (3) describe functional outcomes for patients, and (4) discuss methods for increasing rehabilitation therapy in this unique population. Methods and results A retrospective review of the trauma registry at a level 1 center (1995–2005) was completed in conjunction with a patient survey outlining formal in-hospital therapy. Forty-nine percent of patients underwent in-patient rehabilitation therapy. Injuries predictive of receiving therapy included musculoskeletal and spinal cord trauma. Previous injury while horseback riding was predictive of not receiving therapy. The majority (55%) of respondents had chronic physical difficulties following their accident. Conclusion Rehabilitation therapy is significantly underutilized following severe equestrian trauma. Increased therapy services should target patients with brain, neck and skull injuries. Improvements in the initial provision, and follow-up of rehabilitation therapy could enhance functional outcomes in the treatment resistant Western equestrian population. PMID:19228424

A general review of the otolaryngologic manifestations of Down Syndrome.

PubMed

Chin, Christopher J; Khami, Maria M; Husein, Murad

2014-06-01

Down Syndrome (DS) is the most common chromosome abnormality in liveborn children. Otolaryngologists frequently encounter these patients in their practice; in one survey, 50% of DS patients had been seen by Otolaryngology at least once. As such, it is essential that the practicing Otolaryngologist is aware of the otologic, rhinologic, and laryngologic manifestations of this complex disease and comfortable in the management and treatment of these unique patients. Our goal was to provide this information in a concise and definitive document. A comprehensive literature review using PubMed was completed. The terms "Otolaryngology", "Head and neck", "Ear, nose, throat", "Down Syndrome", and "Trisomy 21" were searched in various combinations. Applicable articles that discussed the Otolaryngologic manifestations of Down Syndrome were included. In total, fifty articles were included for review. The Down Syndrome child tends to have smaller external ear canals, have higher rates of chronic ear disease, and may present with conductive, sensorineural, or mixed hearing loss. As such, DS patients should receive behaviouralaudiological testing every 6 monthsand annually after the age of three in addition to closer follow-up by an Otolaryngologist if tympanic membranes cannot be visualized or if the external auditory canals are significantly stenosed. Management should involve close follow-up and a low threshold for PE tube placement to reduce the risks for speech and language delay. Chronic rhinitis in the Down Syndrome patient is common. Retrognathia, hypotonia, and macroglossia can all cause obstructive sleep apnea (OSA) in this population and therefore each DS patient should get an overnight polysomnograph. Subglottic stenosis, vocal cord paralysis and laryngomalacia are not infrequently seen in the Down Syndrome patient. To reduce acquired subglottic stenosis, endotracheal tubes that are at least two sizes smaller than what is appropriate for the patient's age should be used. Down Syndrome is common and there are many Otolaryngologic manifestations. We recommend that this patient population visit an Otolaryngologist on a regular basis and that the practicing Otolaryngologist is comfortable with the management and treatment of the unique challenges faced with these children. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A Case Study: Bilingualism - The Link to International Trade in Miami.

ERIC Educational Resources Information Center

Cote, Andre; Cote, Ellyn

The metropolitan Miami area is a thriving bilingual community that uniquely exemplifies the utility of Spanish for business careers. Miami is unique in its large Latin population, the success of this population, and the proximity of Miami to the Caribbean and Latin American markets. The impact of the Latin population of Miami on education and…

Estimating avian population size using Bowden's estimator

USGS Publications Warehouse

Diefenbach, D.R.

2009-01-01

Avian researchers often uniquely mark birds, and multiple estimators could be used to estimate population size using individually identified birds. However, most estimators of population size require that all sightings of marked birds be uniquely identified, and many assume homogeneous detection probabilities. Bowden's estimator can incorporate sightings of marked birds that are not uniquely identified and relax assumptions required of other estimators. I used computer simulation to evaluate the performance of Bowden's estimator for situations likely to be encountered in bird studies. When the assumptions of the estimator were met, abundance and variance estimates and confidence-interval coverage were accurate. However, precision was poor for small population sizes (N < 50) unless a large percentage of the population was marked (>75%) and multiple (≥8) sighting surveys were conducted. If additional birds are marked after sighting surveys begin, it is important to initially mark a large proportion of the population (pm ≥ 0.5 if N ≤ 100 or pm > 0.1 if N ≥ 250) and minimize sightings in which birds are not uniquely identified; otherwise, most population estimates will be overestimated by >10%. Bowden's estimator can be useful for avian studies because birds can be resighted multiple times during a single survey, not all sightings of marked birds have to uniquely identify individuals, detection probabilities among birds can vary, and the complete study area does not have to be surveyed. I provide computer code for use with pilot data to design mark-resight surveys to meet desired precision for abundance estimates.

A guide to wound managment in palliative care.

PubMed

Naylor, Wayne A

2005-11-01

Wound management in palliative patients is often a very challenging area of care. There are many unique issues that can combine to produce complicated wound management scenarios, including the types of wounds and wound symptoms most commonly affecting palliative care patients, as well as the presence of concurrent disease and associated treatment. Problems exist with the availability of suitable dressings and balancing life expectancy with the goals of wound care. A significant, and possibly under-recognized, issue is the emotional and social distress experienced by these patients, which can be directly attributed to their wound. These problems must all be recognized and addressed in order to manage wounds effectively in this patient population. This article aims to explore these issues and offer advice on the management of wound-related symptoms, with the ultimate goal of improving patients' quality of life.

Establishment and baseline characteristics of a nationwide Danish cohort of patients with Ehlers-Danlos syndrome.

PubMed

Kulas Søborg, Marie-Louise; Leganger, Julie; Quitzau Mortensen, Laura; Rosenberg, Jacob; Burcharth, Jakob

2017-05-01

The aim of this study was to investigate national prevalence, general demographic characteristics and survival of Danish patients with Ehlers-Danlos syndrome (EDS). A population-based cohort study was conducted using a database consisting of the entire Danish population alive at any given time between 1 January 2000 and 31 December 2012, based upon longitudinal Danish national registers. All patients with EDS were identified, and the cohort was described by disease prevalence, basic demographic characteristics, mean age at death and mortality for the observational period of 13 years. The cohort held 1427 unique persons with EDS, giving a national prevalence of 0.02%. The EDS population had a mean ( s . d .) age of 34.9 (18.6) years and comprised 73.9% females and 26.1% males. Of the cohort, 95.9% originated from Denmark and 57% were unmarried. We found that 31.6% of the cohort received state-granted subsidies, of which 77% were in the form of early retirement pension. Regarding educational status, 28.1% of the EDS cohort had completed primary education (⩽10th grade) as their highest educational level, while 71.9% had completed a higher level. During the observation period, 42 patients died, with a mean ( s . d .) age at death of 53.6 (21.7) years. This study confirmed a small national prevalence of patients diagnosed with EDS and showed that the majority of patients diagnosed are female. The EDS cohort had a lower educational level, mean age and life expectancy compared with the background population and showed a predisposition for receiving state-granted subsidies. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

The association of sleep difficulties with health-related quality of life among patients with fibromyalgia

PubMed Central

2012-01-01

Background Difficulty sleeping is common among patients with fibromyalgia (FM); however, its impact on health-related quality of life (HRQoL) is not well understood. The aim of the current study was to assess the burden of sleep difficulty symptoms on HRQoL among patients with FM. Methods The current study included data from the 2009 National Health and Wellness Survey (N=75,000), which is a cross-sectional, Internet-based survey representative of the adult US population. The prevalence of sleep difficulty symptoms among patients with FM (n=2,196) were compared with matched controls (n=2,194), identified using propensity-score matching. Additionally, the relationship between the number of sleep difficulty symptoms (none, one, or two or more) and HRQoL (using the SF-12v2) was assessed using regression modeling, controlling for demographic and health history variables. Results Of the 2,196 patients with FM, 11.2% reported no sleep difficulty symptoms, 25.7% reported one sleep difficulty symptom, and 63.05% reported two or more sleep difficulty symptoms. The prevalence of sleep difficulty symptoms was significantly higher than matched controls. Patients with one and two sleep difficulty symptoms both reported significantly worse HRQoL summary and domain scores relative to those with no sleep difficulty symptoms (all p<.05). Further, the relationship between sleep difficulty symptoms and HRQoL was significantly different between those with FM than matched controls, suggesting a uniqueness of the burden of sleep difficulties within the FM population. Conclusions Among the FM population, sleep difficulty symptoms were independently associated with clinically-meaningful decrements in mental and physical HRQoL. These results suggest that greater emphasis in the treatment of sleep difficulty symptoms among the FM population may be warranted. PMID:23072292

The association of sleep difficulties with health-related quality of life among patients with fibromyalgia.

PubMed

Wagner, Jan-Samuel; DiBonaventura, Marco D; Chandran, Arthi B; Cappelleri, Joseph C

2012-10-17

Difficulty sleeping is common among patients with fibromyalgia (FM); however, its impact on health-related quality of life (HRQoL) is not well understood. The aim of the current study was to assess the burden of sleep difficulty symptoms on HRQoL among patients with FM. The current study included data from the 2009 National Health and Wellness Survey (N=75,000), which is a cross-sectional, Internet-based survey representative of the adult US population. The prevalence of sleep difficulty symptoms among patients with FM (n=2,196) were compared with matched controls (n=2,194), identified using propensity-score matching. Additionally, the relationship between the number of sleep difficulty symptoms (none, one, or two or more) and HRQoL (using the SF-12v2) was assessed using regression modeling, controlling for demographic and health history variables. Of the 2,196 patients with FM, 11.2% reported no sleep difficulty symptoms, 25.7% reported one sleep difficulty symptom, and 63.05% reported two or more sleep difficulty symptoms. The prevalence of sleep difficulty symptoms was significantly higher than matched controls. Patients with one and two sleep difficulty symptoms both reported significantly worse HRQoL summary and domain scores relative to those with no sleep difficulty symptoms (all p<.05). Further, the relationship between sleep difficulty symptoms and HRQoL was significantly different between those with FM than matched controls, suggesting a uniqueness of the burden of sleep difficulties within the FM population. Among the FM population, sleep difficulty symptoms were independently associated with clinically-meaningful decrements in mental and physical HRQoL. These results suggest that greater emphasis in the treatment of sleep difficulty symptoms among the FM population may be warranted.

Tissues from population-based cancer registries: a novel approach to increasing research potential.

PubMed

Goodman, Marc T; Hernandez, Brenda Y; Hewitt, Stephen; Lynch, Charles F; Coté, Timothy R; Frierson, Henry F; Moskaluk, Christopher A; Killeen, Jeffrey L; Cozen, Wendy; Key, Charles R; Clegg, Limin; Reichman, Marsha; Hankey, Benjamin F; Edwards, Brenda

2005-07-01

Population-based cancer registries, such as those included in the Surveillance, Epidemiology, and End-Results (SEER) Program, offer tremendous research potential beyond traditional surveillance activities. We describe the expansion of SEER registries to gather formalin-fixed, paraffin-embedded tissue from cancer patients on a population basis. Population-based tissue banks have the advantage of providing an unbiased sampling frame for evaluating the public health impact of genes or protein targets that may be used for therapeutic or diagnostic purposes in defined communities. Such repositories provide a unique resource for testing new molecular classification schemes for cancer, validating new biologic markers of malignancy, prognosis and progression, assessing therapeutic targets, and measuring allele frequencies of cancer-associated genetic polymorphisms or germline mutations in representative samples. The assembly of tissue microarrays will allow for the use of rapid, large-scale protein-expression profiling of tumor samples while limiting depletion of this valuable resource. Access to biologic specimens through SEER registries will provide researchers with demographic, clinical, and risk factor information on cancer patients with assured data quality and completeness. Clinical outcome data, such as disease-free survival, can be correlated with previously validated prognostic markers. Furthermore, the anonymity of the study subject can be protected through rigorous standards of confidentiality. SEER-based tissue resources represent a step forward in true, population-based tissue repositories of tumors from US patients and may serve as a foundation for molecular epidemiology studies of cancer in this country.

Staphylococcus aureus infections in pediatric oncology patients: high rates of antimicrobial resistance, antiseptic tolerance and complications.

PubMed

McNeil, J Chase; Hulten, Kristina G; Kaplan, Sheldon L; Mahoney, Donald H; Mason, Edward O

2013-02-01

: Patients with malignancies represent a population at high risk for drug-resistant infections. We sought to determine the clinical spectrum and molecular epidemiology of Staphylococcus aureus infections in pediatric oncology patients followed at Texas Children's Hospital (Houston, TX). Furthermore, we determined the prevalence of the chlorhexidine resistance gene qacA/B from isolates in this unique population. : Patients with a history of malignancy and a culture-proven S. aureus infection were identified from 2001 to 2011. Antibiotic susceptibility, pulsed-field gel electrophoresis and detection of qacA/B by polymerase chain reaction were performed on all isolates. Medical records for all patients were reviewed. : During the study period, 213 isolates were identified from 179 patients with malignancies. Thirty-one percent of the isolates were methicillin-resistant S. aureus. The most common infectious diagnosis was bacteremia (85/213 [39.9%], with 72/85 [84.7%] being catheter-associated). Thirteen patients with bacteremia were found to have pulmonary nodules at the time of presentation; only S. aureus was found in tissue in 5 of the 6 patients who underwent lung biopsy. After 2007, 18.2% of isolates were qacA/B positive with a steady increase in prevalence every year (χ for trend P = 0.04). : S. aureus is a significant cause of morbidity and mortality in pediatric oncology patients at Texas Children's Hospital. In addition to the more well-known clinical manifestations, this pathogen can also be associated with pulmonary nodules. Furthermore, the prevalence of S. aureus isolates carrying antiseptic resistance genes increased in this population. Additional clinical and molecular studies and surveillance among pediatric oncology patients are warranted to further explore these findings.

Multi-Disciplinary Management of Athletes with Post-Concussion Syndrome: An Evolving Pathophysiological Approach.

PubMed

Ellis, Michael J; Leddy, John; Willer, Barry

2016-01-01

Historically, patients with sports-related concussion (SRC) have been managed in a uniform fashion consisting mostly of prescribed physical and cognitive rest with the expectation that all symptoms will spontaneously resolve with time. Although this approach will result in successful return to school and sports activities in the majority of athletes, an important proportion will develop persistent concussion symptoms characteristic of post-concussion syndrome (PCS). Recent advances in exercise science, neuroimaging, and clinical research suggest that the clinical manifestations of PCS are mediated by unique pathophysiological processes that can be identified by features of the clinical history and physical examination as well as the use of graded aerobic treadmill testing. Athletes who develop PCS represent a unique population whose care must be individualized and must incorporate a rehabilitative strategy that promotes enhanced recovery of concussion-related symptoms while preventing physical deconditioning. In this review, we present our evolving evidence-based approach to evaluation and management of athletes with PCS that aims to identify the pathophysiological mechanisms mediating persistent concussion symptoms and guides the initiation of individually tailored rehabilitation programs that target these processes. In addition, we outline the important qualified roles that multi-disciplinary healthcare professionals can play in the management of this patient population, and discuss where future research efforts must be focused to further evaluate this evolving pathophysiological approach.

Multi-Disciplinary Management of Athletes with Post-Concussion Syndrome: An Evolving Pathophysiological Approach

PubMed Central

Ellis, Michael J.; Leddy, John; Willer, Barry

2016-01-01

Historically, patients with sports-related concussion (SRC) have been managed in a uniform fashion consisting mostly of prescribed physical and cognitive rest with the expectation that all symptoms will spontaneously resolve with time. Although this approach will result in successful return to school and sports activities in the majority of athletes, an important proportion will develop persistent concussion symptoms characteristic of post-concussion syndrome (PCS). Recent advances in exercise science, neuroimaging, and clinical research suggest that the clinical manifestations of PCS are mediated by unique pathophysiological processes that can be identified by features of the clinical history and physical examination as well as the use of graded aerobic treadmill testing. Athletes who develop PCS represent a unique population whose care must be individualized and must incorporate a rehabilitative strategy that promotes enhanced recovery of concussion-related symptoms while preventing physical deconditioning. In this review, we present our evolving evidence-based approach to evaluation and management of athletes with PCS that aims to identify the pathophysiological mechanisms mediating persistent concussion symptoms and guides the initiation of individually tailored rehabilitation programs that target these processes. In addition, we outline the important qualified roles that multi-disciplinary healthcare professionals can play in the management of this patient population, and discuss where future research efforts must be focused to further evaluate this evolving pathophysiological approach. PMID:27605923

Cancer and the LGBTQ Population: Quantitative and Qualitative Results from an Oncology Providers’ Survey on Knowledge, Attitudes, and Practice Behaviors

PubMed Central

Tamargo, Christina L.; Sanchez, Julian A.

2017-01-01

Background: Despite growing social acceptance, the LGBTQ population continues to face barriers to healthcare including fear of stigmatization by healthcare providers, and providers’ lack of knowledge about LGBTQ-specific health issues. This analysis focuses on the assessment of quantitative and qualitative responses from a subset of providers who identified as specialists that treat one or more of the seven cancers that may be disproportionate in LGBTQ patients. Methods: A 32-item web-based survey was emailed to 388 oncology providers at a single institution. The survey assessed: demographics, knowledge, attitudes, and practice behaviors. Results: Oncology providers specializing in seven cancer types had poor knowledge of LGBTQ-specific health needs, with fewer than half of the surveyed providers (49.5%) correctly answering knowledge questions. Most providers had overall positive attitudes toward LGBTQ patients, with 91.7% agreeing they would be comfortable treating this population, and would support education and/or training on LGBTQ-related cancer health issues. Conclusion: Results suggest that despite generally positive attitudes toward the LGBTQ population, oncology providers who treat cancer types most prevalent among the population, lack knowledge of their unique health issues. Knowledge and practice behaviors may improve with enhanced education and training on this population’s specific needs. PMID:28991160

[The medical autonomy of elderly in Taiwan].

PubMed

Chen, Kai-Li; Chen, Ching-Huey

2014-10-01

The elderly population is increasing rapidly in Taiwan. With the average life expectancy on the rise, the elderly have become major consumers of healthcare products and services. Factors that influence respect for autonomy, a core value of medical ethics, may be related to family, society, and the medical culture. Especially in patients who are already elderly, aging causes declines in physical, mental and societal capacities. Practicing a respect for patient autonomy is particularly challenging for healthcare professionals in Taiwan due the unique culture background of elderly Taiwanese patients. This article reviews and integrates the literature related to the issue of patient autonomy and elaborates on medical decision-making among elderly patients in Taiwan in the contexts of: the disadvantages faced by the elderly, the background of Chinese culture, and the current medical decision-making environment. A few suggestions are proposed to help preserve the medical-decision-making autonomy of elderly patients in Taiwan.

Results of a voter registration project at 2 family medicine residency clinics in the Bronx, New York.

PubMed

Liggett, Alisha; Sharma, Manisha; Nakamura, Yumiko; Villar, Ryna; Selwyn, Peter

2014-01-01

Federally qualified health centers provide care to medically underserved populations, the same individuals often underrepresented in the electoral process. These centers are unique venues to access patients for voter registration services. We undertook a clinician-led, nonpartisan voter registration drive within 2 university-affiliated federally qualified health centers in the Bronx, New York. Patients were approached by voter registration volunteers in clinic waiting areas during a 12-week period. Volunteers directly engaged with 304 patients. Of the 128 patients who were eligible and not currently registered, 114 (89%) registered to vote through this project. This number corresponded to 38% of all patients engaged. Sixty-five percent of new registrants were aged younger than 40 years. This project was successful in registering clinic patients to vote. Clinics are not only health centers, but also powerful vehicles for bringing a voice to civically disenfranchised communities. © 2014 Annals of Family Medicine, Inc.

CD34+CD38-CD123+ Cells Are Present in Virtually All Acute Myeloid Leukaemia Blasts: A Promising Single Unique Phenotype for Minimal Residual Disease Detection.

PubMed

Al-Mawali, Adhra; Pinto, Avinash Daniel; Al-Zadjali, Shoaib

In CD34-positive acute myeloid leukaemia (AML), the leukaemia-initiating event likely takes place in the CD34+CD38- cell compartment. CD123 has been shown to be a unique marker of leukaemic stem cells within the CD34+CD38- compartment. The aim of this study was to identify the percentage of CD34+CD38-CD123+ cells in AML blasts, AML CD34+CD38- stem cells, and normal and regenerating bone marrow CD34+CD38- stem cells from non-myeloid malignancies. Thirty-eight adult de novo AML patients with intention to treat were enrolled after the application of inclusion criteria from February 2012 to February 2017. The percentage of the CD34+CD38-CD123+ phenotype in the blast population at diagnosis was determined using a CD45-gating strategy and CD34+ backgating by flow cytometry. We studied the CD34+CD38-CD123+ fraction in AML blasts at diagnosis, and its utility as a unique phenotype for minimal residual disease (MRD) of AML patients. CD123+ cells were present in 97% of AML blasts in patients at diagnosis (median 90%; range 21-99%). CD123+ cells were also present in 97% of the CD34+CD38- compartment (median 0.8164%, range 0.0262-39.7%). Interestingly, CD123 was not present in normal and regenerating CD34+CD38- bone marrow stem cells (range 0.002- 0.067 and 0.004-0.086, respectively). The CD34+CD38-CD123+ phenotype is present in virtually all AML blasts and it may be used as a unique single phenotype for MRD detection in AML patients. © 2017 The Author(s) Published by S. Karger AG, Basel.

Malignancy in Children with Trisomy 21

PubMed Central

Rabin, Karen R.; Whitlock, James A.

2009-01-01

Patients with Down syndrome (DS) display a unique spectrum of malignancies, with a 10 to 20-fold increased risk of acute leukemias, and a markedly decreased incidence of solid tumors. This review discusses current understanding of the basis for this distinctive pattern of cancer incidence, and the clinical and biologic features of the malignant disorders most frequent in DS: transient myeloproliferative disease, acute megakaryoblastic leukemia, and acute lymphoblastic leukemia. We also review distinctive pharmacogenetic issues, highlighting the differential chemosensitivity and toxicity profiles of DS patients compared to the general population; and epidemiologic studies of protective and adverse environmental risk factors for development of leukemia. PMID:19176633

Riga-Fede-like disease in an AIDS patient.

PubMed

Cunha, Vanessa Santos; Rocha Zanol, Jorge David; Sprinz, Eduardo

2007-12-01

Riga-Fede disease is a benign and ulcerative process that occurs as a result of repetitive trauma of the oral mucosal surfaces by the teeth. The authors describe here a case of a 40-year-old man in rescue therapy for advanced AIDS with a 2-month history of an ulcerated area on the dorsal surface of his tongue, which was histopathologically consistent with Riga-Fede disease. This case report is unique because it is the first time that this lesion has been reported in an AIDS patient, and Riga-Fede disease should be included in the differential diagnosis of a tongue ulcer in these populations.

Cystic fibrosis, common variable immunodeficiency and Aspergers syndrome: an immunological and behavioural challenge.

PubMed

Chotirmall, S H; Low, T B; Hassan, T; Branagan, P; Kernekamp, C; Flynn, M G; Gunaratnam, C; McElvaney, N G

2011-06-01

Cystic fibrosis (CF) is of particular importance in Ireland as the Irish population has both the highest incidence (2.98/10,000) and the highest carrier rate (1 in 19) in the world. Primary immunodeficiency has not been previously reported as co-existing with CF. We report a unique case of CF associated with a primary immunodeficiency syndrome--common variable immunodeficiency (CVID). Our patient has CF, CVID and the additional comorbidity of Aspergers syndrome. The challenges inherent in diagnosing and treating such a case are outlined herein and the successful management of this case is evidenced by the well-preserved lung function of our patient.

Ventricular assist device use in single ventricle congenital heart disease.

PubMed

Carlo, Waldemar F; Villa, Chet R; Lal, Ashwin K; Morales, David L

2017-11-01

As VAD have become an effective therapy for end-stage heart failure, their application in congenital heart disease has increased. Single ventricle congenital heart disease introduces unique physiologic challenges for VAD use. However, with regard to the mixed clinical results presented within this review, we suggest that patient selection, timing of implant, and center experience are all important contributors to outcome. This review focuses on the published experience of VAD use in single ventricle patients and details physiologic challenges and novel approaches in this growing pediatric and adult population. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Spinal cord injured women's treatment of breast carcinoma: alert to complications.

PubMed

de Padua, Ashley L; Strickland, Kimberly; Patrick, Mary; Ditunno, John F

2018-01-01

Women with spinal cord injury (SCI) and who develop breast cancer are a vulnerable and potentially overlooked population. They experience risk factors owing to decreased mobility and are at risk for unique complications from their oncologic treatment. A 54-year-old woman who suffered a T6 AIS A traumatic SCI in 1981, who was diagnosed 32 years later with estrogen receptor and progesterone receptor positive and human epidermal growth factor receptor 2-negative invasive ductal carcinoma. During the course of her chemotherapy, she experienced several complications, including reflexive diaphoresis, urinary tract infection, leukopenia, anemia, dehydration, and weakness. These contributed to the development of a stage 4 ischial pressure sore, which required complex treatment. There is a paucity of literature examining the complications of chemotherapy that may be unique to those with SCI. Physiatrists will be seeing more women undergoing oncologic care, as this population of patients ages. A multidisciplinary approach that takes into account the pathophysiologic changes associated with SCI is crucial to understand and prevent complications that could affect their outcomes and contribute to increased cost in a value-based health-care system.

Katrina's Legacy: Processes for Patient Disaster Preparation have Improved but Important Gaps Remain

PubMed Central

Icenogle, Marjorie; Eastburn, Sasha; Arrieta, Martha

2016-01-01

Background Ensuring continuity of care for the chronically ill, who are elderly or indigent presents unique challenges after disasters; this population has fewer financial resources, is less likely to evacuate, has limited access to recovery resources, and is significantly dependent on charitable and government-funded institutions for care. This study expands a previous investigation of the extent to which healthcare providers in coastal Mississippi and Alabama have made changes to facilitate continued care to these populations after disasters. Methods Key informants representing healthcare and social services organizations serving health disparate residents of the Mississippi and Alabama Gulf Coast were interviewed regarding disaster preparation planning for the period 2009-2012. Interview transcripts were qualitatively coded and analyzed for emerging themes using Atlas.ti® software. Results Participant organizations have implemented changes to ensure continuity of care for the chronically ill in case of disasters. Changes include patient assistance with pre-disaster preparation and training; evacuation planning and assistance; support to find resources in evacuation destinations; equipping patients with prescription information, diagnoses, treatment plans, and advance medications when a disaster is imminent; multiple methods for patients to communicate with providers; and more mandated medical needs shelters. Patients whose chronic conditions were diagnosed post-Katrina are more likely to underestimate the need to prepare. Further, patients' lack of compliance tends to increase as time passes from disasters. Conclusions Although changes were implemented, results indicate these may be inadequate to completely address patient needs. Thus, additional efforts may be needed, underscoring the complexity of adequate disaster preparation among disparate populations. PMID:27865292

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Evidence of Big-Five personality changes following acquired brain injury from a prospective longitudinal investigation.

PubMed

Leonhardt, Anne; Schmukle, Stefan C; Exner, Cornelia

2016-03-01

Many studies using different assessment methods have reported personality changes after acquired brain injury (ABI). However, to our knowledge, no prospective study has yet been conducted to examine whether previous cross-sectional and retrospective results can be replicated in a longitudinal prospective design. Further, because clinical control groups were only rarely used, it remains debatable if the personality changes found are unique to patients with ABI or if they also affect patients with other disabilities. This study examined personality change in 114 participants with different kinds of ABI, 1321 matched controls (general control, GC), and 746 matched participants with restrictive impairments other than brain injury (clinical control, CC) in a prospective longitudinal design using data from the panel survey Household, Income and Labour Dynamics in Australia (HILDA). Participants with ABI showed significantly larger declines in Extraversion and Conscientiousness compared with the GC group. When the ABI participants were compared with the CC group, only the difference in Conscientiousness remained significant. Our prospective data corroborate evidence from previous cross-sectional studies that patients with ABI experience larger declines in Extraversion and Conscientiousness than the general population. Whereas the effect on Conscientiousness was unique to patients with ABI, the decline in Extraversion was also observed in participants with other impairments. Copyright © 2016 Elsevier Inc. All rights reserved.

Safety and efficacy of aneurysm treatment with WEB in the cumulative population of three prospective, multicenter series.

PubMed

Pierot, Laurent; Moret, Jacques; Barreau, Xavier; Szikora, Istvan; Herbreteau, Denis; Turjman, Francis; Holtmannspötter, Markus; Januel, Anne-Christine; Costalat, Vincent; Fiehler, Jens; Klisch, Joachim; Gauvrit, Jean-Yves; Weber, Werner; Desal, Hubert; Velasco, Stéphane; Liebig, Thomas; Stockx, Luc; Berkefeld, Joachim; Molyneux, Andrew; Byrne, James; Spelle, Laurent

2018-06-01

Flow disruption with the WEB is an innovative endovascular approach for treatment of wide-neck bifurcation aneurysms. Initial studies have shown a low complication rate with good efficacy. To report clinical and anatomical results of the WEB treatment in the cumulative population of three Good Clinical Practice (GCP) studies: WEBCAST (WEB Clinical Assessment of Intrasaccular Aneurysm), French Observatory, and WEBCAST-2. WEBCAST, French Observatory, and WEBCAST-2 are single-arm, prospective, multicenter, GCP studies dedicated to the evaluation of WEB treatment. Clinical data were independently evaluated. Postoperative and 1-year aneurysm occlusion was independently evaluated using the 3-grade scale: complete occlusion, neck remnant, and aneurysm remnant. The cumulative population comprised 168 patients with 169 aneurysms, including 112 female subjects (66.7%). The patients' ages ranged between 27 and 77 years (mean 55.5±10.2 years). Aneurysm locations were middle cerebral artery in 86/169 aneurysms (50.9%), anterior communicating artery in 36/169 (21.3%), basilar artery in 30/169 (17.8%), and internal carotid artery terminus in 17/169 (10.1%). The aneurysm was ruptured in 14/169 (8.3%). There was no mortality at 1 month and procedure/device-related morbidity was 1.2% (2/168). At 1 year, complete aneurysm occlusion was observed in 81/153 aneurysms (52.9%), neck remnant in 40/153 aneurysms (26.1%), and aneurysm remnant in 32/153 aneurysms (20.9%). Re-treatment was carried out in 6.9%. This series is at the moment the largest prospective, multicenter, GCP series of patients with aneurysms treated with WEB. It shows the high safety and good mid-term efficacy of this treatment. French Observatory: Unique identifier (NCT18069); WEBCAST and WEBCAST-2: Unique identifier (NCT01778322). © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Asymptomatic bacteriuria: when to screen and when to treat.

PubMed

Nicolle, Lindsay E

2003-06-01

Asymptomatic bacteriuria is common. Populations with structural or functional abnormalities of the genitourinary tract may have an exceedingly high prevalence of bacteriuria, but even healthy individuals frequently have positive urine cultures. Asymptomatic bacteriuria is seldom associated with adverse outcomes. Pregnant women and individuals who are to undergo traumatic genitourinary interventions are at risk for complications of bacteriuria and benefit from screening and treatment programs. Although screening is recommended for renal transplant recipients, the benefits for these patients are less clear. For other populations, including most bacteriuric individuals, negative outcomes attributable to asymptomatic bacteriuria have not been described. Treatment of asymptomatic bacteriuria in these patients is not beneficial and, in fact, may be associated with harmful outcomes, such as increased short-term frequency of symptomatic infection, adverse drug effects, and reinfection with organisms of increased antimicrobial resistance. Screening for asymptomatic bacteriuria and treatment is recommended for only selected groups where benefit has been shown. Many research questions still need to be addressed. Different populations have unique risk factors, and the benefits and risks of different management approaches for asymptomatic bacteriuria must continue to be addressed systematically in appropriate clinical trials.

The Risks to Patient Privacy from Publishing Data from Clinical Anesthesia Studies.

PubMed

O'Neill, Liam; Dexter, Franklin; Zhang, Nan

2016-06-01

In this article, we consider the privacy implications of posting data from small, randomized trials, observational studies, or case series in anesthesia from a few (e.g., 1-3) hospitals. Prior to publishing such data as supplemental digital content, the authors remove attributes that could be used to re-identify individuals, a process known as "anonymization." Posting health information that has been properly "de-identified" is assumed to pose no risks to patient privacy. Yet, computer scientists have demonstrated that this assumption is flawed. We consider various realistic scenarios of how the publication of such data could lead to breaches of patient privacy. Several examples of successful privacy attacks are reviewed, as well as the methods used. We survey the latest models and methods from computer science for protecting health information and their application to posting data from small anesthesia studies. To illustrate the vulnerability of such published data, we calculate the "population uniqueness" for patients undergoing one or more surgical procedures using data from the State of Texas. For a patient selected uniformly at random, the probability that an adversary could match this patient's record to a unique record in the state external database was 42.8% (SE < 0.1%). Despite the 42.8% being an unacceptably high level of risk, it underestimates the risk for patients from smaller states or provinces. We propose an editorial policy that greatly reduces the likelihood of a privacy breach, while supporting the goal of transparency of the research process.

Managing migraine by patient profile: role of frovatriptan.

PubMed

Cady, Roger K; Farmer, Kathleen

2016-01-01

For the last quarter of a century, triptans have been available for acute treatment of migraine but with little guidance on which of the different triptan products to use for which patient or which attack of migraine. In this article, we propose a structured approach to analysis of individual migraine attacks and patient characteristics as a means of defining and optimizing acute intervention. Assessment of patient and attack profiles includes the "5-Ps": pattern, phenotype, patient, pharmacology, and precipitants. Attending to these five components of information can assist in developing an individualized behavioral, pharmacological, and nonpharmacological comprehensive treatment plan for most migraine patients. This clinical approach is then focused on frovatriptan because of its unique molecular signature and potential novel clinical applications. Frovatriptan like all triptans is indicated for acute treatment of migraine but its role has been explored in management of several unique migraine phenotypes. Frovatriptan has the longest half-life of any triptan and consequently is often promoted for acute treatment of migraine of longer duration. It has also been studied as a short-term preventive treatment in women with menstrual-related migraine. Given that 60% of female migraineurs suffer from menstrual-related migraine, this population is the obvious group for continued study. Small studies have also explored frovatriptan's use in treating migraine predicted by premonitory symptoms as a preventive for the headache phase of migraine. By identifying patient and attack profiles, clinicians may effectively determine the viability of frovatriptan as an effective pharmacological intervention for migraine.

Managing migraine by patient profile: role of frovatriptan

PubMed Central

Cady, Roger K; Farmer, Kathleen

2016-01-01

For the last quarter of a century, triptans have been available for acute treatment of migraine but with little guidance on which of the different triptan products to use for which patient or which attack of migraine. In this article, we propose a structured approach to analysis of individual migraine attacks and patient characteristics as a means of defining and optimizing acute intervention. Assessment of patient and attack profiles includes the “5-Ps”: pattern, phenotype, patient, pharmacology, and precipitants. Attending to these five components of information can assist in developing an individualized behavioral, pharmacological, and nonpharmacological comprehensive treatment plan for most migraine patients. This clinical approach is then focused on frovatriptan because of its unique molecular signature and potential novel clinical applications. Frovatriptan like all triptans is indicated for acute treatment of migraine but its role has been explored in management of several unique migraine phenotypes. Frovatriptan has the longest half-life of any triptan and consequently is often promoted for acute treatment of migraine of longer duration. It has also been studied as a short-term preventive treatment in women with menstrual-related migraine. Given that 60% of female migraineurs suffer from menstrual-related migraine, this population is the obvious group for continued study. Small studies have also explored frovatriptan’s use in treating migraine predicted by premonitory symptoms as a preventive for the headache phase of migraine. By identifying patient and attack profiles, clinicians may effectively determine the viability of frovatriptan as an effective pharmacological intervention for migraine. PMID:27103792

Elevated PDGFRB gene copy number gain is prognostic for improved survival outcomes in resected malignant pleural mesothelioma.

PubMed

Tsao, Anne S; Harun, Nusrat; Fujimoto, Junya; Devito, Vikki; Lee, J Jack; Kuhn, Elisabetta; Mehran, Reza; Rice, David; Moran, Cesar; Hong, Waun Ki; Shen, Li; Suraokar, Milind; Wistuba, Ignacio

2014-06-01

PDGF/PDGFR pathway has been implicated in malignant pleural mesothelioma (MPM) carcinogenesis, and evidence suggests autocrine mechanisms of proliferation. We sought to evaluate the incidence of PDGFRB gene copy number gain (CNG) by fluorescence in situ hybridization and PDGFR pathway protein expression by immunohistochemistry (IHC) and correlate it to patient clinical outcome. Eighty-eight archived tumor blocks from resected MPM with full clinical information were used to perform IHC biomarkers (PDGFRα, PDGFRβ, p-PDGFRβ) and fluorescence in situ hybridization analysis of PDGFRB gene CNG. Spearman rank correlation, Wilcoxon rank-sum test, Kruskal-Wallis test, BLiP plots, and Kaplan-Meier method were used to analyze the biomarkers and correlation to clinical outcome. Several correlations between the IHC biomarkers were seen; however, none correlated to clinically relevant patient demographics or histology. In the CNG analysis, PDGFRB gene CNG in >10% of tumor cells had lower cytoplasmic p-PDGFRβ (P=.029), while PDGFRB gene CNG in >40% of tumor cells had a higher cytoplasmic PDGFRβ (P=.04). PDGFRB gene CNG status did not associate with patient demographics or tumor characteristics. PDGFR pathway IHC biomarkers did not associate with survival outcomes. However, patients with PDGFRB CNG >40% of tumor cells had improved relapse-free survival (HR 0.25 [95% CI 0.09-0.72], P=.0096) and improved overall survival (HR 0.32 [95% CI 0.11-0.89], P=.029). PDGFRB CNG >40% of MPM tumor cells is a potential prognostic biomarker for surgery and may identify a unique population of mesothelioma patients. Future validation of this biomarker in prospective trials is needed. From a retrospective review of archived tissue specimens from patients with resected malignant pleural mesothelioma tumors, we show that patients with PDGFRB CNG >40% of tumor cells had improved relapse-free survival (HR 0.25 [95% CI 0.09-0.72], P=.0096) and improved overall survival (HR 0.32 [95% CI 0.11-0.89], P=.029). PDGFRB CNG >40% of MPM tumor cells is a potential prognostic biomarker for surgery and may identify a unique population of mesothelioma patients. Copyright © 2014 Elsevier Inc. All rights reserved.

Hereditary spastic paraplegia in Greece: characterisation of a previously unexplored population using next-generation sequencing

PubMed Central

Lynch, David S; Koutsis, Georgios; Tucci, Arianna; Panas, Marios; Baklou, Markella; Breza, Marianthi; Karadima, Georgia; Houlden, Henry

2016-01-01

Hereditary Spastic Paraplegia (HSP) is a syndrome characterised by lower limb spasticity, occurring alone or in association with other neurological manifestations, such as cognitive impairment, seizures, ataxia or neuropathy. HSP occurs worldwide, with different populations having different frequencies of causative genes. The Greek population has not yet been characterised. The purpose of this study was to describe the clinical presentation and molecular epidemiology of the largest cohort of HSP in Greece, comprising 54 patients from 40 families. We used a targeted next-generation sequencing (NGS) approach to genetically assess a proband from each family. We made a genetic diagnosis in >50% of cases and identified 11 novel variants. Variants in SPAST and KIF5A were the most common causes of autosomal dominant HSP, whereas SPG11 and CYP7B1 were the most common cause of autosomal recessive HSP. We identified a novel variant in SPG11, which led to disease with later onset and may be unique to the Greek population and report the first nonsense mutation in KIF5A. Interestingly, the frequency of HSP mutations in the Greek population, which is relatively isolated, was very similar to other European populations. We confirm that NGS approaches are an efficient diagnostic tool and should be employed early in the assessment of HSP patients. PMID:26374131

Katrina's Legacy: Processes for Patient Disaster Preparation Have Improved but Important Gaps Remain.

PubMed

Icenogle, Marjorie; Eastburn, Sasha; Arrieta, Martha

2016-11-01

Ensuring continuity of care for patients with chronic illness, who are elderly or indigent presents unique challenges after disasters; this population has fewer financial resources, is less likely to evacuate, has limited access to recovery resources and is significantly dependent on charitable and government-funded institutions for care. This study expands a previous investigation of the extent to which healthcare providers in coastal Mississippi and Alabama have made changes to facilitate continued care to these populations after disasters. Key informants representing healthcare and social services organizations serving health-disparate residents of the Mississippi and Alabama Gulf Coast were interviewed regarding disaster preparation planning for the period of 2009-2012. Interview transcripts were qualitatively coded and analyzed for emerging themes using ATLAS.ti software. Participant organizations have implemented changes to ensure continuity of care for patients with chronic illness in case of disasters. Changes include patient assistance with predisaster preparation and training; evacuation planning and assistance; support to find resources in evacuation destinations; equipping patients with prescription information, diagnoses, treatment plans and advance medications when a disaster is imminent; multiple methods for patients to communicate with providers and more mandated medical needs shelters. Patients whose chronic conditions were diagnosed post-Katrina are more likely to underestimate the need to prepare. Further, patients' lack of compliance tends to increase as time passes from disasters. Although changes were implemented, results indicate that these may be inadequate to completely address patient needs. Thus, additional efforts may be needed, underscoring the complexity of adequate disaster preparation among disparate populations. Copyright © 2016 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Internet-based data inclusion in a population-based European collaborative follow-up study of inflammatory bowel disease patients: Description of methods used and analysis of factors influencing response rates

PubMed Central

Wolters, Frank L; van Zeijl, Gilbert; Sijbrandij, Jildou; Wessels, Frederik; O’Morain, Colm; Limonard, Charles; Russel, Maurice G; Stockbrügger, Reinhold W

2005-01-01

AIM: To describe an Internet-based data acquisition facility for a European 10-year clinical follow-up study project of a population-based cohort of inflammatory bowel disease (IBD) patients and to investigate the influence of demographic and disease related patient characteristics on response rates. METHODS: Thirteen years ago, the European Collaborative study group of IBD (EC-IBD) initiated a population-based prospective inception cohort of 2 201 uniformly diagnosed IBD patients within 20 well-described geographical areas in 11 European countries and Israel. For the 10-year follow-up of this cohort, an electronic patient questionnaire (ePQ) and electronic physician per patient follow-up form (ePpPFU) were designed as two separate data collecting instruments and made available through an Internet-based website. Independent demographic and clinical determinants of ePQ participation were analyzed using multivariate logistic regression. RESULTS: In 958 (316 CD and 642 UC) out of a total number of 1 505 (64%) available IBD patients, originating from 13 participating centers from nine different countries, both ePQ and ePpPFU were completed. Patients older than 40 years at ePQ completion (OR: 1.53 (95%CI: 1.14-2.05)) and those with active disease during the 3 mo previous to ePQ completion (OR: 3.32 (95%CI: 1.57-7.03)) were significantly more likely to respond. CONCLUSION: An Internet-based data acquisition tool appeared successful in sustaining a unique Western-European and Israelian multi-center 10-year clinical follow-up study project in patients afflicted with IBD. PMID:16437663

Internet-based data inclusion in a population-based European collaborative follow-up study of inflammatory bowel disease patients: description of methods used and analysis of factors influencing response rates.

PubMed

Wolters, Frank L; van Zeijl, Gilbert; Sijbrandij, Jildou; Wessels, Frederik; O'Morain, Colm; Limonard, Charles; Russel, Maurice G; Stockbrugger, Reinhold W

2005-12-07

To describe an Internet-based data acquisition facility for a European 10-year clinical follow-up study project of a population-based cohort of inflammatory bowel disease (IBD) patients and to investigate the influence of demographic and disease related patient characteristics on response rates. Thirteen years ago, the European Collaborative study group of IBD (EC-IBD) initiated a population-based prospective inception cohort of 2 201 uniformly diagnosed IBD patients within 20 well-described geographical areas in 11 European countries and Israel. For the 10-year follow-up of this cohort, an electronic patient questionnaire (ePQ) and electronic physician per patient follow-up form (ePpPFU) were designed as two separate data collecting instruments and made available through an Internet-based website. Independent demographic and clinical determinants of ePQ participation were analyzed using multivariate logistic regression. In 958 (316 CD and 642 UC) out of a total number of 1 505 (64%) available IBD patients, originating from 13 participating centers from nine different countries, both ePQ and ePpPFU were completed. Patients older than 40 years at ePQ completion (OR: 1.53 (95%CI: 1.14-2.05)) and those with active disease during the 3 mo previous to ePQ completion (OR: 3.32 (95%CI: 1.57-7.03)) were significantly more likely to respond. An Internet-based data acquisition tool appeared successful in sustaining a unique Western-European and Israelian multi-center 10-year clinical follow-up study project in patients afflicted with IBD.

Antithrombotic therapy in peripheral artery disease: A review of the EUCLID trial results and current ongoing trials.

PubMed

Ward, Rachael; Long, Chandler; Patel, Manesh R; Jones, William S

2018-01-01

In addition to risk-factor modification, antithrombotic therapy is the hallmark of management to reduce cardiovascular ischemic events in patients with peripheral artery disease (PAD). Currently, the guidelines recommend long-term antiplatelet therapy with aspirin or clopidogrel in this patient population to reduce myocardial infarction, stroke, and vascular death. Past outcomes studies have shown some benefit of ticagrelor, another antiplatelet agent, as compared with clopidogrel in patients with coronary disease and concomitant PAD. However, most recently, the Examining Use of Ticagrelor in Peripheral Artery Disease (EUCLID) trial has shown no additional benefit of ticagrelor over clopidogrel. In this trial, a minority of patients had concomitant coronary artery disease, making it unique to previous studies. The EUCLID trial's evidence of neutrality between clopidogrel and ticagrelor sheds light into the complexity of studying the PAD population and the continued need to meticulously design trials to investigate the optimal therapies. The topics that will be discussed in this review include the role of antiplatelet therapy in the management of patients with PAD, a review of the EUCLID trial results and the important factors to be considered in interpreting the surprising results, and promising recent ongoing clinical trials assessing therapies in the treatment of patients with PAD. © 2018 Wiley Periodicals, Inc.

Asian motility studies in irritable bowel syndrome.

PubMed

Lee, Oh Young

2010-04-01

Altered motility remains one of the important pathophysiologic factors in patients with irritable bowel syndrome (IBS) who commonly complain of abdominal pain and stool changes such as diarrhea and constipation. The prevalence of IBS has increased among Asian populations these days. Gastrointestinal (GI) physiology may vary between Asian and Western populations because of differences in diets, socio-cultural backgrounds, and genetic factors. The characteristics and differences of GI dysmotility in Asian IBS patients were reviewed. MEDLINE search work was performed including following terms, 'IBS,' 'motility,' 'transit time,' 'esophageal motility,' 'gastric motility,' 'small intestinal motility,' 'colonic motility,' 'anorectal function,' and 'gallbladder motility' and over 100 articles were categorized under 'esophagus,' 'stomach,' 'small intestine,' 'colon,' 'anorectum,' 'gallbladder,' 'transit,' 'motor pattern,' and 'effect of stressors.' Delayed gastric emptying, slow tansit in constipation predominant IBS patients, rapid transit in diarrhea predominant IBS patients, accelerated motility responses to various stressors such as meals, mental stress, or corticotrophin releasing hormones, and altered rectal compliance and altered rectal accomodation were reported in many Asian studies regarding IBS. Many conflicting results were found among these studies and there are still controversies to conclude these as unique features of Asian IBS patients. Multinational and multicenter studies are needed to be performed vigorously in order to elaborate characteristics as well as differences of altered motililty in Asian patients with IBS.

Elderly persons with ICU-acquired weakness: the potential role for β-hydroxy-β-methylbutyrate (HMB) supplementation?

PubMed

Rahman, Adam; Wilund, Kenneth; Fitschen, Peter J; Jeejeebhoy, Khursheed; Agarwala, Ravi; Drover, John W; Mourtzakis, Marina

2014-07-01

Intensive care unit (ICU)-acquired weakness is common and characterized by muscle loss, weakness, and paralysis. It is associated with poor short-term outcomes, including increased mortality, but the consequences of reduced long-term outcomes, including decreased physical function and quality of life, can be just as devastating. ICU-acquired weakness is particularly relevant to elderly patients who are increasingly consuming ICU resources and are at increased risk for ICU-acquired weakness and complications, including mortality. Elderly patients often enter critical illness with reduced muscle mass and function and are also at increased risk for accelerated disuse atrophy with acute illness. Increasingly, intensivists and researchers are focusing on strategies and therapies aimed at improving long-term neuromuscular function. β-Hydroxy-β-methylbutyrate (HMB), an ergogenic supplement, has shown efficacy in elderly patients and certain clinical populations in counteracting muscle loss. The present review discusses ICU-acquired weakness, as well as the unique physiology of muscle loss and skeletal muscle function in elderly patients, and then summarizes the evidence for HMB in elderly patients and in clinical populations. We subsequently postulate on the potential role and strategies in studying HMB in elderly ICU patients to improve muscle mass and function. © 2013 American Society for Parenteral and Enteral Nutrition.

Educational Colonoscopy Video Enhances Bowel Preparation Quality and Comprehension in an Inner City Population.

PubMed

Pillai, Ajish; Menon, Radha; Oustecky, David; Ahmad, Asyia

2017-07-24

Quality of bowel preparation and patient knowledge remains a major barrier for completing colorectal cancer screening. Few studies have tested unique ways to impact patient understanding centering on interactive computer programs, pictures, and brochures. Two studies explored instructional videos but focused on patient compliance and anxiety as endpoints. Furthermore, excessive video length and content may limit their impact on a broad patient population. No study so far has studied a video's impact on preparation quality and patient understanding of the colonoscopy procedure. We conducted a single blinded prospective study of inner city patients presenting for a first time screening colonoscopy. During their initial visit patients were randomized to watch an instructional colonoscopy video or a video discussing gastroesophageal reflux disease (GERD). All patients watched a 6 minutes long video with the same spokesperson, completed a demographic questionnaire (Supplemental Digital Content 1, http://links.lww.com/JCG/A352) and were enrolled only if screened within 30 days of their visit. On the day of the colonoscopy, patients completed a 14 question quiz of their knowledge. Blinded endoscopist graded patient preparations based on the Ottawa scale. All authors had access to the study data and reviewed and approved the final manuscript. Among the 104 subjects enrolled in the study, 56 were in the colonoscopy video group, 48 were in GERD video group, and 12 were excluded. Overall, 48% were male and 52% female; 90% of patients had less than a high school education, 76% were African American, and 67% used a 4 L split-dose preparation. There were no differences between either video group with regard to any of the above categories. Comparisons between the 2 groups revealed that the colonoscopy video group had significantly better Ottawa bowel preparation score (4.77 vs. 6.85; P=0.01) than the GERD video group. The colonoscopy video group also had less-inadequate repeat bowel preparations versus the GERD video group (9% vs. 23%; P<0.01). The overall score on the knowledge questionnaire (Supplemental Digital Content 1, http://links.lww.com/JCG/A352) was significantly higher in the colonoscopy video group as compared with the GERD video group (12.77 vs. 11.08; P<0.001. In all patients the overall quiz score positively correlated with preparation quality (odds ratio, 2.31; confidence interval, 1.35-3.94; P<0.001). Our unique population represented an overwhelmingly under-educated (85% had a high school education or less) and minority group (76% African American). They are one of the most at risk of having multiple barriers such as comprehension and reading difficulties resulting in poor preparation examinations and no shows to procedures. Our instructional video proved to be high yield in this population. The patients assigned to watch the colonoscopy video showed a significant increase in "excellent" grade adequate bowel preparation quality by >23% and a significant decrease in "inadequate" bowel preparations by almost 50%. Our study proves that an educational video can improve both comprehension with regard to all aspects of colonoscopy. ClinicalTrials.gov number, NCT02906969.

Working with the Hmong Population in a Genetics Setting: an Interpreter Perspective.

PubMed

Krieger, Meghan; Agather, Aime; Douglass, Kathryn; Reiser, Catherine A; Petty, Elizabeth M

2018-06-01

The aim of this pilot qualitative study was to describe the experiences and beliefs of medical interpreters when working with genetic counselors and other genetic providers caring for Hmong patients who are not native English speakers. Specific goals were to identify interpreters' thoughts and perceptions on (a) their roles during sessions, (b) unique challenges in a genetics session, (c) knowledge genetics providers need when working with Hmong patients and interpreters, and (d) supports and training needed to effectively interpret in a genetics setting. Hmong medical interpreters from Wisconsin and Minnesota were invited by email to participate in the study. Six were interviewed by telephone. Participants had worked with a variety of providers including geneticists, genetic counselors, primary care physicians, and oncologists. Factors identified by Hmong interpreters that made interpretation of content difficult in clinical genetics sessions included: time constraints, technical terms, and unique cultural perspectives of Hmong patients. While all respondents felt their primary role was to interpret session content as close to verbatim as possible, there was notable variation in the description of their interpretation style and other perceived roles in the genetic counseling session. Cultural issues genetics providers could consider when working with Hmong patients and different style issues when working with Hmong interpreters are discussed. Ideas for future studies and suggestions to improve communication with Hmong patients are explored.

The coach program - a "joint" approach to patient education and support.

PubMed

Shaked, Yael; Dickson, Patricia; Workman, Kathy

2016-12-01

Hospital lengths of stay for orthopaedic procedures are declining internationally. Discharge home from hospital following total joint replacement surgery can be stressful due to pain and physical restrictions. Thus, many patients report experiencing increased anxiety and feeling a sudden withdrawal of support from their medical team. The Coach Program maximizes human resources and family-centred care by formally integrating an individual whom the patient identifies as their primary support into their health care team. This unique and innovative program was designed to decrease patient anxiety, increase patient confidence, enhance coping with shorter hospital lengths of stay, and smooth the discharge planning process. Anecdotal feedback from patients and staff has been overwhelmingly positive. A pilot self-reported patient survey was conducted. Future steps include distribution and analysis of a more detailed survey to a broader patient population and finding ways to address the needs of patients with limited social support. Copyright © 2016 Elsevier Inc. All rights reserved.

Optimizing the impact of alcohol and drug screening and early intervention in a high-risk population receiving services in New York City sexual health clinics: A process and outcome evaluation of Project Renew.

PubMed

Harris, B R; Yu, J; Wolff, M; Rogers, M; Blank, S

2018-04-17

Unhealthy substance use is associated with increased rates of STDs, including HIV. Within three high-risk New York City (NYC) sexual health clinics between 2008 and 2012 (n = 146,657), 17% of patients screened positive for a current SUD but only 5.3% ever received prior treatment. The goal of Project Renew was to expand the reach of substance use early intervention services within and across sexual health clinics citywide and decrease substance use, poor mental health, and risky sexual behavior. To accomplish this goal, Screening, Brief Intervention, and Referral to Treatment (SBIRT), an evidence-based substance use early intervention model, was implemented in all eight NYC sexual health clinics February 2012-January 2015. Clinic patients were screened for substance misuse using the AUDIT/DAST-10, and those who screened positive were eligible for on-site brief intervention. Overall, 130,597 substance misuse screenings were conducted (66,989, or 51%, positive), and 17,474 on-site brief interventions and 1238 referrals were provided (not unique to individual patients). A 10% sample of 14,709 unique patients who screened positive were interviewed using a federal data collection tool at baseline and six months later to assess changes in substance use, sexual risk behaviors, mental health, and health status (n = 1328). At six-month follow-up, patients reported reduced substance use, less sexual activity, improved overall health, and fewer days of depression and anxiety compared to measures at baseline (p < 0.05). Based on positive results, Project Renew SBIRT services have been sustained, ensuring essential care which may help prevent acquisition of HIV/STDs among a large population of high-risk New Yorkers. Copyright © 2018 Elsevier Inc. All rights reserved.

The Rising Incidence of Younger Patients With Colorectal Cancer: Questions About Screening, Biology, and Treatment.

PubMed

Connell, Louise C; Mota, José Mauricio; Braghiroli, Maria Ignez; Hoff, Paulo M

2017-04-01

Colorectal cancer (CRC) is the third leading cancer diagnosed globally and an important cause of cancer-related mortality. Of interest, while we have witnessed a declining incidence trend over the past few decades in the older population, incidence rates for adolescents and young adults have been increasing steadily. Several factors may well explain this apparent epidemic in the young, namely a lack of routine screening and emerging lifestyle issues such as obesity, lack of exercise, and dietary factors. It is known that both environmental and genetic factors can increase the likelihood of developing CRC. Although inherited susceptibility is associated with the most striking increases in risk, and must always be considered in a young patient with CRC, the majority of CRCs are in fact sporadic rather than familial. Early-onset CRC is a truly heterogeneous disease, with mounting evidence to suggest that this patient population has a distinctive molecular profile, very different to late-onset CRC cases. Currently, both younger and older patients with CRC are treated in essentially the same manner, but with a better understanding of the molecular mechanisms underlying CRC in the young, we will have the opportunity to specifically tailor screening and clinical management strategies in this unique patient population in an effort to improve outcomes. The aim of this review is to outline our current knowledge of the distinguishing features of early-onset CRC, the ongoing research efforts, and the evolving evidence in this field.

Sex- and Age-Adjusted Population Analysis of Prevalence Estimates for Hidradenitis Suppurativa in the United States.

PubMed

Garg, Amit; Kirby, Joslyn S; Lavian, Jonathan; Lin, Gloria; Strunk, Andrew

2017-08-01

The true prevalence of hidradenitis suppurativa (HS) is unknown. To establish standardized overall and group-specific prevalence estimates for HS in the United States. This retrospective analysis included a demographically heterogeneous population-based sample of more than 48 million unique patients across all US census regions. As of October 27, 2016, a total of 47 690 patients with HS were identified using electronic health record data. Standardized overall point prevalence for HS and sex-, age-, and race-specific prevalence estimates of HS in the general US population. Of the 47 690 patients with HS (26.2% men and 73.8% women), the overall HS prevalence in the US population sample was 0.10%, or 98 per 100 000 persons (95% CI, 97-99 per 100 000 persons). The adjusted prevalence in women was 137 per 100 000 (95% CI, 136-139 per 100 000), more than twice that of men (58 per 100 000; 95% CI, 57-59 per 100 000; P < .001). The prevalence of HS was highest among patients aged 30 to 39 years (172 per 100 000; 95% CI, 169-275 per 100 000) compared with all other age groups (range, 15-150 per 100 000; P < .001). Adjusted HS prevalences among African American (296 per 100 000; 95% CI, 291-300 per 100 000) and biracial (218 per 100 000; 95% CI, 202-235 per 100 000) patients were more than 3-fold and 2-fold greater, respectively, than that among white patients (95 per 100 000; 95% CI, 94-96 per 100 000; P < .001). Hidradenitis suppurativa is an uncommon, but not rare, disease in the United States that disproportionately affects female patients, young adults, and African American and biracial patients.

Factors influencing the development of early- or late-onset Parkinson's disease in a cohort of South African patients.

PubMed

van der Merwe, Celia; Haylett, William; Harvey, Justin; Lombard, Debbie; Bardien, Soraya; Carr, Jonathan

2012-10-01

Neurodegenerative disorders such as Parkinson's disease (PD) contribute significantly to global disease burden. PD can be categorised into early-onset PD (EOPD) with an age at onset (AAO) of ≤50 years and late-onset PD (LOPD) with an AAO of 50 years. To identify factors influencing EOPD and LOPD development in a group of patients in South Africa (SA). A total of 397 unrelated PD patients were recruited from the Movement Disorders Clinic at Tygerberg Hospital and via the Parkinson's Association of SA. Patient demographic and environmental data were recorded and associations with PD onset (EOPD v. LOPD) were analysed with a Pearson's Chi-squared test. The English- and Afrikaans-speaking (Afrikaner) white patients were analysed separately. Logistic regression analysis showed that ethnicity (p<0.001) and family history (p=0.004) were independently associated with AAO of PD. Average AAO was younger in black, coloured and Afrikaner patients than English-speaking white patients. A positive family history of PD, seen in 31.1% of LOPD patients, was associated with a younger AAO in the study population. These associations may be attributed to specific genetic and/or environmental risk factors that increase PD susceptibility and influence the clinical course of the disorder. More studies on PD in the unique SA populations are required to provide novel insights into mechanisms underlying this debilitating condition.

Increasing use of prescription drugs in the United Kingdom.

PubMed

Zhang, Frank; Mamtani, Ronac; Scott, Frank I; Goldberg, David S; Haynes, Kevin; Lewis, James D

2016-06-01

Prescription drugs are a central component of healthcare worldwide. We investigated changes in drug-prescribing patterns over time in the general population. Secular trends were analyzed using 1999-2012 prescription data from The Health Improvement Network. Prevalence of receipt of medication prescriptions was computed by age, sex, and therapeutic category for each calendar year. Spearman correlations were computed to assess change over time. Between 1999 and 2012, the percentage of the population that received at least one medication prescription increased from 64.5% to 69.2% (rho = 0.96, p < 0.001). The percentage of patients receiving prescriptions for one to four unique agents declined from 45.6% to 42.1% (Spearman's rho = -0.98, p < 0.001). Meanwhile, the percentage receiving five to nine and 10 or more unique agents increased from 14.1% to 17.5% (rho = 0.996, p < 0.001) and 4.7% to 9.6% (rho = 1.000, p < 0.001) respectively. Largest increases were seen in use of drugs for gastrointestinal disease among women and cardiovascular disease among men. In 2012, the most commonly used agents were for infection or nervous system drugs, with 32.0% and 28.9% of patients receiving at least one prescription, respectively. Nearly 70% of the United Kingdom population has received prescriptions for one or more medication with increasing proportions receiving prescriptions for five or more. The high rates of medication use increase the complexity and cost of healthcare. These data can be used for public health planning and to design pharmacoepidemiology and comparative effectiveness studies. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Clinical utility of genetic testing in pediatric drug-resistant epilepsy: a pilot study.

PubMed

Ream, Margie A; Mikati, Mohamad A

2014-08-01

The utility of genetic testing in pediatric drug-resistant epilepsy (PDRE), its yield in "real life" clinical practice, and the practical implications of such testing are yet to be determined. To start to address the above gaps in our knowledge as they apply to a patient population seen in a tertiary care center. We retrospectively reviewed our experience with the use of clinically available genetic tests in the diagnosis and management of PDRE in one clinic over one year. Genetic testing included, depending on clinical judgment, one or more of the following: karyotype, chromosomal microarray, single gene sequencing, gene sequencing panels, and/or whole exome sequencing (WES). We were more likely to perform genetic testing in patients with developmental delay, epileptic encephalopathy, and generalized epilepsy. In our unique population, the yield of specific genetic diagnosis was relatively high: karyotype 14.3%, microarray 16.7%, targeted single gene sequencing 15.4%, gene panels 46.2%, and WES 16.7%. Overall yield of diagnosis from at least one of the above tests was 34.5%. Disease-causing mutations that were not clinically suspected based on the patients' phenotypes and representing novel phenotypes were found in 6.9% (2/29), with an additional 17.2% (5/29) demonstrating pharmacologic variants. Three patients were incidentally found to be carriers of recessive neurologic diseases (10.3%). Variants of unknown significance (VUSs) were identified in 34.5% (10/29). We conclude that genetic testing had at least some utility in our patient population of PDRE, that future similar larger studies in various populations are warranted, and that clinics offering such tests must be prepared to address the complicated questions raised by the results of such testing. Copyright © 2014. Published by Elsevier Inc.

Mind over matter: cognitive - behavioral determinants of emotional distress in multiple sclerosis patients.

PubMed

Chalk, Holly McCartney

2007-10-01

Given the high incidence and unique symptomatology of depression in multiple sclerosis (MS) patients, the current study examined the role of cognitive and behavioral variables in predicting psychosocial adjustment in this population, in order to suggest psychotherapeutic interventions tailored specifically to MS patients. Data from 329 MS patients indicated that problem solving coping, acceptance coping, and challenge appraisals were associated with positive psychological adjustment (i.e., high life satisfaction, low depression and anxiety), whereas variables measuring disease severity (i.e., illness duration, subjective health status, and self-reported disability) were not associated with adjustment. These findings suggest that MS patients' psychological outcomes are more related to controllable cognitive and behavioral factors than to the physical effects of the disease. Consequently, it is expected that interventions that target these specific coping strategies and cognitive appraisals will be effective in treating the emotional effects of MS.

Outcomes of Adolescent and Young Adults Receiving High Ligation and Mesh Repairs: A 16-Year Experience.

PubMed

Criss, Cory N; Gish, Nathan; Gish, Joshua; Carr, Benjamin; McLeod, Jennifer S; Church, Joseph T; Hsieh, Lily; Matusko, Niki; Geiger, James D; Hirschl, Ronald B; Gadepalli, Samir K

2018-02-01

Interestingly, the pediatric and adult surgeons perform vastly different operations in similar patient populations. Little is known about long-term recurrence and quality of life (QOL) in adolescents and young adults undergoing inguinal hernia repair. We evaluated long-term patient-centered outcomes in this population to determine the optimal operative approach. The medical records of patients 12-25 years old at the time of a primary inguinal hernia repair at our institution from 2000 to 2016 were retrospectively reviewed. Patients then completed a phone survey of their postoperative courses and QOL. Outcomes of high ligation performed by pediatric surgeons were compared to those of mesh repairs by adult general surgeons. The primary outcome was recurrence. Secondary outcomes included time to recurrence, postoperative complications, and patient-centered outcomes. A Cox regression analysis was used to determine associations for recurrence. Of 213 patients identified, 143 (67.1%) were repaired by adult surgeons and 70 (32.9%) repaired by pediatric surgeons. Overall recurrence rate for the entire cohort was 5.7% with a median time to recurrence of 3.5 years (interquartile range 120-2155 days). High ligation and mesh repairs had similar rates of recurrence (6.3 versus 5.8, P = .57) and postoperative complications (17% versus 16%, P = .45). 101/213 (47%) patients completed the phone survey. Of those surveyed, 20% reported postoperative pain, 10% had residual numbness and tingling, and 10% of patients complained of intermittent bulging. Overall, a survey comparison showed no differences among subgroups. In adolescents and young adults, the long-term recurrence rate after inguinal hernia repair is ∼6% with time to recurrence approaching 4 years. Outcomes of high ligation and mesh repair are similar, highlighting the need for individualized approaches for this unique population.

A Pilot Study to Improve Access to Eye Care Services for Patients in Rural India by Implementing Community Ophthalmology through Innovative Telehealth Technology.

PubMed

John, Sheila; Premila, M; Javed, Mohd; Vikas, G; Wagholikar, Amol

2015-01-01

To inform about a very unique and first of its kind telehealth pilot study in India that has provided virtual telehealth consultation to eye care patients in low resource at remote villages. Provision of Access to eye care services in remote population is always challenging due to pragmatic reasons. Advances in Telehealth technologies have provided an opportunity to improve access to remote population. However, current Telehealth technologies are limited to face-to-face video consultation only. We inform about a pilot study that illustrates real-time imaging access to ophthalmologists. Our innovative software led technology solution allowed screening of patients with varying ocular conditions. Eye camps were conducted in 2 districts in South India over a 12-month period in 2014. Total of 196 eye camps were conducted. Total of 19,634 patients attended the eye camps. Innovative software was used to conduct consultation with the ophthalmologist located in the city hospital. The software enabled virtual visit and allowed instant sharing of fundus camera images for assessment and diagnosis. About 71% of the patients were found to have Refractive Error problems, 15% of them were found to have cataract, 7% of the patients were diagnosed to have Retina problems and 7% of the patients were found to have other ocular diseases. The patients requiring cataract surgery were immediately transferred to city hospital for treatment. Software led assessment of fundus camera images assisted in identifying retinal eye diseases. Our real-time virtual visit software assisted in specialist care provision and illustrated a novel tele health solution for low resource population.

Modernizing Clinical Trial Eligibility Criteria: Recommendations of the American Society of Clinical Oncology–Friends of Cancer Research HIV Working Group

PubMed Central

Uldrick, Thomas S.; Ison, Gwynn; Rudek, Michelle A.; Noy, Ariela; Schwartz, Karl; Bruinooge, Suanna; Schenkel, Caroline; Miller, Barry; Dunleavy, Kieron; Wang, Judy; Zeldis, Jerome; Little, Richard F.

2018-01-01

Purpose People with HIV are living longer as a result of effective antiretroviral therapy. Cancer has become a leading cause of morbidity and mortality in this patient population. However, studies of novel cancer therapeutics have historically excluded patients with HIV. Critical review of eligibility criteria related to HIV is required to accelerate development of and access to effective therapeutics for HIV-infected patients with cancer and make studies more generalizable to this patient population. Methods From January through April 2016, the HIV Working Group conducted a series of teleconferences; a review of 46 New Drug Applications from registration studies of unique agents studied in adults with cancer that led to the initial US Food and Drug Administration approval of that agent from 2011 to 2015; and a review of HIV-related eligibility criteria from National Cancer Institute–sponsored studies. Results were discussed and refined at a multistakeholder workshop held May 12, 2016. The HIV Working Group developed recommendations for eligibility criteria that focus on pharmacologic and immunologic considerations in this patient population and that balance patient safety, access to appropriate investigational agents, and study integrity. Results Exclusion of patients with HIV remains common in most studies of novel cancer agents. Models for HIV-related eligibility criteria in National Cancer Institute–sponsored studies are instructive. HIV infection itself should no longer be an exclusion criterion for most studies. Eligibility criteria related to HIV infection that address concurrent antiretroviral therapy and immune status should be designed in a manner that is appropriate for a given cancer. Conclusion Expanding clinical trial eligibility to be more inclusive of patients with HIV is justified in most cases and may accelerate the development of effective therapies in this area of unmet clinical need. PMID:28968173

Modernizing Clinical Trial Eligibility Criteria: Recommendations of the American Society of Clinical Oncology-Friends of Cancer Research HIV Working Group.

PubMed

Uldrick, Thomas S; Ison, Gwynn; Rudek, Michelle A; Noy, Ariela; Schwartz, Karl; Bruinooge, Suanna; Schenkel, Caroline; Miller, Barry; Dunleavy, Kieron; Wang, Judy; Zeldis, Jerome; Little, Richard F

2017-11-20

Purpose People with HIV are living longer as a result of effective antiretroviral therapy. Cancer has become a leading cause of morbidity and mortality in this patient population. However, studies of novel cancer therapeutics have historically excluded patients with HIV. Critical review of eligibility criteria related to HIV is required to accelerate development of and access to effective therapeutics for HIV-infected patients with cancer and make studies more generalizable to this patient population. Methods From January through April 2016, the HIV Working Group conducted a series of teleconferences; a review of 46 New Drug Applications from registration studies of unique agents studied in adults with cancer that led to the initial US Food and Drug Administration approval of that agent from 2011 to 2015; and a review of HIV-related eligibility criteria from National Cancer Institute-sponsored studies. Results were discussed and refined at a multistakeholder workshop held May 12, 2016. The HIV Working Group developed recommendations for eligibility criteria that focus on pharmacologic and immunologic considerations in this patient population and that balance patient safety, access to appropriate investigational agents, and study integrity. Results Exclusion of patients with HIV remains common in most studies of novel cancer agents. Models for HIV-related eligibility criteria in National Cancer Institute-sponsored studies are instructive. HIV infection itself should no longer be an exclusion criterion for most studies. Eligibility criteria related to HIV infection that address concurrent antiretroviral therapy and immune status should be designed in a manner that is appropriate for a given cancer. Conclusion Expanding clinical trial eligibility to be more inclusive of patients with HIV is justified in most cases and may accelerate the development of effective therapies in this area of unmet clinical need.

Case Report of a Patient With Idiopathic Hypersomnia and a Family History of Malignant Hyperthermia Undergoing General Anesthesia: An Overview of the Anesthetic Considerations.

PubMed

Aflaki, Sena; Hu, Sally; Kamel, Rami A; Chung, Frances; Singh, Mandeep

2017-05-01

The pathophysiologic underpinnings of idiopathic hypersomnia and its interactions with anesthetic medications remain poorly understood. There is a scarcity of literature describing this patient population in the surgical setting. This case report outlines the anesthetic considerations and management plan for a 55-year-old female patient with a known history of idiopathic hypersomnia undergoing an elective shoulder arthroscopy in the ambulatory setting. In addition, this case offers a unique set of considerations and conflicts related to the patient having a family history of malignant hyperthermia. A combined technique of general and regional anesthesia was used. Anesthesia was maintained with total intravenous anesthesia via the use of propofol and remifentanil. The depth of anesthesia was monitored with entropy. There were no perioperative complications.

Ecological validity of neuropsychological assessment and perceived employability.

PubMed

Wen, Johnny H; Boone, Kyle; Kim, Kevin

2006-11-01

Ecological validity studies that have examined the relationship between cognitive abilities and employment in psychiatric and medical populations have found that a wide range of cognitive domains predict employability, although memory and executive skills appear to be the most important. However, no information is available regarding a patient's self-perceived work attributes and objective neuropsychological performance, and whether the same cognitive domains associated with successful employment are also related to a patient's self-perception of work competence. In the present study, 73 medical and psychiatric patients underwent comprehensive neuropsychological assessment. Step-wise multiple regression analyses revealed that the visual-spatial domain was the only significant predictor of self-perceived work attributes and work competence as measured by the Working Inventory (WI) and the Work Adjustment Inventory (WAI), accounting for 7% to 10% of inventory score variability. The results raise the intriguing possibility that targeting of visual spatial skills for remediation and development might play a separate and unique role in the vocational rehabilitation of a lower SES population, specifically, by leading to enhanced self-perception of work competence as these individuals attempt to enter the job market.

Short-term intensive insulin therapy at diagnosis in type 2 diabetes: plan for filling the gaps.

PubMed

Weng, Jianping; Retnakaran, Ravi; Ariachery C, Ammini; Ji, Linong; Meneghini, Luigi; Yang, Wenying; Woo, Jeong-Taek

2015-09-01

Short-term intensive insulin therapy is unique amongst therapies for type 2 diabetes because it offers the potential to preserve and improve beta-cell function without additional pharmacological treatment. On the basis of clinical experience and the promising results of a series of studies in newly diagnosed patients, mostly in Asian populations, an expert workshop was convened to assess the available evidence and the potential application of short-term intensive insulin therapy should it be advocated for inclusion in clinical practice. Participants included primary care physicians and endocrinologists. We endorse the concept of short-term intensive insulin therapy as an option for some patients with type 2 diabetes at the time of diagnosis and have identified the following six areas where additional knowledge could help clarify optimal use in clinical practice: (1) generalizability to primary care, (2) target population and biomarkers, (3) follow-up treatment, (4) education of patients and providers, (5) relevance of ethnicity, and (6) health economics. © 2014 The Authors. Diabetes Metabolism Research and Reviews published by John Wiley & Sons, Ltd.

The role of patient activation in frequent attendance at primary care: a population-based study of people with chronic disease.

PubMed

Donald, Maria; Ware, Robert S; Ozolins, Ieva Z; Begum, Nelufa; Crowther, Ruth; Bain, Christopher

2011-05-01

This study explores a range of relevant socio-demographic, physical and psychological factors in a unique examination of the risk factors for frequent attendance at primary care. The impact of patient activation for self-management on health service utilisation is of particular interest. A population-based sample of people with chronic disease from Queensland, Australia, was interviewed using computer assisted telephone surveying. Data were collected from a random sample of 1470 people with either diabetes or a cardiovascular condition. As participants became more activated they were less likely to frequently attend their main health care provider for assistance with their chronic condition. For both conditions the association was graduated and for participants with a cardiovascular condition this association remained statistically significant even after controlling for other potentially influential factors such as disease severity, length of time since diagnosis, and psychological distress. Characteristics of the individual, including patient activation and psychological functioning, as well as disease factors contribute to primary care consulting patterns among people with chronic illness. Efforts to improve patient activation for self-management should remain a central element of chronic care. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Free tissue transfer for head and neck reconstruction in solid organ transplant patients.

PubMed

Miller, Matthew W; Dean, Nichole R; Cannady, Steven B; Rosenthal, Eben L; Wax, Mark K

2012-08-01

Patients with head and neck malignancies who have had solid organ transplant and require free tissue transfer are a unique population. This study was performed to evaluate the effect of immunosuppression on the rate of perioperative complications and the success of free tissue transfer in the head and neck. Complications in solid organ transplant patients undergoing free tissue transfer for reconstruction of head and neck malignancies from 1998 to 2010 were evaluated. A total of 22 flaps in 17 patients were performed. Eight patients (11 of 22 flaps) had complications. The median hospital stay was 6 days (range, 4-26 days). The median length of follow-up was 13.5 months (range, 3.5-49.9 months). Solid organ transplant patients are at an increased risk of de novo malignancies due to chronic immunosuppression. This study demonstrates that free tissue transfer is a viable option in transplant patients with morbidity similar to nontransplant patients. Copyright © 2011 Wiley Periodicals, Inc.

Integrating community health workers within Patient Protection and Affordable Care Act implementation.

PubMed

Islam, Nadia; Nadkarni, Smiti Kapadia; Zahn, Deborah; Skillman, Megan; Kwon, Simona C; Trinh-Shevrin, Chau

2015-01-01

The Patient Protection and Affordable Care Act's (PPACA) emphasis on community-based initiatives affords a unique opportunity to disseminate and scale up evidence-based community health worker (CHW) models that integrate CHWs within health care delivery teams and programs. Community health workers have unique access and local knowledge that can inform program development and evaluation, improve service delivery and care coordination, and expand health care access. As a member of the PPACA-defined health care workforce, CHWs have the potential to positively impact numerous programs and reduce costs. This article discusses different strategies for integrating CHW models within PPACA implementation through facilitated enrollment strategies, patient-centered medical homes, coordination and expansion of health information technology (HIT) efforts, and also discusses payment options for such integration. Title V of the PPACA outlines a plan to improve access to and delivery of health care services for all individuals, particularly low-income, underserved, uninsured, minority, health disparity, and rural populations. Community health workers' role as trusted community leaders can facilitate accurate data collection, program enrollment, and provision of culturally and linguistically appropriate, patient- and family-centered care. Because CHWs already support disease management and care coordination services, they will be critical to delivering and expanding patient-centered medical homes and Health Home services, especially for communities that suffer disproportionately from multiple chronic diseases. Community health workers' unique expertise in conducting outreach make them well positioned to help enroll people in Medicaid or insurance offered by Health Benefit Exchanges. New payment models provide opportunities to fund and sustain CHWs. Community health workers can support the effective implementation of PPACA if the capacity and potential of CHWs to serve as cultural brokers and bridges among medically underserved communities and health care delivery systems is fully tapped. Patient Protection and Affordable Care Act and current payment structures provide an unprecedented and important vehicle for integrating and sustaining CHWs as part of these new delivery and enrollment models.

Integrating Community Health Workers Within Patient Protection and Affordable Care Act Implementation

PubMed Central

Islam, Nadia; Nadkarni, Smiti Kapadia; Zahn, Deborah; Skillman, Megan; Kwon, Simona C.; Trinh-Shevrin, Chau

2015-01-01

Context The Patient Protection and Affordable Care Act’s (PPACA) emphasis on community-based initiatives affords a unique opportunity to disseminate and scale up evidence-based community health worker (CHW) models that integrate CHWs within health care delivery teams and programs. Community health workers have unique access and local knowledge that can inform program development and evaluation, improve service delivery and care coordination, and expand health care access. As a member of the PPACA-defined health care workforce, CHWs have the potential to positively impact numerous programs and reduce costs. Objective This article discusses different strategies for integrating CHW models within PPACA implementation through facilitated enrollment strategies, patient-centered medical homes, coordination and expansion of health information technology (HIT) efforts, and also discusses payment options for such integration. Results Title V of the PPACA outlines a plan to improve access to and delivery of health care services for all individuals, particularly low-income, underserved, uninsured, minority, health disparity, and rural populations. Community health workers’ role as trusted community leaders can facilitate accurate data collection, program enrollment, and provision of culturally and linguistically appropriate, patient- and family-centered care. Because CHWs already support disease management and care coordination services, they will be critical to delivering and expanding patient-centered medical homes and Health Home services, especially for communities that suffer disproportionately from multiple chronic diseases. Community health workers’ unique expertise in conducting outreach make them well positioned to help enroll people in Medicaid or insurance offered by Health Benefit Exchanges. New payment models provide opportunities to fund and sustain CHWs. Conclusion Community health workers can support the effective implementation of PPACA if the capacity and potential of CHWs to serve as cultural brokers and bridges among medically underserved communities and health care delivery systems is fully tapped. Patient Protection and Affordable Care Act and current payment structures provide an unprecedented and important vehicle for integrating and sustaining CHWs as part of these new delivery and enrollment models. PMID:25414955

Racial and Ethnic Disparities in Cardiovascular Disease: An Assessment of Obstetrician-Gynecologists' Knowledge, Attitudes, and Practice Patterns.

PubMed

Jones, Katherine M; Carter, Michele M; Schulkin, Jay

2015-06-01

African American and Hispanic women are disproportionately affected by cardiovascular disease (CVD) and its many risk factors. Obstetrician-gynecologists (OB/GYNs) play an integral role in well-woman care and have a unique opportunity to provide CVD counseling and screening to these at-risk and underserved groups. To assess whether OB/GYN race/ethnicity and OB/GYN practices with increasing minority patient populations predicted differences in OB/GYNs' knowledge, attitudes, and practice patterns relevant to racial/ethnic disparities in CVD. This study also sought to determine provider and patient-related barriers to CVD care. A questionnaire on CVD was mailed to 273 members of The American College of Obstetricians and Gynecologists in March-July 2013. African American and Hispanic OB/GYNs and OB/GYN practices with increasing minority patient populations were more knowledgeable of CVD disparities. These OB/GYNs reported greater concern for minority women's CVD risk relative to White OB/GYNs. Overall, OB/GYNs appear less knowledgeable and concerned with Hispanics' increased CVD risk relative to African Americans'. The most commonly reported provider and patient-related barriers to CVD care were time constraints, patient nonadherence to treatment recommendations, and inadequate training. It is likely that minority OB/GYNs and those with practices with increasing minority patient populations have greater exposure to women at risk for CVD. Dissemination of educational information regarding Hispanic women's CVD risk profile may improve OB/GYN knowledge, counseling, and screening. Increased training in CVD and multicultural competency during medical school and residency should help OB/GYNs overcome what they report as primary barriers to CVD care.

Clinical Holistic Medicine: Holistic Treatment of Rape and Incest Trauma

PubMed Central

Ventegodt, Søren; Kandel, Isack; Neikrug, Shimshon; Merric, Joav

2005-01-01

Studies indicate that at least 15% of the female population in western countries has experienced sexual abuse and severe sexual traumas. This paper explains how even serious sexual abuse and trauma can be healed when care and resources encourage the patient to return to the painful life events. When the physician cares and receives the trust of the patient, emotional holding and processing will follow quite naturally. Spontaneous regression seems to be an almost pain-free way of integrating the severe traumas from earlier experiences of rape and incest. This technique is a recommended alternative to classical timeline therapy using therapeutic commands. When traumatized patients distance themselves from their soul (feelings, sexuality, and existential depth), they often lose their energy and enjoyment of life. However, this does not mean that they are lost to life. Although it may seem paradoxical, a severe trauma may be a unique opportunity to regain enjoyment of life. The patient will often be richly rewarded for the extensive work of clearing and sorting out in order to experience a new depth in his or her existence and emotional life, with a new ability to understand life in general and other people in particular. So what may look like a tragedy can be transformed into a unique gift; if the patient gets sufficient support, there is the possibility of healing and learning. Consciousness-based medicine seems to provide severely traumatized patients with the quality of support and care needed for their soul to heal. PMID:15962195

Clinical holistic medicine: holistic treatment of rape and incest trauma.

PubMed

Ventegodt, Søren; Kandel, Isack; Neikrug, Shimshon; Merric, Joav

2005-04-06

Studies indicate that at least 15% of the female population in western countries has experienced sexual abuse and severe sexual traumas. This paper explains how even serious sexual abuse and trauma can be healed when care and resources encourage the patient to return to the painful life events. When the physician cares and receives the trust of the patient, emotional holding and processing will follow quite naturally. Spontaneous regression seems to be an almost pain-free way of integrating the severe traumas from earlier experiences of rape and incest. This technique is a recommended alternative to classical timeline therapy using therapeutic commands. When traumatized patients distance themselves from their soul (feelings, sexuality, and existential depth), they often lose their energy and enjoyment of life. However, this does not mean that they are lost to life. Although it may seem paradoxical, a severe trauma may be a unique opportunity to regain enjoyment of life. The patient will often be richly rewarded for the extensive work of clearing and sorting out in order to experience a new depth in his or her existence and emotional life, with a new ability to understand life in general and other people in particular. So what may look like a tragedy can be transformed into a unique gift; if the patient gets sufficient support, there is the possibility of healing and learning. Consciousness-based medicine seems to provide severely traumatized patients with the quality of support and care needed for their soul to heal.

The Vulnerabilities of Orphaned Children Participating in Research: A Critical Review and Factors for Consideration for Participation in Biomedical and Behavioral Research

PubMed Central

Thompson, Rachel T.; Meslin, Eric M.; Braitstein, Paula K. A.; Nyandiko, Winstone M.; Ayaya, Samuel O.; Vreeman, Rachel C.

2013-01-01

Orphans are a subpopulation with a unique set of additional vulnerabilities. Increasing focus on children’s rights, pediatric global health, and pediatric research makes it imperative to recognize and address unique vulnerabilities of orphaned children. This paper describes the unique vulnerabilities of the orphaned pediatric population and offers a structured set of factors that require consideration when including orphans in biomedical research. Pediatric orphans are particularly vulnerable due to decreased economic resources, psychosocial instability, increased risk of abuse, and delayed/decreased access to healthcare. These vulnerabilities are significant. By carefully considering each issue in a population in a culturally specific and study-specific manner, researchers can make valuable contributions to the overall health and well-being of this uniquely vulnerable population. PMID:23086048

African Indigenous Cattle: Unique Genetic Resources in a Rapidly Changing World

PubMed Central

Mwai, Okeyo; Hanotte, Olivier; Kwon, Young-Jun; Cho, Seoae

2015-01-01

At least 150 indigenous African cattle breeds have been named, but the majority of African cattle populations remain largely uncharacterized. As cattle breeds and populations in Africa adapted to various local environmental conditions, they acquired unique features. We know now that the history of African cattle was particularly complex and while several of its episodes remain debated, there is no doubt that African cattle population evolved dramatically over time. Today, we find a mosaic of genetically diverse population from the purest Bos taurus to the nearly pure Bos indicus. African cattle are now found all across the continent, with the exception of the Sahara and the river Congo basin. They are found on the rift valley highlands as well as below sea level in the Afar depression. These unique livestock genetic resources are in danger to disappear rapidly following uncontrolled crossbreeding and breed replacements with exotic breeds. Breeding improvement programs of African indigenous livestock remain too few while paradoxically the demand of livestock products is continually increasing. Many African indigenous breeds are endangered now, and their unique adaptive traits may be lost forever. This paper reviews the unique known characteristics of indigenous African cattle populations while describing the opportunities, the necessity and urgency to understand and utilize these resources to respond to the needs of the people of the continent and to the benefit of African farmers. PMID:26104394

Increased occurrence of anti-AQP4 seropositivity and unique HLA Class II associations with neuromyelitis optica (NMO), among Muslim Arabs in Israel.

PubMed

Brill, Livnat; Mandel, Micha; Karussis, Dimitrios; Petrou, Panayiota; Miller, Keren; Ben-Hur, Tamir; Karni, Arnon; Paltiel, Ora; Israel, Shoshana; Vaknin-Dembinsky, Adi

2016-04-15

Previous studies have revealed different human leukocyte antigen (HLA) associations in multiple sclerosis (MS) and neuromyelitis optica (NMO), further discriminating these two demyelinating pathological conditions. In worldwide analyses, NMO and opticospinal MS are represented at higher proportions among demyelinating conditions in African, East-Asian and Latin American populations. There are currently no data regarding the prevalence of NMO in Middle East Muslims. The population in Israel is diverse in many ways, and includes subpopulations, based on religion and ethnicity; some exhibit genetic homogeneity. In Israel, the incidence of MS is lower in the Muslim population than the Jewish population and Muslims carry different allele frequency distribution of HLA haplotypes. To evaluate the occurrence of anti-AQP4 seropositivity in the Israeli Muslim population among patients with central nervous system (CNS) demyelinating conditions; and to identify the HLA DR and DQ profiles of Muslim Arab Israeli patients with NMO spectrum of diseases (NMOSD). The prevalence of anti-AQP4 seropositivity was analyzed in 342 samples, obtained from patients with various CNS demyelinating conditions and in a validation set of 310 samples. HLA class II alleles (HLA-DRB1 and DQB1) were examined in DNA samples from 35 Israeli Muslim Arabs NMO patients and compared to available data from 74 Israeli Muslim controls. Our data reveal a significantly increased prevalence of anti-AQP4 seropositivity, indicative of NMOSD, in Muslim Arab Israeli patients with initial diagnosis of a CNS demyelinating syndrome. In this population, there was a positive association with the HLA-DRB1*04:04 and HLA-DRB1*10:01 alleles (p=0.03), and a strong negative association with the HLA-DRB1*07 and HLA-DQB1*02:02 alleles (p=0.003, p=0.002). Our findings indicate a possibly increased prevalence of NMOSD in Muslim Arabs in Israel with distinct (positive and negative) HLA associations. Further studies in patients with similar genetic backgrounds worldwide could help to confirm our findings and identify more genetic susceptibility factors for NMO, contributing to our general understanding of the pathogenesis of NMOSD. Copyright © 2016 Elsevier B.V. All rights reserved.

Unique disease heritage of the Dutch-German Mennonite population.

PubMed

Orton, Noelle C; Innes, A Micheil; Chudley, Albert E; Bech-Hansen, N Torben

2008-04-15

The Dutch-German Mennonites are a religious isolate with foundational roots in the 16th century. A tradition of endogamy, large families, detailed genealogical records, and a unique disease history all contribute to making this a valuable population for genetic studies. Such studies in the Dutch-German Mennonite population have already contributed to the identification of the causative genes in several conditions such as the incomplete form of X-linked congenital stationary night blindness (CSNB2; previously iCSNB) and hypophosphatasia (HOPS), as well as the discovery of founder mutations within established disease genes (MYBPC1, CYP17alpha). The Dutch-German Mennonite population provides a strong resource for gene discovery and could lead to the identification of additional disease genes with relevance to the general population. In addition, further research developments should enhance delivery of clinical genetic services to this unique community. In the current review we discuss 31 genetic conditions, including 17 with identified gene mutations, within the Dutch-German Mennonite population. Copyright 2008 Wiley-Liss, Inc.

Contribution of Established Stroke Risk Factors to the Burden of Stroke in Young Adults.

PubMed

Aigner, Annette; Grittner, Ulrike; Rolfs, Arndt; Norrving, Bo; Siegerink, Bob; Busch, Markus A

2017-07-01

As stroke in young adults is assumed to have different etiologies and risk factors than in older populations, the aim of this study was to examine the contribution of established potentially modifiable cardiovascular risk factors to the burden of stroke in young adults. A German nationwide case-control study based on patients enrolled in the SIFAP1 study (Stroke In Young Fabry Patients) 2007 to 2010 and controls from the population-based GEDA study (German Health Update) 2009 to 2010 was performed. Cases were 2125 consecutive patients aged 18 to 55 years with acute first-ever stroke from 26 clinical stroke centers; controls (age- and sex-matched, n=8500, without previous stroke) were from a nationwide community sample. Adjusted population-attributable risks of 8 risk factors (hypertension, hyperlipidemia, diabetes mellitus, coronary heart disease, smoking, heavy episodic alcohol consumption, low physical activity, and obesity) and their combinations for all stroke, ischemic stroke, and primary intracerebral hemorrhage were calculated. Low physical activity and hypertension were the most important risk factors, accounting for 59.7% (95% confidence interval, 56.3-63.2) and 27.1% (95% confidence interval, 23.6-30.6) of all strokes, respectively. All 8 risk factors combined explained 78.9% (95% confidence interval, 76.3-81.4) of all strokes. Population-attributable risks of all risk factors were similar for all ischemic stroke subtypes. Population-attributable risks of most risk factors were higher in older age groups and in men. Modifiable risk factors previously established in older populations also account for a large part of stroke in younger adults, with 4 risk factors explaining almost 80% of stroke risk. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00414583. © 2017 American Heart Association, Inc.

Initial report of the osteogenesis imperfecta adult natural history initiative.

PubMed

Tosi, Laura L; Oetgen, Matthew E; Floor, Marianne K; Huber, Mary Beth; Kennelly, Ann M; McCarter, Robert J; Rak, Melanie F; Simmonds, Barbara J; Simpson, Melissa D; Tucker, Carole A; McKiernan, Fergus E

2015-11-14

A better understanding of the natural history of osteogenesis imperfecta (OI) in adulthood should improve health care for patients with this rare condition. The Osteogenesis Imperfecta Foundation established the Adult Natural History Initiative (ANHI) in 2010 to give voice to the health concerns of the adult OI community and to begin to address existing knowledge gaps for this condition. Using a web-based platform, 959 adults with self-reported OI, representing a wide range of self-reported disease severity, reported symptoms and health conditions, estimated the impact of these concerns on present and future health-related quality of life (QoL) and completed a Patient-Reported Outcomes Measurement Information System (PROMIS®) survey of health issues. Adults with OI report lower general physical health status (p < .0001), exhibit a higher prevalence of auditory (58% of sample versus 2-16% of normalized population) and musculoskeletal (64% of sample versus 1-3% of normalized population) concerns than the general population, but report generally similar mental health status. Musculoskeletal, auditory, pulmonary, endocrine, and gastrointestinal issues are particular future health-related QoL concerns for these adults. Numerous other statistically significant differences exist among adults with OI as well as between adults with OI and the referent PROMIS® population, but the clinical significance of these differences is uncertain. Adults with OI report lower general health status but are otherwise more similar to the general population than might have been expected. While reassuring, further analysis of the extensive OI-ANHI databank should help identify areas of unique clinical concern and for future research. The OI-ANHI survey experience supports an internet-based strategy for successful patient-centered outcomes research in rare disease populations.

What’s Age Got to do with it? A Review of Contemporary Revascularization in the Elderly

PubMed Central

Vandermolen, Sebastian; Abbott, Jane; Silva, Kalpa De

2015-01-01

Currently a quarter of all patients treated with percutanous coronary intervention (PCI) are aged >75 years, with this proportion steadily growing. This subset of patients have a number of unique characteristics, such as a greater number of cardiovascular risk factors and frequently a larger burden of coronary artery disease, when compared to younger patients, therefore potentially deriving increased benefit from revascularization. Nonetheless this population are also more likely to experience procedural complications, secondary to age-related physiological alterations, increased frailty and increased prevalence of other co-morbidities. This article reviews the various aspects and data available to clinicians pertaining to and guiding revascularization in the elderly, including the use of adjuvant pharmacotherapy, specific considerations when considering age-related physiology, and revascularization in acute coronary syndromes. PMID:25329923

Guidelines for the Perianesthesia Care of the Duchenne Muscular Dystrophy/Becker Muscular Dystrophy Patient.

PubMed

Alliod, Barbara A; Ash, Rebecca A

2016-12-01

More patients suffering with Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are presenting to perianesthesia settings for emergent and nonemergent treatment and care. A group of collaborative health care providers at Rush University Medical Center in Chicago developed a multidisciplinary DMD/BMD Task Force to study this disorder and create a set of guidelines to aid those engaging in the planning, execution of care, and recovery of this unique population in the perianesthesia setting. Attention to detail, well-executed preplanning, meticulous awareness of the patient, and prearranged implementation and intervention has proven to offset potential problems and complications and is the key to a successful perianesthesia period. Copyright © 2016 American Society of PeriAnesthesia Nurses. Published by Elsevier Inc. All rights reserved.

Incidence of hospital-acquired pressure ulcers - a population-based cohort study.

PubMed

Gardiner, Joseph C; Reed, Philip L; Bonner, Joseph D; Haggerty, Diana K; Hale, Daniel G

2016-10-01

Our study sought to estimate the association between race, gender, comorbidity and body mass index (BMI) on the incidence of hospital-acquired pressure ulcer (PU) from a population-based retrospective cohort comprising 242 745 unique patient hospital discharges in two fiscal years from July 2009 to June 2010 from 15 general and tertiary care hospitals. Cases were patients with a single inpatient encounter that led to an incident PU. Controls were patients without a PU at any encounter during the two fiscal years with the earliest admission retained for analysis. Logistic regression models quantified the association of potential risk factors for PU incidence. Spline functions captured the non-linear effects of age and comorbidity. Overall 2·68% of patients experienced an incident PU during their inpatient stay. Unadjusted analyses revealed statistically significant associations by age, gender, race, comorbidity, BMI, admitted for a surgical procedure, source of admission and fiscal year, but differences by gender and race did not persist in adjusted analyses. Interactions between age, comorbidity and BMI contributed significantly to the likelihood of PU incidence. Patients who were older, with multiple comorbidities and admitted for a surgical diagnosis-related groups (DRG) were at greater risk of experiencing a PU during their stay. © 2014 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

Using stakeholder engagement to develop a patient-centered pediatric asthma intervention.

PubMed

Shelef, Deborah Q; Rand, Cynthia; Streisand, Randi; Horn, Ivor B; Yadav, Kabir; Stewart, Lisa; Fousheé, Naja; Waters, Damian; Teach, Stephen J

2016-12-01

Stakeholder engagement has the potential to develop research interventions that are responsive to patient and provider preferences. This approach contrasts with traditional models of clinical research in which researchers determine the study's design. This article describes the effect of stakeholder engagement on the design of a randomized trial of an intervention designed to improve child asthma outcomes by reducing parental stress. The study team developed and implemented a stakeholder engagement process that provided iterative feedback regarding the study design, patient-centered outcomes, and intervention. Stakeholder engagement incorporated the perspectives of parents of children with asthma; local providers of community-based medical, legal, and social services; and national experts in asthma research methodology and implementation. Through a year-long process of multidimensional stakeholder engagement, the research team successfully refined and implemented a patient-centered study protocol. Key stakeholder contributions included selection of patient-centered outcome measures, refinement of intervention content and format, and language framing the study in a culturally appropriate manner. Stakeholder engagement was a useful framework for developing an intervention that was acceptable and relevant to our target population. This approach might have unique benefits in underserved populations, leading to sustainable improvement in health outcomes and reduced disparities. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Nutrition considerations in traumatic brain injury.

PubMed

Cook, Aaron M; Peppard, Amy; Magnuson, Barbara

The provision of adequate nutrition support for patients with traumatic brain injury (TBI) has been a clinical challenge for decades. The primary and secondary injuries create unique metabolic derangements along with accompanying issues such as optimal timing and route of nutrition, appropriate fluid and electrolytes, drug administration, rehabilitation, and dysphagia. Enteral nutrition is clearly established as the preferential route of nutrition support for this population vs parenteral nutrition. There appears to be a consensus on early initiation of enteral nutrition, but less definitive are recommendations on advancement timing and formula components. Nutrition therapies should include exact fluid resuscitation goals specific for TBI and strict electrolyte monitoring to avoid extreme fluid, electrolyte, or glucose shifts that could be detrimental to the patient. While the critical care patient often tolerates small bowel feeding, the long-term rehabilitation patient should transition to and tolerate gastric feeding. Drug-nutrient and adverse drug reactions such as diarrhea should be routinely evaluated in patients receiving enteral nutrition. Monitoring for dysphagia is critical to avoid the costly negative aspects associated with aspiration and to capitalize on quality of life and appropriate oral nutrition. Emphasizing the priority of early nutrition support within a multi-disciplinary team may be the critical key for successful provision and tolerance of nutrition support in the TBI population.

Lack of communication and control: experiences of distance caregivers of parents with advanced cancer.

PubMed

Mazanec, Polly; Daly, Barbara J; Ferrell, Betty Rolling; Prince-Paul, Maryjo

2011-05-01

To explore the new and complex phenomenon of distance caregiving in the advanced cancer population. Qualitative. A large comprehensive cancer center in the midwestern region of the United States. 14 distance caregivers of parents with advanced cancer. Patients with advanced lung, gastrointestinal, and gynecologic malignancies consented to have their distance caregiving adult children contacted to participate in the study. Responses to three open-ended questions guided the tape-recorded telephone interviews with the distance caregivers. Following transcription, content analysis with inductive coding was performed. Two major themes, communication and control, and five subthemes, benefits and burdens of distance caregiving, dealing with uncertainty, direct action through information seeking, protecting, and staying connected, emerged from the data. Distance caregivers experience some of the same stressors that local caregivers of patients with cancer experience. In addition, they have unique psychosocial needs related to the burden of geographic distance. Distance caregivers could benefit from nursing interventions targeted at their unique needs. Innovative interventions using Web-based computer technology for improved communication, as well as supportive care interventions, may be helpful.

Quality, Safety and Patient Centered Care--A Dream Come True in the Mountains of Northern Pakistan. An Award winning project of "2015 Quality, Safety & Patient Centered Care Award" at, Chicago USA.

PubMed

Jassani, Kashif; Essani, Rozina Roshan; Abbas, Syed Nadeem Husain

2016-01-01

Northern Pakistan remains very challenging terrain due to harsh weather all year round presenting an infrastructura, human resource and supply chain challenge of its own. Many times the facility had to move to different locations on emergency and ad hoc basis due to landslides, earthquakes affecting continuity of care. Providing quality healthcare to often resource constraint hard-to-reach areas has always been AKHS,P's unique forte. Breaking barriers for catchment population to access quality healthcare, AKHS,P embarked on an initiative of implementing, achieving and sustaining ISO 9001:2008 Quality Management System international standards certification. This article shares the unique experience of AKHS,P in achieving and sustaining ISO 9001:2008 International Quality Management System Certification. After untiring efforts and the hard work of ground staff; AKHS,P achieved ISO 9001:2008 International Quality Management System Certification as well as 1st Surveillance Audit which itself proved that AKHS,P sustained quality systems and ensured continuous quality improvement in the Mountains of Northern Pakistan.

Intravesical antineoplastic therapy following transurethral resection of bladder tumors: nursing implications from the operating room to discharge.

PubMed

Washburn, Donna J

2007-08-01

An aging population and latent effects from exposure to carcinogens will likely augment the current trend of increased incidence of urinary bladder cancer. Intravesical antineoplastic therapy is a common treatment for urinary bladder cancer. Transurethral resection of bladder tumors often is followed immediately by the instillation of an antineoplastic agent in the operating room or postanesthesia care unit. Oncology nurses, who have a unique knowledge of safe handling and patient care, can improve staff safety and patient outcomes in several areas of healthcare organizations, as well as reduce the mortality and morbidity of urinary bladder cancer by learning more about the disease and intravesical antineoplastic therapy.

Hearing the Silenced Voices of Underserved Women -The Role of Qualitative Research in Gynecologic and Reproductive Care

PubMed Central

Lawson, Angela K.; Marsh, Erica E.

2017-01-01

Summary for Indexing In order to provide effective evidence-based health care to women, rigorous research that examines women’s lived experiences in their own voices in needed. However, clinical health research has often excluded the experiences of women and minority patient populations. Further, clinical research has often relied on quantitative research strategies; this provides an interesting but limited understanding of women’s health experiences and hinders the provision of effective patient-centered care. In this review, we define qualitative research and its unique contributions to research, and provide examples of how qualitative research has given insights into the reproductive health perspectives and behaviors of underserved women. PMID:28160888

Fractional resurfacing in the Asian patient: Current state of the art.

PubMed

Wat, Heidi; Wu, Douglas C; Chan, Henry Hin Lee

2017-01-01

Fractionated photothermolysis (FP) has revolutionized modern laser technology. By creating selective columns of microthermal damage, fractionated devices allows for greater treatment depths to be achieved without the prolonged downtime and risk of complications seen in traditional fully ablative laser resurfacing. Fractional resurfacing is a proven method to treat a variety of cutaneous conditions. In the Caucasian patient, a wide range of devices and treatment settings can be utilized safely and effectively. However, ethnic skin requires special consideration due to its unique pigmentary characteristics and clinical presentations. In this review article, we detail the current indications and strategies to optimize results and mitigate complications when utilizing fractional resurfacing for the Asian patient. A review of the MEDLINE English literature was conducted on fractionated laser devices studied in the Asian population. Articles included describe non-ablative devices including fractionated erbium glass, thulium fiber, diode, and radiofrequency devices; and ablative devices including fractionated carbon dioxide (CO 2 ) laser, erbium yttrium aluminum garnet and yttrium scandium gallium garnet (YSGG) laser. These data were integrated with the expert opinion of the authors. Taking into account the unique characteristics and cosmetic concerns of the Asian population, fractional resurfacing can be considered a safe and effective option for the treatment of atrophic and hypertrophic scarring, and photorejuvenation in ethnic skin types. Select cases of melasma may be treated with fractionated non-ablative devices, but utilized with caution. The predominant complication associated with fractional resurfacing for these conditions is post-inflammatory hyperpigmentation (PIH) and rebound worsening of melasma. A greater number of treatments at lower density settings and wider treatment intervals typically produce the lowest risks of PIH without compromising treatment efficacy. Lasers Surg. Med. 49:45-59, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Managed approaches to multiple sclerosis in special populations.

PubMed

Sperandeo, Kara; Nogrady, Lisa; Moreo, Kathleen; Prostko, Chris R

2011-01-01

Multiple sclerosis (MS) is a chronic demyelinating disorder of the central nervous system that is classified as an immune-mediated inflammatory disease. In managed care, patients with MS can be managed through care coordination that engages an interprofessional approach to a comprehensive spectrum of preventive, medical, rehabilitative, cognitive, and long-term health care services. In addition, the management paradigm for MS is currently in a stage of rapid evolution, with a number of new agents, including more oral drugs, expected to become available in the near future. Pharmacy and therapeutic committees may soon be faced with evaluating a hierarchy of new scientific data to differentiate the safety and efficacy of these new agents. Decisions will need to be made regarding the utility of these potential new agents among existing therapies with longer-term safety and efficacy data available in the scientific literature. For those MS patients managed under Medicaid, formulary and medication management decisions may be further impacted by psychosocial, cultural, educational, attitudinal, and/or economic factors that may be unique to the Medicaid population. The need to maximize immediate and long-term resource utilization is usually an important consideration when managing a Medicaid population. There is also an increasing focus on quality measures and quality outcomes by the Centers for Medicare and Medicaid Services. Many managed care professionals can be involved in establishing quality measures and quality improvement processes to effectively appropriate and manage the resources required for Medicaid patients with MS. As a result, medication and medical management of this special population can involve a comprehensive approach by managed care professionals. For purposes of this article, the term "special populations" applies to patients with MS who are managed under Medicaid plans. To review (a) particular challenges managed care organizations (MCOs) encounter when managing special populations of Medicaid patients with MS, (b) recent efficacy and safety data for oral therapies for relapsing forms of MS, (c) costs of current MS therapies, and (d) potential strategies for managed care to improve care of their MS patient population and optimize clinical and economic outcomes. Review of recent published literature, abstracts related to MS presented at major medical conferences, and recommendations from key organizations including the U.S. Department of Health and Human Services and the National Multiple Sclerosis Society. The health economics of MS are a central issue for MCOs managing Medicaid patient populations. Additional challenges include the anticipated expansion of the marketplace to include several new oral agents and the lack of consensus guidelines for management of patients with MS. The benefit-risk profile of new agents will need to be considered in the context of established first-line parenteral drugs. Management of patients with MS should include an individualized approach for each patient as part of a shared decision-making process. In the overall management of special patient populations, case management and collaborative practice models in managed care may help to ensure that critical benchmarks are achieved.

Linked Patient-Reported Outcomes Data From Patients With Multiple Sclerosis Recruited on an Open Internet Platform to Health Care Claims Databases Identifies a Representative Population for Real-Life Data Analysis in Multiple Sclerosis.

PubMed

Risson, Valery; Ghodge, Bhaskar; Bonzani, Ian C; Korn, Jonathan R; Medin, Jennie; Saraykar, Tanmay; Sengupta, Souvik; Saini, Deepanshu; Olson, Melvin

2016-09-22

An enormous amount of information relevant to public health is being generated directly by online communities. To explore the feasibility of creating a dataset that links patient-reported outcomes data, from a Web-based survey of US patients with multiple sclerosis (MS) recruited on open Internet platforms, to health care utilization information from health care claims databases. The dataset was generated by linkage analysis to a broader MS population in the United States using both pharmacy and medical claims data sources. US Facebook users with an interest in MS were alerted to a patient-reported survey by targeted advertisements. Eligibility criteria were diagnosis of MS by a specialist (primary progressive, relapsing-remitting, or secondary progressive), ≥12-month history of disease, age 18-65 years, and commercial health insurance. Participants completed a questionnaire including data on demographic and disease characteristics, current and earlier therapies, relapses, disability, health-related quality of life, and employment status and productivity. A unique anonymous profile was generated for each survey respondent. Each anonymous profile was linked to a number of medical and pharmacy claims datasets in the United States. Linkage rates were assessed and survey respondents' representativeness was evaluated based on differences in the distribution of characteristics between the linked survey population and the general MS population in the claims databases. The advertisement was placed on 1,063,973 Facebook users' pages generating 68,674 clicks, 3719 survey attempts, and 651 successfully completed surveys, of which 440 could be linked to any of the claims databases for 2014 or 2015 (67.6% linkage rate). Overall, no significant differences were found between patients who were linked and not linked for educational status, ethnicity, current or prior disease-modifying therapy (DMT) treatment, or presence of a relapse in the last 12 months. The frequencies of the most common MS symptoms did not differ significantly between linked patients and the general MS population in the databases. Linked patients were slightly younger and less likely to be men than those who were not linkable. Linking patient-reported outcomes data, from a Web-based survey of US patients with MS recruited on open Internet platforms, to health care utilization information from claims databases may enable rapid generation of a large population of representative patients with MS suitable for outcomes analysis.

The relation of PTSD symptoms to migraine and headache-related disability among substance dependent inpatients.

PubMed

McDermott, Michael J; Fulwiler, Joshua C; Smitherman, Todd A; Gratz, Kim L; Connolly, Kevin M; Tull, Matthew T

2016-04-01

Despite emerging evidence for the comorbidity of posttraumatic stress disorder (PTSD) and migraine, few studies have examined the relation of PTSD and migraine, particularly among clinical populations at-risk for both conditions (e.g., substance-dependent patients). This study examined the role of PTSD symptoms in migraine and headache-related disability within a sample of 153 substance-dependent inpatients (37.25% female, Mean age 36.46). PTSD symptoms predicted both migraine and headache-related disability above and beyond gender, depression and anxiety symptoms, the experience of a Criterion A traumatic event, and current alcohol use disorder. Findings highlight the strong association between migraine and PTSD symptoms in a unique population at risk for both conditions.

Integrating Sexual Minority Health Issues into a Health Assessment Class.

PubMed

Bosse, Jordon D; Nesteby, J Aleah; Randall, Carla E

2015-01-01

The health needs of the lesbian, gay, bisexual, and transgender (LGBT) population are traditionally overlooked by the health care community and are rendered invisible by most nursing school curricula. Initial contact with a nurse during a health history and assessment can have an impact on whether the person will feel comfortable disclosing his or her identity, returning for services, or following plans of care. Because the first interaction with a nurse can be critical, the health assessment course is an appropriate place in the curriculum to discuss the needs of the LGBT community. This article includes a discussion of unique health risks to the LGBT population, benefits, and challenges of incorporating these issues into the classroom and recommendations for including the care of this population into a health assessment nursing course. Specific communication techniques are provided that may be helpful during history taking and physical examination with a patient who is LGBT. Guidance regarding physical examination of the transgender patient is also included. These suggestions will be helpful to nurse faculty who teach health assessment, nursing students, educators who design and implement professional development and continuing education for established nurses, preceptors in the clinical setting, and any nurse who is unfamiliar with the needs and concerns specific to the LGBT population. Copyright © 2015 Elsevier Inc. All rights reserved.

ZMYND10--Mutation Analysis in Slavic Patients with Primary Ciliary Dyskinesia.

PubMed

Kurkowiak, Małgorzata; Ziętkiewicz, Ewa; Greber, Agnieszka; Voelkel, Katarzyna; Wojda, Alina; Pogorzelski, Andrzej; Witt, Michał

2016-01-01

Primary ciliary dyskinesia (PCD) is a rare recessive disease with a prevalence of 1/10,000; its symptoms are caused by a kinetic dysfunction of motile cilia in the respiratory epithelium, flagella in spermatozoids, and primary cilia in the embryonic node. PCD is genetically heterogeneous: genotyping the already known PCD-related genes explains the genetic basis in 60-65% of the cases, depending on the population. While identification of new genes involved in PCD pathogenesis remains crucial, the search for new, population-specific mutations causative for PCD is equally important. The Slavs remain far less characterized in this respect compared to West European populations, which significantly limits diagnostic capability. The main goal of this study was to characterize the profile of causative genetic defects in one of the PCD-causing genes, ZMYND10, in the cohort of PCD patients of Slavic origin. The study was carried out using biological material from 172 unrelated PCD individuals of Polish origin, with no causative mutation found in nine major PCD genes. While none of the previously described mutations was found using the HRM-based screening, a novel frameshift mutation (c.367delC) in ZMYND10, unique for Slavic PCD population, was found in homozygous state in two unrelated PCD patients. Immunofluorescence analysis confirmed the absence of outer and inner dynein arms from the ciliary axoneme, consistent with the already published ZMYND10-mutated phenotype; cDNA analysis revealed the lack of ZMYND10 mRNA, indicating nonsense-mediated decay of the truncated transcript.

Genotypic Resistance Tests Sequences Reveal the Role of Marginalized Populations in HIV-1 Transmission in Switzerland

PubMed Central

Shilaih, Mohaned; Marzel, Alex; Yang, Wan Lin; Scherrer, Alexandra U.; Schüpbach, Jörg; Böni, Jürg; Yerly, Sabine; Hirsch, Hans H.; Aubert, Vincent; Cavassini, Matthias; Klimkait, Thomas; Vernazza, Pietro L.; Bernasconi, Enos; Furrer, Hansjakob; Günthard, Huldrych F.; Kouyos, Roger; Battegay, Manuel; Braun, Dominique; Bucher, Heiner; Burton-Jeangros, Claudine; Calmy, Alexandra; Dollenmaier, Günter; Egger, Matthias; Elzi, Luigia; Fehr, Jan; Fellay, Jaque; Fux, Christoph; Gorgievski, Meri; Haerry, David; Hasse, Barbara; Hoffmann, Matthias; Hösli, Irene; Kahlert, Christian; Kaiser, Laurent; Keiser, Olivia; Kovari, Helen; Ledergerber, Bruno; Martinetti, Gladys; de Tejada, Begoña Martinez; Marzolini, Catia; Metzner, Karin; Müller, Nicolas; Nadal, David; Nicca, Dunja; Pantaleo, Giuseppe; Rauch, Andre; Regenass, Stephan; Rudin, Christoph; Schöni-Affolter, Franziska; Schmid, Patrick; Speck, Roberto; Stöckle, Marcel; Tarr, Philip; Trkola, Alexandra; Weber, Reiner

2016-01-01

Targeting hard-to-reach/marginalized populations is essential for preventing HIV-transmission. A unique opportunity to identify such populations in Switzerland is provided by a database of all genotypic-resistance-tests from Switzerland, including both sequences from the Swiss HIV Cohort Study (SHCS) and non-cohort sequences. A phylogenetic tree was built using 11,127 SHCS and 2,875 Swiss non-SHCS sequences. Demographics were imputed for non-SHCS patients using a phylogenetic proximity approach. Factors associated with non-cohort outbreaks were determined using logistic regression. Non-B subtype (univariable odds-ratio (OR): 1.9; 95% confidence interval (CI): 1.8–2.1), female gender (OR: 1.6; 95% CI: 1.4–1.7), black ethnicity (OR: 1.9; 95% CI: 1.7–2.1) and heterosexual transmission group (OR:1.8; 95% CI: 1.6–2.0), were all associated with underrepresentation in the SHCS. We found 344 purely non-SHCS transmission clusters, however, these outbreaks were small (median 2, maximum 7 patients) with a strong overlap with the SHCS’. 65% of non-SHCS sequences were part of clusters composed of >= 50% SHCS sequences. Our data suggests that marginalized-populations are underrepresented in the SHCS. However, the limited size of outbreaks among non-SHCS patients in-care implies that no major HIV outbreak in Switzerland was missed by the SHCS surveillance. This study demonstrates the potential of sequence data to assess and extend the scope of infectious-disease surveillance. PMID:27297284

Genotypic Resistance Tests Sequences Reveal the Role of Marginalized Populations in HIV-1 Transmission in Switzerland.

PubMed

Shilaih, Mohaned; Marzel, Alex; Yang, Wan Lin; Scherrer, Alexandra U; Schüpbach, Jörg; Böni, Jürg; Yerly, Sabine; Hirsch, Hans H; Aubert, Vincent; Cavassini, Matthias; Klimkait, Thomas; Vernazza, Pietro L; Bernasconi, Enos; Furrer, Hansjakob; Günthard, Huldrych F; Kouyos, Roger

2016-06-14

Targeting hard-to-reach/marginalized populations is essential for preventing HIV-transmission. A unique opportunity to identify such populations in Switzerland is provided by a database of all genotypic-resistance-tests from Switzerland, including both sequences from the Swiss HIV Cohort Study (SHCS) and non-cohort sequences. A phylogenetic tree was built using 11,127 SHCS and 2,875 Swiss non-SHCS sequences. Demographics were imputed for non-SHCS patients using a phylogenetic proximity approach. Factors associated with non-cohort outbreaks were determined using logistic regression. Non-B subtype (univariable odds-ratio (OR): 1.9; 95% confidence interval (CI): 1.8-2.1), female gender (OR: 1.6; 95% CI: 1.4-1.7), black ethnicity (OR: 1.9; 95% CI: 1.7-2.1) and heterosexual transmission group (OR:1.8; 95% CI: 1.6-2.0), were all associated with underrepresentation in the SHCS. We found 344 purely non-SHCS transmission clusters, however, these outbreaks were small (median 2, maximum 7 patients) with a strong overlap with the SHCS'. 65% of non-SHCS sequences were part of clusters composed of >= 50% SHCS sequences. Our data suggests that marginalized-populations are underrepresented in the SHCS. However, the limited size of outbreaks among non-SHCS patients in-care implies that no major HIV outbreak in Switzerland was missed by the SHCS surveillance. This study demonstrates the potential of sequence data to assess and extend the scope of infectious-disease surveillance.

Improving Transgender Healthcare in the New York City Correctional System.

PubMed

Jaffer, Mohamed; Ayad, John; Tungol, Jose Gabriel; MacDonald, Ross; Dickey, Nathaniel; Venters, Homer

2016-04-01

Correctional settings create unique challenges for patients with special needs, including transgender patients, who have an increased rate of overall discrimination, sexual abuse, healthcare disparities, and improper housing. As part of our correctional health quality improvement process, we sought to review and evaluate the adequacy of care for transgender patients in the New York City jail system. Using correctional pharmacy records, transgender patients receiving hormonal treatment were identified. A brief in-person survey was conducted to evaluate their care in the community before incarceration, medical care in jail, and experience in the jail environment. Survey findings and analysis of transgender patient healthcare-related complaints revealed opportunities for improvements in the provision of care and staff understanding of this population. Utilizing these findings, we conducted lesbian, gay, bisexual, and transgender (LGBT) trainings in all 12 jail clinics for medical, nursing, and mental health staff. Three months after LGBT training, patient complaints dropped by over 50%. After the development and implementation of a newly revised transgender healthcare policy, complaints dropped to zero within 6 months. Our efforts to assess the quality of care provided to transgender patients revealed significant areas for improvement. Although we have made important gains in providing quality care through the implementation of policies and procedures rooted in community standards and the express wishes of our patients, we continue to engage this patient population to identify other issues that impact their health and well-being in the jail environment.

Uniqueness of Nash equilibrium in vaccination games.

PubMed

Bai, Fan

2016-12-01

One crucial condition for the uniqueness of Nash equilibrium set in vaccination games is that the attack ratio monotonically decreases as the vaccine coverage level increasing. We consider several deterministic vaccination models in homogeneous mixing population and in heterogeneous mixing population. Based on the final size relations obtained from the deterministic epidemic models, we prove that the attack ratios can be expressed in terms of the vaccine coverage levels, and also prove that the attack ratios are decreasing functions of vaccine coverage levels. Some thresholds are presented, which depend on the vaccine efficacy. It is proved that for vaccination games in homogeneous mixing population, there is a unique Nash equilibrium for each game.

Prevalence of Hypertension and Associated Risk Factors in Western Alaska Native People: The Western Alaska Tribal Collaborative for Health (WATCH) Study.

PubMed

Jolly, Stacey E; Koller, Kathryn R; Metzger, Jesse S; Day, Gretchen M; Silverman, Angela; Hopkins, Scarlett E; Austin, Melissa A; Boden-Albala, Bernadette; Ebbesson, Sven O E; Boyer, Bert B; Howard, Barbara V; Umans, Jason G

2015-10-01

Hypertension is a common chronic disease and a key risk factor in the development of cardiovascular disease. The Western Alaska Tribal Collaborative for Health study consolidates baseline data from four major cohorts residing in the Norton Sound and Yukon-Kuskokwim regions of western Alaska. This consolidated cohort affords an opportunity for a systematic analysis of high blood pressure and its correlates in a unique population with high stroke rates over a wide age range. While the prevalence of hypertension among western Alaska Native people (30%, age-standardized) is slightly less than that of the US general population (33%), cardiovascular disease is a leading cause of mortality in this rural population. The authors found that improvement is needed in hypertension awareness as about two thirds (64%) of patients reported awareness and only 39% with hypertension were controlled on medication. Future analyses assessing risk and protective factors for incident hypertension in this population are indicated. © 2015 Wiley Periodicals, Inc.

A novel, privacy-preserving cryptographic approach for sharing sequencing data

PubMed Central

Cassa, Christopher A; Miller, Rachel A; Mandl, Kenneth D

2013-01-01

Objective DNA samples are often processed and sequenced in facilities external to the point of collection. These samples are routinely labeled with patient identifiers or pseudonyms, allowing for potential linkage to identity and private clinical information if intercepted during transmission. We present a cryptographic scheme to securely transmit externally generated sequence data which does not require any patient identifiers, public key infrastructure, or the transmission of passwords. Materials and methods This novel encryption scheme cryptographically protects participant sequence data using a shared secret key that is derived from a unique subset of an individual’s genetic sequence. This scheme requires access to a subset of an individual’s genetic sequence to acquire full access to the transmitted sequence data, which helps to prevent sample mismatch. Results We validate that the proposed encryption scheme is robust to sequencing errors, population uniqueness, and sibling disambiguation, and provides sufficient cryptographic key space. Discussion Access to a set of an individual’s genotypes and a mutually agreed cryptographic seed is needed to unlock the full sequence, which provides additional sample authentication and authorization security. We present modest fixed and marginal costs to implement this transmission architecture. Conclusions It is possible for genomics researchers who sequence participant samples externally to protect the transmission of sequence data using unique features of an individual’s genetic sequence. PMID:23125421

NIAID-sponsored 2010 guidelines for managing food allergy: applications in the pediatric population.

PubMed

Burks, A Wesley; Jones, Stacie M; Boyce, Joshua A; Sicherer, Scott H; Wood, Robert A; Assa'ad, Amal; Sampson, Hugh A

2011-11-01

Data from many studies have suggested a rise in the prevalence of food allergies during the past 10 to 20 years. Currently, no curative treatments for food allergy exist, and there are no effective means of preventing the disease. Management of food allergy involves strict avoidance of the allergen in the patient's diet and treatment of symptoms as they arise. Because diagnosis and management of the disease can vary between clinical practice settings, the National Institute of Allergy and Infectious Diseases (NIAID) sponsored development of clinical guidelines for the diagnosis and management of food allergy. The guidelines establish consensus and consistency in definitions, diagnostic criteria, and management practices. They also provide concise recommendations on how to diagnose and manage food allergy and treat acute food allergy reactions. The original guidelines encompass practices relevant to patients of all ages, but food allergy presents unique and specific concerns for infants, children, and teenagers. To focus on those concerns, we describe here the guidelines most pertinent to the pediatric population.

Atopic dermatitis in diverse racial and ethnic groups-Variations in epidemiology, genetics, clinical presentation and treatment.

PubMed

Kaufman, Bridget P; Guttman-Yassky, Emma; Alexis, Andrew F

2018-04-01

Atopic dermatitis (AD) is a chronic inflammatory skin condition that affects diverse ethnic groups with varying prevalence. Despite a predominance of studies in individuals of European ancestry, AD has been found to occur more frequently in Asian and Black individuals than Whites. Therefore, an understanding of the unique clinical features of AD in diverse ethnic groups, as well as the differences in genetic polymorphisms that influence susceptibility to AD and response to current therapies, is paramount for management of an increasingly diverse patient population. In this article, we review key nuances in the epidemiology, pathophysiology, clinical presentation and treatment of AD in non-White ethnic groups, which are largely underappreciated in the literature. We highlight the need for studies evaluating the tissue molecular and cellular phenotypes of AD in non-White patients, as well as greater inclusion of minority groups in clinical trials, to develop targeted treatments for a multi-ethnic population. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Management of the failing Fontan.

PubMed

De Rita, Fabrizio; Crossland, David; Griselli, Massimo; Hasan, Asif

2015-01-01

With and increasing number of early survivors after the palliation of the single ventricle physiology there is a burgeoning Fontan population worldwide that will pose unique challenges because of the inevitable sequelae related to the absence of the alleged "needless" sub-pulmonic ventricle. The increasing number and older-age single-ventricle patients highlights the results of successful contemporary surgical palliation in children, leading to the development of an adult single-ventricle population with unpredictable socio-economic and health service impacts. The wide variability in clinical status of patients with Fontan circulation reflects not only the broadened spectrum of morphological substrates involved, but also the evolving surgical techniques during the last four decades. This has come in the wake of a gradual understanding of an incredibly tricky physiology. The magnitude of the disease, the physio-pathological mechanisms, and the therapeutic options to optimize the "failing Fontan" status and to delay the irreversible deterioration of "Fontan failure" condition are discussed in this review. Copyright © 2015 Elsevier Inc. All rights reserved.

Neuropsychology in India.

PubMed

Kumar, J Keshav; Sadasivan, Akila

2016-11-01

This is an invited paper for a special issue with the objective to provide information on neuropsychology in India. Information was gathered from a literature search and personal communication with professionals working in the field of neuropsychology. Neuropsychology as a specialization started in India approximately 40 years ago. The early years witnessed the use of Western tools for assessing patients with organic brain damage. Subsequent years saw the development of indigenous tools for use with the vast majority of the Indian population and also a few Western tests adapted to suit the needs of the unique Indian clientele. The starting of the Neuropsychology unit at the National Institute of Mental Health and Neurosciences (NIMHANS) in Bangalore in 1975 resulted in changing of the course of training and practice of Neuropsychology. The field of assessments has witnessed indigenous tests being developed, while rehabilitation programs have brought about a decline in cognitive deficits in several clinical conditions. Currently, work within the field of neuropsychology has focused on child, geriatric, acquired brain injury, and forensic populations with a development of unique rehabilitations to suit needs of several clinical conditions. However, there are very few neuropsychologists in the country, and only one nodal training center, which limits the availability of training to the large population of the country. Despite the shortcomings, the field of neuropsychology has received much attention in the recent years with the number of referrals and professionals increasing.

Conservation of genetic uniqueness of populations may increase extinction likelihood of endangered species: the case of Australian mammals.

PubMed

Weeks, Andrew R; Stoklosa, Jakub; Hoffmann, Ary A

2016-01-01

As increasingly fragmented and isolated populations of threatened species become subjected to climate change, invasive species and other stressors, there is an urgent need to consider adaptive potential when making conservation decisions rather than focussing on past processes. In many cases, populations identified as unique and currently managed separately suffer increased risk of extinction through demographic and genetic processes. Other populations currently not at risk are likely to be on a trajectory where declines in population size and fitness soon appear inevitable. Using datasets from natural Australian mammal populations, we show that drift processes are likely to be driving uniqueness in populations of many threatened species as a result of small population size and fragmentation. Conserving and managing such remnant populations separately will therefore often decrease their adaptive potential and increase species extinction risk. These results highlight the need for a paradigm shift in conservation biology practise; strategies need to focus on the preservation of genetic diversity at the species level, rather than population, subspecies or evolutionary significant unit. The introduction of new genetic variants into populations through in situ translocation needs to be considered more broadly in conservation programs as a way of decreasing extinction risk by increasing neutral genetic diversity which may increase the adaptive potential of populations if adaptive variation is also increased.

Challenges of univentricular physiology in heterotaxy.

PubMed

Jacobs, Marshall L; Mavroudis, Constantine

2011-04-01

Patients with heterotaxy syndrome exhibit an extensive constellation of congenital cardiac malformations, making these patients a challenging group to manage surgically. Many of these patients' hearts do not lend themselves to separation of the pulmonary and systemic circulations except by some modification of the Fontan procedure. Palliative procedures early in life are directed at creating a satisfactory balance of pulmonary and systemic blood flow and at the same time ensuring unobstructed pulmonary venous return. Early conversion from parallel pulmonary and systemic circulations to superior cavopulmonary connections is important, to reduce volume work of the systemic ventricle. Heterotaxy patients are generally considered a high-risk population with respect to eventual Fontan procedure. It is important to appreciate the unique and variable anatomy of the sinus node and conduction system and the potential for occult pulmonary venous obstruction, atrioventricular valve regurgitation, and recurrent cyanosis, which may be related to the development of pulmonary arteriovenous malformations.

Communication challenges in complex medical environments.

PubMed

Lee, Jessica D; Hohler, Anna

2014-06-01

The provision of health care is becoming increasingly complex and can involve multiple providers and care setting transitions, particularly as the population is living longer, and often with chronic disease. The Electronic Health Record (EHR) was intended to provide a comprehensive documentation of a patient's health-related information; however, health care systems often function in isolation with EHRs that are unique only to that system. The EHR may also limit face-to-face communication between treating physicians within the same system. It is only with diligent effort that changes in medical management plans are conveyed among providers. When multiple providers are involved in a patient's care, physician-to-patient communication may also suffer, which can impact patient satisfaction and outcome. This article describes a scenario in which several lapses in communication occurred, and it outlines other common pitfalls while providing possible solutions for improving communication across the health care spectrum.

Causal Structure of Brain Physiology after Brain Injury from Subarachnoid Hemorrhage.

PubMed

Claassen, Jan; Rahman, Shah Atiqur; Huang, Yuxiao; Frey, Hans-Peter; Schmidt, J Michael; Albers, David; Falo, Cristina Maria; Park, Soojin; Agarwal, Sachin; Connolly, E Sander; Kleinberg, Samantha

2016-01-01

High frequency physiologic data are routinely generated for intensive care patients. While massive amounts of data make it difficult for clinicians to extract meaningful signals, these data could provide insight into the state of critically ill patients and guide interventions. We develop uniquely customized computational methods to uncover the causal structure within systemic and brain physiologic measures recorded in a neurological intensive care unit after subarachnoid hemorrhage. While the data have many missing values, poor signal-to-noise ratio, and are composed from a heterogeneous patient population, our advanced imputation and causal inference techniques enable physiologic models to be learned for individuals. Our analyses confirm that complex physiologic relationships including demand and supply of oxygen underlie brain oxygen measurements and that mechanisms for brain swelling early after injury may differ from those that develop in a delayed fashion. These inference methods will enable wider use of ICU data to understand patient physiology.

Cannabis Intoxication Case Series: The Dangers of Edibles Containing Tetrahydrocannabinol.

PubMed

Vo, Kathy T; Horng, Howard; Li, Kai; Ho, Raymond Y; Wu, Alan H B; Lynch, Kara L; Smollin, Craig G

2018-03-01

Cannabis and its principal active constituent, Δ9-tetrahydrocannabinol (THC), are increasingly available as edibles resembling commercially available food products. In this case series, we describe a population of predominantly pediatric patients who were inadvertently exposed to a THC-containing product in San Francisco. Twelve children and 9 adults were identified, with 16 patients having detectable serum THC and THC metabolites. All patients presented to hospitals with a variety of constitutional symptoms and all were discharged home within 12 hours. In general, pediatric patients had more severe symptoms and longer hospital length of stay, and, uniquely, a majority presented with leukocytosis and elevated lactic acid levels. We recommend that efforts be made to increase general public awareness in regard to the potential hazards of THC-containing edibles resembling commercially available food products. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

A study of Huntington disease-like syndromes in black South African patients reveals a single SCA2 mutation and a unique distribution of normal alleles across five repeat loci.

PubMed

Baine, Fiona K; Peerbhai, Nabeelah; Krause, Amanda

2018-07-15

Huntington disease (HD) is a progressive neurodegenerative disease, characterised by a triad of movement disorder, emotional and behavioural disturbances and cognitive impairment. The underlying cause is an expanded CAG repeat in the huntingtin gene. For a small proportion of patients presenting with HD-like symptoms, the mutation in this gene is not identified and they are said to have a HD "phenocopy". South Africa has the highest number of recorded cases of an African-specific phenocopy, Huntington disease-like 2 (HDL2), caused by a repeat expansion in the junctophilin-3 gene. However, a significant proportion of black patients with clinical symptoms suggestive of HD still test negative for HD and HDL2. This study thus aimed to investigate five other loci associated with HD phenocopy syndromes - ATN1, ATXN2, ATXN7, TBP and C9orf72. In a sample of patients in whom HD and HDL2 had been excluded, a single expansion was identified in the ATXN2 gene, confirming a diagnosis of Spinocerebellar ataxia 2. The results indicate that common repeat expansion disorders do not contribute significantly to the HD-like phenotype in black South African patients. Importantly, allele sizing reveals unique distributions of normal repeat lengths across the associated loci in the African population studied. Copyright © 2018 Elsevier B.V. All rights reserved.

Schizophrenia and sleep disorders: links, risks, and management challenges.

PubMed

Kaskie, Rachel E; Graziano, Bianca; Ferrarelli, Fabio

2017-01-01

Schizophrenia is a major psychiatric disorder that has a massive, long-lasting negative impact on the patients as well as society. While positive symptoms (i.e., delusions and hallucinations), negative symptoms (i.e., anhedonia, social withdrawal), and cognitive impairments are traditionally considered the most prominent features of this disorder, the role of sleep and sleep disturbances has gained increasing prominence in clinical practice. Indeed, the vast majority of patients with schizophrenia report sleep abnormalities, which tend to precede illness onset and can predict an acute exacerbation of psychotic symptoms. Furthermore, schizophrenia patients often have a comorbid sleep disorder, including insomnia, obstructive sleep apnea, restless leg syndrome, or periodic limb movement disorder. Despite accumulating data, the links between sleep disorders and schizophrenia have not been thoroughly examined, in part because they are difficult to disentangle, as numerous factors contribute to their comorbidity, including medication status. Additionally, sleep disorders are often not the primary focus of clinicians treating this population, despite studies suggesting that comorbid sleep disorders carry their own unique risks, including worsening of psychotic symptoms and poorer quality of life. There is also limited information about effective management strategies for schizophrenia patients affected by significant sleep disturbances and/or sleep disorders. To begin addressing these issues, the present review will systematically examine the literature on sleep disorders and schizophrenia, focusing on studies related to 1) links between distinct sleep disorders and schizophrenia; 2) risks unique to patients with a comorbid sleep disorder; and 3) and management challenges and strategies.

The State of Ethnic Dermatology in Canada.

PubMed

Ogunyemi, Boluwaji; Miller-Monthrope, Yvette

Approximately 30% of Canadians will be members of a visible minority by 2031. When dermatology became an independent medical discipline in the late 18th and early 19th centuries, most residents of Canada and the United States were of Northern European descent. Morphology and descriptions of dermatoses are based on patients with light skin. Skin of colour dermatology refers to a unique field in dermatology dedicated to the diagnosis and management of disorders that are more prevalent in patients with moderately to richly pigmented skin. Important differences in the presentation of common dermatoses such as seborrheic dermatitis and acne exist in patients with darker skin types. The effect of traditional treatments for common and uncommon dermatoses is also an important consideration in managing patients with skin of colour. Such treatments may result in adverse effects such as postinflammatory hyperpigmentation or keloid scarring at a higher rate. Most respondents from a 2013 UK study of dermatology residents and consultants agreed that individuals with 'ethnic skin' had specific and unique dermatological problems. The Royal College of Physician and Surgeons of Canada's Objectives of Training in Dermatology states that residents must demonstrate the requisite knowledge, skills, and attitudes for effective patient-centred care and service to a diverse population. Future steps include creating a national society of dermatologists interested in clinical and academic aspects of ethnic dermatology. As well, presentations on skin of colour dermatology could be encouraged at major Canadian dermatology meetings.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pastor-Soler, N.M.; Hu, D.; Schertz, E.

Metachromatic leukodystrophy (MLD) is an autosomal recessive lysosomal disorder caused by defective catabolism of sulfatide, an important sphingolipid in myelin. Late infantile (LI), juvenile and adult patients with MLD are found throughout the world. Mutational analysis of the ARSA gene in patients with MLD has resulted in the identification of about 30 mutations. Recently we identified a mutation in the ARSA gene that was present in all Navajo Indian patients tested with LIMLD. All of the patients were homozygous for the G to A change at position 1 of intron 4 which causes aberrant splicing and a low level ofmore » ARSA mRNA. This mutation had not been found in any non-Navajo population. However, recently we were sent samples from two Alaskan Eskimo siblings with LIMLD. Sequencing of amplified genomic DNA showed that the affected siblings were homozygous for the above mutation. A simple DNA-based test will permit accurate patient and carrier identification in both the Eskimo and Navajo populations. Many studies have focused on the migrations of the Amerindian, Athapaskan and Eskimo from eastern Asia to the new world and the intermingling of these peoples. While it is clear that Na-Dene speaking Navajo split from other Athapaskan tribes and migrated from western Canada and Alaska to the southwest area of the United States, a direct genetic connection between the Western Eskimo and the Navajo has not been made. The presence of the same unique mutation causing a fatal inherited disease in both populations may point to interaction between these peoples prior to the migration of the Navajos south about 1000 years ago.« less

Analysis of Diagnoses Associated with Multiple Sclerosis-Related In-Hospital Mortality Using the Premier Hospital Database.

PubMed

Ernst, Frank R; Pocoski, Jennifer; Cutter, Gary; Kaufman, David W; Pleimes, Dirk

2016-01-01

We sought to compare mortality rates and related diagnoses in hospitalized patients with multiple sclerosis (MS), those with diabetes mellitus (DM), and the general hospitalized population (GHP). Patients who died between 2007 and 2011 were identified in the US hospital-based Premier Healthcare Database. Demographic information was collected, mortality rates calculated, and principal diagnoses categorized. Of 55,152 unique patients with MS identified, 1518 died. Mean age at death was 10 years younger for the MS group (63.4 years) than for the DM (73.3 years) and GHP (73.1 years) groups. Age-adjusted mortality rates, based on the 2000 US Standard Million Population, were 1077, 1248, and 1133 per 100,000, respectively. Infection was the most common principal diagnosis at the hospital stay during which the patient died in the MS cohort (43.1% vs. 26.3% and 24.0% in the DM and GHP groups, respectively). Other common principal diagnoses in the MS group included pulmonary (17.5%) and cardiovascular (12.1%) disease. Septicemia/sepsis/septic shock was a secondary diagnosis for 50.7% of patients with MS versus 36.0% and 31.0% of patients in the DM and GHP cohorts, respectively. Patients with MS had a shorter life span than patients with DM or the GHP and were more likely to have a principal diagnosis of infection at their final hospital stay. However, the database was limited to codes recorded in the hospital; diagnoses received outside the hospital were not captured.

A de novo whole gene deletion of XIAP detected by exome sequencing analysis in very early onset inflammatory bowel disease: a case report.

PubMed

Kelsen, Judith R; Dawany, Noor; Martinez, Alejandro; Martinez, Alejuandro; Grochowski, Christopher M; Maurer, Kelly; Rappaport, Eric; Piccoli, David A; Baldassano, Robert N; Mamula, Petar; Sullivan, Kathleen E; Devoto, Marcella

2015-11-18

Children with very early-onset inflammatory bowel disease (VEO-IBD), those diagnosed at less than 5 years of age, are a unique population. A subset of these patients present with a distinct phenotype and more severe disease than older children and adults. Host genetics is thought to play a more prominent role in this young population, and monogenic defects in genes related to primary immunodeficiencies are responsible for the disease in a small subset of patients with VEO-IBD. We report a child who presented at 3 weeks of life with very early-onset inflammatory bowel disease (VEO-IBD). He had a complicated disease course and remained unresponsive to medical and surgical therapy. The refractory nature of his disease, together with his young age of presentation, prompted utilization of whole exome sequencing (WES) to detect an underlying monogenic primary immunodeficiency and potentially target therapy to the identified defect. Copy number variation analysis (CNV) was performed using the eXome-Hidden Markov Model. Whole exome sequencing revealed 1,380 nonsense and missense variants in the patient. Plausible candidate variants were not detected following analysis of filtered variants, therefore, we performed CNV analysis of the WES data, which led us to identify a de novo whole gene deletion in XIAP. This is the first reported whole gene deletion in XIAP, the causal gene responsible for XLP2 (X-linked lymphoproliferative Disease 2). XLP2 is a syndrome resulting in VEO-IBD and can increase susceptibility to hemophagocytic lymphohistocytosis (HLH). This identification allowed the patient to be referred for bone marrow transplantation, potentially curative for his disease and critical to prevent the catastrophic sequela of HLH. This illustrates the unique etiology of VEO-IBD, and the subsequent effects on therapeutic options. This cohort requires careful and thorough evaluation for monogenic defects and primary immunodeficiencies.

The SMILE study: a study of medical information and lifestyles in Eindhoven, the rationale and contents of a large prospective dynamic cohort study

PubMed Central

van den Akker, Marjan; Spigt, Mark G; De Raeve, Lore; van Steenkiste, Ben; Metsemakers, Job FM; van Voorst, Ernst J; de Vries, Hein

2008-01-01

Background Health problems, health behavior, and the consequences of bad health are often intertwined. There is a growing need among physicians, researchers and policy makers to obtain a comprehensive insight into the mutual influences of different health related, institutional and environmental concepts and their collective developmental processes over time. Methods/Design SMILE is a large prospective cohort study, focusing on a broad range of aspects of disease, health and lifestyles of people living in Eindhoven, the Netherlands. This study is unique in its kind, because two data collection strategies are combined: first data on morbidity, mortality, medication prescriptions, and use of care facilities are continuously registered using electronic medical records in nine primary health care centers. Data are extracted regularly on an anonymous basis. Secondly, information about lifestyles and the determinants of (ill) health, sociodemographic, psychological and sociological characteristics and consequences of chronic disease are gathered on a regular basis by means of extensive patient questionnaires. The target population consisted of over 30,000 patients aged 12 years and older enrolled in the participating primary health care centers. Discussion Despite our relatively low response rates, we trust that, because of the longitudinal character of the study and the high absolute number of participants, our database contains a valuable set of information. SMILE is a longitudinal cohort with a long follow-up period (15 years). The long follow-up and the unique combination of the two data collection strategies will enable us to disentangle causal relationships. Furthermore, patient-reported characteristics can be related to self-reported health, as well as to more validated physician registered morbidity. Finally, this population can be used as a sampling frame for intervention studies. Sampling can either be based on the presence of certain diseases, or on specific lifestyles or other patient characteristics. PMID:18208599

Noxious sensory perceptions in patients with mild to moderate rosacea treated with azelaic acid 15% gel.

PubMed

Draelos, Zoe Diana

2004-10-01

Patients with rosacea form a unique subset of the sensitive skin population because of the barrier defects inherent in this condition and the increased propensity for burning/stinging from topical products. This propensity for burning/ stinging when medications, skin care products, or cosmetics are applied to the facial skin has been frequently documented but never quantified. The objective of this 2-week study was to determine the prevalence of heightened neurosensory perceptions of burning/stinging in a random population of 40 women with mild to moderate rosacea defined as 15 or fewer inflammatory papules or pustules. Also evaluated was the effect of azelaic acid 15% gel on barrier function and facial stinging utilizing transepidermal water loss (TEWL), corneometry, and lactic acid facial sting tests as noninvasive measurement criteria. At baseline, the incidence of lactic acid stinging among these rosacea subjects was 62.5%, which is substantially higher than observed in the general population. Two weeks after application of azelaic acid 15% gel, no evidence of barrier damage was noted on TEWL or corneometry tests. Moreover, there was no statistical relationship between lactic acid stinging and a stinging response that is occasionally reported with exposure to azelaic acid 15% gel.

Survey of family physicians' perspectives on management of immigrant patients: attitudes, barriers, strategies, and training needs.

PubMed

Papic, Ognjen; Malak, Ziad; Rosenberg, Ellen

2012-02-01

Immigrants in Canada form a significant portion of the population and have unique and complex health needs. This study was undertaken to evaluate family physicians' perspectives on the care of this population. Questionnaires were distributed to family physicians in Montreal (n=598). The main outcomes of interest were attitudes of family physicians to care of immigrants including barriers perceived, resources and strategies used to accommodate immigrant patients, as well as physicians' training in immigrant care. Family physicians find communication difficulties to be the key barrier and would like to see the access to interpreters improved. Very few physicians make use of professional interpreters. Only a minority of physicians have received specific cross-cultural competence training but those who have seem to provide better quality of care. Knowledge of physician perspectives is an essential element on which to base interventions to improve the quality of care to this population. Physicians should be reminded of the importance of using professional interpretation services in multi-lingual encounters. Cross-cultural training should be further advanced in Canadian medical curricula. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Antipsychotic Treatment of Adolescent Dual Diagnosis Patients

PubMed Central

Price, Scott A.; Brahm, Nancy C.

2011-01-01

BACKGROUND A diagnosis of schizophrenia requires development of a pharmacotherapy regimen that balances many factors in the therapeutic decision-making process. Patient age and the presence or absence of comorbid chemical dependency represent two factors. Comorbid chemical dependency can have a profound impact on the successful treatment of schizophrenia, making patients with dual diagnoses of schizophrenia and chemical dependence a uniquely challenging population. There is little information regarding treatment of schizophrenia and chemical dependence in the pediatric population. Existing data from pediatric and adult populations may facilitate a well-guided and knowledgeable approach to treating pediatric dual diagnosis patients. METHODS A review of the literature for medication trials evaluating antipsychotic medication used to treat schizophrenia in childhood and adolescence as well as antipsychotic use in the treatment of the dual diagnoses of schizophrenia and chemical dependence was done. Databases for Ovid MEDLINE, PubMed, and PsycInfo were searched using the terms “addiction,” “adolescence,” “childhood,” “dual diagnosis,” “schizophrenia,” and “substance abuse.” Results were limited to English-language articles. RESULTS Seven articles were identified related to psychotic disorders and substance abuse in pediatric populations. Psychosis measurement instruments included the Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, and Clinical Global Impression. Mean improvements were insignificant in most cases. Medication trials included clozapine, olanzapine, risperidone, and molindone. Trial safety concerns included metabolic effects, increased prolactin levels, and akathisia. One study with random assignment to olanzapine was discontinued early because of substantial weight gain without evidence of superior efficacy. Clozapine treatment was associated with more adverse drug events. CONCLUSION There is a great need for more research and use of available data to develop safe and effective treatment guidelines for childhood and adolescent dual diagnosis patients. When appropriate decisions are made regarding treatment of patients with comorbid schizophrenia and chemical dependence, both conditions may benefit with increased remission. PMID:22768007

Big Events and Risks to Global Substance Using Populations: Unique Threats and Common Challenges.

PubMed

Mackey, Tim K; Strathdee, Steffanie A

2015-01-01

In this commentary, we review a set of "Big Events" from around the world that have adversely impacted substance using populations by first identifying common thematic areas between them, and then describing the unique challenges faced by the diverse and vulnerable populations impacted. The Big Events reviewed are multifaceted and complex in nature, and include the recent global financial crisis, economic and trade sanctions, political transition and its impact on ethnic minorities, colonialism and indigenous communities, and ecological disasters. All have led to immense trauma, displacement, and disruption to critical healthcare services/treatment for people who use drugs, populations who are left underserved in the midst of these crises. It is our hope that through this comparative assessment, global policymakers will proactively identify Big Events and prioritize the development of interventions and policy that meet the unique and immediate needs of substance using population in order to mitigate the significant negative short- and long-term impacts on global public health.

Management of pediatric mandible fractures.

PubMed

Goth, Stephen; Sawatari, Yoh; Peleg, Michael

2012-01-01

The pediatric mandible fracture is a rare occurrence when compared with the number of mandible fractures that occur within the adult population. Although the clinician who manages facial fractures may never encounter a pediatric mandible fracture, it is a unique injury that warrants a comprehensive discussion. Because of the unique anatomy, dentition, and growth of the pediatric patient, the management of a pediatric mandible fracture requires true diligence with a variance in treatment ranging from soft diet to open reduction and internal fixation. In addition to the variability in treatment, any trauma to the face of a child requires additional management factors including child abuse issues and long-term sequelae involving skeletal growth, which may affect facial symmetry and occlusion. The following is a review of the incidence, relevant anatomy, clinical and radiographic examination, and treatment modalities for specific fracture types of the pediatric mandible based on the clinical experience at the University of Miami/Jackson Memorial Hospital Oral and Maxillofacial Surgery program. In addition, a review of the literature regarding the management of the pediatric mandible fracture was performed to offer a more comprehensive overview of this unique subset of facial fractures.

Creating a sampling frame for population-based veteran research: representativeness and overlap of VA and Department of Defense databases.

PubMed

Washington, Donna L; Sun, Su; Canning, Mark

2010-01-01

Most veteran research is conducted in Department of Veterans Affairs (VA) healthcare settings, although most veterans obtain healthcare outside the VA. Our objective was to determine the adequacy and relative contributions of Veterans Health Administration (VHA), Veterans Benefits Administration (VBA), and Department of Defense (DOD) administrative databases for representing the U.S. veteran population, using as an example the creation of a sampling frame for the National Survey of Women Veterans. In 2008, we merged the VHA, VBA, and DOD databases. We identified the number of unique records both overall and from each database. The combined databases yielded 925,946 unique records, representing 51% of the 1,802,000 U.S. women veteran population. The DOD database included 30% of the population (with 8% overlap with other databases). The VHA enrollment database contributed an additional 20% unique women veterans (with 6% overlap with VBA databases). VBA databases contributed an additional 2% unique women veterans (beyond 10% overlap with other databases). Use of VBA and DOD databases substantially expands access to the population of veterans beyond those in VHA databases, regardless of VA use. Adoption of these additional databases would enhance the value and generalizability of a wide range of studies of both male and female veterans.

Characterization of a rare Unverricht-Lundborg disease mutation.

PubMed

Duarte, Ana Joana; Ribeiro, Diogo; Chaves, João; Amaral, Olga

2015-09-01

Cystatin B (CSTB) gene mutations cause Unverricht-Lundborg disease (ULD), a rare form of myoclonic epilepsy. The previous identification of a Portuguese patient, homozygous for a unique splicing defect (c.66G > A; p.Q22Q), provided awareness regarding the existence of variant forms of ULD. In this work we aimed at the characterization of this mutation at the population level and at the cellular level. The cellular fractionation studies here carried out showed mislocalization of the protein and add to the knowledge on this disease.

Stop waiting and start creating: service learning with an outpatient bone marrow transplant unit art cart program.

PubMed

Fletcher, Tina; Bayer, Christina; Beyer, Emily; Gonzales, Jessica; Ralston, Ashley; Yount, Phyllis

2013-01-01

This paper examines how master of occupational therapy students, their occupational therapy instructor, and a community-based licensed clinical social worker collaborated in a service learning art cart program on an outpatient bone marrow transplant unit. As they progressed through the phases of Kolb's model of service learning, occupational therapy students, their occupational therapy instructor, and the licensed clinical social worker were all able to meet mutual goals of serving a unique patient population, increasing knowledge of best practices, and building and fostering university/community relationships.

Radiation Toxicity to the Cardiovascular System.

PubMed

Marmagkiolis, Konstantinos; Finch, William; Tsitlakidou, Despina; Josephs, Tyler; Iliescu, Cezar; Best, John F; Yang, Eric H

2016-03-01

Radiation therapy is an important component of cancer treatment, and today, it is applied to approximately 50% of malignancies, including valvular, myocardial, pericardial, coronary or peripheral vascular disease, and arrhythmias. An increased clinical suspicion and knowledge of those mechanisms is important to initiate appropriate screening for the optimal diagnosis and treatment. As the number of cancer survivors has been steadily increasing over the last decades, cardio-oncology, an evolving subspecialty of cardiology, will soon play a pivotal role in raising awareness of the increased cardiovascular risk and formulate strategies to optimally manage patients in this unique population.

Towards sustainable traumatic brain injury care systems: healthcare leadership imperatives in Canada.

PubMed

Caro, Denis

2011-01-01

Traumatic brain injuries pose strategic population health challenges in the face of burgeoning clinical demands that continue to tax capital, financial, and social resource capacities. The sustainability of traumatic brain injury care systems depends on paradigmatic shifts in healthcare leadership thinking. In quest for high-performance care and sustained quality of life for traumatic brain injury patients, this article presents a unique paradigm of seven care performance layers and seven health leadership imperatives that together form the paradigm for the systemic sustainability of TBI care systems of the future.

Ketamine - A Multifaceted Drug.

PubMed

Meng, Lingzhong; Li, Jian; Lu, Yi; Sun, Dajin; Tao, Yuan-Xiang; Liu, Renyu; Luo, Jin Jun

There is a petition for tight control of ketamine from the Chinese government to classify ketamine as a Schedule I drug, which is defined as a drug with no currently accepted medical use but a high potential for abuse. However, ketamine has unique properties that can benefit different patient populations. Scholars from the Translational Perioperative and Pain Medicine and the International Chinese Academy of Anesthesiology WeChat groups had an interactive discussion on ketamine, including its current medical applications, future research priorities, and benefits versus risks. The discussion is summarized in this manuscript with some minor edits.

Managing residual limb hyperhidrosis in wounded warriors.

PubMed

Pace, Sarah; Kentosh, Joshua

2016-06-01

Residual limb dermatologic problems are a common concern among young active traumatic amputee patients who strive to maintain an active lifestyle. Hyperhidrosis of residual limbs is a recognized inciting factor that often contributes to residual limb dermatoses and is driven by the design of the prosthetic liner covering the residual limb. Treatment of hyperhidrosis in this population presents a unique challenge. Several accepted treatments of hyperhidrosis can offer some relief but have been limited by lack of results or side-effect profiles. Microwave thermal ablation has presented an enticing potential for residual limb hyperhidrosis.

HIV Infection and Older Americans: The Public Health Perspective

PubMed Central

Buchacz, Kate; Gebo, Kelly A.; Mermin, Jonathan

2012-01-01

HIV disease is often perceived as a condition affecting young adults. However, approximately 11% of new infections occur in adults aged 50 years or older. Among persons living with HIV disease, it is estimated that more than half will be aged 50 years or older in the near future. In this review, we highlight issues related to HIV prevention and treatment for HIV-uninfected and HIV-infected older Americans, and outline unique considerations and emerging challenges for public health and patient management in these 2 populations. PMID:22698038

Supporting Asian patients with metastatic breast cancer during ixabepilone therapy.

PubMed

Bourdeanu, Laura; Wong, Siu-Fun

2010-05-01

Ixabepilone is currently FDA-approved in metastatic breast cancer, and most patients in the registrational trials were Caucasian. Studies in Asian populations receiving other cytotoxic agents have revealed differential pharmacokinetics and clinical outcomes. As such, clinicians should understand the possible contributions of Asian ethnicity and culture to the clinical profile of ixabepilone. Studies in Asian patients receiving other chemotherapeutics reported altered toxicity profiles for myelosuppression, neurotoxicity and gastrointestinal symptoms. Encouragingly, the limited clinical data in Asian patients receiving ixabepilone suggest that efficacy and toxicity in these women resemble those reported in the ixabepilone registrational trials. The reader will better understand how Asian genetics and culture may influence treatment outcomes and patient attitudes toward therapy and interaction with caregivers. Management of ixabepilone-related adverse events is also discussed with an emphasis on special considerations for Asian patients. Awareness of possible altered drug response in Asian patients will aid clinicians in monitoring for toxicity, recognizing the need for dose modification and educating patients. Sensitivity to cultural aspects that are unique to Asians may improve adherence, reporting of adverse events and trust among Asian patients receiving ixabepilone.

Characteristics and Outcomes of Patients With Nodular Lymphocyte-Predominant Hodgkin Lymphoma Versus Those With Classical Hodgkin Lymphoma: A Population-Based Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerber, Naamit K.; Atoria, Coral L.; Elkin, Elena B.

Purpose: Nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL) is rare, comprising approximately 5% of all Hodgkin lymphoma (HL) cases. Patients with NLPHL tend to have better prognoses than those with classical HL (CHL). Our goal was to assess differences in survival between NLPHL and CHL patients, controlling for differences in patient and disease characteristics. Methods and Materials: Using data from the population-based Surveillance, Epidemiology and End Results (SEER) cancer registry program, we identified patients diagnosed with pathologically confirmed HL between 1988 and 2010. Results: We identified 1,162 patients with NLPHL and 29,083 patients with CHL. With a median follow-up of 7 years, 5- andmore » 10-year overall survival (OS) rates were 91% and 83% for NLPHL, respectively, and 81% and 74% for CHL, respectively. After adjusting for all available characteristics, NLPHL (vs CHL) was associated with higher OS (hazard ratio [HR]: 0.62, P<.01) and disease-specific survival (DSS; HR: 0.48, P<.01). The male predominance of NLPHL, compared to CHL, as well as the more favorable prognostic features in NLPHL patients are most pronounced in NLPHL patients <20 years old. Among all NLPHL patients, younger patients were less likely to receive radiation, and radiation use has declined by 40% for all patients from 1988 to 2010. Receipt of radiation was associated with better OS (HR: 0.64, P=.03) and DSS (HR: 0.45, P=.01) in NLPHL patients after controlling for available baseline characteristics. Other factors associated with OS and DSS in NLPHL patients are younger age and early stage. Conclusions: Our results in a large population dataset demonstrated that NLPHL patients have improved prognosis compared to CHL patients, even after accounting for stage and baseline characteristics. Use of radiation is declining among NLPHL patients despite an association in this series between radiation and better DSS and OS. Unique treatment strategies for NLPHL are warranted in both early and advanced stage disease.« less

A Community Health Worker Intervention for Diabetes Self-Management Among the Tz'utujil Maya of Guatemala.

PubMed

Micikas, Mary; Foster, Jennifer; Weis, Allison; Lopez-Salm, Alyse; Lungelow, Danielle; Mendez, Pedro; Micikas, Ashley

2015-07-01

Despite the high prevalence of diabetes in rural Guatemala, there is little education in diabetes self-management, particularly among the indigenous population. To address this need, a culturally relevant education intervention for diabetic patients was developed and implemented in two rural communities in Guatemala. An evaluative research project was designed to investigate if the structured, community-led diabetes self-management intervention improved selected health outcomes for participants. A one-group, pretest-posttest design was used to evaluate the effectiveness of the educational intervention by comparing measures of health, knowledge, and behavior in patients pre- and postintervention. A survey instrument assessed health beliefs and practices and hemoglobin A1c (HgA1c) measured blood glucose levels at baseline and 4 months post initiation of intervention (n = 52). There was a significant decrease (1.2%) in the main outcome measure, mean HgA1c from baseline (10.1%) and follow-up (8.9%; p = .001). Other survey findings were not statistically significant. This study illustrates that a culturally specific, diabetes self-management program led by community health workers may reduce HgA1c levels in rural populations of Guatemala. However, as a random sample was not feasible for this study, this finding should be interpreted with caution. Limitations unique to the setting and patient population are discussed in this article. © 2014 Society for Public Health Education.

Toward population management in an integrated care model.

PubMed

Maddux, Franklin W; McMurray, Stephen; Nissenson, Allen R

2013-04-01

Under the Patient Protection and Affordable Care Act of 2010, accountable care organizations (ACOs) will be the primary mechanism for achieving the dual goals of high-quality patient care at managed per capita costs. To achieve these goals in the newly emerging health care environment, the nephrology community must plan for and direct integrated delivery and coordination of renal care, focusing on population management. Even though the ESRD patient population is a complex group with comorbid conditions that may confound integration of care, the nephrology community has unique experience providing integrated care through ACO-like programs. Specifically, the recent ESRD Management Demonstration Project sponsored by the Centers for Medicare & Medicaid Services and the current ESRD Prospective Payment System with it Quality Incentive Program have demonstrated that integrated delivery of renal care can be accomplished in a manner that provides improved clinical outcomes with some financial margin of savings. Moving forward, integrated renal care will probably be linked to provider performance and quality outcomes measures, and clinical integration initiatives will share several common elements, namely performance-based payment models, coordination of communication via health care information technology, and development of best practices for care coordination and resource utilization. Integration initiatives must be designed to be measured and evaluated, and, consistent with principles of continuous quality improvement, each initiative will provide for iterative improvements of the initiative.

Genome-wide molecular dissection of serotype M3 group A Streptococcus strains causing two epidemics of invasive infections.

PubMed

Beres, Stephen B; Sylva, Gail L; Sturdevant, Daniel E; Granville, Chanel N; Liu, Mengyao; Ricklefs, Stacy M; Whitney, Adeline R; Parkins, Larye D; Hoe, Nancy P; Adams, Gerald J; Low, Donald E; DeLeo, Frank R; McGeer, Allison; Musser, James M

2004-08-10

Molecular factors that contribute to the emergence of new virulent bacterial subclones and epidemics are poorly understood. We hypothesized that analysis of a population-based strain sample of serotype M3 group A Streptococcus (GAS) recovered from patients with invasive infection by using genome-wide investigative methods would provide new insight into this fundamental infectious disease problem. Serotype M3 GAS strains (n = 255) cultured from patients in Ontario, Canada, over 11 years and representing two distinct infection peaks were studied. Genetic diversity was indexed by pulsed-field gel electrophoresis, DNA-DNA microarray, whole-genome PCR scanning, prophage genotyping, targeted gene sequencing, and single-nucleotide polymorphism genotyping. All variation in gene content was attributable to acquisition or loss of prophages, a molecular process that generated unique combinations of proven or putative virulence genes. Distinct serotype M3 genotypes experienced rapid population expansion and caused infections that differed significantly in character and severity. Molecular genetic analysis, combined with immunologic studies, implicated a 4-aa duplication in the extreme N terminus of M protein as a factor contributing to an epidemic wave of serotype M3 invasive infections. This finding has implications for GAS vaccine research. Genome-wide analysis of population-based strain samples cultured from clinically well defined patients is crucial for understanding the molecular events underlying bacterial epidemics.

Oral Health on Wheels: A Service Learning Project for Dental Hygiene Students.

PubMed

Flick, Heather; Barrett, Sheri; Carter-Hanson, Carrie

2016-08-01

To provide dental hygiene students with a service learning opportunity to work with special needs and culturally diverse underserved populations through the Oral Health on Wheels (OHOW) community based mobile dental hygiene clinic. A student feedback survey was administered between the years of 2009 and 2013 to 90 students in order to gather and identify significant satisfaction, skills acquisition and personal growth information after the student's clinical experience on the OHOW. ANOVA and Pearson correlation coefficient statistical analysis were utilized to investigate relationships between student responses to key questions in the survey. An analysis of 85 student responses (94.44%) demonstrated statistically significant correlations between student learning and their understanding of underserved populations, building confidence in skills, participation as a dental team member and understanding their role in total patient care. The strong correlations between these key questions related to the clinical experience and students confidence, skills integration into the dental team, and understanding of both total patient care, and the increased understanding of the oral health care needs of special populations. All questions directly link to the core mission of the OHOW program. The OHOW clinical experience allows dental hygiene students a unique opportunity to engage in their community while acquiring necessary clinical competencies required by national accreditation and providing access to oral health care services to underserved patients who would otherwise go without treatment. Copyright © 2016 The American Dental Hygienists’ Association.

Toward population management in an integrated care model.

PubMed

Maddux, Franklin W; McMurray, Stephen; Nissenson, Allen R

2013-01-01

Under the Patient Protection and Affordable Care Act of 2010, accountable care organizations (ACOs) will be the primary mechanism for achieving the dual goals of high-quality patient care at managed per capita costs. To achieve these goals in the newly emerging health care environment, the nephrology community must plan for and direct integrated delivery and coordination of renal care, focusing on population management. Even though the ESRD patient population is a complex group with comorbid conditions that may confound integration of care, the nephrology community has unique experience providing integrated care through ACO-like programs. Specifically, the recent ESRD Management Demonstration Project sponsored by the Centers for Medicare & Medicaid Services and the current ESRD Prospective Payment System with it Quality Incentive Program have demonstrated that integrated delivery of renal care can be accomplished in a manner that provides improved clinical outcomes with some financial margin of savings. Moving forward, integrated renal care will probably be linked to provider performance and quality outcomes measures, and clinical integration initiatives will share several common elements, namely performance-based payment models, coordination of communication via health care information technology, and development of best practices for care coordination and resource utilization. Integration initiatives must be designed to be measured and evaluated, and, consistent with principles of continuous quality improvement, each initiative will provide for iterative improvements of the initiative. © 2013 S. Karger AG, Basel.

Phenotype and Clinical Course of Inflammatory Bowel Disease with Co-Existent Celiac Disease.

PubMed

Tse, Chung Sang; Deepak, Parakkal; De La Fuente, Jaime; Bledsoe, Adam C; Larson, Joseph J; Murray, Joseph A; Papadakis, Konstantinos A

2018-05-07

Inflammatory bowel diseases, principally Crohn's disease and ulcerative colitis, and celiac disease are among the most common immune-mediated gastrointestinal diseases. We aim to elucidate the clinical course and outcomes of patients with concomitant inflammatory bowel disease and celiac disease, a unique population that remains scarcely studied to date. A retrospective matched case-control study of adults with coexistent inflammatory bowel disease and celiac disease was performed at a tertiary referral institution in North America. Logistic regression and Kaplan-Meier curves compared disease characteristics and clinical outcomes of the two groups. A total of 342 inflammatory bowel disease patients were included in this study, of which 114 had coexistent celiac disease and 228 did not. Patients with coexistent inflammatory bowel disease and celiac disease had higher rates of primary sclerosing cholangitis (19.3% vs 5.7%; odds ratio, 4.4; 95% confidence interval, 2.1-9.4; p<0.001), extensive ulcerative colitis (78.1% vs 59.0%; odds ratio, 2.8; 95% confidence interval 1.5-5.5, p=0.002), and family history of celiac disease (10.5% vs 3.5%; odds ratio 3.2; 95% confidence interval 1.3-8.2; p=0.01), compared to patients without concomitant celiac disease. Patients with inflammatory bowel disease with concomitant celiac disease have unique phenotypic features compared to non-celiac inflammatory bowel disease, with higher risks for colitis-related hospitalizations, extensive colitis, and primary sclerosing cholangitis. Increased recognition of coexistent IBD and celiac disease can prompt clinicians to investigate for concomitant disease sooner, particularly in patients with seemingly refractory disease.

Spinal arachnoid cysts in the pediatric population: report of 31 cases and a review of the literature.

PubMed

Bond, Aaron E; Zada, Gabriel; Bowen, Ira; McComb, J Gordon; Krieger, Mark D

2012-04-01

The goal of this study was to review all cases of pediatric spinal arachnoid cysts (SACs) surgically treated at the authors' institution between 1992 and 2008 and to compare these cases to the published literature for the general population. The charts of all pediatric patients with SACs were reviewed for demographics, medical history, presenting symptoms, imaging findings, operative procedure(s), complications, and outcomes. Following a complete literature review, the pediatric data were compared with data from the general population and unique findings associated with pediatric patients were identified. Thirty-one pediatric patients (median age 6.9 years) underwent operative intervention for SACs between 1992 and 2008 (median duration of follow-up 4.2 years). There were 17 female patients (55%) and 14 male patients (45%). Twenty-one patients (68%) presented with symptoms of radiculopathy or myelopathy. The most common presenting symptoms were pain (42%), lower-extremity weakness (39%), gait instability (32%), spasticity (19%), sensory loss (10%), and bladder dysfunction (7%). In 3 patients (10%) SACs were incidental findings. Intradural SACs were more common (18 patients, 58%) than extradural SACs (11 patients, 36%). One patient (3%) had extradural and intradural components. One patient (3%) had a purely intramedullary cyst, and 1 patient (3%) had both an intradural and intramedullary component. Of the 18 intradural SACs, 9 (50%) were located ventral to the spinal cord and 9 (50%) were dorsally situated. One dorsal intradural SAC had an intramedullary component. All extradural SACs were located dorsal to the spinal cord. Intradural SACs were primarily concentrated in the cervical and thoracic regions (67%), whereas extradural cysts were more evenly distributed between the thoracic, lumbar, and sacral regions. Of the 18 patients with intradural SACs, 13 (72%) had significant previous CNS abnormalities, compared with 3 (27%) of 11 patients with extradural SACs. There were 2 operative complications. One patient had a CSF leak treated with a lumbar drain, and the second patient had a pseudomeningocele. No patients had neurological deterioration as a result of surgical intervention. Twenty-one patients (68%) had complete remission of symptoms, 6 (19%) had improvement, 3 (10%) were stable, and 1 (3%) has worsening of symptoms with recurrence that ultimately required cystoperitoneal shunting, despite multiple failed attempts at fenestration. Spinal arachnoid cysts are rare lesions in the pediatric population. Affected patients present with back pain, weakness, and/or gait instability. In children, SACs predominantly develop in the thoracic region and are more likely to occur intradurally, compared with SACs in the general population. Overall outcomes following surgical fenestration or excision of SACs are excellent, with complete remission or improvement of symptoms achieved in 87% of cases.

Back pain in the pediatric and adolescent athlete.

PubMed

Haus, Brian M; Micheli, Lyle J

2012-07-01

Clinicians taking care of athletes are likely to see many young patients complaining of back pain. The young athlete places significant repetitive stresses across the growing thoracolumbar spine, which can cause acute and overuse injuries that are unique to this age and patient population. Fortunately, by using a careful and systematic approach, with a sport-specific history, careful physical exam, and proper imaging, most problems can be properly identified. Although it is important to always remember that rare and more serious problems such as a neoplasm or infection maybe a source of pain in the athletic patient, most problems are benign and can be treated conservatively. Accurate diagnosis and management of back pain not only can prevent long-term deformity and disability, but it can also allow young athletes to return to doing what they love to do most: play sports.

Fall risk assessment and prevention.

PubMed

Kline, Nancy E; Davis, Mary Elizabeth; Thom, Bridgette

2011-02-01

Patient falls are a common cause of morbidity and are the leading cause of injury deaths in adults age 65 years and older. Injuries sustained as result of falls in a cancer hospital are often severe, regardless of patient age, due to the nature of the underlying cancer. Falls are a nursing-sensitive indicator and nurses are in a unique position to assess, design, implement, and evaluate programs for fall risk reduction. We analyzed our nursing processes related to falls and fall prevention in conjunction with an evidence-based review, a research study to improve our fall risk-assessment process, and development of a comprehensive fall-reduction program. This article outlines how our institution developed a fall risk assessment for the oncology patient population, and utilized this assessment in a comprehensive nursing approach to fall prevention in both inpatient and outpatient settings.

Migraine with Aura or Sports-Related Concussion: Case Report, Pathophysiology, and Multidisciplinary Approach to Management.

PubMed

Ellis, Michael J; Cordingley, Dean; Girardin, Richard; Ritchie, Lesley; Johnston, Janine

The evaluation and management of athletes presenting with clinical features of migraine headache with aura in the setting of sports-related head trauma is challenging. We present a case report of a 15-yr-old boy with a history of migraine with visual aura that developed acute visual disturbance and headache after a head injury during an ice hockey game. The patient underwent comprehensive assessment at a multidisciplinary concussion program, including neuro-ophthalmological examination, neurocognitive testing, and graded aerobic treadmill testing. Clinical history and multidisciplinary assessment was consistent with the diagnosis of coexisting sports-related concussion and migraine with brainstem aura. The authors discuss the pearls and pitfalls of managing patients who develop migraine headache with visual aura after sports-related head injury and the value of a comprehensive multidisciplinary approach to this unique patient population.

Mortality and causes of death in children referred to a tertiary epilepsy center.

PubMed

Grønborg, Sabine; Uldall, Peter

2014-01-01

Patients with epilepsy, including children, have an increased mortality rate when compared to the general population. Only few studies on causes of mortality in childhood epilepsy exist and pediatric SUDEP rate is under continuous discussion. To describe general mortality, incidence of sudden unexpected death in epilepsy (SUDEP), causes of death and age distribution in a pediatric epilepsy patient population. The study retrospectively examined the mortality and causes of death in 1974 patients with childhood-onset epilepsy at a tertiary epilepsy center in Denmark over a period of 9 years. Cases of death were identified through their unique civil registration number. Information from death certificates, autopsy reports and medical notes were collected. 2.2% (n = 43) of the patient cohort died during the study period. This includes 9 patients with SUDEP (8 SUDEP cases per 10,000 patient years). 9 patients died in the course of neurodegenerative disease and 28 children died of various causes. Epilepsy was considered drug resistant in more than 95% of the deceased patients, 90% were diagnosed with intellectual disability. Mortality of patients that underwent dietary epilepsy treatment was slightly higher than in the general cohort. There were no epilepsy-related deaths due to drowning. This study confirms that SUDEP must not be disregarded in the pediatric age group. The vast majority of SUDEP cases in this study displays numerous risk factors similar to those described in adult epilepsy patients. Including SUDEP, only 30% of the mortality was directly seizure related. Copyright © 2013 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

New advances in amblyopia therapy II: refractive therapies.

PubMed

Kraus, Courtney L; Culican, Susan M

2018-06-05

The treatment of anisometropic or ametropic amblyopia has traditionally enjoyed a high treatment success rate. Early initiation and consistent use of spectacle correction can completely resolve amblyopia in a majority of patients. For those with anisometropic amblyopia that fail to improve with glasses wear alone, patching or atropine penalisation can lead to equalisation of visual acuity. However, successful treatment requires full-time compliance with refractive correction and this can be a challenge for a patient population that often has one eye with good acuity without correction. Other barriers for a select population with high anisometropic or ametropic amblyopia include rejection of glasses for various reasons including discomfort, behavioural or sensory problems, postural issues and visually significant aniseikonia. When consistent wear of optical correction proves difficult and patching/atropine remains a major obstacle, surgical correction of refractive error has proven success in achieving vision improvement. Acting as a means to achieve spectacle independence or reducing the overall needed refractive correction, refractive surgery can offer a unique treatment option for this patient population. Laser surgery, phakic intraocular lenses and clear lens exchange are three approaches to altering the refractive state of the eye. Each has documented success in improving vision, particularly in populations where glasses wear has not been possible. Surgical correction of refractive error has a risk profile greater than that of more traditional therapies. However, its use in a specific population offers the opportunity for improving visual acuity in children who otherwise have poor outcomes with glasses and patching/atropine alone. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

PubMed Central

Stukel, Thérèse A; Goldbloom, David; Kopp, Alexander; Zagorski, Brandon M; Mulsant, Benoit H

2014-01-01

Background: We studied the relationships among psychiatrist supply, practice patterns, and access to psychiatrists in Ontario Local Health Integration Networks (LHINs) with differing levels of psychiatrist supply. Methods: We analyzed practice patterns of full-time psychiatrists (n = 1379) and postdischarge care to patients who had been admitted to hospital for psychiatric care, according to LHIN psychiatrist supply in 2009. We measured the characteristics of psychiatrists' patient panels, including sociodemographic characteristics, outpatient panel size, number of new patients, inpatient and outpatient visits per psychiatrist, and percentages of psychiatrists seeing fewer than 40 and fewer than 100 unique patients. Among patients admitted to hospital with schizophrenia, bipolar disorder, or major depression (n = 21,123), we measured rates of psychiatrist visits, readmissions, and visits to the emergency department within 30 and 180 days after discharge. Results: Psychiatrist supply varied from 7.2 per 100 000 residents in LHINs with below-average supply to 62.7 per 100 000 in the Toronto Central LHIN. Population-based outpatient and inpatient visit rates and psychiatric admission rates increased with LHIN psychiatrist supply. However, as the supply of psychiatrists increased, outpatient panel size for full-time psychiatrists decreased, with Toronto psychiatrists having 58% smaller outpatient panels and seeing 57% fewer new outpatients relative to LHINs with the lowest psychiatrist supply. Similar patterns were found for inpatient practice. Moreover, as supply increased, annual outpatient visit frequency increased: the average visit frequency was 7 visits per outpatient for Toronto psychiatrists and 3.9 visits per outpatient in low-supply LHINs. One-quarter of Toronto psychiatrists and 2% of psychiatrists in the lowest-supply LHINs saw their outpatients more than 16 times per year. Of full-time psychiatrists in Toronto, 10% saw fewer than 40 unique patients and 40% saw fewer than 100 unique patients annually; the corresponding proportions were 4% and 10%, respectively, in the lowest-supply LHINs. Overall, follow-up visits after psychiatric discharge were low, with slightly higher rates in LHINs with a high psychiatrist supply. Interpretation: Full-time psychiatrists who practised in Ontario LHINs with high psychiatrist supply saw fewer patients, but they saw those patients more frequently than was the case for psychiatrists in low-supply LHINs. Increasing the supply of psychiatrists while funding unlimited frequency and duration of psychotherapy care may not improve access for patients who need psychiatric services. PMID:25426177

Leading change: evidence-based transition.

PubMed

Lewis, Brennan; Allen, Stephanie

2015-01-01

The purpose of this article was to provide a framework for evidence-based transition of patient populations within an acute care pediatric institution. Transition within a hospital is foreseeable, given the ever-changing needs of the patients within an evolving healthcare system. These changes include moving patient populations because of expansion, renovation, or cohorting similar patient diagnoses to provide care across a continuum. Over the past 1 to 2 years, Children's Health Children's Medical Center Dallas has experienced a wide variety of transition. To provide a smooth transition for patients and families into new care areas resulting in a healthy work environment for all team members. The planning phase for patient population moves, and transition should address key aspects to include physical location and care flow, supplies and equipment, staffing model and human resources (HR), education and orientation, change process and integrating teams, and family preparation. It is imperative to consider these aspects in order for transitions within a healthcare system to be successful. During a time of such transitions, the clinical nurse specialist (CNS) is a highly valuable team member offering a unique perspective and methodological approach, which is central to the new initiative's overall success. The themes addressed in this article on evidence-based transition are organized according to the CNS spheres of influence: system/organization, patient/family, and nursing. An evidence-based transition plan was developed and implemented successfully with the support from the CNS for 3 patient populations. Organizational leadership gained an increased awareness of the CNS role at the conclusion of each successful transition. The CNS plays a pivotal role as clinical experts and proponents of evidence-based practice and effects change in the system/organization, nursing, and patient/family spheres of influence. While transitions can be a source of stress for leaders and bedside staff, it is also a time that allows for growth and new opportunities for staff and may result in development of a healthier work environment. The CNS is able to provide leadership while working collaboratively to oversee the moves with a forward-thinking approach. There are key components to consider during times of transition. These include (1) organize, plan, and improve work efficiencies during a construction build; (2) identify the key elements for improvement in nurse and patient satisfaction; (3) develop or maintain healthy work environment standards; (4) establish adequate staffing levels and staff education to successfully care for patient populations following transition; and (5) support the staff and patients during transition.

Testing an Adapted Modified Delphi Method: Synthesizing Multiple Stakeholder Ratings of Health Care Service Effectiveness.

PubMed

Escaron, Anne L; Chang Weir, Rosy; Stanton, Petra; Vangala, Sitaram; Grogan, Tristan R; Clarke, Robin M

2016-03-01

The Affordable Care Act incentivizes health systems for better meeting patient needs, but often guidance about patient preferences for particular health services is limited. All too often vulnerable patient populations are excluded from these decision-making settings. A community-based participatory approach harnesses the in-depth knowledge of those experiencing barriers to health care. We made three modifications to the RAND-UCLA appropriateness method, a modified Delphi approach, involving patients, adding an advisory council group to characterize existing knowledge in this little studied area, and using effectiveness rather than "appropriateness" as the basis for rating. As a proof of concept, we tested this method by examining the broadly delivered but understudied nonmedical services that community health centers provide. This method created discrete, new knowledge about these services by defining 6 categories and 112 unique services and by prioritizing among these services based on effectiveness using a 9-point scale. Consistent with the appropriateness method, we found statistical convergence of ratings among the panelists. Challenges include time commitment and adherence to a clear definition of effectiveness of services. This diverse stakeholder engagement method efficiently addresses gaps in knowledge about the effectiveness of health care services to inform population health management. © 2015 Society for Public Health Education.

Optimal therapy of type 2 diabetes: a controversial challenge

PubMed Central

Dardano, Angela; Penno, Giuseppe; Del Prato, Stefano; Miccoli, Roberto

2014-01-01

Type 2 diabetes mellitus (T2DM) is one of the most common chronic disorders in older adults and the number of elderly diabetic subjects is growing worldwide. Nonetheless, the diagnosis of T2DM in elderly population is often missed or delayed until an acute metabolic emergency occurs. Accumulating evidence suggests that both aging and environmental factors contribute to the high prevalence of diabetes in the elderly. Clinical management of T2DM in elderly subjects presents unique challenges because of the multifaceted geriatric scenario. Diabetes significantly lowers the chances of “successful” aging, notably it increases functional limitations and impairs quality of life. In this regard, older diabetic patients have a high burden of comorbidities, diabetes-related complications, physical disability, cognitive impairment and malnutrition, and they are more susceptible to the complications of dysglycemia and polypharmacy. Several national and international organizations have delivered guidelines to implement optimal therapy in older diabetic patients based on individualized treatment goals. This means appreciation of the heterogeneity of the disease as generated by life expectancy, functional reserve, social support, as well as personal preference. This paper will review current treatments for achieving glycemic targets in elderly diabetic patients, and discuss the potential role of emerging treatments in this patient population. PMID:24753144

The impact of genetics on future drug discovery in schizophrenia.

PubMed

Matsumoto, Mitsuyuki; Walton, Noah M; Yamada, Hiroshi; Kondo, Yuji; Marek, Gerard J; Tajinda, Katsunori

2017-07-01

Failures of investigational new drugs (INDs) for schizophrenia have left huge unmet medical needs for patients. Given the recent lackluster results, it is imperative that new drug discovery approaches (and resultant drug candidates) target pathophysiological alterations that are shared in specific, stratified patient populations that are selected based on pre-identified biological signatures. One path to implementing this paradigm is achievable by leveraging recent advances in genetic information and technologies. Genome-wide exome sequencing and meta-analysis of single nucleotide polymorphism (SNP)-based association studies have already revealed rare deleterious variants and SNPs in patient populations. Areas covered: Herein, the authors review the impact that genetics have on the future of schizophrenia drug discovery. The high polygenicity of schizophrenia strongly indicates that this disease is biologically heterogeneous so the identification of unique subgroups (by patient stratification) is becoming increasingly necessary for future investigational new drugs. Expert opinion: The authors propose a pathophysiology-based stratification of genetically-defined subgroups that share deficits in particular biological pathways. Existing tools, including lower-cost genomic sequencing and advanced gene-editing technology render this strategy ever more feasible. Genetically complex psychiatric disorders such as schizophrenia may also benefit from synergistic research with simpler monogenic disorders that share perturbations in similar biological pathways.

Barriers to accessing and using health insurance cards among methadone maintenance treatment patients in northern Vietnam.

PubMed

Tran, Bach Xuan; Boggiano, Victoria L; Nguyen, Cuong Tat; Nguyen, Long Hoang; Le Nguyen, Anh Tuan; Latkin, Carl A

2017-07-17

Methadone maintenance treatment (MMT) patients face unique costs associated with their healthcare expenditures. As such, it is important that these patients have access to health insurance (HI) to help them pay for both routine and unforeseen health services. In this study, we explored factors related to health insurance enrollment and utilization among MMT patients, to move Vietnam closer to universal coverage among this patient population. A cross-sectional study was conducted with 1003 patients enrolled in MMT in five clinics in Hanoi and Nam Dinh provinces. Patients were asked a range of questions about their health, health expenditures, and health insurance access and utilization. We used multivariate logistic regressions to determine factors associated with health insurance access among participants. The majority of participants (nearly 80%) were not currently enrolled in health insurance at the time of the study. Participants from rural regions were significantly more likely than urban participants to report difficulty using HI. Family members of participants from rural regions were more likely to have overall poor service quality through health insurance compared with family members of participants from urban regions. Overall, 37% of participants endorsed a lack of information about HI, nearly 22% of participants reported difficulty accessing HI, 22% reported difficulty using HI, and more than 20% stated they had trouble paying for HI. Older, more highly educated, and employed participants were more likely to have an easier time accessing HI than their younger, less well educated, and unemployed counterparts. HIV-positive participants were more likely to have sufficient information about health insurance options. Our study highlights the dearth of health insurance utilization among MMT patients in northern Vietnam. It also sheds light on factors associated with increased access to and utilization of health insurance among this underserved population. These results can help improve health insurance enrollment among MMT patients, a population that is at increased need of financial assistance in accessing health services.

Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta.

PubMed

Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev

2016-08-12

The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.

Challenge and Yield of Enrolling Racially and Ethnically Diverse Patient Populations in Low Event Rate Clinical Trials.

PubMed

Sheffet, Alice J; Howard, George; Sam, Albert; Jamil, Zafar; Weaver, Fred; Chiu, David; Voeks, Jenifer H; Howard, Virginia J; Hughes, Susan E; Flaxman, Linda; Longbottom, Mary E; Brott, Thomas G

2018-01-01

We report patient enrollment and retention by race and ethnicity in the CREST (Carotid Revascularization Endarterectomy Versus Stent Trial) and assess potential effect modification by race/ethnicity. In addition, we discuss the challenge of detecting differences in study outcomes when subgroups are small and the event rate is low. We compared 2502 patients by race, ethnicity, baseline characteristics, and primary outcome (any periprocedural stroke, death, or myocardial infarction and subsequent ipsilateral stroke up to 10 years). Two hundred forty (9.7%) patients were minority by race (6.1%) or ethnicity (3.6%); 109 patients (4.4%) were black, 32 (1.3%) Asian, 2332 (93.4%) white, 11 (0.4%) other, and 18 (0.7%) unknown. Ninety (3.6%) were Hispanic, 2377 (95%) non-Hispanic, and 35 (1.4%) unknown. The rate of the primary end point for all patients was 10.9%±0.9% at 10 years and did not differ by race or ethnicity ( P inter >0.24). The proportion of minorities recruited to CREST was below their representation in the general population, and retention of minority patients was lower than for whites. Primary outcomes did not differ by race or ethnicity. However, in CREST (like other studies), the lack of evidence of a racial/ethnic difference in the treatment effect should be interpreted with caution because of low statistical power to detect such a difference. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00004732. © 2017 American Heart Association, Inc.

Prevalence and clinicopathological characteristics of ALK fusion subtypes in lung adenocarcinomas from Chinese populations.

PubMed

Zheng, Difan; Wang, Rui; Zhang, Yang; Pan, Yunjian; Cheng, Xinghua; Cheng, Chao; Zheng, Shanbo; Li, Hang; Gong, Ranxia; Li, Yuan; Shen, Xuxia; Sun, Yihua; Chen, Haiquan

2016-04-01

We performed this retrospective study to have a comprehensive investigation of the clinicopathological characteristics of ALK fusion-positive lung adenocarcinoma in Chinese populations. We screened 1407 patients with primary lung adenocarcinoma from October 2007 to May 2013. Quantitative real-time PCR (qRT-PCR), reverse transcriptase PCR (RT-PCR), and fluorescence in situ hybridization were performed to detect ALK fusion genes, with validation of positive results using immunohistochemistry. Clinicopathological characteristics were collected to assess prognosis in ALK fusion-positive patients. Of 1407 patients with lung adenocarcinoma, there were 74 (5.3 %) ALK fusion-positive patients. Patients harboring ALK fusion were significantly younger (56.0 years vs. 59.8 years p = 0.002) and were more likely to have advanced stages (stage III or stage IV) (OR 1.761; 95 % CI 1.10-2.82, p = 0.017). Lepidic predominant adenocarcinoma was rarely found in ALK fusion patients (2.7 vs. 13.5 % p = 0.025), while IMA (invasive mucinous adenocarcinoma) predominant adenocarcinoma was more frequently found (21.6 vs. 5.0 % p < 0.001). ALK fusion was neither a risk factor nor protective factor in relapse-free survival and overall survival. Male, current smoker, and EML4-ALK variant 3 indicated poor prognosis among ALK fusion-positive lung adenocarcinomas. ALK fusion was detected in 5.3 % (74/1407) of the Chinese patients with lung adenocarcinoma. ALK fusion defines a molecular subset of lung adenocarcinoma with unique clinicopathological characteristics. Different ALK fusion variants determine distinct prognoses.

An Analysis of Vulvar Necrotizing Fasciitis in the Unique and Ethnically Diverse Hawaiian Population

PubMed Central

Busse, Raydeen

2010-01-01

Vulvar necrotizing fasciitis is a surgical emergency with a high rate of morbidity and mortality. Our case series adds seven patients to the literature and presents the first group that is predominantly of Pacific-Islander origin. This study not only confirms traditional risk factors such as diabetes mellitus, obesity and hypertension but investigates ethnicity and socioeconomic status as risk factors. Also presented is a case of recurrent necrotizing fasciitis initially involving the vulva, then the back. In any patient for which there is suspicion of vulvar necrotizing fasciitis, surgical diagnosis remains the gold standard and facilitates rapid debridement of all necrotic tissues. Aggressive surgical debridement with broad spectrum antibiotic coverage is required to minimize mortality. PMID:20222491

Pediatric mandibular fractures treated by rigid internal fixation.

PubMed

Wong, G B

1993-09-01

Mandibular fractures in the pediatric patient population are relatively uncommon. These patients present with their own unique treatment requirements. Most fractures have been treated conservatively by dental splints. Closed reduction techniques with maxillomandibular fixation (MMF) in very young children can pose several concerns, including cooperation, compliance and adequate nutritional intake. Rigid internal fixation of unstable mandibular fractures using miniplates and screws circumvents the need for MMF and allows immediate jaw mobilization. At major pediatric trauma institutions, there has been an increasing trend toward the use of this treatment when open reduction is necessary. This article presents a report of a five-year-old child who presented with bilateral mandibular fractures and was treated by rigid internal fixation and immediate mandibular mobilization.

Garrison Institute on Aging: A New Hope for Elderly Individuals and Patients with Alzheimer's Disease.

PubMed

Reddy, P Hemachandra; Blackmon, Joan; Molinar-Lopez, Veronica; Ament, Clay; Manczak, Maria; Kandimalla, Ramesh; Yin, Xianglin; Pandey, Akhilesh; Kuruva, Chandra Sekhar; Wang, Rui; Fry, David; Osborn, Carrah; Stonum, Kathleen; Quesada, Kandi; Gonzales, Ruben; Boles, Annette

2015-01-01

The Garrison Institute on Aging (GIA) is an established institute within Texas Tech University Health Sciences Center, whose mission is to promote healthy aging through cutting-edge research on Alzheimer's disease (AD) and other diseases of aging through innovative educational opportunities for students, clinicians, researchers, health care professionals, and the public. The GIA has multiple programs, including both research and education on healthy aging and AD, community outreach, caregiving, the Retired Senior Volunteer Program, Healthy Lubbock, the GIA Brain Bank, healthy aging seminars, research seminars, and collaborations and scholarships. The GIA programs connect basic and clinical researchers and health care professionals, and provide a unique environment to help our growing elderly population and patients with AD and their families.

Aging on the Street: Homeless Older Adults in America.

PubMed

Sorrell, Jeanne M

2016-09-01

Older adults are at greater risk for homelessness today than at any time in recent history. Approximately one half of homeless individuals in America are older than 50, which has created serious challenges for how cities, governments, and health care providers care for homeless populations. Systems established in the 1980s to help care for homeless individuals were not designed to address problems of aging. It is critical that nurses and all health professionals have a better understanding of the unique needs and concerns of homeless older adults. Nurses can be an important part of the solution, not only through direct patient care but by advocating for improvements in care for this vulnerable population. [Journal of Psychosocial Nursing and Mental Health Services, 54(9), 25-29.]. Copyright 2016, SLACK Incorporated.

Sugammadex to Reverse Neuromuscular Blockade in a Child with a Past History of Cardiac Transplantation

PubMed Central

Miller, Karen; Hall, Brian; Tobias, Joseph D

2017-01-01

Sugammadex is a novel agent for the reversal of neuromuscular blockade. The speed and efficacy of reversal with sugammadex are significantly faster than acetylcholinesterase inhibitors, such as neostigmine. Sugammadex also has a limited adverse profile when compared with acetylcholinesterase inhibitors, specifically in regard to the incidence of bradycardia. This adverse effect may be particularly relevant in the setting of a heart transplant recipient with a denervated heart. The authors present a case of an 8-year-old child, status postcardiac transplantation, who required anesthetic care for laparoscopy and lysis of intra-abdominal adhesions. Sugammadex was used to reverse neuromuscular blockade and avoid the potential adverse effects of neostigmine. The unique mechanism of action of sugammadex is discussed, previous reports of its use in this unique patient population are reviewed, and its potential benefits compared to traditional acetylcholinesterase inhibitors are presented. PMID:28701612

Sugammadex to reverse neuromuscular blockade in a child with a past history of cardiac transplantation.

PubMed

Miller, Karen; Hall, Brian; Tobias, Joseph D

2017-01-01

Sugammadex is a novel agent for the reversal of neuromuscular blockade. The speed and efficacy of reversal with sugammadex are significantly faster than acetylcholinesterase inhibitors, such as neostigmine. Sugammadex also has a limited adverse profile when compared with acetylcholinesterase inhibitors, specifically in regard to the incidence of bradycardia. This adverse effect may be particularly relevant in the setting of a heart transplant recipient with a denervated heart. The authors present a case of an 8-year-old child, status postcardiac transplantation, who required anesthetic care for laparoscopy and lysis of intra-abdominal adhesions. Sugammadex was used to reverse neuromuscular blockade and avoid the potential adverse effects of neostigmine. The unique mechanism of action of sugammadex is discussed, previous reports of its use in this unique patient population are reviewed, and its potential benefits compared to traditional acetylcholinesterase inhibitors are presented.

Standards for Clinical Trials in Male and Female Sexual Dysfunction: III. Unique Aspects of Clinical Trials in Male Sexual Dysfunction.

PubMed

Fisher, William A; Gruenwald, Ilan; Jannini, Emmanuele A; Lev-Sagie, Ahinoam; Lowenstein, Lior; Pyke, Robert E; Reisman, Yakov; Revicki, Dennis A; Rubio-Aurioles, Eusebio

2017-01-01

This series of articles, Standards for Clinical Trials in Male and Female Sexual Dysfunction, began with the discussion of a common expected standard for clinical trial design in male and female sexual dysfunction, a common rationale for the design of phase I to IV clinical trials, and common considerations for the selection of study population and study duration in male and female sexual dysfunction. The second article in this series discussed fundamental principles in development, validation, and selection of patient- (and partner-) reported outcome assessment. The third and present article in this series discusses selected aspects of sexual dysfunction that are that are unique to male sexual dysfunctions and relevant to the conduct of clinical trials of candidate treatments for men. Copyright © 2016 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

Identification of dendritic cells in the blood and synovial fluid of children with Juvenile Idiopathic Arthritis.

PubMed

Tabarkiewicz, Jacek; Postępski, Jacek; Olesińska, Edyta; Roliński, Jacek; Tuszkiewicz-Misztal, Ewa

2011-01-01

Childhood chronic arthritis of unknown etiology is known collectively as juvenile idiopathic arthritis (JIA) and consists of heterogeneous subtypes with unique clinical patterns of disease. JIA is the commonest rheumatic disease in children and may still result in significant disability, with joint deformity, growth impairment, and persistence of active arthritis into adulthood. Basic research is rather focused on rheumatoid arthritis, and this lead to small number of publications considering JIA. In this study we examine, by flow cytometry, the expression of dendritic cells (DCs) in the peripheral blood and synovial fluid of children with active JIA in a group of 220 patients. We reveal a significant decrease in the percentage of immature DCs in the blood of patients compared to control children. Surprisingly, we found higher percentages of mature circulating dendritic cells. Both populations of DCs, immature and mature, were accumulated in patients' synovial fluid. We also confirmed the presence of CD206+/CD209+ in JIA samples, which can represent a population of macrophages with dendritic cells morphology. Our results support the thesis that dendritic cells are crucial in the induction and maintenance of autoimmune response and local inflammation during juvenile idiopathic arthritis.

Nursing students' perceptions of clients undergoing elective cosmetic surgery.

PubMed

Cooper, Leah Beth

2007-01-01

Aesthetic obsession is commonplace in current society. Supermarket a isles dedicated to beauty products, makeup, and anti-aging creams seem to expand daily. Television and publications flood the public with messages of what constitutes beauty and how to achieve the ideal. Surgical alteration of the body is swiftly becoming a form of self-care technique along with other heath-promoting behavior. Since 2003, the general acceptance of plastic surgery among all Americans surpassed 50% (American Society for Aesthetic Plastic Surgery, 2003). Elective cosmetic surgical procedures have increased by an astounding 444% since 1997 (American Society of Plastic Surgeons, 2006). This quest for body satisfaction based on modern cultural norms increases the public's need for accurate information and understanding from those in the healthcare profession. Despite a transformation in the general population's conception of cosmetic surgery and its clients, stigma still lies in many individuals, including those in the healthcare profession. As this progressively growing patient population emerges, many in healthcare question their attitudes toward plastic surgery and the patients receiving aesthetic operations. With clients undergoing plastic surgery becoming increasingly visible within the healthcare system, some unique aspects of patient care must be addressed.

[Patterns of physical activity of people with chronic mental and behavioral disorders].

PubMed

Adamoli, Angélica Nickel; Azevedo, Mario Renato

2009-01-01

Since physical activity (PA) is capable of improving both the quality of life and the prognosis for individuals with mental and behavioral disorders (MBD), the main purpose of this study was to analyze the PA patterns in individuals with MBD frequenting a Psychosocial Care Center (PCC) in the city of Pelotas. The target population of this descriptive study consisted of individuals attended in any of the PCCs of Pelotas. The sample was selected from six PCCs and comprised 85 patients and their relatives. The mean age of the sample was 40.9 years (standard deviation 13.8). It was found that, in comparison with the general population, these individuals had a lower socioeconomic level and less schooling. The prevalence of leisure-time physical activity was low. In addition, women tended to dedicate the greater part of their time to household activities. Men participated more in the PA offered by the PCC than women. Therefore, incorporation of PA in PCC seems to be a feasible initiative for supporting the treatment of these patients and would offer a unique opportunity for the patients to engage in supervised and structured PA programs.

Characterization of In Vivo Resistance to Osimertinib and JNJ-61186372, an EGFR/Met Bispecific Antibody, Reveals Unique and Consensus Mechanisms of Resistance.

PubMed

Emdal, Kristina B; Dittmann, Antje; Reddy, Raven J; Lescarbeau, Rebecca S; Moores, Sheri L; Laquerre, Sylvie; White, Forest M

2017-11-01

Approximately 10% of non-small cell lung cancer (NSCLC) patients in the United States and 40% of NSCLC patients in Asia have activating epidermal growth factor receptor (EGFR) mutations and are eligible to receive targeted anti-EGFR therapy. Despite an extension of life expectancy associated with this treatment, resistance to EGFR tyrosine kinase inhibitors and anti-EGFR antibodies is almost inevitable. To identify additional signaling routes that can be cotargeted to overcome resistance, we quantified tumor-specific molecular changes that govern resistant cancer cell growth and survival. Mass spectrometry-based quantitative proteomics was used to profile in vivo signaling changes in 41 therapy-resistant tumors from four xenograft NSCLC models. We identified unique and tumor-specific tyrosine phosphorylation rewiring in tumors resistant to treatment with the irreversible third-generation EGFR-inhibitor, osimertinib, or the novel dual-targeting EGFR/Met antibody, JNJ-61186372. Tumor-specific increases in tyrosine-phosphorylated peptides from EGFR family members, Shc1 and Gab1 or Src family kinase (SFK) substrates were observed, underscoring a differential ability of tumors to uniquely escape EGFR inhibition. Although most resistant tumors within each treatment group displayed a marked inhibition of EGFR as well as SFK signaling, the combination of EGFR inhibition (osimertinib) and SFK inhibition (saracatinib or dasatinib) led to further decrease in cell growth in vitro This result suggests that residual SFK signaling mediates therapeutic resistance and that elimination of this signal through combination therapy may delay onset of resistance. Overall, analysis of individual resistant tumors captured unique in vivo signaling rewiring that would have been masked by analysis of in vitro cell population averages. Mol Cancer Ther; 16(11); 2572-85. ©2017 AACR . ©2017 American Association for Cancer Research.

Nonsyndromic Retinitis Pigmentosa in the Ashkenazi Jewish Population: Genetic and Clinical Aspects.

PubMed

Kimchi, Adva; Khateb, Samer; Wen, Rong; Guan, Ziqiang; Obolensky, Alexey; Beryozkin, Avigail; Kurtzman, Shoshi; Blumenfeld, Anat; Pras, Eran; Jacobson, Samuel G; Ben-Yosef, Tamar; Newman, Hadas; Sharon, Dror; Banin, Eyal

2018-05-01

To analyze the genetic and clinical findings in retinitis pigmentosa (RP) patients of Ashkenazi Jewish (AJ) descent, aiming to identify genotype-phenotype correlations. Cohort study. Retinitis pigmentosa patients from 230 families of AJ origin. Sanger sequencing was performed to detect specific founder mutations known to be prevalent in the AJ population. Ophthalmologic analysis included a comprehensive clinical examination, visual acuity (VA), visual fields, electroretinography, color vision testing, and retinal imaging by OCT, pseudocolor, and autofluorescence fundus photography. Inheritance pattern and causative mutation; retinal function as assessed by VA, visual fields, and electroretinography results; and retinal structural changes observed on clinical funduscopy as well as by pseudocolor, autofluorescence, and OCT imaging. The causative mutation was identified in 37% of families. The most prevalent RP-causing mutations are the Alu insertion (c.1297_8ins353, p.K433Rins31*) in the male germ cell-associated kinase (MAK) gene (39% of families with a known genetic cause for RP) and c.124A>G, p.K42E in dehydrodolichol diphosphate synthase (DHDDS) (33%). Additionally, disease-causing mutations were identified in 11 other genes. Analysis of clinical parameters of patients with mutations in the 2 most common RP-causing genes revealed that MAK patients had better VA and visual fields at relatively older ages in comparison with DHDDS patients. Funduscopic findings of DHDDS patients matched those of MAK patients who were 20 to 30 years older. Patients with DHDDS mutations were referred for electrophysiologic evaluation at earlier ages, and their cone responses became nondetectable at a much younger age than MAK patients. Our AJ cohort of RP patients is the largest reported to date and showed a substantial difference in the genetic causes of RP compared with cohorts of other populations, mainly a high rate of autosomal recessive inheritance and a unique composition of causative genes. The most common RP-causing genes in our cohort, MAK and DHDDS, were not described as major causative genes in other populations. The clinical data show that in general, patients with biallelic MAK mutations had a later age of onset and a milder retinal phenotype compared with patients with biallelic DHDDS mutations. Copyright © 2017 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

The impact of solid organ transplant history on inpatient complications, mortality, length of stay, and cost for primary total shoulder arthroplasty admissions in the United States.

PubMed

Malcolm, Tennison L; Chatha, Kiran; Breceda, Adam P; Guo, Eric; Friedman, Darren J; Sabesan, Vani J; Barsoum, Wael K

2018-05-04

There is a growing population of patients with history of solid organ transplant (SOT) surgery among total joint patients. Patients with history of SOT have been found to have longer lengths of stay and higher inpatient hospital costs and complications rates after hip and knee arthroplasty. The purpose of this study was to determine whether this is true for shoulder arthroplasty in SOT patients. The Nationwide Inpatient Sample was queried to describe relative demographic, hospital, and clinical characteristics, perioperative complications, length of stay, and total costs for patients with a history of SOT (International Classification of Diseases-9th Edition-Clinical Modificiation V42.0, V42.1, V42.7, V42.83) undergoing shoulder arthroplasty (81.80, 81.88) from 2004 to 2014. A weighted total of 843 patients (unweighted frequency = 171) and 382,773 patients (unweighted frequency = 77,534) with and without history of SOT, respectively, underwent shoulder arthroplasty. SOT patients were more often younger and more likely to be male, have Medicare, and undergo surgery in a large teaching institution in the Midwest or Northeast (P < .001). SOT patients had higher or similar comorbid disease prevalence for 27 of 29 Elixhauser comorbidities. The risk of any complication was significantly higher among SOT patients (15.5% vs. 9.3%, P = .007). SOT patients experienced inpatient admissions an average 0.27 days longer (P < .001) and $1103 more costly (P = .06) than non-SOT patients. Patients with history of SOT undergoing shoulder arthroplasty appear to remain a unique population due to their specific vulnerability to minor complications and inherently increased inpatient resource utilization. Copyright © 2018. Published by Elsevier Inc.

Virtual Reality as an Adjunctive Non-pharmacologic Analgesic for Acute Burn Pain During Medical Procedures

PubMed Central

Chambers, Gloria T.; Meyer, Walter J.; Arceneaux, Lisa L.; Russell, William J.; Seibel, Eric J.; Richards, Todd L.; Sharar, Sam R.; Patterson, David R.

2015-01-01

Introduction Excessive pain during medical procedures is a widespread problem but is especially problematic during daily wound care of patients with severe burn injuries. Methods Burn patients report 35–50% reductions in procedural pain while in a distracting immersive virtual reality, and fMRI brain scans show associated reductions in pain-related brain activity during VR. VR distraction appears to be most effective for patients with the highest pain intensity levels. VR is thought to reduce pain by directing patients’ attention into the virtual world, leaving less attention available to process incoming neural signals from pain receptors. Conclusions We review evidence from clinical and laboratory research studies exploring Virtual Reality analgesia, concentrating primarily on the work ongoing within our group. We briefly describe how VR pain distraction systems have been tailored to the unique needs of burn patients to date, and speculate about how VR systems could be tailored to the needs of other patient populations in the future. PMID:21264690

[The name in schizophrenia: a study of 60 patients].

PubMed

Rafrafi, Rim; Bram, Nesrine; Bergaoui, Haifa; Ben Romdhane, Imene; El Hechmi, Zouhaier

2014-03-01

Clinical aspects in schizophrenia suggest a unique relationship with the proper name. aim: Discuss the validity of the hypothesis that the non-transmission of the surname may be a vulnerability factor in schizophrenia. Descriptive cross-sectional study conducted among 60 patients with schizophrenia and their families. Data were collected using a semi-structured interview. results: Seven patients carried a different surname from their father (11.6% of participants). The disparity has only concerned the child with schizophrenia. Family characteristics (birth rank, desired character of pregnancy, family history of schizophrenia) and evolutif profile of the disease were comparable between patients with a family name according to the father and those with a different surname. It appears that patients with schizophrenia maintain a special relationship with the proper name, which could be involved in the genesis of schizophrenia. Our early hypothesis, supported by the psychoanalytic, transgenerational and behavioral theories, would be a plausible starting point for studies with a broader spectrum including witnesses of the general and psychiatric populations.

The Need for Cultural Competency in Health Care.

PubMed

Abrishami, Doris

2018-05-01

To highlight the importance of cultural competency education in health care and in the medical imaging industry. A comprehensive search of the Education Resource Information Center and MEDLINE databases was conducted to acquire full-text and peer-reviewed articles relating to cultural competency training in health care. A total of 1008 academic journal articles and 3 books were identified for this literature review. Search criteria was narrowed to peer-reviewed articles published between 2000 and 2016, resulting in 24 articles. A majority of the research studies addressed cultural competency education in allied health professions, as well as psychology and athletic training. Recent research studies pertaining to the cultural competence of imaging professionals were not found. Research shows that the behaviors of health care providers can contribute to health disparities. National standards have been established to promote patient-centered care that reduces or eliminates health disparities in the U.S. Lectures and training sessions help professionals maintain these standards, but they might not be adequate. Health care workers need to interact and work with diverse patient populations to increase their empathy and become culturally competent. A patient-centered care approach that responds to patients' unique needs and reduces health disparities among diverse patient populations can be achieved by training culturally competent health care professionals. More research is needed to determine the nature of cultural competency education taught in radiography programs. ©2018 American Society of Radiologic Technologists.

Shared Decision Making With Vulnerable Populations in the Emergency Department.

PubMed

Castaneda-Guarderas, Ana; Glassberg, Jeffrey; Grudzen, Corita R; Ngai, Ka Ming; Samuels-Kalow, Margaret E; Shelton, Erica; Wall, Stephen P; Richardson, Lynne D

2016-12-01

The emergency department (ED) occupies a unique position within the healthcare system, serving as a safety net for vulnerable patients, regardless of their race, ethnicity, religion, country of origin, sexual orientation, socioeconomic status, or medical diagnosis. Shared decision making (SDM) presents special challenges when used with vulnerable population groups. The differing circumstances, needs, and perspectives of vulnerable groups invoke issues of provider bias, disrespect, judgmental attitudes, and lack of cultural competence, as well as patient mistrust and the consequences of their social and economic disenfranchisement. A research agenda that includes community-engaged approaches, mixed-methods studies, and cost-effectiveness analyses is proposed to address the following questions: 1) What are the best processes/formats for SDM among racial, ethnic, cultural, religious, linguistic, social, or otherwise vulnerable groups who experience disadvantage in the healthcare system? 2) What organizational or systemic changes are needed to support SDM in the ED whenever appropriate? 3) What competencies are needed to enable emergency providers to consider patients' situation/context in an unbiased way? 4) How do we teach these competencies to students and residents? 5) How do we cultivate these competencies in practicing emergency physicians, nurses, and other clinical providers who lack them? The authors also identify the importance of using accurate, group-specific data to inform risk estimates for SDM decision aids for vulnerable populations and the need for increased ED-based care coordination and transitional care management capabilities to create additional care options that align with the needs and preferences of vulnerable populations. © 2016 by the Society for Academic Emergency Medicine.

Impact of the HIV-1 genetic background and HIV-1 population size on the evolution of raltegravir resistance.

PubMed

Fun, Axel; Leitner, Thomas; Vandekerckhove, Linos; Däumer, Martin; Thielen, Alexander; Buchholz, Bernd; Hoepelman, Andy I M; Gisolf, Elizabeth H; Schipper, Pauline J; Wensing, Annemarie M J; Nijhuis, Monique

2018-01-05

Emergence of resistance against integrase inhibitor raltegravir in human immunodeficiency virus type 1 (HIV-1) patients is generally associated with selection of one of three signature mutations: Y143C/R, Q148K/H/R or N155H, representing three distinct resistance pathways. The mechanisms that drive selection of a specific pathway are still poorly understood. We investigated the impact of the HIV-1 genetic background and population dynamics on the emergence of raltegravir resistance. Using deep sequencing we analyzed the integrase coding sequence (CDS) in longitudinal samples from five patients who initiated raltegravir plus optimized background therapy at viral loads > 5000 copies/ml. To investigate the role of the HIV-1 genetic background we created recombinant viruses containing the viral integrase coding region from pre-raltegravir samples from two patients in whom raltegravir resistance developed through different pathways. The in vitro selections performed with these recombinant viruses were designed to mimic natural population bottlenecks. Deep sequencing analysis of the viral integrase CDS revealed that the virological response to raltegravir containing therapy inversely correlated with the relative amount of unique sequence variants that emerged suggesting diversifying selection during drug pressure. In 4/5 patients multiple signature mutations representing different resistance pathways were observed. Interestingly, the resistant population can consist of a single resistant variant that completely dominates the population but also of multiple variants from different resistance pathways that coexist in the viral population. We also found evidence for increased diversification after stronger bottlenecks. In vitro selections with low viral titers, mimicking population bottlenecks, revealed that both recombinant viruses and HXB2 reference virus were able to select mutations from different resistance pathways, although typically only one resistance pathway emerged in each individual culture. The generation of a specific raltegravir resistant variant is not predisposed in the genetic background of the viral integrase CDS. Typically, in the early phases of therapy failure the sequence space is explored and multiple resistance pathways emerge and then compete for dominance which frequently results in a switch of the dominant population over time towards the fittest variant or even multiple variants of similar fitness that can coexist in the viral population.

A unique linkage of administrative and clinical registry databases to expand analytic possibilities in pediatric heart transplantation research.

PubMed

Godown, Justin; Thurm, Cary; Dodd, Debra A; Soslow, Jonathan H; Feingold, Brian; Smith, Andrew H; Mettler, Bret A; Thompson, Bryn; Hall, Matt

2017-12-01

Large clinical, research, and administrative databases are increasingly utilized to facilitate pediatric heart transplant (HTx) research. Linking databases has proven to be a robust strategy across multiple disciplines to expand the possible analyses that can be performed while leveraging the strengths of each dataset. We describe a unique linkage of the Scientific Registry of Transplant Recipients (SRTR) database and the Pediatric Health Information System (PHIS) administrative database to provide a platform to assess resource utilization in pediatric HTx. All pediatric patients (1999-2016) who underwent HTx at a hospital enrolled in the PHIS database were identified. A linkage was performed between the SRTR and PHIS databases in a stepwise approach using indirect identifiers. To determine the feasibility of using these linked data to assess resource utilization, total and post-HTx hospital costs were assessed. A total of 3188 unique transplants were identified as being present in both databases and amenable to linkage. Linkage of SRTR and PHIS data was successful in 3057 (95.9%) patients, of whom 2896 (90.8%) had complete cost data. Median total and post-HTx hospital costs were $518,906 (IQR $324,199-$889,738), and $334,490 (IQR $235,506-$498,803) respectively with significant differences based on patient demographics and clinical characteristics at HTx. Linkage of the SRTR and PHIS databases is feasible and provides an invaluable tool to assess resource utilization. Our analysis provides contemporary cost data for pediatric HTx from the largest US sample reported to date. It also provides a platform for expanded analyses in the pediatric HTx population. Copyright © 2017 Elsevier Inc. All rights reserved.

Genomic characterization of chronic lymphocytic leukemia (CLL) in radiation-exposed Chornobyl cleanup workers.

PubMed

Ojha, Juhi; Dyagil, Iryna; Finch, Stuart C; Reiss, Robert F; de Smith, Adam J; Gonseth, Semira; Zhou, Mi; Hansen, Helen M; Sherborne, Amy L; Nakamura, Jean; Bracci, Paige M; Gudzenko, Nataliya; Hatch, Maureen; Babkina, Nataliya; Little, Mark P; Chumak, Vadim V; Walsh, Kyle M; Bazyka, Dimitry; Wiemels, Joseph L; Zablotska, Lydia B

2018-05-02

Chronic lymphocytic leukemia (CLL) was the predominant leukemia in a recent study of Chornobyl cleanup workers from Ukraine exposed to radiation (UR-CLL). Radiation risks of CLL significantly increased with increasing bone marrow radiation doses. Current analysis aimed to clarify whether the increased risks were due to radiation or to genetic mutations in the Ukrainian population. A detailed characterization of the genomic landscape was performed in a unique sample of 16 UR-CLL patients and age- and sex-matched unexposed general population Ukrainian-CLL (UN-CLL) and Western-CLL (W-CLL) patients (n = 28 and 100, respectively). Mutations in telomere-maintenance pathway genes POT1 and ATM were more frequent in UR-CLL compared to UN-CLL and W-CLL (both p < 0.05). No significant enrichment in copy-number abnormalities at del13q14, del11q, del17p or trisomy12 was identified in UR-CLL compared to other groups. Type of work performed in the Chornobyl zone, age at exposure and at diagnosis, calendar time, and Rai stage were significant predictors of total genetic lesions (all p < 0.05). Tumor telomere length was significantly longer in UR-CLL than in UN-CLL (p = 0.009) and was associated with the POT1 mutation and survival. No significant enrichment in copy-number abnormalities at CLL-associated genes was identified in UR-CLL compared to other groups. The novel associations between radiation exposure, telomere maintenance and CLL prognosis identified in this unique case series provide suggestive, though limited data and merit further investigation.

Characteristics and Outcomes of Very Elderly Enrolled in a Prehospital Stroke Research Study.

PubMed

Sanossian, Nerses; Apibunyopas, Kathleen C; Liebeskind, David S; Starkman, Sidney; Burgos, Adrian M; Conwit, Robin; Eckstein, Marc; Pratt, Frank; Stratton, Sam; Hamilton, Scott; Saver, Jeffrey L

2016-11-01

Greater numbers of individuals aged ≥80 years enjoy a high quality of life, yet historically stroke trials have excluded this population. We aimed to describe a population of very elderly successfully enrolled into an acute stroke trial and compare their characteristics and outcomes with the younger cohort. We analyzed consecutive patients enrolled <2 hours of symptom onset in a prehospital stroke treatment trial, the FAST-MAG clinical trial (Field Administration of Stroke Therapy-Magnesium). We gathered demographic, treatment, and outcome data for nonelderly (<80 years old), very elderly (≥80 years old), and extreme elderly (≥90 years old). We describe key differences in the population of elderly and the impact of their inclusion on the clinical trial. Of 1700 participants in FAST-MAG, there were 1210 nonelderly, 490 very elderly, and 60 extreme elderly subjects. Very elderly stroke patients successfully enrolled in a research study were more likely to be women, white, and have an ischemic mechanism rather than an intracerebral hemorrhage. Although the very elderly had generally poorer outcomes, 4 in 10 were functionally independent at 90 days. Inclusion of the very elderly population in acute stroke clinical trials would both significantly increase study participation and generalizability of future acute stroke clinical trials. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00059332. © 2016 American Heart Association, Inc.

Real time and label free profiling of clinically relevant exosomes

PubMed Central

Sina, Abu Ali Ibn; Vaidyanathan, Ramanathan; Dey, Shuvashis; Carrascosa, Laura G.; Shiddiky, Muhammad J. A.; Trau, Matt

2016-01-01

Tumor-derived exosomes possess significant clinical relevance due to their unique composition of genetic and protein material that is representative of the parent tumor. Specific isolation as well as identification of proportions of these clinically relevant exosomes (CREs) from biological samples could help to better understand their clinical significance as cancer biomarkers. Herein, we present a simple approach for quantification of the proportion of CREs within the bulk exosome population isolated from patient serum. This proportion of CREs can potentially inform on the disease stage and enable non-invasive monitoring of inter-individual variations in tumor-receptor expression levels. Our approach utilises a Surface Plasmon Resonance (SPR) platform to quantify the proportion of CREs in a two-step strategy that involves (i) initial isolation of bulk exosome population using tetraspanin biomarkers (i.e., CD9, CD63), and (ii) subsequent detection of CREs within the captured bulk exosomes using tumor-specific markers (e.g., human epidermal growth factor receptor 2 (HER2)). We demonstrate the isolation of bulk exosome population and detection of as low as 10% HER2(+) exosomes from samples containing designated proportions of HER2(+) BT474 and HER2(−) MDA-MB-231 cell derived exosomes. We also demonstrate the successful isolation of exosomes from a small cohort of breast cancer patient samples and identified that approximately 14–35% of their bulk population express HER2. PMID:27464736

Real time and label free profiling of clinically relevant exosomes.

PubMed

Sina, Abu Ali Ibn; Vaidyanathan, Ramanathan; Dey, Shuvashis; Carrascosa, Laura G; Shiddiky, Muhammad J A; Trau, Matt

2016-07-28

Tumor-derived exosomes possess significant clinical relevance due to their unique composition of genetic and protein material that is representative of the parent tumor. Specific isolation as well as identification of proportions of these clinically relevant exosomes (CREs) from biological samples could help to better understand their clinical significance as cancer biomarkers. Herein, we present a simple approach for quantification of the proportion of CREs within the bulk exosome population isolated from patient serum. This proportion of CREs can potentially inform on the disease stage and enable non-invasive monitoring of inter-individual variations in tumor-receptor expression levels. Our approach utilises a Surface Plasmon Resonance (SPR) platform to quantify the proportion of CREs in a two-step strategy that involves (i) initial isolation of bulk exosome population using tetraspanin biomarkers (i.e., CD9, CD63), and (ii) subsequent detection of CREs within the captured bulk exosomes using tumor-specific markers (e.g., human epidermal growth factor receptor 2 (HER2)). We demonstrate the isolation of bulk exosome population and detection of as low as 10% HER2(+) exosomes from samples containing designated proportions of HER2(+) BT474 and HER2(-) MDA-MB-231 cell derived exosomes. We also demonstrate the successful isolation of exosomes from a small cohort of breast cancer patient samples and identified that approximately 14-35% of their bulk population express HER2.

Breast cancer treatment across health care systems: linking electronic medical records and state registry data to enable outcomes research.

PubMed

Kurian, Allison W; Mitani, Aya; Desai, Manisha; Yu, Peter P; Seto, Tina; Weber, Susan C; Olson, Cliff; Kenkare, Pragati; Gomez, Scarlett L; de Bruin, Monique A; Horst, Kathleen; Belkora, Jeffrey; May, Suepattra G; Frosch, Dominick L; Blayney, Douglas W; Luft, Harold S; Das, Amar K

2014-01-01

Understanding of cancer outcomes is limited by data fragmentation. In the current study, the authors analyzed the information yielded by integrating breast cancer data from 3 sources: electronic medical records (EMRs) from 2 health care systems and the state registry. Diagnostic test and treatment data were extracted from the EMRs of all patients with breast cancer treated between 2000 and 2010 in 2 independent California institutions: a community-based practice (Palo Alto Medical Foundation; "Community") and an academic medical center (Stanford University; "University"). The authors incorporated records from the population-based California Cancer Registry and then linked EMR-California Cancer Registry data sets of Community and University patients. The authors initially identified 8210 University patients and 5770 Community patients; linked data sets revealed a 16% patient overlap, yielding 12,109 unique patients. The percentage of all Community patients, but not University patients, treated at both institutions increased with worsening cancer prognostic factors. Before linking the data sets, Community patients appeared to receive less intervention than University patients (mastectomy: 37.6% vs 43.2%; chemotherapy: 35% vs 41.7%; magnetic resonance imaging: 10% vs 29.3%; and genetic testing: 2.5% vs 9.2%). Linked Community and University data sets revealed that patients treated at both institutions received substantially more interventions (mastectomy: 55.8%; chemotherapy: 47.2%; magnetic resonance imaging: 38.9%; and genetic testing: 10.9% [P < .001 for each 3-way institutional comparison]). Data linkage identified 16% of patients who were treated in 2 health care systems and who, despite comparable prognostic factors, received far more intensive treatment than others. By integrating complementary data from EMRs and population-based registries, a more comprehensive understanding of breast cancer care and factors that drive treatment use was obtained. © 2013 American Cancer Society.

Investigating the widely held belief that men and women with learning disabilities receive poor quality healthcare when admitted to hospital: a single-site study of 30-day readmission rates.

PubMed

Kelly, C L; Thomson, K; Wagner, A P; Waters, J P; Thompson, A; Jones, S; Holland, A J; Redley, M

2015-09-01

This study aims to use 30-day readmission rates to investigate the presumption that men and women with learning disabilities (LDs, known internationally as intellectual disabilities) receive poorer quality hospital care than their non-disabled peers. A 12-month retrospective audit was conducted using Hospital Episode Statistics (HES) at a single acute hospital in the East of England. This identified all in-patient admissions; admissions where the person concerned was recognised as having a LD; and all emergency readmissions within 30 days of discharge. Additionally, the healthcare records of all patients identified as having a LD and readmitted within 30 days as a medical emergency were examined in order to determine whether or not these readmissions were potentially preventable. Over the study period, a total of 66 870 adults were admitted as in-patients, among whom 7408 were readmitted as medical emergencies within 30 days of discharge: a readmission rate of 11%. Of these 66 870 patients, 256 were identified as having a LD, with 32 of them experiencing at least one emergency readmission within 30 days: a readmission rate of 13%. When examined, the healthcare records pertaining to these 32 patients who had a total of 39 unique 30-day readmissions revealed that 69% (n = 26) of these readmissions were potentially preventable. Although overall readmission rates were similar for patients with LDs and those from the general population, patients with LDs had a much higher rate of potentially preventable readmissions when compared to a general population estimate from van Walraven et al. This suggests that there is still work to be done to ensure that this patient population receives hospital care that is both safe and of high quality. © 2015 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.

Providing health care to human beings trapped in the poverty culture.

PubMed

Benson, D S

2000-01-01

The culture of poverty impacts everything patients in this socioeconomic group think and do. If what poor patients say does not sit well with the way we think, that doesn't mean they are wrong. Physicians have to adjust their mental model and think in different cultural terms. The author recently completed his thirtieth year of a career dedicated to providing health care to people living in poverty. He shares seven concepts important in building a mental model that will enable physicians to successfully provide health care to this patient population: (1) Poverty is the number one health problem; (2) we see same diseases as everyone else; (3) patients are trapped in the poverty culture; (4) patients' behavior is often manipulative; (5) compliance is a unique challenge; (6) patients have limited resources; and (7) the ultimate contributors to poverty are unwanted adolescent pregnancy and substance abuse. These concepts can help physicians to be more effective in providing health care to patients living in poverty. They can help them understand what is happening, so that their experience might be fulfilling rather than demoralizing.

Patient support groups in the management of Wilson disease.

PubMed

Graper, Mary L; Schilsky, Michael L

2017-01-01

Patient support groups serve an important function for those affected by a disease but especially for people with a rare disease. Because of the complexity of Wilson disease there are some unique and difficult problems faced by groups that advocate for these patients. We give a comparative overview of the differences between groups that support people with more common diseases and groups that serve the rare disease population. The history and current status of the Wilson Disease Association and other worldwide Wilson disease groups are described and information about other organizations that support Wilson disease in additional ways is explained. The specific challenges faced in the support of Wilson disease patients are outlined and possible solutions proposed. Drawing from experience in speaking with many patients, we discuss some of the most common questions that are asked by patients who are seeking a possible diagnosis or are already on treatment. There are many options for improving patient advocacy efforts in the future that we hope will be accomplished. © 2017 Elsevier B.V. All rights reserved.

Impaired Health Status, Psychological Distress, and Personality in Women and Men With Nonobstructive Coronary Artery Disease: Sex and Gender Differences: The TWIST (Tweesteden Mild Stenosis) Study.

PubMed

Mommersteeg, Paula M C; Arts, Lindy; Zijlstra, Wobbe; Widdershoven, Jos W; Aarnoudse, Wilbert; Denollet, Johan

2017-02-01

Patients with nonobstructive coronary artery disease (NOCAD; wall irregularities, stenosis <60%), and women with NOCAD in particular, remain underinvestigated. We examined sex and gender (S&G) differences in health status, psychological distress, and personality between patients with NOCAD and the general population, as well as S&G differences within the NOCAD population. In total, 523 patients with NOCAD (61±9 years, 52% women) were included via coronary angiography and computed tomography as part of the TWIST (Tweesteden Mild Stenosis) study. Generic health status (12-item Short Form physical and mental scales and fatigue), psychological distress (Hospital Anxiety and Depression Scale anxiety and depressive symptoms and Global Mood Scale negative and positive affect), and personality (Type D personality) were compared between patients with NOCAD and an age- and sex-matched group of 1347 people from the general population. Frequency matching was performed to obtain a similar sex distribution in each age-decile group. Both men and women with NOCAD reported impaired health status, more psychological distress, and Type D personality compared with men and women in the reference group. Women reported more psychosocial distress compared with men, but no significant sex-by-group interaction effects were observed. Women with NOCAD reported impaired health status, more anxiety, and less positive affect, but no differences in depressive symptoms, angina, or Type D personality when compared with men with NOCAD. Age, education, employment, partner, and alcohol use explained these S&G differences within the NOCAD group. In both men and women, NOCAD was associated with impaired health status, more psychological distress, and Type D personality when compared with a reference population. Factors reflecting S&G differences explained these S&G findings in patient-reported outcomes. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01788241. © 2016 The Authors.

Treatment Effect Estimation Using Nonlinear Two-Stage Instrumental Variable Estimators: Another Cautionary Note.

PubMed

Chapman, Cole G; Brooks, John M

2016-12-01

To examine the settings of simulation evidence supporting use of nonlinear two-stage residual inclusion (2SRI) instrumental variable (IV) methods for estimating average treatment effects (ATE) using observational data and investigate potential bias of 2SRI across alternative scenarios of essential heterogeneity and uniqueness of marginal patients. Potential bias of linear and nonlinear IV methods for ATE and local average treatment effects (LATE) is assessed using simulation models with a binary outcome and binary endogenous treatment across settings varying by the relationship between treatment effectiveness and treatment choice. Results show that nonlinear 2SRI models produce estimates of ATE and LATE that are substantially biased when the relationships between treatment and outcome for marginal patients are unique from relationships for the full population. Bias of linear IV estimates for LATE was low across all scenarios. Researchers are increasingly opting for nonlinear 2SRI to estimate treatment effects in models with binary and otherwise inherently nonlinear dependent variables, believing that it produces generally unbiased and consistent estimates. This research shows that positive properties of nonlinear 2SRI rely on assumptions about the relationships between treatment effect heterogeneity and choice. © Health Research and Educational Trust.

Legal Issues for the Medical Director.

PubMed

Trulove, William G

2015-09-04

The nephrologist serving as medical director of a dialysis clinic must understand that the role of director is not simply an extension of being a good nephrologist. The two roles-nephrology practice and the leadership of a dialysis clinic-may be filled by a single person. However, each role contains unique tasks, requiring specific skill sets, and each role comes with inherent, associated legal risks. The medical director assumes a new level of responsibility and accountability defined by contractual obligations to the dialysis provider and by state and federal regulations. Hence, a medical director is accountable not only for providing standard-of-care treatment to his or her private practice patients dialyzed at the clinic but also for maintaining the safety of the dialysis clinic patient population and staff. Accordingly, a nephrologist serving in the role of medical director faces distinct legal risks beyond typical professional liability concerns. The medical director must also be mindful of regulatory compliance, unique avenues to licensure board complaints, and implications of careless communication habits. A thoughtful and prepared medical director can mitigate these risk exposures by understanding the sources of these challenges: contractual obligations, pertinent regulatory responsibilities, and the modern electronic communications environment. Copyright © 2015 by the American Society of Nephrology.

Legal Issues for the Medical Director

PubMed Central

2015-01-01

The nephrologist serving as medical director of a dialysis clinic must understand that the role of director is not simply an extension of being a good nephrologist. The two roles—nephrology practice and the leadership of a dialysis clinic—may be filled by a single person. However, each role contains unique tasks, requiring specific skill sets, and each role comes with inherent, associated legal risks. The medical director assumes a new level of responsibility and accountability defined by contractual obligations to the dialysis provider and by state and federal regulations. Hence, a medical director is accountable not only for providing standard-of-care treatment to his or her private practice patients dialyzed at the clinic but also for maintaining the safety of the dialysis clinic patient population and staff. Accordingly, a nephrologist serving in the role of medical director faces distinct legal risks beyond typical professional liability concerns. The medical director must also be mindful of regulatory compliance, unique avenues to licensure board complaints, and implications of careless communication habits. A thoughtful and prepared medical director can mitigate these risk exposures by understanding the sources of these challenges: contractual obligations, pertinent regulatory responsibilities, and the modern electronic communications environment. PMID:25492255

Review article: the management of cirrhosis in women.

PubMed

Allen, A M; Hay, J E

2014-11-01

There are differences in the predisposition, natural history of liver disease, complications and treatment response between men and women. To review clinical differences in cirrhosis between men and women and to address unique management issues of fertility, pregnancy and contraception in this patient population. PubMed and MEDLINE were searched using the terms 'cirrhosis' and 'chronic liver disease', each cross-referenced with specific liver diseases, as well as terms such as 'cancer', 'hepatocellular carcinoma', 'smoking', 'liver transplantation', 'metabolic bone disease', 'fertility',' pregnancy' and 'contraception'. Pre-menopausal status is protective in viral hepatitis C and non-alcoholic steatohepatitis. However, smoking, especially in combination with alcohol, is a stronger risk factor for cirrhosis and malignancies in women with chronic liver disease compared to men, although they are less likely than men to develop hepatocellular carcinoma. Women with cirrhosis have more osteopenic bone disease than men and require active management. Successful pregnancy is possible in well-compensated cirrhosis or with mild portal hypertension, although the maternal and foetal mortality and morbidity are higher than in the general population. The maternal risk correlates with liver disease severity and derives mostly from variceal bleeding. The choices for contraception in compensated cirrhosis are generally the same as for the general population. Women with cirrhosis are disadvantaged by the current MELD system of organ allocation, at least in part due to body size. The management of women with chronic liver disease is unique in regards to counselling, screening for complications, fertility and pregnancy. © 2014 John Wiley & Sons Ltd.

Unique Challenges of Type 1 Diabetes in the Preschool Population.

PubMed

Coshway, Loyal K; Hoffman, Robert P

2017-01-01

Extremely young children aged ≤6 years old represent a unique population among patients with type 1 diabetes in terms of glycemic variation, diabetes management and complications. We describe distinct features of diabetes care and outcomes in preschool age children. We searched PubMed, Google Scholar, and authors' bibliographies in order to extract articles specific to type 1 diabetes in preschool age children. The preschool age group is beset by many challenges to diabetes care, including more frequent hypo- and hyperglycemia, hypoglycemia unawareness, decreased residual beta cell function, and greater long-term neurocognitive effects from severe hypoglycemia and chronic hyperglycemia. Randomized controlled trials show that equally good metabolic control can be obtained with multiple daily injections or an insulin pump. Several non-randomized trials, including an 8 year longitudinal study, show lower hemoglobin A1C and decreased hypoglycemia on insulin pumps. Sensor augmented pump therapy resulted in superior A1C as long as sensors were used regularly. In contrast to adults, continuous glucose monitoring has little to no impact on A1C, although parents appreciate the improved monitoring for hypoglycemia. Children with onset of diabetes prior to age 5 are at risk for younger onset of microalbuminuria, however do not develop earlier onset retinopathy than children diagnosed after 5 years. Both severe hypoglycemia and chronic hyperglycemia have negative impact on neurocognition. Special knowledge about this young population is helpful for practitioners and parents. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

A qualitative understanding of patient falls in inpatient mental health units.

PubMed

Powell-Cope, Gail; Quigley, Patricia; Besterman-Dahan, Karen; Smith, Maureen; Stewart, Jonathan; Melillo, Christine; Haun, Jolie; Friedman, Yvonne

2014-01-01

Falls are the leading cause of injury-related deaths among people age 65 and older, and fractures are the major category of serious injuries produced by falls. Determine market segment-specific recommendations for "selling" falls prevention in acute inpatient psychiatry. Descriptive using focus groups. One inpatient unit at a Veterans' hospital in the Southeastern United States and one national conference of psychiatric and mental health nurses. A convenience sample of 22 registered nurses and advanced practice nurses, one physical therapist and two physicians participated in one of six focus groups. None. Focus groups were conducted by expert facilitators using a semistructured interview guide. Focus groups were recorded and transcribed. Content analysis was used to organize findings. Findings were grouped into fall risk assessment, clinical fall risk precautions, programmatic fall prevention, and "selling" fall prevention in psychiatry. Participants focused on falls prevention instead of fall injury prevention, were committed to reducing risk, and were receptive to learning how to improve safety. Participants recognized unique features of their patients and care settings that defined risk, and were highly motivated to work with other disciplines to keep patients safe. Selling fall injury prevention to staff in psychiatric settings is similar to selling fall injury prevention to staff in other health care settings. Appealing to the larger construct of patient safety will motivate staff in psychiatric settings to implement best practices and customize these to account for unique population needs characteristics. © The Author(s) 2014.

Challenges and unmet needs in basal insulin therapy: lessons from the Asian experience

PubMed Central

Chan, Wing Bun; Chen, Jung Fu; Goh, Su-Yen; Vu, Thi Thanh Huyen; Isip-Tan, Iris Thiele; Mudjanarko, Sony Wibisono; Bajpai, Shailendra; Mabunay, Maria Aileen; Bunnag, Pongamorn

2017-01-01

Basal insulin therapy can improve glycemic control in people with type 2 diabetes. However, timely initiation, optimal titration, and proper adherence to prescribed basal insulin regimens are necessary to achieve optimal glycemic control. Even so, glycemic control may remain suboptimal in a significant proportion of patients. Unique circumstances in Asia (eg, limited resources, management of diabetes primarily in nonspecialist settings, and patient populations that are predominantly less educated) coupled with the limitations of current basal insulin options (eg, risk of hypoglycemia and dosing time inflexibility) amplify the challenge of optimal basal insulin therapy in Asia. Significant progress has been made with long-acting insulin analogs (insulin glargine 100 units/mL and insulin detemir), which provide longer coverage and less risk of hypoglycemia over intermediate-acting insulin (Neutral Protamine Hagedorn insulin). Furthermore, recent clinical evidence suggests that newer long-acting insulin analogs, new insulin glargine 300 units/mL and insulin degludec, may address some of the unmet needs of current basal insulin options in terms of risk of hypoglycemia and dosing time inflexibility. Nevertheless, more can be done to overcome barriers to basal insulin therapy in Asia, through educating both patients and physicians, developing better patient support models, and improving accessibility to long-acting insulin analogs. In this study, we highlight the unique challenges associated with basal insulin therapy in Asia and, where possible, propose strategies to address the unmet needs by drawing on clinical experiences and perspectives in Asia. PMID:29276400

Challenges and unmet needs in basal insulin therapy: lessons from the Asian experience.

PubMed

Chan, Wing Bun; Chen, Jung Fu; Goh, Su-Yen; Vu, Thi Thanh Huyen; Isip-Tan, Iris Thiele; Mudjanarko, Sony Wibisono; Bajpai, Shailendra; Mabunay, Maria Aileen; Bunnag, Pongamorn

2017-01-01

Basal insulin therapy can improve glycemic control in people with type 2 diabetes. However, timely initiation, optimal titration, and proper adherence to prescribed basal insulin regimens are necessary to achieve optimal glycemic control. Even so, glycemic control may remain suboptimal in a significant proportion of patients. Unique circumstances in Asia (eg, limited resources, management of diabetes primarily in nonspecialist settings, and patient populations that are predominantly less educated) coupled with the limitations of current basal insulin options (eg, risk of hypoglycemia and dosing time inflexibility) amplify the challenge of optimal basal insulin therapy in Asia. Significant progress has been made with long-acting insulin analogs (insulin glargine 100 units/mL and insulin detemir), which provide longer coverage and less risk of hypoglycemia over intermediate-acting insulin (Neutral Protamine Hagedorn insulin). Furthermore, recent clinical evidence suggests that newer long-acting insulin analogs, new insulin glargine 300 units/mL and insulin degludec, may address some of the unmet needs of current basal insulin options in terms of risk of hypoglycemia and dosing time inflexibility. Nevertheless, more can be done to overcome barriers to basal insulin therapy in Asia, through educating both patients and physicians, developing better patient support models, and improving accessibility to long-acting insulin analogs. In this study, we highlight the unique challenges associated with basal insulin therapy in Asia and, where possible, propose strategies to address the unmet needs by drawing on clinical experiences and perspectives in Asia.

Committee Opinion No. 726 Summary: Hospital Disaster Preparedness for Obstetricians and Facilities Providing Maternity Care.

PubMed

2017-12-01

Large-scale catastrophic events and infectious disease outbreaks highlight the need for disaster planning at all community levels. Features unique to the obstetric population (including antepartum, intrapartum, postpartum and neonatal care) warrant special consideration in the event of a disaster. Pregnancy increases the risks of untoward outcomes from various infectious diseases. Trauma during pregnancy presents anatomic and physiologic considerations that often can require increased use of resources such as higher rates of cesarean delivery. Recent evidence suggests that floods and human-influenced environmental disasters increase the risks of spontaneous miscarriages, preterm births, and low-birth-weight infants among pregnant women. The potential surge in maternal and neonatal patient volume due to mass-casualty events, transfer of high-acuity patients, or redirection of patients because of geographic barriers presents unique challenges for obstetric care facilities. These circumstances require that facilities plan for additional increases in necessary resources and staffing. Although emergencies may be unexpected, hospitals and obstetric delivery units can prepare to implement plans that will best serve maternal and pediatric care needs when disasters occur. Clear designation of levels of maternal and neonatal care facilities, along with establishment of a regional network incorporating hospitals that provide maternity services and those that do not, will enable rapid transport of obstetric patients to the appropriate facilities, ensuring the right care at the right time. Using common terminology for triage and transfer and advanced knowledge of regionalization and levels of care will facilitate disaster preparedness.

Committee Opinion No. 726: Hospital Disaster Preparedness for Obstetricians and Facilities Providing Maternity Care.

PubMed

2017-12-01

Large-scale catastrophic events and infectious disease outbreaks highlight the need for disaster planning at all community levels. Features unique to the obstetric population (including antepartum, intrapartum, postpartum and neonatal care) warrant special consideration in the event of a disaster. Pregnancy increases the risks of untoward outcomes from various infectious diseases. Trauma during pregnancy presents anatomic and physiologic considerations that often can require increased use of resources such as higher rates of cesarean delivery. Recent evidence suggests that floods and human-influenced environmental disasters increase the risks of spontaneous miscarriages, preterm births, and low-birth-weight infants among pregnant women. The potential surge in maternal and neonatal patient volume due to mass-casualty events, transfer of high-acuity patients, or redirection of patients because of geographic barriers presents unique challenges for obstetric care facilities. These circumstances require that facilities plan for additional increases in necessary resources and staffing. Although emergencies may be unexpected, hospitals and obstetric delivery units can prepare to implement plans that will best serve maternal and pediatric care needs when disasters occur. Clear designation of levels of maternal and neonatal care facilities, along with establishment of a regional network incorporating hospitals that provide maternity services and those that do not, will enable rapid transport of obstetric patients to the appropriate facilities, ensuring the right care at the right time. Using common terminology for triage and transfer and advanced knowledge of regionalization and levels of care will facilitate disaster preparedness.

Transgender populations and HIV: unique risks, challenges and opportunities.

PubMed

Wansom, Tanyaporn; Guadamuz, Thomas E; Vasan, Sandhya

2016-04-01

Due to unique social, behavioural, structural and biological issues, transgender (TG) populations, especially TG women, are at high risk for HIV acquisition. This increased risk is multifactorial, due to differing psychosocial risk factors, poorer access to TG-specific healthcare, a higher likelihood of using exogenous hormones or fillers without direct medical supervision, interactions between hormonal therapy and antiretroviral therapy, and direct effects of hormonal therapy on HIV acquisition and immune control. Further research is needed to elucidate these mechanisms of risk and to help design interventions to reduce HIV risk among transgender populations.

Development of the Primary Care Quality-Homeless (PCQ-H) Instrument: A Practical Survey of Patients' Experiences in Primary Care

PubMed Central

Kertesz, Stefan. G.; Pollio, David E.; Jones, Richard N.; Steward, Jocelyn; Stringfellow, Erin J.; Gordon, Adam J.; Johnson, Nancy K.; Kim, Theresa A.; Granstaff, Unita; Austin, Erika L.; Young, Alexander S.; Golden, Joya; Davis, Lori L.; Roth, David L.; Holt, Cheryl L.

2015-01-01

Background Homeless patients face unique challenges in obtaining primary care responsive to their needs and context. Patient experience questionnaires could permit assessment of patient-centered medical homes for this population, but standard instruments may not reflect homeless patients' priorities and concerns. Objectives This report describes (a) the content and psychometric properties of a new primary care questionnaire for homeless patients and (b) the methods utilized in its development. Methods Starting with quality-related constructs from the Institute of Medicine, we identified relevant themes by interviewing homeless patients and experts in their care. A multidisciplinary team drafted a preliminary set of 78 items. This was administered to homeless-experienced clients (n=563) across 3 VA facilities and 1 non-VA Health Care for the Homeless Program. Using Item Response Theory, we examined Test Information Function curves to eliminate less informative items and devise plausibly distinct subscales. Results The resulting 33-item instrument (Primary Care Quality-Homeless, PCQ-H) has four subscales: Patient-Clinician Relationship (15 items), Cooperation among Clinicians (3 items), Access/Coordination (11 items) and Homeless-Specific Needs (4 items). Evidence for divergent and convergent validity is provided. Test Information Function (TIF) graphs showed adequate informational value to permit inferences about groups for 3 subscales (Relationship, Cooperation and Access/Coordination). The 3-item Cooperation subscale had lower informational value (TIF<5) but had good internal consistency (alpha=0.75) and patients frequently reported problems in this aspect of care. Conclusions Systematic application of qualitative and quantitative methods supported the development of a brief patient-reported questionnaire focused on the primary care of homeless patients and offers guidance for future population-specific instrument development. PMID:25023918

Incidence and risk factors for preoperative deep venous thrombosis in 314 consecutive patients undergoing surgery for spinal metastasis.

PubMed

Zacharia, Brad E; Kahn, Sweena; Bander, Evan D; Cederquist, Gustav Y; Cope, William P; McLaughlin, Lily; Hijazi, Alexa; Reiner, Anne S; Laufer, Ilya; Bilsky, Mark

2017-08-01

OBJECTIVE The authors of this study aimed to identify the incidence of and risk factors for preoperative deep venous thrombosis (DVT) in patients undergoing surgical treatment for spinal metastases. METHODS Univariate analysis of patient age, sex, ethnicity, laboratory values, comorbidities, preoperative ambulatory status, histopathological classification, spinal level, and surgical details was performed. Factors significantly associated with DVT univariately were entered into a multivariate logistic regression model. RESULTS The authors identified 314 patients, of whom 232 (73.9%) were screened preoperatively for a DVT. Of those screened, 22 (9.48%) were diagnosed with a DVT. The screened patients were older (median 62 vs 55 years, p = 0.0008), but otherwise similar in baseline characteristics. Nonambulatory status, previous history of DVT, lower partial thromboplastin time, and lower hemoglobin level were statistically significant and independent factors associated with positive results of screening for a DVT. Results of screening were positive in only 6.4% of ambulatory patients in contrast to 24.4% of nonambulatory patients, yielding an odds ratio of 4.73 (95% CI 1.88-11.90). All of the patients who had positive screening results underwent preoperative placement of an inferior vena cava filter. CONCLUSIONS Patients requiring surgery for spinal metastases represent a population with unique risks for venous thromboembolism. This study showed a 9.48% incidence of DVT in patients screened preoperatively. The highest rates of preoperative DVT were identified in nonambulatory patients, who were found to have a 4-fold increase in the likelihood of harboring a DVT. Understanding the preoperative thrombotic status may provide an opportunity for early intervention and risk stratification in this critically ill population.

Algorithm development and the clinical and economic burden of Cushing's disease in a large US health plan database.

PubMed

Burton, Tanya; Le Nestour, Elisabeth; Neary, Maureen; Ludlam, William H

2016-04-01

This study aimed to develop an algorithm to identify patients with CD, and quantify the clinical and economic burden that patients with CD face compared to CD-free controls. A retrospective cohort study of CD patients was conducted in a large US commercial health plan database between 1/1/2007 and 12/31/2011. A control group with no evidence of CD during the same time was matched 1:3 based on demographics. Comorbidity rates were compared using Poisson and health care costs were compared using robust variance estimation. A case-finding algorithm identified 877 CD patients, who were matched to 2631 CD-free controls. The age and sex distribution of the selected population matched the known epidemiology of CD. CD patients were found to have comorbidity rates that were two to five times higher and health care costs that were four to seven times higher than CD-free controls. An algorithm based on eight pituitary conditions and procedures appeared to identify CD patients in a claims database without a unique diagnosis code. Young CD patients had high rates of comorbidities that are more commonly observed in an older population (e.g., diabetes, hypertension, and cardiovascular disease). Observed health care costs were also high for CD patients compared to CD-free controls, but may have been even higher if the sample had included healthier controls with no health care use as well. Earlier diagnosis, improved surgery success rates, and better treatments may all help to reduce the chronic comorbidity and high health care costs associated with CD.

Analysis of Diagnoses Associated with Multiple Sclerosis–Related In-Hospital Mortality Using the Premier Hospital Database

PubMed Central

Pocoski, Jennifer; Cutter, Gary; Kaufman, David W.; Pleimes, Dirk

2016-01-01

Background: We sought to compare mortality rates and related diagnoses in hospitalized patients with multiple sclerosis (MS), those with diabetes mellitus (DM), and the general hospitalized population (GHP). Methods: Patients who died between 2007 and 2011 were identified in the US hospital–based Premier Healthcare Database. Demographic information was collected, mortality rates calculated, and principal diagnoses categorized. Results: Of 55,152 unique patients with MS identified, 1518 died. Mean age at death was 10 years younger for the MS group (63.4 years) than for the DM (73.3 years) and GHP (73.1 years) groups. Age-adjusted mortality rates, based on the 2000 US Standard Million Population, were 1077, 1248, and 1133 per 100,000, respectively. Infection was the most common principal diagnosis at the hospital stay during which the patient died in the MS cohort (43.1% vs. 26.3% and 24.0% in the DM and GHP groups, respectively). Other common principal diagnoses in the MS group included pulmonary (17.5%) and cardiovascular (12.1%) disease. Septicemia/sepsis/septic shock was a secondary diagnosis for 50.7% of patients with MS versus 36.0% and 31.0% of patients in the DM and GHP cohorts, respectively. Conclusions: Patients with MS had a shorter life span than patients with DM or the GHP and were more likely to have a principal diagnosis of infection at their final hospital stay. However, the database was limited to codes recorded in the hospital; diagnoses received outside the hospital were not captured. PMID:27252603

Case Report: A Rare Cause of Complicated Urinary Tract Infection in a Woman with Herlyn-Werner-Wunderlich Syndrome.

PubMed

Tsai, Jun-Li; Tsai, Shang-Feng

2016-11-01

Urinary tract infection is a common disease in the general population. However, in patients with frequent urinary tract infection, it is important to determine any treatable cause to avoid recurrence. Herlyn-Werner-Wunderlich syndrome or OHVIRA syndrome is a very rare congenital anomaly with uterus didelphys, obstructed hemivagina, and ipsilateral renal agenesis. The earliest presentation of this syndrome is hematocolpos that develops during menstruation and results in dysmenorrhea and a pelvic mass shortly after menarche. Herein, we report a patient with Herlyn-Werner-Wunderlich syndrome manifested with unusual symptoms, delayed onset and without surgery. The unique point of this patient is the partial obstruction of cervico-vaginal junction. Early diagnosis and timely treatment of OHVIRA syndrome can prevent long-term complications, such as recurrent urinary tract infection and infertility. A high index of suspicion is required, even though OHVIRA syndrome is extremely rare and may have an atypical presentation.

Psychodynamic Group Psychoterapy in the Early Intervention Program for Patients with Psychosis (RIPEPP).

PubMed

Restek-Petrović, Branka; Mayer, Nina; Grah, Majda

2018-06-01

Psychiatric Hospital "Sveti Ivan" in Zagreb, Croatia, offers an outpatient Early intervention programme for patients with psychotic disorders (RIPEPP), consisting of psychoeducational workshops and group psychodynamic psychotherapy. Psychodynamic group psychotherapy presents a unique conceptual format not offered by other types of psychotherapy, and it is especially useful for population of patients with psychotic disorders. During group work, gradual establishment of communication and interactions, and creating a network of relations through experiences of corrective emotional symbiosis, affect the constellation of internal objects and relationships between members, and their restructuring. The function of group psychotherapy is not only to offer relief, support, and elements of education, but also to enable internal changes. Therapeutic factors contributing to the improvement of people with schizophrenia include supportive aspects such as universality, acceptance, cohesion, hope and altruism. This paper contains vignettes from inpatient and outpatient group dynamics.

Bronchioloalveolar carcinoma.

PubMed

Arenberg, Douglas

2011-02-01

This review focuses on aspects of bronchioloalveolar carcinoma (BAC) in which it differs importantly from other forms of non-small-cell lung cancer. BAC is a form of adenocarcinoma with unique clinical, radiological, and epidemiological features. With the notable exception of a lower likelihood of a positive positron-emission tomographic (PET) scan in BAC, staging, diagnosis, and treatment are largely the same as for other histological subtypes of lung cancer. However, additional treatment options exist that are equivalent, if not more effective, for many patients with BAC. The diagnosis of BAC should be reserved for those tumors meeting the 1999/2004 criteria set forth by the World Health Organization. Revised nomenclature proposed by an expert consensus panel may change how this disease is viewed. Additional clinical trials are needed on patients with BAC, employing strict definitions and enrollment criteria to allow the results to be applied to appropriate patient populations. © Thieme Medical Publishers.

Association between financial strain, social network and five-year recovery from first episode psychosis.

PubMed

Mattsson, Maria; Topor, Alain; Cullberg, Johan; Forsell, Yvonne

2008-12-01

Despite much effort to positively affect long-term outcome in psychosis and schizophrenia many patients are still facing a poor outcome with persistent psychotic symptoms and decline in social functioning. The aim of this study was to examine the relationship between financial strain and social network and five-year outcome of first episode psychosis (FEP). FEP patients were divided into recovered (n = 52) and non-recovered (n = 19). Each person was matched according to age and gender with four persons (n = 284) from a longitudinal population-based study. All persons had answered an extensive questionnaire including social network, quantitative and qualitative, financial strain and mental health. Linear regression analysis showed that both financial strain and social network were associated, and had a unique contribution, to outcome. The results indicate that FEP patients might benefit from interventions that reduce financial strain thus facilitating daily life and cultural and social activities.

Wartime critical care air transport.

PubMed

Bridges, Elizabeth; Evers, Karen

2009-04-01

Describe the characteristics/enroute care of casualties transported by USAF Critical Care Air Transport Teams (CCATT) during Operation Enduring Freedom/Iraqi Freedom (OEF/OIF). Retrospective review of TRAC2ES and CCATT Mission Reports (Oct 2001-May 2006). 3492 patient moves (2439 patients). Moves by route: within Area of Responsibility (AOR) (n = 261); AOR-Landstuhl (LRMC) (n = 1995), Germany-CONUS (n = 1188). For AOR-LRMC: BI (64%), NBI (8%), Disease (25%). Among injured (n = 1491), 69% suffered polytrauma, primarily d/t explosions. Injury area: extremities (63%), head (55%), thorax (46%), abdomen (31%), neck (17%). Injury type: soft tissue (64%), orthopedic (45%), thoracic (35%), skull fracture (27%), brain injury (25%). Disease diagnoses: cardiac (15%) and pulmonary (8%). This is the first analysis of OEF/OIF CCATT patients. Phase 1 of this study demonstrates the strengths and limitations of TRAC2ES and CCATT Mission Reports to describe the characteristics/enroute care of this unique population.

Prevalence, Employment Rate, and Cost of Schizophrenia in a High-Income Welfare Society: A Population-Based Study Using Comprehensive Health and Welfare Registers

PubMed Central

Evensen, Stig; Wisløff, Torbjørn; Lystad, June Ullevoldsæter; Bull, Helen; Ueland, Torill; Falkum, Erik

2016-01-01

Schizophrenia is associated with recurrent hospitalizations, need for long-term community support, poor social functioning, and low employment rates. Despite the wide- ranging financial and social burdens associated with the illness, there is great uncertainty regarding prevalence, employment rates, and the societal costs of schizophrenia. The current study investigates 12-month prevalence of patients treated for schizophrenia, employment rates, and cost of schizophrenia using a population-based top-down approach. Data were obtained from comprehensive and mandatory health and welfare registers in Norway. We identified a 12-month prevalence of 0.17% for the entire population. The employment rate among working-age individuals was 10.24%. The societal costs for the 12-month period were USD 890 million. The average cost per individual with schizophrenia was USD 106 thousand. Inpatient care and lost productivity due to high unemployment represented 33% and 29%, respectively, of the total costs. The use of mandatory health and welfare registers enabled a unique and informative analysis on true population-based datasets. PMID:26433216

Enhancing the effectiveness of HIV/AIDS prevention programs targeted to unique population groups in Thailand: lessons learned from applying concepts of diffusion of innovation and social marketing.

PubMed

Svenkerud, P J; Singhal, A

1998-01-01

Diffusion of innovations theory and social marketing theory have been criticized for their limited applicability in influencing unique population groups (e.g., female commercial sex workers (CSWs) working in low-class brothels). This study investigated the applicability of these two theoretical frameworks in outreach efforts directed to unique populations at high risk for HIV/AIDS in Bangkok, Thailand. Further, this study examined Thai cultural characteristics that influence communication about HIV/AIDS prevention. The results suggest that certain concepts and strategies drawn from the two frameworks were used more or less by effective outreach programs, providing several policy-relevant lessons. Cultural constraints, such as the lack of visibility of the disease and traditional sexual practices, influenced communication about HIV/AIDS prevention.

The conduct of practice-based research in community clinics compared to private practices: similarities, differences, and challenges

PubMed Central

Gillette, Jane; Cunha-Cruz, Joana; Gilbert, Ann; Speed-McIntyre, Pollene; Zhou, Lingmei; DeRouen, Timothy

2013-01-01

Practice-based research should be performed in all practice settings if the results are to be applied to all settings. However, some practice settings, such as community clinics, have unique features that may make the conduct of such research more challenging. The purpose of this article is to describe and compare the similarities and unique challenges related to conducting research in community clinics compared to private practices within the Northwest Practice-Based REsearch Collaborative in Evidence-Based DENTistry (PRECEDENT) network. Information was obtained from meetings with general dentists, a survey of general dentists (N = 253), and a clinical examination and record review of a systemic random sample of patients visiting community clinics and private practices. (N = 1903)—all part of a dental practice-based research network. The processes of conducting research, the dentist and patient sociodemographic characteristics, the prevalence of oral diseases, and the dental treatments received in community clinics and private practices were compared. Both community clinics and private practices have the clinical treatment of the patients as their priority and have time constraints on research. The processes of research training, obtaining informed consent, and collecting, transmitting, and securely maintaining research data are also similar. The patient populations and treatment needs differ substantially between community clinics and private practices, with a higher prevalence of dental caries and higher restorative treatment needs in the community clinic patients. The process of study participant selection and follow-up for research and the dentist and staff work arrangements also vary between the two practice settings. Although community clinic patients and their dental healthcare providers have different research needs and challenges than their counterparts in private practice, practice-based research can be successfully PMID:25429251

Efficacy and safety of ETC-1002, a novel investigational low-density lipoprotein-cholesterol-lowering therapy for the treatment of patients with hypercholesterolemia and type 2 diabetes mellitus.

PubMed

Gutierrez, Maria J; Rosenberg, Noah L; Macdougall, Diane E; Hanselman, Jeffrey C; Margulies, Janice R; Strange, Poul; Milad, Mark A; McBride, Scott J; Newton, Roger S

2014-03-01

8-Hydroxy-2,2,14,14-tetramethylpentadecanedioic acid (ETC-1002) is a small molecule with a unique mechanism of action shown in nonclinical studies to modulate pathways of cholesterol, fatty acid, and carbohydrate metabolism. In previous phase 2 clinical trials, once daily oral treatment with ETC-1002 significantly reduced low-density lipoprotein-cholesterol in patients with hypercholesterolemia. In this trial, the lipid-lowering efficacy of ETC-1002 was evaluated in patients with type 2 diabetes mellitus and hypercholesterolemia. Additional cardiometabolic biomarkers, including glycemic measures, were also assessed. A single-center, double-blind, placebo-controlled trial evaluated 60 patients with type 2 diabetes mellitus and elevated low-density lipoprotein-cholesterol. Patients discontinued all diabetes mellitus and lipid-regulating drugs and were randomized to receive ETC-1002 80 mg QD for 2 weeks followed by 120 mg QD for 2 weeks or placebo for 4 weeks. ETC-1002 lowered low-density lipoprotein-cholesterol levels by 43±2.6% (least squares mean±SE), compared with a reduction of 4±2.5% by placebo at day 29 (P<0.0001; primary end point). Non-high-density lipoprotein-cholesterol and total cholesterol were also significantly lowered by ETC-1002 compared with placebo (P<0.0001). High-sensitivity C-reactive protein was reduced by 41% (median) compared with a placebo reduction of 11% (P=0.0011). No clinically meaningful safety findings were observed. ETC-1002 lowered low-density lipoprotein-cholesterol and other lipids and demonstrated improvement in high-sensitivity C-reactive protein in patients with type 2 diabetes mellitus and hypercholesterolemia without worsening glycemic control. ETC-1002 was well tolerated in this population. http://www.clinicaltrials.gov. Unique identifier: NCT# 01607294.

Early detection of coronary artery disease by 64-slice multidetector computed tomography in asymptomatic hypertensive high-risk patients.

PubMed

Gaudio, Carlo; Mirabelli, Francesca; Pelliccia, Francesco; Francone, Marco; Tanzilli, Gaetano; Di Michele, Sara; Leonetti, Stefania; De Vincentis, Giuseppe; Carbone, Iacopo; Mangieri, Enrico; Catalano, Carlo; Passariello, Roberto

2009-07-10

The 64-slice multidetector-row computed tomography (MDCT) is an accurate noninvasive technique for assessing the degree of luminal narrowing in coronary arteries of patients with chronic ischemic disease. Aim of this study was to determine the value of MDCT in comparison to invasive coronary angiography (ICA) for detecting the presence and extent of coronary atherosclerotic plaques in a population of asymptomatic, hypertensive patients considered to be at high risk for cardiovascular events. We studied 67 asymptomatic, hypertensive patients at high-risk (Euro Score >5%). All patients had negative or nondiagnostic findings at exercise stress testing and therefore underwent both MDCT and ICA. In the per-patient analysis, MDCT correctly identified 16/17 (94%) patients with significant coronary artery disease involving at least 1 vessel and 48/50 (96%) normal subjects. In the per-segment analysis, MDCT correctly detected 21/22 (95%) coronary segments with a stenosis >or=50% and 856/868 (98%) normal segments, with a high negative predictivity of normal scans (100%). There was a good concordance between MDCT and ICA, with a high Pearson correlation coefficient between the coronary narrowings with the two techniques (r=0.84, p<0.01). Mean coronary calcium score was higher for the 17 patients with significant coronary artery disease on ICA than in the 50 patients without (422+/-223 HU vs 72+/-21 HU p<0.001). The ROC curves identified 160 as the best calcium volumetric score cut-off value able to identify >or=1 significant coronary stenosis with sensitivity 88% and specificity 85%. MDCT is an excellent noninvasive technique for early identification of significant coronary stenoses in high risk asymptomatic hypertensive patients and might provide unique information for the screening of this broad population.

Influence of BMI in nephrolithiasis in an Appalachian pediatric population: A single-center experience.

PubMed

Murphy, Margaret O; Erpelding, Scott G; Chishti, Aftab S; Dugan, Adam; Ziada, Ali; Kiessling, Stefan G

2018-06-07

The prevalence of pediatric nephrolithiasis has increased significantly in the past 20 years. Metabolic abnormalities predisposing adults to nephrolithiasis in obese patients include increased urinary sodium and uric acid excretion as well as low urine pH; however, limited data are available in the pediatric population. The aim was to investigate whether obese pediatric patients presenting with nephrolithiasis have a unique metabolic profile similar to reported findings in obese adults with nephrolithiasis. A retrospective chart review was performed in children aged 1-18 years seen at Kentucky Children's Hospital between 2010 and 2016. Inclusion criteria included all patients with documented stones confirmed by ultrasonography or computed tomography. A total of 111 patient charts were reviewed in the study with a mean age of 11.8 ± 4.2 years. Seventy patients (63%) had a normal BMI and 41 patients (37%) were considered overweight/obese. There was no statistically significant relationship between BMI and stone recurrence. Obese patients had significantly decreased levels of urinary citrate, oxalate, magnesium, and potassium with significant elevations of urinary urea nitrogen, ammonia, and low urine pH compared with normal weight patients (Summary Figure). Several groups have reported on metabolic findings within obese and non-obese pediatric patients. A Turkish study reported increased oxalate excretion and hypocitraturia in obese patients while a Korean study also reported increased rates of hypocitraturia in recurrent stone formers. Similar to these studies, we did find significant differences in citrate within our study population; however, we found significantly lower levels of urinary oxalate in obese patients. The majority of these studies do not report an association with BMI and urine pH although this has been reported in the adult population and our findings support an inverse relationship between body mass index (BMI) and pH. Our group found a higher level of calcium phosphate stones, supporting of Eisner's findings that high BMI is associated with increased supersaturation of calcium phosphate. Limitations of our study include being a single center and retrospective in nature. Our study demonstrates differences in types of stones and urinary metabolites in an obese pediatric population suggestive of different metabolic profiles contributing to stone disease. We report similar association between BMI and urine pH, urinary potassium, and citrate. This study confirmed our primary hypothesis that obese pediatric patients would have a different urinary mineral profile as evidenced by lower levels of citrate and potassium and low urine pH; however, obese patients did not exhibit significantly elevated urinary sodium and uric acid when normalized to weight, as described in the adult population. Our study did not confirm our secondary hypothesis that stone composition would be associated with BMI status or stone recurrence. Copyright © 2018 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

A cluster-randomized effectiveness trial of a physician-pharmacist collaborative model to improve blood pressure control.

PubMed

Carter, Barry L; Clarke, William; Ardery, Gail; Weber, Cynthia A; James, Paul A; Vander Weg, Mark; Chrischilles, Elizabeth A; Vaughn, Thomas; Egan, Brent M

2010-07-01

Numerous studies have demonstrated the value of team-based care to improve blood pressure (BP) control, but there is limited information on whether these models would be adopted in diverse populations. The purpose of this study was to evaluate whether a collaborative model between physicians and pharmacists can improve BP control in multiple primary care medical offices with diverse geographic and patient characteristics and whether long-term BP control can be sustained. This study is a randomized prospective trial in 27 primary care offices first stratified by the percentage of underrepresented minorities and the level of clinical pharmacy services within the office. Each office is then randomized to either a 9- or 24-month intervention or a control group. Patients will be enrolled in this study until 2012. The results of this study should provide information on whether this model can be implemented in large numbers of diverse offices, if it is effective in diverse populations, and whether BP control can be sustained long term. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00935077.

β-cell-specific CD8 T cell phenotype in type 1 diabetes reflects chronic autoantigen exposure

PubMed Central

McLaren, James E.; Dolton, Garry; Matthews, Katherine K.; Gostick, Emma; Kronenberg-Versteeg, Deborah; Eichmann, Martin; Knight, Robin R.; Heck, Susanne; Powrie, Jake; Bingley, Polly J.; Dayan, Colin M.; Miles, John J.; Sewell, Andrew K.

2015-01-01

Autoreactive CD8 T cells play a central role in the destruction of pancreatic islet β-cells that leads to type 1 diabetes, yet the key features of this immune-mediated process remain poorly defined. In this study, we combined high definition polychromatic flow cytometry with ultrasensitive peptide-human leukocyte antigen class I (pHLAI) tetramer staining to quantify and characterize β-cell-specific CD8 T cell populations in patients with recent onset type 1 diabetes and healthy controls. Remarkably, we found that β-cell-specific CD8 T cell frequencies in peripheral blood were similar between subject groups. In contrast to healthy controls, however, patients with newly diagnosed type 1 diabetes displayed hallmarks of antigen-driven expansion uniquely within the β-cell-specific CD8 T cell compartment. Molecular analysis of selected β-cell-specific CD8 T cell populations further revealed highly skewed oligoclonal T cell receptor (TCR) repertoires comprising exclusively private clonotypes. Collectively, these data identify novel and distinctive features of disease-relevant CD8 T cells that inform the immunopathogenesis of type 1 diabetes. PMID:25249579

Hypertension, obesity, and coronary artery disease in the survivors of congenital heart disease.

PubMed

Roche, S Lucy; Silversides, Candice K

2013-07-01

Obesity, hypertension, and coronary artery disease are prevalent in the general population and well recognized as contributors to cardiac morbidity and mortality. With surgical and medical advances, there is a growing and aging population with congenital heart disease who are also at risk of developing these comorbidities. In addition, some congenital cardiac lesions predispose patients to conditions such as hypertension or coronary artery disease. The effect of these comorbidities on the structurally abnormal heart is not well understood, but might be very important, especially in those with residual abnormalities. Thus, in addition to surveillance for and treatment of late complications it is important for the congenital cardiologist to consider and aggressively manage acquired comorbidities. In this review we explore the prevalence of hypertension, obesity, and coronary artery disease, discuss congenital lesions that predispose to these conditions and review management strategies for this unique population. Copyright © 2013 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Cancer Incidence in Five Continents: Inclusion criteria, highlights from Volume X and the global status of cancer registration.

PubMed

Bray, F; Ferlay, J; Laversanne, M; Brewster, D H; Gombe Mbalawa, C; Kohler, B; Piñeros, M; Steliarova-Foucher, E; Swaminathan, R; Antoni, S; Soerjomataram, I; Forman, D

2015-11-01

Cancer Incidence in Five Continents (CI5), a longstanding collaboration between the International Agency for Research on Cancer and the International Association of Cancer Registries, serves as a unique source of cancer incidence data from high-quality population-based cancer registries around the world. The recent publication of Volume X comprises cancer incidence data from 290 registries covering 424 populations in 68 countries for the registration period 2003-2007. In this article, we assess the status of population-based cancer registries worldwide, describe the techniques used in CI5 to evaluate their quality and highlight the notable variation in the incidence rates of selected cancers contained within Volume X of CI5. We also discuss the Global Initiative for Cancer Registry Development as an international partnership that aims to reduce the disparities in availability of cancer incidence data for cancer control action, particularly in economically transitioning countries, already experiencing a rapid rise in the number of cancer patients annually. © 2015 UICC.

Delayed Partial Nephrectomy for Hydronephrosis After Renal Trauma.

PubMed

Setia, Shaan; Jackson, Jessica Nicole; Herndon, C D Anthony; Corbett, Sean T

2017-03-01

Delayed sequelae following conservative management of renal trauma in the pediatric population are uncommon. Reports of delayed operations to manage these sequelae are even less common. Here we present the case of a 16-year-old male patient who had delayed development of upper urinary tract obstruction with recurrent infections following high-grade renal trauma managed conservatively. Ultimately, he required a robotic-assisted partial nephrectomy 2 years after initial nonoperative management. This is unique as no prior studies to our knowledge have described delayed hydronephrosis and delayed partial nephrectomy over a year following renal trauma. Copyright © 2016 Elsevier Inc. All rights reserved.

The lingual splint: an often forgotten method for fixating pediatric mandibular fractures.

PubMed

Binahmed, Abdulaziz; Sansalone, Claudio; Garbedian, Justin; Sándor, George K B

2007-01-01

Maxillofacial fractures are uncommon in the pediatric population, and their treatment is unique due to the psychological, physiological, developmental and anatomical characteristics of children. We present the case of a boy who was treated in an outpatient dental clinic using a lingual splint for the reduction, stabilization and fixation of a mandibular body fracture. This technique is a reliable, noninvasive procedure that dentists may consider in selected cases by referral to an oral and maxillofacial surgeon. It also limits the discomfort and morbidity that can be associated with maxillomandibular fixation or open reduction and internal fixation in pediatric patients.

Palliative care for adolescents and young adults with cancer

PubMed Central

Rosenberg, Abby R; Wolfe, Joanne

2017-01-01

Adolescents and young adults (AYAs) with cancer represent a unique and challenging group of patients with distinct developmental and psychosocial needs that may be unrecognized or unmet during their cancer experience. Palliative care refers to the total care of a patient, regardless of his or her disease status, and aims to improve quality of life by controlling symptoms and alleviating physical, social, psychological, and spiritual suffering. Integrating palliative care into standard oncology practice for AYAs is therefore valuable, if not imperative, in improving their overall cancer experience. In this review, we aimed to describe the scope, benefits, and challenges of palliative care for AYA oncology patients. We provide a broad impression of the existing literature describing or investigating palliative care in this population. Put together, the evidence suggests that palliative care is not only needed, but can also be critically beneficial to patients, families, and health care professionals alike. As we increase public and professional awareness of the needs and applications of palliative care for AYA patients with cancer, we will ultimately enable better psychosocial outcomes of the AYA patients and their larger communities. PMID:21523753

The clinical effects of music therapy in palliative medicine.

PubMed

Gallagher, Lisa M; Lagman, Ruth; Walsh, Declan; Davis, Mellar P; Legrand, Susan B

2006-08-01

This study was to objectively assess the effect of music therapy on patients with advanced disease. Two hundred patients with chronic and/or advanced illnesses were prospectively evaluated. The effects of music therapy on these patients are reported. Visual analog scales, the Happy/Sad Faces Assessment Tool, and a behavior scale recorded pre- and post-music therapy scores on standardized data collection forms. A computerized database was used to collect and analyze the data. Utilizing the Wilcoxon signed rank test and a paired t test, music therapy improved anxiety, body movement, facial expression, mood, pain, shortness of breath, and verbalizations. Sessions with family members were also evaluated, and music therapy improved families' facial expressions, mood, and verbalizations. All improvements were statistically significant (P<0.001). Most patients and families had a positive subjective and objective response to music therapy. Objective data were obtained for a large number of patients with advanced disease. This is a significant addition to the quantitative literature on music therapy in this unique patient population. Our results suggest that music therapy is invaluable in palliative medicine.

The re-identification risk of Canadians from longitudinal demographics

PubMed Central

2011-01-01

Background The public is less willing to allow their personal health information to be disclosed for research purposes if they do not trust researchers and how researchers manage their data. However, the public is more comfortable with their data being used for research if the risk of re-identification is low. There are few studies on the risk of re-identification of Canadians from their basic demographics, and no studies on their risk from their longitudinal data. Our objective was to estimate the risk of re-identification from the basic cross-sectional and longitudinal demographics of Canadians. Methods Uniqueness is a common measure of re-identification risk. Demographic data on a 25% random sample of the population of Montreal were analyzed to estimate population uniqueness on postal code, date of birth, and gender as well as their generalizations, for periods ranging from 1 year to 11 years. Results Almost 98% of the population was unique on full postal code, date of birth and gender: these three variables are effectively a unique identifier for Montrealers. Uniqueness increased for longitudinal data. Considerable generalization was required to reach acceptably low uniqueness levels, especially for longitudinal data. Detailed guidelines and disclosure policies on how to ensure that the re-identification risk is low are provided. Conclusions A large percentage of Montreal residents are unique on basic demographics. For non-longitudinal data sets, the three character postal code, gender, and month/year of birth represent sufficiently low re-identification risk. Data custodians need to generalize their demographic information further for longitudinal data sets. PMID:21696636

Multidisciplinary care considerations for gender nonconforming adolescents with eating disorders: A case series.

PubMed

Donaldson, Abigail A; Hall, Allison; Neukirch, Jodie; Kasper, Vania; Simones, Shannon; Gagnon, Sherry; Reich, Steven; Forcier, Michelle

2018-05-01

Gender nonconforming youth are at risk for body dissatisfaction and disordered eating. Currently, only a small body of literature addresses this high-risk group. The five cases in this series highlight important themes for this patient population from an interdisciplinary perspective. Identified themes include increased risk for self-harm/suicide, complex psychiatric, and medical implications of delay to treatment for either gender dysphoria or disordered eating, and the importance of collaborative management to maximize care and facilitate healthy development to adulthood. The purpose of this case series is to expand the interdisciplinary discussion regarding the breadth of presentation and management considerations for gender nonconforming adolescents with disordered eating. An interdisciplinary approach to care might enhance access to comprehensive, collaborative treatment for disordered eating, and gender dysphoria in this unique population. © 2018 Wiley Periodicals, Inc.

Psychosocial needs of ethnic minority, inner-city, pediatric cancer patients.

PubMed

Moody, Karen; Mannix, Margaret M; Furnari, Nicole; Fischer, Judith; Kim, Mimi; Moadel, Alyson

2011-09-01

Limited data are available regarding the psychosocial impact of cancer on families of culturally diverse backgrounds living in medically underserved communities. The unique psychosocial needs of families of children with cancer from an ethnically diverse inner-city population is the focus of this study. The prevalence of psychosocial needs among a multi-cultural, inner-city sample of children and adolescents with cancer and their parents was assessed using a modified version of the Psychosocial Needs Assessment Survey. All patients were recruited from the Children's Hospital at Montefiore located in Bronx, NY, a designated medically underserved community. Seventy-eight percent of parents reported unmet informational needs. The three most commonly endorsed informational needs by parents and children were regarding dietary management of acute side effects, late effects of having cancer and secondary cancer prevention. Less educated parents reported greater unmet supportive, practical, and spiritual needs than those with more education. Fathers had greater informational and practical needs than mothers and younger parents had more practical needs than older parents. Endorsement of spiritual needs was lower for both children and parents compared with supportive, informational, or practical needs. Given the high prevalence of reported unmet informational needs, efforts should be made to provide patients and families with education tailored to their informational needs and level of education. This population may benefit from psychoeducational interventions, including community-based informational and peer support groups. Such interventions may augment efforts to lessen health gaps experienced in this population.

Life-span perspective of personality in dementia.

PubMed

Kolanowski, A M; Whall, A L

1996-01-01

To propose an alternative view of personality change in dementia by presenting existing evidence for the continuity of personality. As the population continues to age, dementing illnesses will account for a greater proportion of morbidity and mortality; the care of these people will have a significant effect on the health care system. Life-span perspective of personality continuity. SCOPE METHOD: Review of current literature on personality in dementia using Medline, 1980-1994; CINAHL, 1990-1994; and Psych Lit., 1980-1994. Although there are systematic shifts in personality with dementia, individuals tend to maintain their unique pattern of premorbid personality traits. The personalities of dementia patients seem to reflect adaptive patterns that served them in the past. Use of a life-span perspective can enhance individualized care for demented patients and advance theory development.

Minimal invasive treatments for liver malignancies.

PubMed

Orsi, Franco; Varano, Gianluca

2015-11-01

Minimal invasive therapies have proved useful in the management of primary and secondary hepatic malignancies. The most relevant aspects of all these therapies are their minimal toxicity profiles and highly effective tumor responses without affecting the normal hepatic parenchyma. These unique characteristics coupled with their minimally invasive nature provide an attractive therapeutic option for patients who previously may have had few alternatives. Combination of these therapies might extend indications to bring curative treatment to a wider selected population. The results of various ongoing combination trials of intraarterial therapies with targeted therapies are awaited to further improve survival in this patient group. This review focuses on the application of ablative and intra-arterial therapies in the management of hepatocellular carcinoma and hepatic colorectal metastasis. Copyright © 2015 Elsevier B.V. All rights reserved.

Gonadotropin-Dependent Precocious Puberty: Neoplastic Causes and Endocrine Considerations

PubMed Central

2011-01-01

Premature activation of the hypothalamic-pituitary-gonadal (HPG) axis manifests as gonadotropin-dependent precocious puberty. The mechanisms behind HPG activation are complex and a clear etiology for early activation is often not elucidated. Though collectively uncommon, the neoplastic and developmental causes of gonadotropin-dependent precocious puberty are very important to consider, as a delay in diagnosis may lead to adverse patient outcomes. The intent of the current paper is to review the neoplastic and developmental causes of gonadotropin-dependent precocious puberty. We discuss the common CNS lesions and human chorionic gonadotropin-secreting tumors that cause sexual precocity, review the relationship between therapeutic radiation and gonadotropin-dependent precocious puberty, and finally, provide an overview of the therapies available for height preservation in this unique patient population. PMID:21603196

Considerations for planning and conducting clinic-based research in physical therapy.

PubMed

Fitzgerald, G K; Delitto, A

2001-08-01

There is growing demand to increase the volume of clinic-based research in physical therapy. Special considerations, unique to the planning and conduct of clinic-based research, need to be addressed to increase the likelihood that these studies will be completed successfully. The purposes of this perspective are to discuss factors affecting clinic-based research and to offer suggestions for addressing these problems when designing and conducting research studies in a clinical setting. This perspective discusses issues such as patient management, determining the availability of target patient populations, acquiring support from physical therapists and physicians, reporting and managing research-related injury or illness, and modifying or terminating projects. Some of the points made in this perspective are illustrated using examples from the authors' experiences in conducting clinical research.

Garrison Institute on Aging: A New Hope for Elderly Individuals and Patients with Alzheimer’s Disease

PubMed Central

Reddy, P. Hemachandra; Blackmon, Joan; Molinar-Lopez, Veronica; Ament, Clay; Manczak, Maria; Kandimalla, Ramesh; Yin, Xianglin; Pandey, Akhilesh; Kuruva, Chandra Sekhar; Wang, Rui; Fry, David; Osborn, Carrah; Stonum, Kathleen; Quesada, Kandi; Gonzales, Ruben; Boles, Annette

2016-01-01

The Garrison Institute on Aging (GIA) is an established institute within Texas Tech University Health Sciences Center, whose mission is to promote healthy aging through cutting-edge research on Alzheimer’s disease (AD) and other diseases of aging through innovative educational opportunities for students, clinicians, researchers, health care professionals, and the public. The GIA has multiple programs, including both research and education on healthy aging and AD, community outreach, caregiving, the Retired Senior Volunteer Program, Healthy Lubbock, the GIA Brain Bank, healthy aging seminars, research seminars, and collaborations and scholarships. The GIA programs connect basic and clinical researchers and health care professionals, and provide a unique environment to help our growing elderly population and patients with AD and their families. PMID:26402018

In-Hospital Ischemic Stroke

PubMed Central

2015-01-01

Between 2.2% and 17% of all strokes have symptom onset during hospitalization in a patient originally admitted for another diagnosis or procedure. These in-hospital strokes represent a unique population with different risk factors, more mimics, and substantially worsened outcomes compared to community-onset strokes. The fact that these strokes manifest during the acute care hospitalization, in patients with higher rates of thrombolytic contraindications, creates distinct challenges for treatment. However, the best evidence suggests benefit to treating appropriately selected in-hospital ischemic strokes with thrombolysis. Evidence points toward a “quality gap” for in-hospital stroke with longer in-hospital delays to evaluation and treatment, lower rates of evaluation for etiology, and decreased adherence to consensus quality process measures of care. This quality gap for in-hospital stroke represents a focused opportunity for quality improvement. PMID:26288675

Stem cell applications in military medicine.

PubMed

Christopherson, Gregory T; Nesti, Leon J

2011-10-19

There are many similarities between health issues affecting military and civilian patient populations, with the exception of the relatively small but vital segment of active soldiers who experience high-energy blast injuries during combat. A rising incidence of major injuries from explosive devices in recent campaigns has further complicated treatment and recovery, highlighting the need for tissue regenerative options and intensifying interest in the possible role of stem cells for military medicine. In this review we outline the array of tissue-specific injuries typically seen in modern combat - as well as address a few complications unique to soldiers--and discuss the state of current stem cell research in addressing each area. Embryonic, induced-pluripotent and adult stem cell sources are defined, along with advantages and disadvantages unique to each cell type. More detailed stem cell sources are described in the context of each tissue of interest, including neural, cardiopulmonary, musculoskeletal and sensory tissues, with brief discussion of their potential role in regenerative medicine moving forward. Additional commentary is given to military stem cell applications aside from regenerative medicine, such as blood pharming, immunomodulation and drug screening, with an overview of stem cell banking and the unique opportunity provided by the military and civilian overlap of stem cell research.

Unique Features of Ethnic Mongolian Gut Microbiome revealed by metagenomic analysis.

PubMed

Liu, Wenjun; Zhang, Jiachao; Wu, Chunyan; Cai, Shunfeng; Huang, Weiqiang; Chen, Jing; Xi, Xiaoxia; Liang, Zebin; Hou, Qiangchuan; Zhou, Bing; Qin, Nan; Zhang, Heping

2016-10-06

The human gut microbiota varies considerably among world populations due to a variety of factors including genetic background, diet, cultural habits and socioeconomic status. Here we characterized 110 healthy Mongolian adults gut microbiota by shotgun metagenomic sequencing and compared the intestinal microbiome among Mongolians, the Hans and European cohorts. The results showed that the taxonomic profile of intestinal microbiome among cohorts revealed the Actinobaceria and Bifidobacterium were the key microbes contributing to the differences among Mongolians, the Hans and Europeans at the phylum level and genus level, respectively. Metagenomic species analysis indicated that Faecalibacterium prausnitzii and Coprococcus comeswere enrich in Mongolian people which might contribute to gut health through anti-inflammatory properties and butyrate production, respectively. On the other hand, the enriched genus Collinsella, biomarker in symptomatic atherosclerosis patients, might be associated with the high morbidity of cardiovascular and cerebrovascular diseases in Mongolian adults. At the functional level, a unique microbial metabolic pathway profile was present in Mongolian's gut which mainly distributed in amino acid metabolism, carbohydrate metabolism, energy metabolism, lipid metabolism, glycan biosynthesis and metabolism. We can attribute the specific signatures of Mongolian gut microbiome to their unique genotype, dietary habits and living environment.

Physiological and Psychological Challenges of Increasing Physical Activity and Exercise in Patients at Risk of Diabetic Foot Ulcers: A Critical Review

PubMed Central

Crews, Ryan T.; Schneider, Kristin L.; Yalla, Sai V.; Reeves, Neil D.; Vileikyte, Loretta

2017-01-01

Obesity and a sedentary lifestyle are common challenges among individuals at risk of diabetic foot ulcers (DFUs). While substantial research exists on physical activity interventions in adults with diabetes, those at greatest risk for foot ulceration were often excluded or not well-represented. Both at-risk patients and their clinicians may be hesitant to increase physical activity due to their perception of DFU risks. Physical activity is not contraindicated for those at risk of DFU, yet patients at risk present with unique barriers to initiating increases in physical activity. This review focuses upon the physiological and psychological challenges of increasing physical activity and exercise in patients at risk of DFUs. Offloading, diabetic peripheral neuropathy, depression, pain, self-efficacy and social support, DFU risk-specific beliefs and emotions, and research to date on exercise interventions in this population are all discussed. Additionally, recommendations for implementing and researching physical activity interventions for individuals at risk for DFU are provided. PMID:27155091

Anesthesia and the pediatric cardiac catheterization suite: a review.

PubMed

Lam, Jennifer E; Lin, Erica P; Alexy, Ryan; Aronson, Lori A

2015-02-01

Advances in technology over the last couple of decades have caused a shift in pediatric cardiac catheterization from a primary focus on diagnostics to innovative therapeutic interventions. These improvements allow patients a wider range of nonsurgical options for treatment of congenital heart disease. However, these therapeutic modalities can entail higher risk in an already complex patient population, compounded by the added challenges inherent to the environment of the cardiac catheterization suite. Anesthesiologists caring for children with congenital heart disease must understand not only the pathophysiology of the disease but also the effects the anesthetics and interventions have on the patient in order to provide a safe perioperative course. It is the aim of this article to review the latest catheterization modalities offered to patients with congenital heart disease, describe the unique challenges presented in the cardiac catheterization suite, list the most common complications encountered during catheterization and finally, to review the literature regarding different anesthetic drugs used in the catheterization lab. © 2014 John Wiley & Sons Ltd.

Innovative approach to patient-centered care coordination in primary care practices.

PubMed

Clarke, Robin; Bharmal, Nazleen; Di Capua, Paul; Tseng, Chi-Hong; Mangione, Carol M; Mittman, Brian; Skootsky, Samuel A

2015-09-01

Although care coordination is an essential component of the patient-centered medical home structure, current case manager models have limited usefulness to population health because they typically serve a small group of patients defined based on disease or utilization. Our objective was to support our health system's population health by implementing and evaluating a program that embedded nonlicensed coordinators within our primary care practices to support physicians in executing care plans and communicating with patients. Matched case-control differences-in-differences. Comprehensive care coordinators (CCC) were introduced into 14 of the system's 28 practice sites in 2 waves. After a structured training program, CCCs identified, engaged, and intervened among patients within the practice in conjunction with practice primary care providers. We counted and broadly coded CCC activities that were documented in the intervention database. We examined the impact of CCC intervention on emergency department (ED) utilization at the practice level using a negative binomial multivariate regression model controlling for age, gender, and medical complexity. CCCs touched 10,500 unique patients over a 1-year period. CCC interventions included execution of care (38%), coordination of transitions (32%), self-management support/link to community resources (15%), monitor and follow-up (10%), and patient assessment (1%). The CCC intervention group had a 20% greater reduction in its prepost ED visit rate compared with the control group (P < .0001). Our CCC intervention demonstrated a significant reduction in ED visits by focusing on the centrality of the primary care provider and practice. Our model may serve as a cost-effective and scalable alternative for care coordination in primary care.

Sleep-Wake Functioning Along the Cancer Continuum: Focus Group Results From the Patient-Reported Outcomes Measurement Information System (PROMIS™)

PubMed Central

Flynn, Kathryn E.; Shelby, Rebecca A.; Mitchell, Sandra A.; Fawzy, Maria R.; Hardy, N. Chantelle; Husain, Aatif M.; Keefe, Francis J.; Krystal, Andrew D.; Porter, Laura S.; Reeve, Bryce B.; Weinfurt, Kevin P.

2009-01-01

Objective Cancer and its treatments disturb sleep-wake functioning; however, there is little information available on the characteristics and consequences of sleep problems associated with cancer. As part of an effort to improve measurement of sleep-wake functioning, we explored the scope of difficulties with sleep in a diverse group of patients diagnosed with cancer. Methods We conducted 10 focus groups with patients recruited from the Duke University tumor registry and oncology/hematology clinics. Separate groups were held with patients scheduled to begin or currently undergoing treatment for breast, prostate, lung, colorectal, hematological, and other cancer types and with patients who were in posttreatment follow-up. The content of the focus group discussions was transcribed and analyzed for major themes by independent coders. Results Participants reported causes of sleep disturbance common in other populations, such as pain and restless legs, but they also reported causes that may be unique to cancer populations, including abnormal dreams, anxiety about cancer diagnosis and recurrence, night sweats, and problems with sleep positioning. Many participants felt that sleep problems reduced their productivity, concentration, social interactions, and overall quality of life. Many also shared beliefs about the increased importance of sleep when fighting cancer. Conclusions The findings underscore the need for interventions that minimize the negative impact of cancer and its treatments on sleep. This study will inform efforts now underway to develop a patient-reported measure of sleep-wake functioning that reflects the breadth of concepts considered important by patients with cancer. PMID:20013938

A Comparison of Methods for Capturing Patient Preferences for Delivery of Mental Health Services to Low-Income Hispanics Engaged in Primary Care.

PubMed

Herman, Patricia M; Ingram, Maia; Cunningham, Charles E; Rimas, Heather; Murrieta, Lucy; Schachter, Kenneth; de Zapien, Jill Guernsey; Carvajal, Scott C

2016-08-01

Consideration of patient preferences regarding delivery of mental health services within primary care may greatly improve access and quality of care for the many who could benefit from those services. This project evaluated the feasibility and usefulness of adding a consumer-products design method to qualitative methods implemented within a community-based participatory research (CBPR) framework. Discrete-choice conjoint experiment (DCE) added to systematic focus group data collection and analysis. Focus group data were collected from 64 patients of a Federally-Qualified Health Center (FQHC) serving a predominantly low-income Hispanic population. A total of 604 patients in the waiting rooms of the FQHC responded to the DCE. The DCE contained 15 choice tasks that each asked respondents to choose between three mental health services options described by the levels of two (of eight) attributes based on themes that emerged from focus group data. The addition of the DCE was found to be feasible and useful in providing distinct information on relative patient preferences compared with the focus group analyses alone. According to market simulations, the package of mental health services guided by the results of the DCE was preferred by patients. Unique patterns of patient preferences were uncovered by the DCE and these findings were useful in identifying pragmatic solutions to better address the mental health service needs of this population. However, for this resource-intensive method to be adopted more broadly, the scale of the primary care setting and/or scope of the issue addressed have to be relatively large.

Meaning and challenges in the practice of multiple therapeutic massage modalities: a combined methods study.

PubMed

Porcino, Antony J; Boon, Heather S; Page, Stacey A; Verhoef, Marja J

2011-09-20

Therapeutic massage and bodywork (TMB) practitioners are predominantly trained in programs that are not uniformly standardized, and in variable combinations of therapies. To date no studies have explored this variability in training and how this affects clinical practice. Combined methods, consisting of a quantitative, population-based survey and qualitative interviews with practitioners trained in multiple therapies, were used to explore the training and practice of TMB practitioners in Alberta, Canada. Of the 5242 distributed surveys, 791 were returned (15.1%). Practitioners were predominantly female (91.7%), worked in a range of environments, primarily private (44.4%) and home clinics (35.4%), and were not significantly different from other surveyed massage therapist populations. Seventy-seven distinct TMB therapies were identified. Most practitioners were trained in two or more therapies (94.4%), with a median of 8 and range of 40 therapies. Training programs varied widely in number and type of TMB components, training length, or both. Nineteen interviews were conducted. Participants described highly variable training backgrounds, resulting in practitioners learning unique combinations of therapy techniques. All practitioners reported providing individualized patient treatment based on a responsive feedback process throughout practice that they described as being critical to appropriately address the needs of patients. They also felt that research treatment protocols were different from clinical practice because researchers do not usually sufficiently acknowledge the individualized nature of TMB care provision. The training received, the number of therapies trained in, and the practice descriptors of TMB practitioners are all highly variable. In addition, clinical experience and continuing education may further alter or enhance treatment techniques. Practitioners individualize each patient's treatment through a highly adaptive process. Therefore, treatment provision is likely unique to each practitioner. These results may be of interest to researchers considering similar practice issues in other professions. The use of a combined-methods design effectively captured this complexity of TMB practice. TMB research needs to consider research approaches that can capture or adapt to the individualized nature of practice.

Societal costs of diabetes mellitus in Denmark.

PubMed

Sortsø, C; Green, A; Jensen, P B; Emneus, M

2016-07-01

To provide comprehensive real-world evidence on societal diabetes-attributable costs in Denmark. National register data are linked on an individual level through unique central personal registration numbers in Denmark. All patients in the Danish National Diabetes Register in 2011 (N = 318 729) were included in this study. Complication status was defined according to data from the Danish National Hospital Register. Diabetes-attributable costs were calculated as the difference between costs of patients with diabetes and the expected costs given the annual resource consumption of the diabetes-free population. Societal costs attributable to diabetes were estimated to be at least 4.27 billion EUR in 2011, corresponding to 14,349 EUR per patient-year. A twofold higher healthcare resource usage was found for patients with diabetes as compared with the diabetes-free population. Attributable costs, grouped according to different components, were 732 million EUR for primary and secondary care services, 153 million EUR for pharmaceutical drugs, 851 million EUR for nursing services, 1.77 billion EUR in lost productivity and 761 million EUR for additional costs. A steep increase in diabetes-attributable costs was found for patients with major complications compared with patients without complications across all cost components. For attributable healthcare costs this increase was estimated to be 6,992 EUR per person-year after controlling for potential confounders. Nearly half of the total costs of patients with diabetes can be attributed directly to their diabetes. The majority of costs are incurred among patients with major complications pointing to the importance of secondary preventive efforts among patients with diabetes. © 2015 The Authors. Diabetic Medicine published by John Wiley & Sons Ltd on behalf of Diabetes UK.

Treatment patterns, clinical outcomes and health care costs associated with HER2-positive breast cancer with central nervous system metastases: a French multicentre observational study.

PubMed

Baffert, Sandrine; Cottu, Paul; Kirova, Youlia M; Mercier, Florence; Simondi, Cécile; Bachelot, Thomas; Le Rhun, Emilie; Levy, Christelle; Gutierrez, Maya; Madranges, Nicolas; Moldovan, Cristian; Coudert, Bruno; Spaëth, Dominique; Serin, Daniel; Cotté, François-Emery; Benjamin, Laure; Maillard, Cathie; Laulhere-Vigneau, Sabine; Durand-Zaleski, Isabelle

2013-10-31

The population of patients with human epidermal growth factor receptor 2 (HER2)-positive breast cancer (BC) who develop central nervous system (CNS) metastases is growing. Treatment strategies in this population are highly diverse. The objective of the study was to assess health care costs for the management of HER2 positive BC with CNS metastases. This multicentre, retrospective, observational study was conducted on HER2-positive BC patients diagnosed with CNS metastases between 2006 and 2008. Data were extracted from patient medical records to estimate health care resource use. A partitioned estimator was used to adjust censoring costs by use of the Kaplan-Meier survival estimate. 218 patients were included and costs were estimated for 200 patients. The median time to detection of CNS metastases was 37.6 months. The first metastatic event involved the CNS in 39 patients, and this was the unique first metastatic site in 31 of these patients. Two years following diagnosis of CNS metastases, 70.3% of patients had died. The mean per capita cost of HER2-positive BC with CNS metastases in the first year following diagnosis was €35,735 [95% CI: 31,716-39,898]. The proportion of costs attributed to expensive drugs and those arising from hospitalisation were in the same range. A range of individualised disease management strategies are used in HER2-positive BC patients with CNS metastases and the treatments used in the first months following diagnosis are expensive. The understanding of cost drivers may help optimise healthcare expenditure and inform the development of appropriate prevention policies.

Gender differences in Latin-American patients with rheumatoid arthritis.

PubMed

Barragán-Martínez, Carolina; Amaya-Amaya, Jenny; Pineda-Tamayo, Ricardo; Mantilla, Rubén D; Castellanos-de la Hoz, Juan; Bernal-Macías, Santiago; Rojas-Villarraga, Adriana; Anaya, Juan-Manuel

2012-12-01

Data on the effect of gender in rheumatoid arthritis (RA) in non-Caucasian populations is scarce. Latin America and the Caribbean (LAC) is a large population with unique characteristics, including high admixture. Our aim was to examine the effect of gender in patients with RA in LAC. This was a 2-phase study. First we conducted a cross-sectional and analytical study in which 1128 consecutive Colombian patients with RA were assessed. Second, a systematic review of the literature was done to evaluate the effect of gender in LAC patients with RA. Our results show a high prevalence of RA in LAC women with a ratio of 5.2 women per man. Colombian women with RA are more at risk of having an early age at onset and developing polyautoimmunity and abdominal obesity, and they perform more household duties than their male counterparts. However, male gender was associated with the presence of extra-articular manifestations. Of a total of 641 potentially relevant articles, 38 were considered for final analysis, in which several factors and outcomes related to gender were identified. RA in LAC women is not only more common but presents with some clinical characteristics that differ from RA presentation in men. Some of those characteristics could explain the high rates of disability and worse prognosis observed in women with RA in LAC. Copyright © 2012 Elsevier HS Journals, Inc. All rights reserved.

A Novel Admixture-Based Pharmacogenetic Approach to Refine Warfarin Dosing in Caribbean Hispanics

PubMed Central

Claudio-Campos, Karla; Rivera-Miranda, Giselle; Bermúdez-Bosch, Luis; Renta, Jessicca Y.; Cadilla, Carmen L.; Cruz, Iadelisse; Feliu, Juan F.; Vergara, Cunegundo; Ruaño, Gualberto

2016-01-01

Aim This study is aimed at developing a novel admixture-adjusted pharmacogenomic approach to individually refine warfarin dosing in Caribbean Hispanic patients. Patients & Methods A multiple linear regression analysis of effective warfarin doses versus relevant genotypes, admixture, clinical and demographic factors was performed in 255 patients and further validated externally in another cohort of 55 individuals. Results The admixture-adjusted, genotype-guided warfarin dosing refinement algorithm developed in Caribbean Hispanics showed better predictability (R2 = 0.70, MAE = 0.72mg/day) than a clinical algorithm that excluded genotypes and admixture (R2 = 0.60, MAE = 0.99mg/day), and outperformed two prior pharmacogenetic algorithms in predicting effective dose in this population. For patients at the highest risk of adverse events, 45.5% of the dose predictions using the developed pharmacogenetic model resulted in ideal dose as compared with only 29% when using the clinical non-genetic algorithm (p<0.001). The admixture-driven pharmacogenetic algorithm predicted 58% of warfarin dose variance when externally validated in 55 individuals from an independent validation cohort (MAE = 0.89 mg/day, 24% mean bias). Conclusions Results supported our rationale to incorporate individual’s genotypes and unique admixture metrics into pharmacogenetic refinement models in order to increase predictability when expanding them to admixed populations like Caribbean Hispanics. Trial Registration ClinicalTrials.gov NCT01318057 PMID:26745506

Microbiology of tunnelled catheter-related infections in a multi-ethnic South-east Asian patient population.

PubMed

Teo, Boon Wee; Sau, Po Yi; Xu, Hui; Ma, Valerie; Vathsala, A; Lee, Evan J C

2011-01-01

Clinical practice guidelines recommend empiric antibiotic therapy for suspected tunnelled haemodialysis catheter-related infections (CRI), and the choice of antibiotics should be adjusted according to the local microbiological profile and antimicrobial sensitivities. We aim to describe the microbiology, antibiotic sensitivities, and clinical outcomes of CRI with tunnelled haemodialysis catheters in a multi-ethnic South-East Asian population. Using a prospective vascular access registry, we identified 99 patients who had catheters removed for suspected or confirmed CRI (50.5% male, mean age 56.9 years) from January 1, 2007, till May 2009. We retrospectively retrieved microbiology, mortality and echocardiography data from the hospital electronic databases. There were 115 removal-unique cultures that yielded 75.7% Gram-positive and 24.3% Gram-negative isolates (15 removals were polymicrobial). Organisms isolated were methicillin-resistant Staphylococcus aureus (MRSA) 28.6%, methicillin-sensitive S. aureus 26.5%, coagulase-negative staphylococci 21.4%, Pseudomonas aeruginosa 10.2%, and others. Out of 8 patients who died, 7 had MRSA. Risk factors associated with mortality were Chinese race (p = 0.03), MRSA infection (p < 0.001), and older age (p < 0.001). Gram-positive isolates accounted for most tunnelled CRI and MRSA was highly associated with death. In sick patients presenting with suspected CRI, the preferred empiric antibiotic regimen should include agents active against both MRSA and P. aeruginosa. Copyright © 2010 S. Karger AG, Basel.

One hand cannot clap-a study of Arab practitioners of traditional and complementary medicine in Israel: identifying barriers to integrative oncology care.

PubMed

Popper-Giveon, Ariela; Schiff, Elad; Hatem, David; Samuels, Noah; Ben-Arye, Eran

2014-01-01

The integration of complementary medicine is gradually becoming an accepted part of standard care for patients with cancer. In our integrative oncology program, we have encountered difficulties in recruiting Arab patients. In order to understand the special needs of this population, we conducted interviews among Arab practitioners of complementary and traditional medicine (CTM). The characteristics of practitioners and their views regarding the therapeutic process were examined. Semi-structured qualitative interviews were administered to 27 Arab practitioners of CTM whose clientele was comprised primarily of Arab cancer patients. Conventional content analysis of the transcribed interviews and field notes was performed in order to identify key themes. Three groups of CTM practice were identified: Folk-herbal medicine (n = 9), complementary medicine (CM; n = 14), and religious healing (n = 4). Seven factors were identified in the practitioner accounts: the duration and scheduling of treatment sessions, the language of communication, the presence of family members, the appearance of the practitioner, the definition of treatment goals, the discussion of behavioral and lifestyle changes, and finally, the use of tangible elements in treatment. The study of Arab CTM practitioner recommendations may help facilitate a culture-sensitive encounter with Arab patients with cancer. This approach may also have implications for other ethno-culturally unique populations. Copyright © 2014 Elsevier Inc. All rights reserved.

Analysis of leukotrienes in cerebrospinal fluid of a reference population and patients with inborn errors of metabolism: further evidence for a pathognomonic profile in LTC(4)-synthesis deficiency.

PubMed

Mayatepek, E; Zelezny, R; Hoffmann, G F

2000-02-25

Cysteinyl leukotrienes (LTC(4), LTD(4), LTE(4)) are potent lipid mediators derived from arachidonate in the 5-lipoxygenase pathway. Recently, the first inborn error of leukotriene synthesis, LTC(4)-synthesis deficiency, has been identified in association with a fatal developmental syndrome. The absence of leukotrienes in cerebrospinal fluid was one of the most striking biochemical findings in this disorder. We analysed leukotrienes in cerebrospinal fluid of patients with a broad spectrum of other well-defined inborn errors of metabolism, including glutathione synthetase deficiency (n=2), Zellweger syndrome (n=3), mitochondrial disorders (n=8), fatty acid oxidation defects (n=7), organic acidurias (n=7), neurotransmitter defects (n=5) and patients with non-specific neurological symptoms, as a reference population (n=120). The concentrations of leukotrienes were not related to age. Representative percentiles were calculated as reference intervals of each leukotriene. In all patients with an inborn error of metabolism concentration of cysteinyl leukotrienes and LTB(4) did not differ from the reference group. Our results indicate that absence of cysteinyl leukotrienes (<5 pg/ml) in association with normal or increased LTB(4) (50.0-67.3 pg/ml) is pathognomonic for LTC(4)-synthesis deficiency. The unique profile of leukotrienes in cerebrospinal fluid in this new disorder is primarily related to the defect and represents a new diagnostic approach.

Evaluation of a Progressive Mobility Protocol in Postoperative Cardiothoracic Surgical Patients.

PubMed

Floyd, Shawn; Craig, Sarah W; Topley, Darla; Tullmann, Dorothy

2016-01-01

Cardiothoracic surgical patients are at high risk for complications related to immobility, such as increased intensive care and hospital length of stay, intensive care unit readmission, pressure ulcer development, and deep vein thrombosis/pulmonary embolus. A progressive mobility protocol was started in the thoracic cardiovascular intensive care unit in a rural academic medical center. The purpose of the progressive mobility protocol was to increase mobilization of postoperative patients and decrease complications related to immobility in this unique patient population. A matched-pairs design was used to compare a randomly selected sample of the preintervention group (n = 30) to a matched postintervention group (n = 30). The analysis compared outcomes including intensive care unit and hospital length of stay, intensive care unit readmission occurrence, pressure ulcer prevalence, and deep vein thrombosis/pulmonary embolism prevalence between the 2 groups. Although this comparison does not achieve statistical significance (P < .05) for any of the outcomes measured, it does show clinical significance in a reduction in hospital length of stay, intensive care unit days, in intensive care unit readmission rate, and a decline in pressure ulcer prevalence, which is the overall goal of progressive mobility. This study has implications for nursing, hospital administration, and therapy services with regard to staffing and cost savings related to fewer complications of immobility. Future studies with a larger sample size and other populations are warranted.

Population dynamics and angler exploitation of the unique muskellunge population in Shoepack Lake, Voyageurs National Park, Minnesota

USGS Publications Warehouse

Frohnauer, N.K.; Pierce, C.L.; Kallemeyn, L.W.

2007-01-01

A unique population of muskellunge Esox masquinongy inhabits Shoepack Lake in Voyageurs National Park, Minnesota. Little is known about its status, dynamics, and angler exploitation, and there is concern for the long-term viability of this population. We used intensive sampling and mark-recapture methods to quantify abundance, survival, growth, condition, age at maturity and fecundity and angler surveys to quantify angler pressure, catch rates, and exploitation. During our study, heavy rain washed out a dam constructed by beavers Castor canadensis which regulates the water level at the lake outlet, resulting in a nearly 50% reduction in surface area. We estimated a population size of 1,120 adult fish at the beginning of the study. No immediate reduction in population size was detected in response to the loss of lake area, although there was a gradual, but significant, decline in population size over the 2-year study. Adults grew less than 50 mm per year, and relative weight (W r) averaged roughly 80. Anglers were successful in catching, on average, two fish during a full day of angling, but harvest was negligible. Shoepack Lake muskellunge exhibit much slower growth rates and lower condition, but much higher densities and angler catch per unit effort (CPUE), than other muskellunge populations. The unique nature, limited distribution, and location of this population in a national park require special consideration for management. The results of this study provide the basis for assessing the long-term viability of the Shoepack Lake muskellunge population through simulations of long-term population dynamics and genetically effective population size. ?? Copyright by the American Fisheries Society 2007.

Feature selection for wearable smartphone-based human activity recognition with able bodied, elderly, and stroke patients.

PubMed

Capela, Nicole A; Lemaire, Edward D; Baddour, Natalie

2015-01-01

Human activity recognition (HAR), using wearable sensors, is a growing area with the potential to provide valuable information on patient mobility to rehabilitation specialists. Smartphones with accelerometer and gyroscope sensors are a convenient, minimally invasive, and low cost approach for mobility monitoring. HAR systems typically pre-process raw signals, segment the signals, and then extract features to be used in a classifier. Feature selection is a crucial step in the process to reduce potentially large data dimensionality and provide viable parameters to enable activity classification. Most HAR systems are customized to an individual research group, including a unique data set, classes, algorithms, and signal features. These data sets are obtained predominantly from able-bodied participants. In this paper, smartphone accelerometer and gyroscope sensor data were collected from populations that can benefit from human activity recognition: able-bodied, elderly, and stroke patients. Data from a consecutive sequence of 41 mobility tasks (18 different tasks) were collected for a total of 44 participants. Seventy-six signal features were calculated and subsets of these features were selected using three filter-based, classifier-independent, feature selection methods (Relief-F, Correlation-based Feature Selection, Fast Correlation Based Filter). The feature subsets were then evaluated using three generic classifiers (Naïve Bayes, Support Vector Machine, j48 Decision Tree). Common features were identified for all three populations, although the stroke population subset had some differences from both able-bodied and elderly sets. Evaluation with the three classifiers showed that the feature subsets produced similar or better accuracies than classification with the entire feature set. Therefore, since these feature subsets are classifier-independent, they should be useful for developing and improving HAR systems across and within populations.

Diabetes Resolution and Work Absenteeism After Gastric Bypass: a 6-Year Study.

PubMed

Jönsson, E; Ornstein, P; Goine, H; Hedenbro, J L

2017-09-01

Obesity-related diseases cause costs to society. We studied the cost of work absenteeism before and after gastric bypass and the effects of postoperative diabetes resolution. Data were obtained from the Scandinavian Obesity Surgery Registry (SOReg) (national coverage >98%) and cross-matched with data from the Social insurance Agency (coverage 100%) for the period ±3 years from operation. In 2010, a total of 7454 bariatric surgeries were performed; the study group is 4971 unique individuals with an annual income of >10,750 Euros and complete data sets. A sex-, age-, and income-matched reference population was identified for comparison. Patients with obesity had preoperatively a 3.5-fold higher absenteeism. During follow-up (FU), the ratio relative to the reference population remained constant. An increase of 12-14 net absenteeism days was observed in the first 3 months after surgery. Female sex (OR 1.5, CI 1.13-1.8), preoperative anti-depressant use (OR 1.5, CI 1.3-1.9), low income (OR 1.4, CI 1.2-1.8), and a history of sick leave (OR 1.004, CI 1.003-1.004) were associated with increased absenteeism during FU. Diabetes resolution did not decrease absenteeism from preoperative values. Patients with obesity have higher preoperative absenteeism than the reference population. Operation caused an increase the first 90 days after surgery of 12-13 days. There were no relative increases in absenteeism in the next 3 years; patients did not deviate from preoperative patterns but followed the trend of the reference population. Preoperative diabetes did not elevate that level during FU; diabetes resolution did not lower absenteeism.

Feature Selection for Wearable Smartphone-Based Human Activity Recognition with Able bodied, Elderly, and Stroke Patients

PubMed Central

2015-01-01

Human activity recognition (HAR), using wearable sensors, is a growing area with the potential to provide valuable information on patient mobility to rehabilitation specialists. Smartphones with accelerometer and gyroscope sensors are a convenient, minimally invasive, and low cost approach for mobility monitoring. HAR systems typically pre-process raw signals, segment the signals, and then extract features to be used in a classifier. Feature selection is a crucial step in the process to reduce potentially large data dimensionality and provide viable parameters to enable activity classification. Most HAR systems are customized to an individual research group, including a unique data set, classes, algorithms, and signal features. These data sets are obtained predominantly from able-bodied participants. In this paper, smartphone accelerometer and gyroscope sensor data were collected from populations that can benefit from human activity recognition: able-bodied, elderly, and stroke patients. Data from a consecutive sequence of 41 mobility tasks (18 different tasks) were collected for a total of 44 participants. Seventy-six signal features were calculated and subsets of these features were selected using three filter-based, classifier-independent, feature selection methods (Relief-F, Correlation-based Feature Selection, Fast Correlation Based Filter). The feature subsets were then evaluated using three generic classifiers (Naïve Bayes, Support Vector Machine, j48 Decision Tree). Common features were identified for all three populations, although the stroke population subset had some differences from both able-bodied and elderly sets. Evaluation with the three classifiers showed that the feature subsets produced similar or better accuracies than classification with the entire feature set. Therefore, since these feature subsets are classifier-independent, they should be useful for developing and improving HAR systems across and within populations. PMID:25885272

Patterns of neuroAIDS in Africa.

PubMed

Tadesse, Tizeta; Langford, Dianne; Manji, Karim; Mehari, Enawgaw

2005-01-01

According to UNAIDS, the African population accounts for greater than half of persons infected with HIV. Nevertheless, little information exists characterizing HIV in this population. Thus, the natural history and progression of HIV in the African population is virtually undocumented and therefore, poorly understood. Information regarding virtually every aspect of the disease including microbiology, pathogenicity, virulence, and clinical manifestation is based largely on data from select and limited populations. During the HAART-era, we have seen dramatic and significant changes in patterns of NeuroAIDS in patients in clinical cohorts from the United States and Western Europe. These observations have led to increased understanding of the progression of NeuroAIDS and have improved our ability to design treatment regimens to combat CNS complications resulting from HIV. Despite the existence of antiretroviral therapy for HIV, its absence in Africa along with poor treatments for opportunistic infections associated with HIV have become the main sources of neurological morbidity and mortality. In this context, we are presented with a unique opportunity to cultivate and enhance our understanding of the natural history and progression of NeuroAIDS in the African population thereby, better equipping healthcare providers, patients and their families in addressing this epidemic. This concept is particularly important as rapidly improving and more accessible anti-HIV medications and medications for the treatment of opportunistic infections become available to third world countries such as Africa. We believe that it is imperative to foster research, education and training between institutions in the industrialized world and Africa to close the gap in understanding patterns of NeuroAIDS in Africa.

The cyclophosphamide equivalent dose as an approach for quantifying alkylating agent exposure: a report from the Childhood Cancer Survivor Study.

PubMed

Green, Daniel M; Nolan, Vikki G; Goodman, Pamela J; Whitton, John A; Srivastava, DeoKumar; Leisenring, Wendy M; Neglia, Joseph P; Sklar, Charles A; Kaste, Sue C; Hudson, Melissa M; Diller, Lisa R; Stovall, Marilyn; Donaldson, Sarah S; Robison, Leslie L

2014-01-01

Estimation of the risk of adverse long-term outcomes such as second malignant neoplasms and infertility often requires reproducible quantification of exposures. The method for quantification should be easily utilized and valid across different study populations. The widely used Alkylating Agent Dose (AAD) score is derived from the drug dose distribution of the study population and thus cannot be used for comparisons across populations as each will have a unique distribution of drug doses. We compared the performance of the Cyclophosphamide Equivalent Dose (CED), a unit for quantifying alkylating agent exposure independent of study population, to the AAD. Comparisons included associations from three Childhood Cancer Survivor Study (CCSS) outcome analyses, receiver operator characteristic (ROC) curves and goodness of fit based on the Akaike's Information Criterion (AIC). The CED and AAD performed essentially identically in analyses of risk for pregnancy among the partners of male CCSS participants, risk for adverse dental outcomes among all CCSS participants and risk for premature menopause among female CCSS participants, based on similar associations, lack of statistically significant differences between the areas under the ROC curves and similar model fit values for the AIC between models including the two measures of exposure. The CED is easily calculated, facilitating its use for patient counseling. It is independent of the drug dose distribution of a particular patient population, a characteristic that will allow direct comparisons of outcomes among epidemiological cohorts. We recommend the use of the CED in future research assessing cumulative alkylating agent exposure. © 2013 Wiley Periodicals, Inc.

What is Known About Health and Morbidity in the Pediatric Population of Muslim Bedouins in Southern Israel: A Descriptive Review of the Literature from the Past Two Decades.

PubMed

Treister-Goltzman, Yulia; Peleg, Roni

2015-06-01

The Bedouins comprise one of the ethnic groups in Israeli society. They are Muslims, most of who live in the Negev desert region of southern Israel and live by their unique traditions and customs. At the present they are going through a period of "society in transition", a unique condition that has ramifications for health and morbidity. In recent years the number of publications on the health of Bedouins in the Negev has increased. Recognition of unique socio-economic features, characteristics of health and diseases can help the medical team treat various health problems in this population as well as other populations with similar characteristics. In the present paper we survey and discuss publications on the health of Bedouin children over the past 20 years.

Evaluation of potential kidney donors with the personality assessment inventory: normative data for a unique population.

PubMed

Hurst, Duane F; Locke, Dona E C; Osborne, David

2010-09-01

Many transplant centers require personality assessment and/or psychiatric clearance prior to allowing an individual to donate a kidney. This is a unique cohort for personality assessment, and there is no normative information available for this population on standardized self-report measures such as the Personality Assessment Inventory (PAI). We evaluated a prospective sample of 434 kidney donor candidates with development of normative T-scores relevant to this specific comparison group. Compared to the original normative group from the PAI manual, potential kidney donors are 5-7 T-score points above the mean on PIM, RXR, DOM, and WRM and 4-6 points below the mean on the majority of the remaining scales. Raw score/T score conversion tables are provided. The normative data provided here is meant to supplement the original normative information and aid psychologists in evaluation of this unique medical population.

Equilibrium Strategy and Population-Size Effects in Lowest Unique Bid Auctions

NASA Astrophysics Data System (ADS)

Pigolotti, Simone; Bernhardsson, Sebastian; Juul, Jeppe; Galster, Gorm; Vivo, Pierpaolo

2012-02-01

In lowest unique bid auctions, N players bid for an item. The winner is whoever places the lowest bid, provided that it is also unique. We use a grand canonical approach to derive an analytical expression for the equilibrium distribution of strategies. We then study the properties of the solution as a function of the mean number of players, and compare them with a large data set of internet auctions. The theory agrees with the data with striking accuracy for small population-size N, while for larger N a qualitatively different distribution is observed. We interpret this result as the emergence of two different regimes, one in which adaptation is feasible and one in which it is not. Our results question the actual possibility of a large population to adapt and find the optimal strategy when participating in a collective game.

Multi-drug resistant non-typhoidal Salmonella associated with invasive disease in western Kenya.

PubMed

Akullian, Adam; Montgomery, Joel M; John-Stewart, Grace; Miller, Samuel I; Hayden, Hillary S; Radey, Matthew C; Hager, Kyle R; Verani, Jennifer R; Ochieng, John Benjamin; Juma, Jane; Katieno, Jim; Fields, Barry; Bigogo, Godfrey; Audi, Allan; Walson, Judd

2018-01-01

Non-typhoidal Salmonella (NTS) is a leading cause of bloodstream infections in Africa, but the various contributions of host susceptibility versus unique pathogen virulence factors are unclear. We used data from a population-based surveillance platform (population ~25,000) between 2007-2014 and NTS genome-sequencing to compare host and pathogen-specific factors between individuals presenting with NTS bacteremia and those presenting with NTS diarrhea. Salmonella Typhimurium ST313 and Salmonella Enteritidis ST11 were the most common isolates. Multi-drug resistant strains of NTS were more commonly isolated from patients presenting with NTS bacteremia compared to NTS diarrhea. This relationship was observed in patients under age five [aOR = 15.16, 95% CI (2.84-81.05), P = 0.001], in patients five years and older, [aOR = 6.70 95% CI (2.25-19.89), P = 0.001], in HIV-uninfected patients, [aOR = 21.61, 95% CI (2.53-185.0), P = 0.005], and in patients infected with Salmonella serogroup B [aOR = 5.96, 95% CI (2.28-15.56), P < 0.001] and serogroup D [aOR = 14.15, 95% CI (1.10-182.7), P = 0.042]. Thus, multi-drug-resistant NTS was strongly associated with bacteremia compared to diarrhea among children and adults. This association was seen in HIV-uninfected individuals infected with either S. Typhimurium or S. Enteritidis. Risk of developing bacteremia from NTS infection may be driven by virulence properties of the Salmonella pathogen.

A ten-year review of enterocutaneous fistulas after laparotomy for trauma.

PubMed

Fischer, Peter E; Fabian, Timothy C; Magnotti, Louis J; Schroeppel, Thomas J; Bee, Tiffany K; Maish, George O; Savage, Stephanie A; Laing, Ashley E; Barker, Andrew B; Croce, Martin A

2009-11-01

In the era of open abdomen management, the complication of enterocutaneous fistula (ECF) seems to be increasing in frequency. In nontrauma patients, reported mortality rates are 7% to 20%, and spontaneous closure rates are approximately 25%. This study is the largest series of ECFs reported exclusively caused by trauma and examines the characteristics unique to this population. Trauma patients with an ECF at a single regional trauma center over a 10-year period were reviewed. Parameters studied included fistula output, site, nutritional status, operative history, and fistula resolution (spontaneous vs. operative). Approximately 2,224 patients received a trauma laparotomy and survived longer than 4 days. Of these, 43 patients (1.9%) had ECF. The rate of ECF in men was 2.22% and 0.74% in women. Patients with open abdomen had a higher ECF incidence (8% vs. 0.5%) and lower rate of spontaneous closure (37% vs. 45%). Spontaneous closure occurred in 31% with high-output fistulas, 13% with medium output, and 55% with low output. The mortality rate of ECF was 14% after an average stay of 59 days in the intensive care unit. With damage-control laparotomies, the traumatic ECF rate is increasing and is a different entity than nontraumatic ECF. Although the two populations have similar mortality rates, the trauma cohort demonstrates higher spontaneous closure rates and a curiously higher rate of development in men. Fistula output was not predictive of spontaneous closure.

Improving pathways to primary health care among LGBTQ populations and health care providers: key findings from Nova Scotia, Canada.

PubMed

Gahagan, Jacqueline; Subirana-Malaret, Montse

2018-06-13

This study explores the perceived barriers to primary health care as identified among a sample of Lesbian, Gay, Bisexual, Transgender, and Queer (LGBTQ) identified individuals and health care providers in Nova Scotia, Canada. These findings, based on a province-wide anonymous online survey, suggest that additional efforts are needed to improve pathways to primary health among LGBTQ populations and in deepening our understanding of how to advance the unique primary health needs of these populations. Data were collected from the LGBTQ community through an online, closed-ended anonymous survey. Inclusion criteria for participation were self-identifying as LGBTQ, offering primary health care to LGBTQ patients, being able to understand English, being 16 years of age or older, and having lived in Nova Scotia for at least one year. A total of 283 LGBTQ respondents completed the online survey which included sociodemographic questions, perceptions of respondents' health status, and their primary health care experiences. In addition, a total of 109 health care providers completed the survey based on their experiences providing care in Nova Scotia, and in particular, their experiences and perceptions regarding LGBTQ access to primary health care and physician-patient interactions. Our results indicate that, in several key areas, the primary health care needs of LGBTQ populations in Nova Scotia are not being met and this may in turn contribute to their poor health outcomes across the life course. A framework of intersectionality and health equity was used to interpret and analyze the survey data. The key findings indicate the need to continue improving pathways to primary health care among LGBTQ populations, specifically in relation to additional training and related supports for health care providers who work with these populations.

Understanding health anxiety following breast cancer diagnosis.

PubMed

Jones, Shannon L; Hadjistavropoulos, Heather D; Gullickson, Kirsten

2014-01-01

Health anxiety is a persistent fear of illness or disease that often involves the misinterpretation of bodily symptoms as signs of serious illness. Evidence shows that health anxiety affects a proportion of women following a diagnosis of breast cancer, but there are some limitations to how health anxiety has been measured. The objectives of this study were to (1) provide an estimate of clinically elevated health anxiety in women after a diagnosis of breast cancer using a validated measure appropriate for medical populations and (2) understand patient, disease, and anxiety/vulnerability variables that predict health anxiety in this group. Canadian women (n = 137) diagnosed with breast cancer within the past five years completed an online survey measuring health anxiety, along with patient, disease, and anxiety/vulnerability variables. Clinically significant health anxiety was reported by 23.4% of the sample. The regression model revealed that younger age, more advanced stage of breast cancer, increased cognitive anxiety sensitivity, and greater body vigilance were significant unique predictors of health anxiety. These findings highlight that a proportion of women report substantial health anxiety following breast cancer diagnosis, with a combination of patient, disease, and anxiety/vulnerability variables associated with the experience. Further research is needed to better understand the impact of health anxiety in this population.

A Novel Admixture-Based Pharmacogenetic Approach to Refine Warfarin Dosing in Caribbean Hispanics.

PubMed

Duconge, Jorge; Ramos, Alga S; Claudio-Campos, Karla; Rivera-Miranda, Giselle; Bermúdez-Bosch, Luis; Renta, Jessicca Y; Cadilla, Carmen L; Cruz, Iadelisse; Feliu, Juan F; Vergara, Cunegundo; Ruaño, Gualberto

2016-01-01

This study is aimed at developing a novel admixture-adjusted pharmacogenomic approach to individually refine warfarin dosing in Caribbean Hispanic patients. A multiple linear regression analysis of effective warfarin doses versus relevant genotypes, admixture, clinical and demographic factors was performed in 255 patients and further validated externally in another cohort of 55 individuals. The admixture-adjusted, genotype-guided warfarin dosing refinement algorithm developed in Caribbean Hispanics showed better predictability (R2 = 0.70, MAE = 0.72mg/day) than a clinical algorithm that excluded genotypes and admixture (R2 = 0.60, MAE = 0.99mg/day), and outperformed two prior pharmacogenetic algorithms in predicting effective dose in this population. For patients at the highest risk of adverse events, 45.5% of the dose predictions using the developed pharmacogenetic model resulted in ideal dose as compared with only 29% when using the clinical non-genetic algorithm (p<0.001). The admixture-driven pharmacogenetic algorithm predicted 58% of warfarin dose variance when externally validated in 55 individuals from an independent validation cohort (MAE = 0.89 mg/day, 24% mean bias). Results supported our rationale to incorporate individual's genotypes and unique admixture metrics into pharmacogenetic refinement models in order to increase predictability when expanding them to admixed populations like Caribbean Hispanics. ClinicalTrials.gov NCT01318057.

Our chemical burn experience: exposing the dangers of anhydrous ammonia.

PubMed

Wibbenmeyer, L A; Morgan, L J; Robinson, B K; Smith, S K; Lewis, R W; Kealey, G P

1999-01-01

Although chemical injuries account for only a small number of one burn unit's cases, the diversity, resulting complications, and sequelae of these burns pose special problems. We reviewed a 19-year period of the chemical burn experience of our burn unit. The population of patients with these types of burns consisted of young men (mean age: 29.8 years), the majority of whom were injured on the job. Unique to our series is the largest collection of injuries (30%) resulting from the common fertilizer anhydrous ammonia. Another population of concern, accounting for 14% of the injuries in our unit, is that of patients injured at home with routine household cleaners. Nearly one half of those patients injured at home incurred injuries that required grafting. The cornerstone of chemical burn prevention and treatment involves education regarding the caustic nature of chemicals, proper handling, adequate protection, and copious irrigation of the wound at the scene. From the analysis of our retrospective review, adequate education and treatment at the scene appear to be well implemented in the industrial and farming communities. The focus of our education efforts should be directed toward the public and emphasize the safe use of household chemicals. Finally our review illuminated the potential benefit of immediate excision and grafting for decreasing the length of stay, complications, and loss of productivity.

A Concise and Practical Framework for the Development and Usability Evaluation of Patient Information Websites.

PubMed

Peute, L W; Knijnenburg, S L; Kremer, L C; Jaspers, M W M

2015-01-01

The Website Developmental Model for the Healthcare Consumer (WDMHC) is an extensive and successfully evaluated framework that incorporates user-centered design principles. However, due to its extensiveness its application is limited. In the current study we apply a subset of the WDMHC framework in a case study concerning the development and evaluation of a website aimed at childhood cancer survivors (CCS). To assess whether the implementation of a limited subset of the WDMHC-framework is sufficient to deliver a high-quality website with few usability problems, aimed at a specific patient population. The website was developed using a six-step approach divided into three phases derived from the WDMHC: 1) information needs analysis, mock-up creation and focus group discussion; 2) website prototype development; and 3) heuristic evaluation (HE) and think aloud analysis (TA). The HE was performed by three double experts (knowledgeable both in usability engineering and childhood cancer survivorship), who assessed the site using the Nielsen heuristics. Eight end-users were invited to complete three scenarios covering all functionality of the website by TA. The HE and TA were performed concurrently on the website prototype. The HE resulted in 29 unique usability issues; the end-users performing the TA encountered eleven unique problems. Four issues specifically revealed by HE concerned cosmetic design flaws, whereas two problems revealed by TA were related to website content. Based on the subset of the WDMHC framework we were able to deliver a website that closely matched the expectancy of the end-users and resulted in relatively few usability problems during end-user testing. With the successful application of this subset of the WDMHC, we provide developers with a clear and easily applicable framework for the development of healthcare websites with high usability aimed at specific medical populations.

Transitioning From Volume to Value: One Academic Medical Center's Approach to Improving Population Health.

PubMed

Halvorson, Stephanie A C; Tanski, Mary E; Yackel, Thomas R

2017-05-01

The U.S. health care system is undergoing a major transformation. Clinical delivery systems are now being paid according to the value of the care they provide, in accordance with the Triple Aim, which incorporates improving the quality and cost of care and the patient experience. Increasingly, financial risk is being transferred from insurers to clinical delivery systems that become responsible for both episode-based clinical care and the longitudinal care of patients. Thus, these delivery systems need to develop strategies to manage the health of populations. Academic medical centers (AMCs) serve a unique role in many markets yet may be ill prepared for this transformation. In 2013, Oregon Health & Science University (OHSU) partnered with a large health insurer and six other hospitals across the state to form Propel Health, a collaborative partnership designed to deliver the tools, methods, and support necessary for population health management. OHSU also developed new internal structures and transformed its business model to embrace this value-based care model. Each Propel Health partner included the employees and dependents enrolled in its employee medical plan, for approximately 55,000 covered individuals initially. By 2017, Propel Health is expected to cover 110,000 individuals. Other outcomes to measure in the future include the quality and cost of care provided under this partnership. Anticipated challenges to overcome include insufficient primary care networks, conflicting incentives, local competition, and the magnitude of the transformation. Still, the time is right for AMCs to commit to improving the health of populations.

Evidence for the effect of disease management: is $1 billion a year a good investment?

PubMed

Mattke, Soeren; Seid, Michael; Ma, Sai

2007-12-01

To assess the evidence for the effect of disease management on quality of care, disease control, and cost, with a focus on population-based programs. Literature review. We conducted a literature search for and a structured review of studies on population-based disease management programs, as well as for reviews and meta-analyses of disease management interventions. We identified 3 evaluations of large-scale population-based programs, as well as 10 meta-analyses and 16 systematic reviews, covering 317 unique studies. We found consistent evidence that disease management improves processes of care and disease control but no conclusive support for its effect on health outcomes. Overall, disease management does not seem to affect utilization except for a reduction in hospitalization rates among patients with congestive heart failure and an increase in outpatient care and prescription drug use among patients with depression. When the costs of the intervention were appropriately accounted for and subtracted from any savings, there was no conclusive evidence that disease management leads to a net reduction of direct medical costs. Although disease management seems to improve quality of care, its effect on cost is uncertain. Most of the evidence to date addresses small-scale programs targeting high-risk individuals, while only 3 studies evaluate large population-based interventions, implying that little is known about their effect. Payers and policy makers should remain skeptical about vendor claims and should demand supporting evidence based on transparent and scientifically sound methods.

The Genetics of Bene Israel from India Reveals Both Substantial Jewish and Indian Ancestry

PubMed Central

Davidson, Natalie R.; Billing-Ross, Paul; Dubrovsky, Maya; Campbell, Christopher L.; Oddoux, Carole; Friedman, Eitan; Atzmon, Gil; Halperin, Eran; Ostrer, Harry; Keinan, Alon

2016-01-01

The Bene Israel Jewish community from West India is a unique population whose history before the 18th century remains largely unknown. Bene Israel members consider themselves as descendants of Jews, yet the identity of Jewish ancestors and their arrival time to India are unknown, with speculations on arrival time varying between the 8th century BCE and the 6th century CE. Here, we characterize the genetic history of Bene Israel by collecting and genotyping 18 Bene Israel individuals. Combining with 486 individuals from 41 other Jewish, Indian and Pakistani populations, and additional individuals from worldwide populations, we conducted comprehensive genome-wide analyses based on FST, principal component analysis, ADMIXTURE, identity-by-descent sharing, admixture linkage disequilibrium decay, haplotype sharing and allele sharing autocorrelation decay, as well as contrasted patterns between the X chromosome and the autosomes. The genetics of Bene Israel individuals resemble local Indian populations, while at the same time constituting a clearly separated and unique population in India. They are unique among Indian and Pakistani populations we analyzed in sharing considerable genetic ancestry with other Jewish populations. Putting together the results from all analyses point to Bene Israel being an admixed population with both Jewish and Indian ancestry, with the genetic contribution of each of these ancestral populations being substantial. The admixture took place in the last millennium, about 19–33 generations ago. It involved Middle-Eastern Jews and was sex-biased, with more male Jewish and local female contribution. It was followed by a population bottleneck and high endogamy, which can lead to increased prevalence of recessive diseases in this population. This study provides an example of how genetic analysis advances our knowledge of human history in cases where other disciplines lack the relevant data to do so. PMID:27010569

The Genetics of Bene Israel from India Reveals Both Substantial Jewish and Indian Ancestry.

PubMed

Waldman, Yedael Y; Biddanda, Arjun; Davidson, Natalie R; Billing-Ross, Paul; Dubrovsky, Maya; Campbell, Christopher L; Oddoux, Carole; Friedman, Eitan; Atzmon, Gil; Halperin, Eran; Ostrer, Harry; Keinan, Alon

2016-01-01

The Bene Israel Jewish community from West India is a unique population whose history before the 18th century remains largely unknown. Bene Israel members consider themselves as descendants of Jews, yet the identity of Jewish ancestors and their arrival time to India are unknown, with speculations on arrival time varying between the 8th century BCE and the 6th century CE. Here, we characterize the genetic history of Bene Israel by collecting and genotyping 18 Bene Israel individuals. Combining with 486 individuals from 41 other Jewish, Indian and Pakistani populations, and additional individuals from worldwide populations, we conducted comprehensive genome-wide analyses based on FST, principal component analysis, ADMIXTURE, identity-by-descent sharing, admixture linkage disequilibrium decay, haplotype sharing and allele sharing autocorrelation decay, as well as contrasted patterns between the X chromosome and the autosomes. The genetics of Bene Israel individuals resemble local Indian populations, while at the same time constituting a clearly separated and unique population in India. They are unique among Indian and Pakistani populations we analyzed in sharing considerable genetic ancestry with other Jewish populations. Putting together the results from all analyses point to Bene Israel being an admixed population with both Jewish and Indian ancestry, with the genetic contribution of each of these ancestral populations being substantial. The admixture took place in the last millennium, about 19-33 generations ago. It involved Middle-Eastern Jews and was sex-biased, with more male Jewish and local female contribution. It was followed by a population bottleneck and high endogamy, which can lead to increased prevalence of recessive diseases in this population. This study provides an example of how genetic analysis advances our knowledge of human history in cases where other disciplines lack the relevant data to do so.

Randomized sham-controlled trial of renal sympathetic denervation in mild resistant hypertension.

PubMed

Desch, Steffen; Okon, Thomas; Heinemann, Diana; Kulle, Konrad; Röhnert, Karoline; Sonnabend, Melanie; Petzold, Martin; Müller, Ulrike; Schuler, Gerhard; Eitel, Ingo; Thiele, Holger; Lurz, Philipp

2015-06-01

Few data are available with regard to the effectiveness of renal sympathetic denervation in patients with resistant hypertension yet only mildly elevated blood pressure (BP). Patients with resistant hypertension and slightly elevated BP (day-time systolic pressure, 135-149 and diastolic pressure, 90-94 mm Hg on 24-hour ambulatory measurement) were randomized in a 1:1 ratio to renal sympathetic denervation with the Symplicity Flex Catheter (Medtronic) or an invasive sham procedure. The primary efficacy end point was the change in 24-hour systolic BP at 6 months between groups in the intention to treat population. A total of 71 patients underwent randomization. Baseline day-time systolic BP was 144.4±4.8 mm Hg in patients assigned to denervation and 143.0±4.7 mm Hg in patients randomized to the sham procedure. The mean change in 24-hour systolic BP in the intention to treat cohort at 6 months was -7.0 mm Hg (95% confidence interval, -10.8 to -3.2) for patients undergoing denervation and -3.5 mm Hg (95% confidence interval, -6.7 to -0.2) in the sham group (P=0.15). In the per protocol population, the change in 24-hour systolic BP at 6 months was -8.3 mm Hg (95% confidence interval, -11.7 to -5.0) for patients undergoing denervation and -3.5 mm Hg (95% confidence interval, -6.8 to -0.2) in the sham group (P=0.042). In patients with mild resistant hypertension, renal sympathetic denervation failed to show a significant reduction in the primary end point of 24-hour systolic BP at 6 months between groups in the intention to treat analysis. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01656096. © 2015 American Heart Association, Inc.

Incidence of medically attended influenza during pandemic and post-pandemic seasons through the Influenza Incidence Surveillance Project, 2009–13

PubMed Central

Fowlkes, Ashley; Steffens, Andrea; Temte, Jon; Di Lonardo, Steve; McHugh, Lisa; Martin, Karen; Rubino, Heather; Feist, Michelle; Davis, Carol; Selzer, Christine; Lojo, Jose; Oni, Oluwakemi; Kurkjian, Katie; Thomas, Ann; Boulton, Rachelle; Bryan, Nicole; Lynfield, Ruth; Biggerstaff, Matthew; Finelli, Lyn

2017-01-01

Summary Background Since the introduction of pandemic influenza A (H1N1) to the USA in 2009, the Influenza Incidence Surveillance Project has monitored the burden of influenza in the outpatient setting through population-based surveillance. Methods From Oct 1, 2009, to July 31, 2013, outpatient clinics representing 13 health jurisdictions in the USA reported counts of influenza-like illness (fever including cough or sore throat) and all patient visits by age. During four years, staff at 104 unique clinics (range 35–64 per year) with a combined median population of 368 559 (IQR 352 595–428 286) attended 35 663 patients with influenza-like illness and collected 13 925 respiratory specimens. Clinical data and a respiratory specimen for influenza testing by RT-PCR were collected from the first ten patients presenting with influenza-like illness each week. We calculated the incidence of visits for influenza-like illness using the size of the patient population, and the incidence attributable to influenza was extrapolated from the proportion of patients with positive tests each week. Findings The site-median peak percentage of specimens positive for influenza ranged from 58.3% to 77.8%. Children aged 2 to 17 years had the highest incidence of influenza-associated visits (range 4.2–28.0 per 1000 people by year), and adults older than 65 years had the lowest (range 0.5–3.5 per 1000 population). Influenza A H3N2, pandemic H1N1, and influenza B equally co-circulated in the first post-pandemic season, whereas H3N2 predominated for the next two seasons. Of patients for whom data was available, influenza vaccination was reported in 3289 (28.7%) of 11 459 patients with influenza-like illness, and antivirals were prescribed to 1644 (13.8%) of 11 953 patients. Interpretation Influenza incidence varied with age groups and by season after the pandemic of 2009 influenza A H1N1. High levels of influenza virus circulation, especially in young children, emphasise the need for additional efforts to increase the uptake of influenza vaccines and antivirals. Funding US Centers for Disease Control and Prevention. PMID:26300111

Incidence of medically attended influenza during pandemic and post-pandemic seasons through the Influenza Incidence Surveillance Project, 2009-13.

PubMed

Fowlkes, Ashley; Steffens, Andrea; Temte, Jon; Lonardo, Steve Di; McHugh, Lisa; Martin, Karen; Rubino, Heather; Feist, Michelle; Davis, Carol; Selzer, Christine; Lojo, Jose; Oni, Oluwakemi; Kurkjian, Katie; Thomas, Ann; Boulton, Rachelle; Bryan, Nicole; Lynfield, Ruth; Biggerstaff, Matthew; Finelli, Lyn

2015-09-01

Since the introduction of pandemic influenza A (H1N1) to the USA in 2009, the Influenza Incidence Surveillance Project has monitored the burden of influenza in the outpatient setting through population-based surveillance. From Oct 1, 2009, to July 31, 2013, outpatient clinics representing 13 health jurisdictions in the USA reported counts of influenza-like illness (fever including cough or sore throat) and all patient visits by age. During four years, staff at 104 unique clinics (range 35-64 per year) with a combined median population of 368,559 (IQR 352,595-428,286) attended 35,663 patients with influenza-like illness and collected 13,925 respiratory specimens. Clinical data and a respiratory specimen for influenza testing by RT-PCR were collected from the first ten patients presenting with influenza-like illness each week. We calculated the incidence of visits for influenza-like illness using the size of the patient population, and the incidence attributable to influenza was extrapolated from the proportion of patients with positive tests each week. The site-median peak percentage of specimens positive for influenza ranged from 58.3% to 77.8%. Children aged 2 to 17 years had the highest incidence of influenza-associated visits (range 4.2-28.0 per 1000 people by year), and adults older than 65 years had the lowest (range 0.5-3.5 per 1000 population). Influenza A H3N2, pandemic H1N1, and influenza B equally co-circulated in the first post-pandemic season, whereas H3N2 predominated for the next two seasons. Of patients for whom data was available, influenza vaccination was reported in 3289 (28.7%) of 11,459 patients with influenza-like illness, and antivirals were prescribed to 1644 (13.8%) of 11,953 patients. Influenza incidence varied with age groups and by season after the pandemic of 2009 influenza A H1N1. High levels of influenza virus circulation, especially in young children, emphasise the need for additional efforts to increase the uptake of influenza vaccines and antivirals. US Centers for Disease Control and Prevention. Copyright © 2015 Elsevier Ltd. All rights reserved.

A new diagnosis of Williams-Beuren syndrome in a 49-year-old man with severe bullous emphysema.

PubMed

Wojcik, Monica H; Carmichael, Nikkola; Bieber, Frederick R; Wiener, Daniel C; Madan, Rachna; Pober, Barbara R; Raby, Benjamin A

2017-08-01

Williams-Beuren syndrome (WBS) is a chromosomal microdeletion syndrome typically presenting with intellectual disability, a unique personality, a characteristic facial appearance, and cardiovascular disease. Several clinical features of WBS are thought to be due to haploinsufficiency of elastin (ELN), as the ELN locus is included within the WBS critical region at 7q11.23. Emphysema, a disease attributed to destruction of pulmonary elastic fibers, has been reported in patients without WBS who have pathogenic variants in ELN but only once (in one patient) in WBS. Here we report a second adult WBS patient with emphysema where the diagnosis of WBS was established subsequent to the discovery of severe bullous emphysema. Haploinsufficiency of ELN likely contributed to this pulmonary manifestation of WBS. This case emphasizes the contribution of rare genetic variation in cases of severe emphysema and provides further evidence that emphysema should be considered in patients with WBS who have respiratory symptoms, as it may be under-recognized in this patient population. © 2017 Wiley Periodicals, Inc.

Mobile health devices: will patients actually use them?

PubMed

Shaw, Ryan J; Steinberg, Dori M; Bonnet, Jonathan; Modarai, Farhad; George, Aaron; Cunningham, Traven; Mason, Markedia; Shahsahebi, Mohammad; Grambow, Steven C; Bennett, Gary G; Bosworth, Hayden B

2016-05-01

Although mobile health (mHealth) devices offer a unique opportunity to capture patient health data remotely, it is unclear whether patients will consistently use multiple devices simultaneously and/or if chronic disease affects adherence. Three healthy and three chronically ill participants were recruited to provide data on 11 health indicators via four devices and a diet app. The healthy participants averaged overall weekly use of 76%, compared to 16% for those with chronic illnesses. Device adherence declined across all participants during the study. Patients with chronic illnesses, with arguably the most to benefit from advanced (or increased) monitoring, may be less likely to adopt and use these devices compared to healthy individuals. Results suggest device fatigue may be a significant problem. Use of mobile technologies may have the potential to transform care delivery across populations and within individuals over time. However, devices may need to be tailored to meet the specific patient needs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The physician's unique role in preventing violence: a neglected opportunity?

PubMed Central

2012-01-01

Background Episodes of explosive rage and violence comprise a symptom complex which can have a devastating effect on a person's life. In the community this behavior is seen as workplace violence, domestic abuse and road rage, while in the clinical setting, this behavior is rarely mentioned by patients, despite evidence that it can signify an important biological disorder that may afflict more than three percent of the population. Discussion Patients are often reluctant to seek help for episodic attacks of rage, especially attacks which are accompanied by physical violence. Although, in the past, clinicians have had few treatment options to offer, recent neuroscience advances have created new possibilities to understand and help patients with this neglected problem. No formal medical guidelines for treating violence exist; however, many patients can be helped by diagnosis, referral and treatment. Treatment can include pharmaceuticals and nutrients, as well as referral for anger management or behavioral therapy. Summary The astute clinician has an opportunity to positively impact an important problem through the diagnosis and treatment of patients with symptoms of intermittent explosive disorder. PMID:23177023

Haematuria in Postrenal Transplant Patients

PubMed Central

Wang, Ziting; Vathsala, Anantharaman; Tiong, Ho Yee

2015-01-01

Haematuria has a prevalence of 12% in the postrenal transplant patient population. It heralds potentially dangerous causes which could threaten graft loss. It is important to consider causes in light of the unique, urological, and immunological standpoints of these patients. We review the literature on common causes of haematuria in postrenal transplant patients and suggest the salient approach to the evaluation of this condition. A major cause of haematuria is urinary tract infections. There should be a higher index of suspicion for mycobacterial, fungal, and viral infection in this group of immunosuppressed patients. Measures recommended in the prevention of urinary tract infections include early removal of foreign bodies as well as prophylactic antibiotics during the early transplant phase. Another common cause of haematuria is that of malignancies, in particular, renal cell carcinomas. When surgically managing cancer in the setting of a renal transplant, one has to be mindful of the limited retropubic space and the need to protect the anastomoses. Other causes include graft rejections, recurrences of primary disease, and calculus formation. It is important to perform a comprehensive evaluation with the aid of an experienced multidisciplinary transplant team. PMID:25918706

Subjective tinnitus assessment and treatment in clinical practice: the necessity of personalized medicine.

PubMed

Van de Heyning, Paul; Gilles, Annick; Rabau, Sarah; Van Rompaey, Vincent

2015-10-01

Subjective tinnitus can be triggered by a variety of causes, and therefore tinnitus patients constitute a very heterogeneous population difficult to manage. In this article, we reviewed the current literature to present our conceptual model of the conscious auditory percept and tinnitus - based on experimental research - in order to explain the clinical approach to the individual tinnitus patient. Fundamental research has provided evidence to support the neurophysiological model of tinnitus developed by Jastreboff. By manipulating the limbic, autonomic and auditory systems, tinnitus retraining therapy (TRT) aims to reduce the response to the abnormal stimulus. Evidence has confirmed the effectiveness of TRT and cognitive behavioral therapy in reducing the negative impact of subjective tinnitus on the patients' quality of life. Every patient with subjective tinnitus has its unique 'tinnitus profile' which provides a guide to the necessary combination of therapeutic actions. Evidence suggests the multidisciplinary approach combining etiological therapy as well as TRT, and cognitive behavioral therapy in specialized clinics is not only effective in reducing the patient's quality of life but also cost-effective from a healthcare and societal point of view.

Improving Patient Safety, Health Data Accuracy, and Remote Self-Management of Health Through the Establishment of a Biometric-Based Global UHID.

PubMed

Hembroff, Guy

2016-01-01

Healthcare systems globally continue to face challenges surrounding patient identification. Consequences of misidentification include incomplete and inaccurate electronic patient health records potentially jeopardizing patients' safety, a significant amount of cases of medical fraud because of inadequate identification mechanisms, and difficulties affiliated with the value of remote health self-management application data being aggregated accurately into the user's Electronic Health Record (EHR). We introduce a new technique of user identification in healthcare capable of establishing a global identifier. Our research has developed algorithms capable of establishing a Unique Health Identifier (UHID) based on the user's fingerprint biometric, with the utilization of facial-recognition as a secondary validation step before health records can be accessed. Biometric captures are completed using standard smartphones and Web cameras in a touchless method. We present a series of experiments to demonstrate the formation of an accurate, consistent, and scalable UHID. We hope our solution will aid in the reduction of complexities associated with user misidentification in healthcare resulting in lowering costs, enhancing population health monitoring, and improving patient-safety.

Medical management of epileptic seizures: challenges and solutions.

PubMed

Sarma, Anand K; Khandker, Nabil; Kurczewski, Lisa; Brophy, Gretchen M

2016-01-01

Epilepsy is one of the most common neurologic illnesses. This condition afflicts 2.9 million adults and children in the US, leading to an economic impact amounting to $15.5 billion. Despite the significant burden epilepsy places on the population, it is not very well understood. As this understanding continues to evolve, it is important for clinicians to stay up to date with the latest advances to provide the best care for patients. In the last 20 years, the US Food and Drug Administration has approved 15 new antiepileptic drugs (AEDs), with many more currently in development. Other advances have been achieved in terms of diagnostic modalities like electroencephalography technology, treatment devices like vagal nerve and deep-brain stimulators, novel alternate routes of drug administration, and improvement in surgical techniques. Specific patient populations, such as the pregnant, elderly, those with HIV/AIDS, and those with psychiatric illness, present their own unique challenges, with AED side effects, drug interactions, and medical-psychiatric comorbidities adding to the conundrum. The purpose of this article is to review the latest literature guiding the management of acute epileptic seizures, focusing on the current challenges across different practice settings, and it discusses studies in various patient populations, including the pregnant, geriatric, those with HIV/AIDS, comatose, psychiatric, and "pseudoseizure" patients, and offers possible evidence-based solutions or the expert opinion of the authors. Also included is information on newer AEDs, routes of administration, and significant AED-related drug-interaction tables. This review has tried to address only some of these issues that any practitioner who deals with the acute management of seizures may encounter. The document also highlights the numerous avenues for new research that would help practitioners optimize epilepsy management.

Phenotypic & Genotypic Characteristics of Inflammatory Bowel Disease (IBD) in French-Canadians: comparison with a large North American repository

PubMed Central

Bhat, Mamatha; Nguyen, Geoffrey C.; Pare, Pierre; Lahaie, Raymond; Deslandres, Colette; Bernard, Edmond-Jean; Aumais, Guy; Jobin, Gilles; Wild, Gary; Cohen, Albert; Langelier, Diane; Brant, Steven; Dassopoulos, Themistocles; McGovern, Dermot; Torres, Esther; Duerr, Richard; Regueiro, Miguel; Silverberg, Mark S; Steinhart, Hillary; Griffiths, Anne M.; Elkadri, Abdul; Cho, Judy; Proctor, Deborah; Goyette, Philippe; Rioux, John; Bitton, Alain

2009-01-01

BACKGROUND Phenotype characteristics of inflammatory bowel disease (IBD) may differ significantly among ethnic subpopulations. The aim of this study was to characterize the IBD phenotype in French-Canadians, the most prominent founder population in North America. METHODS Using well-characterized phenotype data in the NIDDK-IBD Genetics Consortium repository on IBD patients, we compared phenotypic characteristics of 202 French-Canadians to those of 1287 other Caucasian patients. These included: diagnosis, anatomical location, disease behaviour, extraintestinal manifestations, surgical history, and family history of IBD. RESULTS French-Canadian CD patients were less likely to have stricturing disease (11 vs 21%, P=0.005; OR 0.45, 95% CI: 0.24– 0.85). Using a stringent definition of ethnicity (3 out of 4 grandparents being French-Canadian, as opposed to self-report, n= 148), French-Canadians had a tendency towards developing fistulizing CD (37% vs 28%, p= 0.07), and there was an increased prevalence of sacroiliitis among French-Canadians with IBD (4% vs 2%, p=0.045). Among French-Canadians, the numbers of current smokers in CD (40 vs 25%, p=0.006) and former smokers in UC (35% vs 20%, p=0.03) were significantly higher. The prevalence of one of the three main variant NOD2 SNPs among French-Canadian CD patients was 43.2%. The 3020insC SNP correlated with small bowel disease in French-Canadians (75% versus 0%, P=0.006). CONCLUSION French-Canadians exhibit an IBD phenotype profile distinct from other Caucasian IBD populations, with an accentuated association between smoking status and IBD. This unique profile may have implications regarding the need for a different approach to management of IBD in this population. PMID:19513023

Unmet Needs of African Americans and Whites at the Time of Palliative Care Consultation.

PubMed

Kamal, Arif H; Bull, Janet; Wolf, Steven P; Portman, Diane; Strand, Jacob; Johnson, Kimberly S

2017-06-01

Differences among patient populations that present to consultative palliative care are not known. Such an appreciation would inform health-care delivery tailored to unique populations. We aimed to compare characteristics and palliative care needs of African Americans (AAs) and whites during initial palliative care consultation. We analyzed patient-reported, clinician-entered clinical encounter data from a large, multisite community-based, nonhospice palliative care collaborative. We included first specialty palliative care consultations from January 1, 2014, to July 2, 2015, across 15 sites within the Global Palliative Care Quality Alliance registry. Demographics, disease, performance status, advance care planning, and symptom prevalence/severity were compared. Of 775 patients, 12.9% (N = 100) were AA. African Americans were younger (63 vs 75.4 years, P < .0001). A larger proportion of AAs had a diagnosis of cancer (45.0% vs 36.3%, P = .09) and in the hospital (71% vs 61.8%, P = .07). African Americans were more likely to have a Palliative Performance Score of 0 to 30 (35.6% vs 23.7%, P = .049). Around 50% in both racial groups were full code; slightly more than 40% had an advance directive. Nearly two-thirds in both racial groups reported 3 or more symptoms of any severity; one-third reported 3 or more moderate or severe symptoms. A larger proportion of Africans than whites reported pain of any severity (66.0% vs 56.1%, P = .06). All patients present to palliative care consultations with significant symptom and advance care planning needs. Further research is needed to identify how to deliver palliative care: earlier, in noncancer conditions, and improve pain management in AA populations.

The Contributions of Phonological and Morphological Awareness to Literacy Skills In the Adult Basic Education Population

PubMed Central

Fracasso, Lucille E.; Bangs, Kathryn; Binder, Katherine S.

2014-01-01

The Adult Basic Education (ABE) population consists of a wide range of abilities with needs that may be unique to this set of learners. The purpose of this study was to better understand the relative contributions of phonological decoding and morphological awareness to spelling, vocabulary, and comprehension across a sample of ABE students. In this study, phonological decoding was a unique predictor of spelling ability, listening comprehension and reading comprehension. We also found that morphological awareness was a unique predictor of spelling ability, vocabulary, and listening comprehension. Morphological awareness indirectly contributed to reading comprehension through vocabulary. These findings suggest the need for morphological interventions for this group of learners. PMID:24935886

Existence and uniqueness, attraction for stochastic age-structured population systems with diffusion and Poisson jump

NASA Astrophysics Data System (ADS)

Chen, Huabin

2013-08-01

In this paper, the problems about the existence and uniqueness, attraction for strong solution of stochastic age-structured population systems with diffusion and Poisson jump are considered. Under the non-Lipschitz condition with the Lipschitz condition being considered as a special case, the existence and uniqueness for such systems is firstly proved by using the Burkholder-Davis-Gundy inequality (B-D-G inequality) and Itô's formula. And then by using a novel inequality technique, some sufficient conditions ensuring the existence for the domain of attraction are established. As another by-product, the exponential stability in mean square moment of strong solution for such systems can be also discussed.

Effect of a Behavioral Self-Regulation Intervention on Patient Adherence to Fluid-Intake Restrictions in Hemodialysis: a Randomized Controlled Trial.

PubMed

Howren, M Bryant; Kellerman, Quinn D; Hillis, Stephen L; Cvengros, Jamie; Lawton, William; Christensen, Alan J

2016-04-01

The purpose of this study is to evaluate the efficacy of a behavioral self-regulation intervention vs. active control condition using a parallel-group randomized clinical trial with a sample of center hemodialysis patients with chronic kidney disease. Participants were recruited from 8 hemodialysis treatment centers in the Midwest. Eligible patients were (a) fluid nonadherent as defined by an interdialytic weight gain >2.5 kg over a 4-week period, (b) >18 years of age, (c) English-speaking without severe cognitive impairment, (d) treated with center-based hemodialysis for >3 months, and (e) not living in a care facility in which meals were managed. Medical records were used to identify eligible patients. Patients were randomly assigned to either a behavioral self-regulation intervention or active control condition in which groups of 3-8 patients met for hour-long, weekly sessions for 7 weeks at their usual hemodialysis clinic. Primary analyses were intention-to-treat. Sixty-one patients were randomized to the intervention while 58 were assigned to the attention-placebo support and discussion control. Covariate-adjusted between-subjects analyses demonstrated no unique intervention effect for the primary outcome, interdialytic weight gain (β = 0.13, p = 0.48). Significant within-subjects improvement over time was observed for the intervention group (β = -0.32, p = 0.014). The present study found that participation in a behavioral self-regulation intervention resulted in no unique intervention effect on a key indicator of adherence for those with severe chronic kidney disease. There was, however, modest within-subjects improvement in interdialytic weight gain for the intervention group which meshes with other evidence showing the utility of behavioral interventions in this patient population. ClinicalTrials.gov Identifier: NCT01066949.

Genome-wide methylomic and transcriptomic analyses identify subtype-specific epigenetic signatures commonly dysregulated in glioma stem cells and glioblastoma.

PubMed

Pangeni, Rajendra P; Zhang, Zhou; Alvarez, Angel A; Wan, Xuechao; Sastry, Namratha; Lu, Songjian; Shi, Taiping; Huang, Tianzhi; Lei, Charles X; James, C David; Kessler, John A; Brennan, Cameron W; Nakano, Ichiro; Lu, Xinghua; Hu, Bo; Zhang, Wei; Cheng, Shi-Yuan

2018-06-21

Glioma stem cells (GSCs), a subpopulation of tumor cells, contribute to tumor heterogeneity and therapy resistance. Gene expression profiling classified glioblastoma (GBM) and GSCs into four transcriptomically-defined subtypes. Here, we determined the DNA methylation signatures in transcriptomically pre-classified GSC and GBM bulk tumors subtypes. We hypothesized that these DNA methylation signatures correlate with gene expression and are uniquely associated either with only GSCs or only GBM bulk tumors. Additional methylation signatures may be commonly associated with both GSCs and GBM bulk tumors, i.e., common to non-stem-like and stem-like tumor cell populations and correlating with the clinical prognosis of glioma patients. We analyzed Illumina 450K methylation array and expression data from a panel of 23 patient-derived GSCs. We referenced these results with The Cancer Genome Atlas (TCGA) GBM datasets to generate methylomic and transcriptomic signatures for GSCs and GBM bulk tumors of each transcriptomically pre-defined tumor subtype. Survival analyses were carried out for these signature genes using publicly available datasets, including from TCGA. We report that DNA methylation signatures in proneural and mesenchymal tumor subtypes are either unique to GSCs, unique to GBM bulk tumors, or common to both. Further, dysregulated DNA methylation correlates with gene expression and clinical prognoses. Additionally, many previously identified transcriptionally-regulated markers are also dysregulated due to DNA methylation. The subtype-specific DNA methylation signatures described in this study could be useful for refining GBM sub-classification, improving prognostic accuracy, and making therapeutic decisions.

Advance Care Planning Discussions with Adolescent and Young Adult Cancer Patients Admitted to a Community Palliative Care Service: A Retrospective Case-Note Audit.

PubMed

Fletcher, Sophie; Hughes, Rachel; Pickstock, Sarah; Auret, Kirsten

2018-02-01

Adolescents and young adults (AYA) with cancer are a cohort requiring specialized healthcare models to address unique cognitive and physical challenges. Advance care planning (ACP) discussions likely warrant age-appropriate adaptation, yet, there is little Australian research data available to inform best practice for this group. The goal of this work is to inform future models of ACP discussions for AYA. Retrospective medical record audit of AYA patients and an adult comparison group, diagnosed with a malignancy and referred to a community hospice service, in Western Australia, in the period between January 1, 2012 and December 1, 2015. Information was collected regarding end-of-life care discussions, documentation of agreed plan of care, and care received. Twenty-seven AYA and 37 adult medical records were reviewed. Eighteen (66.7%) AYA patients died at home, compared with 19 (51.4%) adults (p = 0.028). Desire to pursue all available oncological therapies, including clinical trials, was documented for 14 (51.9%) AYA patients compared with 9 (24.3%) of the adult group (p = 0.02). Eleven AYA patients (40.7%) received chemotherapy during the last month of life compared with two (5.4%) adults (p = 0.001). The results indicate that end-of-life care preferences for this unique cohort may differ from those of the adult population and need to be captured and understood. An ACP document incorporating a discussion regarding goals of care, preferred location of care, preference for place of death, and consent to future intervention, including cardiopulmonary resuscitation and prompts for review, could assist in pursuing this objective.

The disclosure of diagnosis codes can breach research participants' privacy.

PubMed

Loukides, Grigorios; Denny, Joshua C; Malin, Bradley

2010-01-01

De-identified clinical data in standardized form (eg, diagnosis codes), derived from electronic medical records, are increasingly combined with research data (eg, DNA sequences) and disseminated to enable scientific investigations. This study examines whether released data can be linked with identified clinical records that are accessible via various resources to jeopardize patients' anonymity, and the ability of popular privacy protection methodologies to prevent such an attack. The study experimentally evaluates the re-identification risk of a de-identified sample of Vanderbilt's patient records involved in a genome-wide association study. It also measures the level of protection from re-identification, and data utility, provided by suppression and generalization. Privacy protection is quantified using the probability of re-identifying a patient in a larger population through diagnosis codes. Data utility is measured at a dataset level, using the percentage of retained information, as well as its description, and at a patient level, using two metrics based on the difference between the distribution of Internal Classification of Disease (ICD) version 9 codes before and after applying privacy protection. More than 96% of 2800 patients' records are shown to be uniquely identified by their diagnosis codes with respect to a population of 1.2 million patients. Generalization is shown to reduce further the percentage of de-identified records by less than 2%, and over 99% of the three-digit ICD-9 codes need to be suppressed to prevent re-identification. Popular privacy protection methods are inadequate to deliver a sufficiently protected and useful result when sharing data derived from complex clinical systems. The development of alternative privacy protection models is thus required.

Handing the pen to the patient: reflective writing for children and families affected by genetic conditions.

PubMed

Murali, Chaya; Fernbach, Susan D; Potocki, Lorraine

2014-12-01

Genetic diagnoses impact the Quality of Life (QoL) of patients and their families. While some patients and families report a positive impact on QoL, others are affected negatively by a genetic diagnosis. No matter the impact, it is clear that social support is needed for this population. Genetic healthcare providers should be aware of the need for psychosocial support and be equipped to provide or direct patients and families to the appropriate resources. Reflective writing offers a unique opportunity for families and health care providers to engage in self-reflection and expression, activities which have the potential to enhance QoL in a positive manner. The therapeutic potential of writing has been studied in many populations, from caregivers of elderly individuals with dementia, to cancer survivors, to survivors of traumatic experiences. Some of these interventions have shown promise for improving participants' QoL. However, reflective writing has never been studied in patients and families affected by genetic conditions. We propose that reflective writing therapy is a feasible, reproducible, and enjoyable approach to providing psychosocial support for our patients. Get it Write is a reflective writing workshop pilot project for those who have a personal or family history of a genetic diagnosis. Our hypothesis is that reflective writing will help engender acceptance and alleviate feelings of isolation. Get it Write does not focus on the stressful factors in the participants' lives, rather it serves to facilitate interactions with peers facing the same struggles, and with medical students in a non-medical context. © 2014 Wiley Periodicals, Inc.

Critical factors in case management: practical lessons from a cardiac case management program.

PubMed

Stafford, Randall S; Berra, Kathy

2007-08-01

Case management (CM) is an important strategy for chronic disease care. By utilizing non-physician providers for conditions requiring ongoing care and follow-up, CM can facilitate guideline-concordant care, patient empowerment, and improvement in quality of life. We identify a series of critical factors required for successful CM implementation. Heart to Heart is a clinical trial evaluating CM for coronary heart disease (CHD) risk reduction in a multiethnic, low-income population. Patients at elevated cardiac risk were randomized to CM plus primary care (212 patients) or to primary care alone (207). Over a mean follow-up of 17 months, patients received face-to-face nurse and dietitian visits. Mean contact time was 14 hours provided at an estimated cost of $1250 per patient for the 341 (81%) patients completing follow-up. Visits emphasized behavior change, risk-factor monitoring, self-management skills, and guideline-based pharmacotherapy. A statistically significant reduction in mean Framingham risk probability occurred in CM plus primary care relative to primary care alone (1.6% decrease in 10-year CHD risk, p = 0.007). Favorable changes were noted across individual risk factors. Our findings suggest that successful CM implementation relies on choosing appropriate case managers and investing in training, integrating CM into existing care systems, delineating the scope and appropriate levels of clinical decision making, using information systems, and monitoring outcomes and costs. While our population, setting, and intervention model are unique, these insights are broadly relevant. If implemented with attention to critical factors, CM has great potential to improve the process and outcomes of chronic disease care.

Perceptions of Spanish-Speaking Clientele of Patient Care Services in a Community Pharmacy

PubMed Central

Olenik, Nicole L.; Gonzalvo, Jasmine D.; Snyder, Margie E.; Nash, Christy L.; Smith, Cory T.

2014-01-01

Background A paucity of studies exists that have assessed community pharmacy preferences of Spanish-speaking patients living in areas of the U.S. with rapidly growing Hispanic populations. The qualitative approach to this research affords a unique opportunity to further explore perceptions of the Spanish-speaking population. Objectives To identify perceptions of Spanish-speaking patients living in the U.S. with a focus on the care provided in community pharmacies, as well as to determine their satisfaction with community pharmacies. Methods Participants were recruited after weekly Spanish-speaking church services for approximately one month. Qualitative, semi-structured individual interviews to identify perceived unmet patient care needs were conducted in Spanish and transcribed/translated verbatim. Qualitative thematic analysis was used to summarize findings. A written questionnaire was administered to collect patient satisfaction and demographic information, summarized using descriptive statistics. Results Twelve interviews were conducted by the principal investigator. Primary themes included lack of insurance coupled with high medical care costs serving as a barrier for acquisition of healthcare, difficulty accessing timely and convenient primary care, perceived negative attitudes from pharmacy personnel, lack of Spanish-speaking healthcare providers, and the provision of verbal and written medication information in English. Conclusions The results of this study suggest a great need for healthcare providers, including pharmacists, to expand outreach services to the Spanish-speaking community. Some examples derived from the interview process include increasing marketing efforts of available services in the Spanish language, hiring Spanish-speaking personnel, and offering medical terminology education classes to Spanish-speaking patients. PMID:25103185

Bariatric CT Imaging: Challenges and Solutions.

PubMed

Fursevich, Dzmitry M; LiMarzi, Gary M; O'Dell, Matthew C; Hernandez, Manuel A; Sensakovic, William F

2016-01-01

The obesity epidemic in the adult and pediatric populations affects all aspects of health care, including diagnostic imaging. With the increasing prevalence of obese and morbidly obese patients, bariatric computed tomographic (CT) imaging is becoming common in day-to-day radiology practice, and a basic understanding of the unique problems that bariatric patients pose to the imaging community is crucial in any setting. Because larger patients may not fit into conventional scanners, having a CT scanner with an adequate table load limit, a large gantry aperture, a large scan field of view, and a high-power generator is a prerequisite for bariatric imaging. Iterative reconstruction methods, high tube current, and high tube voltage can reduce the image noise that is frequently seen in bariatric CT images. Truncation artifacts, cropping artifacts, and ring artifacts frequently complicate the interpretation of CT images of larger patients. If recognized, these artifacts can be easily reduced by using the proper CT equipment, scan acquisition parameters, and postprocessing options. Lastly, because of complex contrast material dynamics, contrast material-enhanced studies of bariatric patients require special attention. Understanding how the rate of injection, the scan timing, and the total mass of iodine affect vascular and parenchymal enhancement will help to optimize contrast-enhanced studies in the bariatric population. This article familiarizes the reader with the challenges that are frequently encountered at CT imaging of bariatric patients, beginning with equipment selection and ending with a review of the most commonly encountered obesity-related artifacts and the technical considerations in the acquisition of contrast-enhanced images. (©)RSNA, 2016.

Decentralisation of radiation therapy. Is it possible and beneficial to patients? Experience of the first 5 years of a satellite radiotherapy unit in the province of Tarragona, Spain

PubMed Central

Arenas, Meritxell; Gomez, David; Sabater, Sebastià; Rovirosa, Angeles; Biete, Albert; Colomer, Jordi

2014-01-01

Background The concept of satellite radiotherapy originates in countries whose populations are largely dispersed in order to treat homogenously the population by a unique fixed team. Aim This report describes the creation and management of a satellite radiotherapy unit in Spain (RUTE-Radiotherapy Unit, Terres de l’Ebre). It is managed by the Radiation Oncology Department at Hospital Universitari Sant Joan de Reus. We report the benefit gained in the comfort of patients and the economic benefit gained by reducing the expense of transport for the health care system. Materials and methods RUTE is equipped with a linear accelerator. A team of 10 physicians, specialised in different oncology pathologies, travel to RUTE on a rotational basis from the main Radiation Oncology Department. Simulation and planning of treatment is managed at the Radiation Oncology Department in Reus. Patients from RUTE only have to visit the centre in Reus once throughout the treatment process. Results Since August 2008, 1500 patients have completed treatment in the satellite unit. The implementation of RUTE has greatly improved the comfort of patients and along with that, there have been important savings in transport costs to the regional health care system. Conclusions Despite the high technological requirements of our speciality, decentralising radiotherapy is feasible. We can guarantee the highest standards of treatment with no differences from attending the main centre. It implies a clear benefit for the comfort of the patients and an economic benefit by decreasing transport costs. PMID:25859402

Evidence-Based Carotid Interventions for Stroke Prevention: State-of-the-art Review

PubMed Central

Morris, Dylan R.; Ayabe, Kengo; Inoue, Takashi; Sakai, Nobuyuki; Bulbulia, Richard; Halliday, Alison

2017-01-01

Carotid artery stenosis is responsible for between 10–20% of all ischaemic strokes. Interventions, such as carotid end-arterectomy and carotid stenting, effectively reduce the risk of stroke in selected individuals. This review describes the history of carotid interventions, and summarises reliable evidence on the safety and efficacy of these interventions gained from large randomised clinical trials. Early trials comparing carotid endarterectomy to medical therapy alone in symptomatic patients, and asymptomatic patients, demonstrated that endarterectomy halved the risk of stroke and perioperative death in these two unique populations. The absolute risk reduction was smaller in the asymptomatic carotid trials, consistent with their lower absolute stroke risk. More recent trials in symptomatic patients, suggest that carotid stenting has similar long term durability to carotid endarterectomy, but possibly has higher procedural hazards dominated by non-disabling strokes. The Asymptomatic Carotid Surgery Trial-2, along with individual patient data meta-analysis of all asymptomatic trials, will provide reliable evidence for the choice of intervention in asymptomatic patients in whom a decision has been made for carotid revascularisation. Given improvements in effective cardiovascular medical therapy, in particular lipid-lowering medications, there is renewed uncertainty as to whether carotid interventions still provide meaningful net reductions in stroke risk in asymptomatic populations. Four large trials in Europe and the US are currently underway, and are expected to report longterm results in the next decade. It is essential that surgeons, interventionalists, and physicians continue to randomise large numbers of patients from around the world to clarify current uncertainty around the management of asymptomatic carotid stenosis. PMID:28260723

Rehabilitation and education are underutilized for mild stroke and TIA sufferers.

PubMed

Faux, Steven G; Arora, Pooja; Shiner, Christine T; Thompson-Butel, Angelica G; Klein, Linda A

2018-06-01

Transient ischemic attack (TIA) and mild stroke represent a large proportion of cerebrovascular events, at high risk of being followed by recurrent, serious events. The importance of early education addressing risk management, secondary prevention and lifestyle modifications is the centerpiece of further stroke prevention. However, delivering education and rehabilitation to this population can be complex and challenging. Via synthesis of a narrative review and clinical experience, we explore the unique and inherent complexities of rehabilitation management and education provision for patients following mild stroke and TIA. A considerable proportion of TIA/mild stroke survivors have ongoing rehabilitation needs that are poorly addressed. The need for rehabilitation in these patients is often overlooked, and available assessment tools lack the sensitivity to identify common subtle impairments in cognition, mood, language and fatigue. Active and accessible education interventions need to be initiated early after the event, and integrated with ongoing rehabilitation management. Priority areas in need of future development in this field are highlighted and discussed. Implications for rehabilitation Survivors of mild stroke and TIA have ongoing unmet rehabilitation needs and require a unique approach to rehabilitation and education. Rehabilitation needs are difficult to assess and poorly addressed in this cohort, where available assessment tools lack the sensitivity required to identify subtle impairments. Education needs to be initiated early after the event and involve active engagement of the patient in order to improve stroke knowledge, mood and motivate adherence to lifestyle modifications and secondary prevention. Rehabilitation physicians are currently an underutilized resource, who should be more involved in the management of all patients following TIA or mild stroke.

Outbreak of Pneumocystis Pneumonia in Renal and Liver Transplant Patients Caused by Genotypically Distinct Strains of Pneumocystis jirovecii1

PubMed Central

Rostved, Andreas A.; Sassi, Monica; Kurtzhals, Jørgen A. L.; Sørensen, Søren Schwartz; Rasmussen, Allan; Ross, Christian; Gogineni, Emile; Huber, Charles; Kutty, Geetha; Kovacs, Joseph A.; Helweg-Larsen, Jannik

2013-01-01

Background An outbreak of 29 cases of Pneumocystis jirovecii pneumonia (PCP) occurred among renal and liver transplant recipients (RTR and LTR) in the largest Danish transplantation centre between 2007 and 2010, when routine PCP prophylaxis was not used. Methods P. jirovecii isolates from 22 transplant-cases, 2 colonized RTRs and 19 Pneumocystis-control samples were genotyped by restriction fragment length polymorphism and multi-locus sequence typing analysis. Contact tracing were used to investigate transmission. Potential risk factors were compared between PCP cases and matched non-PCP transplant patients. Results Three unique Pneumocystis genotypes were shared among 19 of the RTRs, LTRs and a colonized RTR in 3 distinct clusters, two of which overlapped temporally. In contrast, Pneumocystis-control samples harbored a wide range of genotypes. Evidence of possible nosocomial transmission was observed. Among several potential risk factors, only CMV viremia was consistently associated with PCP (P = 0.03; P = 0.009). Mycophenolate mofetile was associated with PCP risk only in the RTR population (P = 0.04). Conclusion We identified three large groups infected with unique strains of Pneumocystis and provide evidence of an outbreak profile and nosocomial transmission. LTRs may be infected in PCP outbreaks simultaneously with RTRs and by the same strains, most likely by inter-human transmission. Patients are at risk several years after transplantation, but the risk is highest during the first 6 months post-transplantation. Since patients at risk cannot be identified clinically and outbreaks cannot be predicted, six months of PCP chemoprophylaxis should be considered for all renal and liver transplant recipients. PMID:23903011

Outbreak of pneumocystis pneumonia in renal and liver transplant patients caused by genotypically distinct strains of Pneumocystis jirovecii.

PubMed

Rostved, Andreas A; Sassi, Monica; Kurtzhals, Jørgen A L; Sørensen, Søren Schwartz; Rasmussen, Allan; Ross, Christian; Gogineni, Emile; Huber, Charles; Kutty, Geetha; Kovacs, Joseph A; Helweg-Larsen, Jannik

2013-11-15

An outbreak of 29 cases of Pneumocystis jirovecii pneumonia (PCP) occurred among renal and liver transplant recipients (RTR and LTR) in the largest Danish transplantation centre between 2007 and 2010, when routine PCP prophylaxis was not used. P. jirovecii isolates from 22 transplant cases, 2 colonized RTRs, and 19 Pneumocystis control samples were genotyped by restriction fragment length polymorphism and multilocus sequence typing analysis. Contact tracing was used to investigate transmission. Potential risk factors were compared between PCP cases and matched non-PCP transplant patients. Three unique Pneumocystis genotypes were shared among 19 of the RTRs, LTRs, and a colonized RTR in three distinct clusters, two of which overlapped temporally. In contrast, Pneumocystis control samples harbored a wide range of genotypes. Evidence of possible nosocomial transmission was observed. Among several potential risk factors, only cytomegalovirus viremia was consistently associated with PCP (P=0.03; P=0.009). Mycophenolate mofetil was associated with PCP risk only in the RTR population (P=0.04). We identified three large groups infected with unique strains of Pneumocystis and provide evidence of an outbreak profile and nosocomial transmission. LTRs may be infected in PCP outbreaks simultaneously with RTRs and by the same strains, most likely by interhuman transmission. Patients are at risk several years after transplantation, but the risk is highest during the first 6 months after transplantation. Because patients at risk cannot be identified clinically and outbreaks cannot be predicted, 6 months of PCP chemoprophylaxis should be considered for all RTRs and LTRs.

Unique identification code for medical fundus images using blood vessel pattern for tele-ophthalmology applications.

PubMed

Singh, Anushikha; Dutta, Malay Kishore; Sharma, Dilip Kumar

2016-10-01

Identification of fundus images during transmission and storage in database for tele-ophthalmology applications is an important issue in modern era. The proposed work presents a novel accurate method for generation of unique identification code for identification of fundus images for tele-ophthalmology applications and storage in databases. Unlike existing methods of steganography and watermarking, this method does not tamper the medical image as nothing is embedded in this approach and there is no loss of medical information. Strategic combination of unique blood vessel pattern and patient ID is considered for generation of unique identification code for the digital fundus images. Segmented blood vessel pattern near the optic disc is strategically combined with patient ID for generation of a unique identification code for the image. The proposed method of medical image identification is tested on the publically available DRIVE and MESSIDOR database of fundus image and results are encouraging. Experimental results indicate the uniqueness of identification code and lossless recovery of patient identity from unique identification code for integrity verification of fundus images. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Integration of Molecular Pathology, Epidemiology, and Social Science for Global Precision Medicine

PubMed Central

Nishi, Akihiro; Milner, Danny A; Giovannucci, Edward L.; Nishihara, Reiko; Tan, Andy S.; Kawachi, Ichiro; Ogino, Shuji

2015-01-01

Summary The precision medicine concept and the unique disease principle imply that each patient has unique pathogenic processes resulting from heterogeneous cellular genetic and epigenetic alterations, and interactions between cells (including immune cells) and exposures, including dietary, environmental, microbial, and lifestyle factors. As a core method field in population health science and medicine, epidemiology is a growing scientific discipline that can analyze disease risk factors, and develop statistical methodologies to maximize utilization of big data on populations and disease pathology. The evolving transdisciplinary field of molecular pathological epidemiology (MPE) can advance biomedical and health research by linking exposures to molecular pathologic signatures, enhancing causal inference, and identifying potential biomarkers for clinical impact. The MPE approach can be applied to any diseases, although it has been most commonly used in neoplastic diseases (including breast, lung and colorectal cancers) because of availability of various molecular diagnostic tests. However, use of state-of-the-art genomic, epigenomic and other omic technologies and expensive drugs in modern healthcare systems increases racial, ethnic and socioeconomic disparities. To address this, we propose to integrate molecular pathology, epidemiology, and social science. Social epidemiology integrates the latter two fields. The integrative social MPE model can embrace sociology, economics and precision medicine, address global health disparities and inequalities, and elucidate biological effects of social environments, behaviors, and networks. We foresee advancements of molecular medicine, including molecular diagnostics, biomedical imaging, and targeted therapeutics, which should benefit individuals in a global population, by means of an interdisciplinary approach of integrative MPE and social health science. PMID:26636627

Economic measurement of medical errors using a hospital claims database.

PubMed

David, Guy; Gunnarsson, Candace L; Waters, Heidi C; Horblyuk, Ruslan; Kaplan, Harold S

2013-01-01

The primary objective of this study was to estimate the occurrence and costs of medical errors from the hospital perspective. Methods from a recent actuarial study of medical errors were used to identify medical injuries. A visit qualified as an injury visit if at least 1 of 97 injury groupings occurred at that visit, and the percentage of injuries caused by medical error was estimated. Visits with more than four injuries were removed from the population to avoid overestimation of cost. Population estimates were extrapolated from the Premier hospital database to all US acute care hospitals. There were an estimated 161,655 medical errors in 2008 and 170,201 medical errors in 2009. Extrapolated to the entire US population, there were more than 4 million unique injury visits containing more than 1 million unique medical errors each year. This analysis estimated that the total annual cost of measurable medical errors in the United States was $985 million in 2008 and just over $1 billion in 2009. The median cost per error to hospitals was $892 for 2008 and rose to $939 in 2009. Nearly one third of all medical injuries were due to error in each year. Medical errors directly impact patient outcomes and hospitals' profitability, especially since 2008 when Medicare stopped reimbursing hospitals for care related to certain preventable medical errors. Hospitals must rigorously analyze causes of medical errors and implement comprehensive preventative programs to reduce their occurrence as the financial burden of medical errors shifts to hospitals. Copyright © 2013 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

Integration of molecular pathology, epidemiology and social science for global precision medicine.

PubMed

Nishi, Akihiro; Milner, Danny A; Giovannucci, Edward L; Nishihara, Reiko; Tan, Andy S; Kawachi, Ichiro; Ogino, Shuji

2016-01-01

The precision medicine concept and the unique disease principle imply that each patient has unique pathogenic processes resulting from heterogeneous cellular genetic and epigenetic alterations and interactions between cells (including immune cells) and exposures, including dietary, environmental, microbial and lifestyle factors. As a core method field in population health science and medicine, epidemiology is a growing scientific discipline that can analyze disease risk factors and develop statistical methodologies to maximize utilization of big data on populations and disease pathology. The evolving transdisciplinary field of molecular pathological epidemiology (MPE) can advance biomedical and health research by linking exposures to molecular pathologic signatures, enhancing causal inference and identifying potential biomarkers for clinical impact. The MPE approach can be applied to any diseases, although it has been most commonly used in neoplastic diseases (including breast, lung and colorectal cancers) because of availability of various molecular diagnostic tests. However, use of state-of-the-art genomic, epigenomic and other omic technologies and expensive drugs in modern healthcare systems increases racial, ethnic and socioeconomic disparities. To address this, we propose to integrate molecular pathology, epidemiology and social science. Social epidemiology integrates the latter two fields. The integrative social MPE model can embrace sociology, economics and precision medicine, address global health disparities and inequalities, and elucidate biological effects of social environments, behaviors and networks. We foresee advancements of molecular medicine, including molecular diagnostics, biomedical imaging and targeted therapeutics, which should benefit individuals in a global population, by means of an interdisciplinary approach of integrative MPE and social health science.

Divergence in sink contributions to population persistence

EPA Science Inventory

Population sinks present unique conservation challenges. The loss of animals in sinks can compromise persistence. Conversely, sinks can bolster population sizes, improving viability. To assess the contribution of sinks to regional persistence, we simulated the removal of sink hab...

Ataxia-telangiectasia: founder effect among north African Jews.

PubMed

Gilad, S; Bar-Shira, A; Harnik, R; Shkedy, D; Ziv, Y; Khosravi, R; Brown, K; Vanagaite, L; Xu, G; Frydman, M; Lavin, M F; Hill, D; Tagle, D A; Shiloh, Y

1996-12-01

The ATM gene is responsible for the autosomal recessive disorder ataxia-telangiectasia (A-T), characterized by cerebellar degeneration, immunodeficiency and cancer predisposition. A-T carriers were reported to be moderately cancer-prone. A wide variety of A-T mutations, most of which are unique to single families, were identified in various ethnic groups, precluding carrier screening with mutation-specific assays. However, a single mutation was observed in 32/33 defective ATM alleles in Jewish A-T families of North African origin, coming from various regions of Morocco and Tunisia. This mutation, 103C-->T, results in a stop codon at position 35 of the ATM protein. In keeping with the nature of this mutation, various antibodies directed against the ATM protein failed to defect this protein in patient cells. A rapid carrier detection assay detected this mutation in three out of 488 ATM alleles of Jewish Moroccan or Tunisian origin. This founder effect provides a unique opportunity for population-based screening for A-T carriers in a large Jewish community.

A comprehensive database of the geographic spread of past human Ebola outbreaks

PubMed Central

Mylne, Adrian; Brady, Oliver J.; Huang, Zhi; Pigott, David M.; Golding, Nick; Kraemer, Moritz U.G.; Hay, Simon I.

2014-01-01

Ebola is a zoonotic filovirus that has the potential to cause outbreaks of variable magnitude in human populations. This database collates our existing knowledge of all known human outbreaks of Ebola for the first time by extracting details of their suspected zoonotic origin and subsequent human-to-human spread from a range of published and non-published sources. In total, 22 unique Ebola outbreaks were identified, composed of 117 unique geographic transmission clusters. Details of the index case and geographic spread of secondary and imported cases were recorded as well as summaries of patient numbers and case fatality rates. A brief text summary describing suspected routes and means of spread for each outbreak was also included. While we cannot yet include the ongoing Guinea and DRC outbreaks until they are over, these data and compiled maps can be used to gain an improved understanding of the initial spread of past Ebola outbreaks and help evaluate surveillance and control guidelines for limiting the spread of future epidemics. PMID:25984346

A comprehensive database of the geographic spread of past human Ebola outbreaks.

PubMed

Mylne, Adrian; Brady, Oliver J; Huang, Zhi; Pigott, David M; Golding, Nick; Kraemer, Moritz U G; Hay, Simon I

2014-01-01

Ebola is a zoonotic filovirus that has the potential to cause outbreaks of variable magnitude in human populations. This database collates our existing knowledge of all known human outbreaks of Ebola for the first time by extracting details of their suspected zoonotic origin and subsequent human-to-human spread from a range of published and non-published sources. In total, 22 unique Ebola outbreaks were identified, composed of 117 unique geographic transmission clusters. Details of the index case and geographic spread of secondary and imported cases were recorded as well as summaries of patient numbers and case fatality rates. A brief text summary describing suspected routes and means of spread for each outbreak was also included. While we cannot yet include the ongoing Guinea and DRC outbreaks until they are over, these data and compiled maps can be used to gain an improved understanding of the initial spread of past Ebola outbreaks and help evaluate surveillance and control guidelines for limiting the spread of future epidemics.

What We Do and Do Not Know About Women and Kidney Diseases; Questions Unanswered and Answers Unquestioned: Reflection on World Kidney Day and International Woman’s Day

PubMed Central

Piccoli, Giorgina B.; Alrukhaimi, Mona; Liu, Zhi-Hong; Zakharova, Elena; Levin, Adeera

2018-01-01

Background: Chronic kidney disease affects approximately 10% of the world’s adult population: It is within the top 20 causes of death worldwide, and its impact on patients and their families can be devastating. World Kidney Day and International Women’s Day in 2018 coincide, thus giving an occasion to reflect on open questions on the importance of kidney health in women for the present and the future generations. Objectives: In this review, we summarize some aspects that are unique to women’s kidney health, offering an opportunity to reflect on the importance of women’s health and specifically their kidney health, on the community, and the next generations, as well as to strive to be more curious about the unique aspects of kidney disease in women so that we may apply those learnings more broadly. Findings: Girls and women, who make up approximately 50% of the world’s population, are important contributors to society and their families. Gender differences continue to exist around the world in access to education, medical care, and participation in clinical studies. Pregnancy is not only a unique state for women, offering an opportunity for diagnosis of kidney disease, but also a state where acute and chronic kidney diseases may manifest, and which may impact future generations with respect to kidney health. There are various autoimmune and other conditions that are more likely to impact women with profound consequences for childbearing, and on the fetus. Women have different complications on dialysis than men, and are more likely to be donors than recipients of kidney transplants. Conclusion: Improving knowledge on women, kidney health, and kidney disease, may be a way to improve outcomes of kidney diseases worldwide. PMID:29552348

Population genetics of Cryptosporidium meleagridis in humans and birds: evidence for cross-species transmission.

PubMed

Wang, Yuanfei; Yang, Wenli; Cama, Vitaliano; Wang, Lin; Cabrera, Lilia; Ortega, Ynes; Bern, Caryn; Feng, Yaoyu; Gilman, Robert; Xiao, Lihua

2014-07-01

Population genetic studies have been used to understand the transmission of pathogens in humans and animals, especially the role of zoonotic infections and evolution and dispersal of virulent subtypes. In this study, we analysed the genetic diversity and population structure of Cryptosporidium meleagridis, the only known Cryptosporidium species that infects both avian and mammalian hosts and is responsible for approximately 10% of human cryptosporidiosis in some areas. A total of 62 C. meleagridis specimens from children, AIDS patients, and birds in Lima, Peru were characterised by sequence analysis of the ssrRNA gene and five minisatellite, microsatellite and polymorphic markers in chromosome 6, including the 60 kDa glycoprotein (gp60), 47 kDa glycoprotein (CP47), a serine repeat antigen (MSC6-5), retinitis pigmentosa GTPase regulator (RPGR) and thrombospondin protein 8 (TSP8). The multilocus sequence analysis identified concurrent infections with Cryptosporidium hominis in four AIDS patients and three children. Unique subtypes of C. meleagridis ranged from eight at the gp60 locus (gene diversity -Hd=0.651), three at the RPGR (Hd=0.556), three at the MSC6-5 locus (Hd=0.242), two at TSP8 (Hd=0.198), to one at CP47 (monomorphic), much lower than that of C. hominis in the same area. Intragenic linkage disequilibrium was strong and complete at all gene loci. Intergenic linkage disequilibrium was highly significant (P<0.001) for all pairs of polymorphic loci. Two major groups of subtypes were seen, with most subtypes belonging to group 1. Within group 1, there was no clear population segregation, and two of the 14 multilocus subtypes of C. meleagridis were found in both AIDS patients and birds. We believe that these results provide the first evidence of a clonal population structure of C. meleagridis and the likely occurrence of cross-species transmission of C. meleagridis between birds and humans. Published by Elsevier Ltd.

The Lung Microbiome After Lung Transplantation

PubMed Central

Becker, Julia B.; Poroyko, Valeriy

2014-01-01

Summary Lung transplantation survival remains significantly impacted by infections and the development of chronic rejection manifesting as bronchiolitis obliterans syndrome (BOS). Traditional microbiologic data has provided insight into the role of infections in BOS. Now, new non-culture-based techniques have been developed to characterize the entire population of microbes resident on the surfaces of the body, also known as the human microbiome. Early studies have identified that lung transplant patients have a different lung microbiome and have demonstrated the important finding that the transplant lung microbiome changes over time. Furthermore, both unique bacterial populations and longitudinal changes in the lung microbiome have now been suggested to play a role in the development of BOS. In the future, this technology will need to be combined with functional assays and assessment of the immune responses in the lung to help further explain the microbiome’s role in the failing lung allograft. PMID:24601662

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

The growing role of noninvasive ventilation in patients requiring prolonged mechanical ventilation.

PubMed

Hess, Dean R

2012-06-01

For many patients with chronic respiratory failure requiring ventilator support, noninvasive ventilation (NIV) is preferable to invasive support by tracheostomy. Currently available evidence does not support the use of nocturnal NIV in unselected patients with stable COPD. Several European studies have reported benefit for high intensity NIV, in which setting of inspiratory pressure and respiratory rate are selected to achieve normocapnia. There have also been studies reporting benefit for the use of NIV as an adjunct to exercise training. NIV may be useful as an adjunct to airway clearance techniques in patients with cystic fibrosis. Accumulating evidence supports the use of NIV in patients with obesity hypoventilation syndrome. There is considerable observational evidence supporting the use of NIV in patients with chronic respiratory failure related to neuromuscular disease, and one randomized controlled trial reported that the use of NIV was life-prolonging in patients with amyotrophic lateral sclerosis. A variety of interfaces can be used to provide NIV in patients with stable chronic respiratory failure. The mouthpiece is an interface that is unique in this patient population, and has been used with success in patients with neuromuscular disease. Bi-level pressure ventilators are commonly used for NIV, although there are now a new generation of intermediate ventilators that are portable, have a long battery life, and can be used for NIV and invasive applications. Pressure support ventilation, pressure controlled ventilation, and volume controlled ventilation have been used successfully for chronic applications of NIV. New modes have recently become available, but their benefits await evidence to support their widespread use. The success of NIV in a given patient population depends on selection of an appropriate patient, selection of an appropriate interface, selection of an appropriate ventilator and ventilator settings, the skills of the clinician, the motivation of the patient, and the support of the family. 2012 Daedalus Enterprises

Patient trends in orthopedic traumas and related disorders after tsunami caused by the Great East Japan Earthquake: An experience in the primary referral medical center.

PubMed

Matsuzawa, Gaku; Sano, Hirotaka; Ohnuma, Hideji; Tomiya, Akihito; Kuwahara, Yoshiyuki; Hashimoto, Chihiro; Imamura, Itaru; Ishibashi, Satoru; Kobayashi, Michio; Kobayashi, Masakazu; Ishii, Tadashi; Kaneda, Iwao; Itoi, Eiji

2016-07-01

In the Great East Japan Earthquake, the Japanese Red Cross Ishinomaki Hospital played an important role as a principal referral center within the Ishinomaki region, one of the most severely affected areas in eastern Japan. The present study describes the patient population, clinical characteristics, and time courses of the medical problems observed at this hospital. A retrospective survey of medical logs and records was conducted on the first 2 weeks after the earthquake to characterize orthopedic traumas and related disorders treated during this catastrophe. Patient number, severity of injuries, number of patients secondarily transported to the referral medical centers in the inland area, and the number of surgeries performed during the study period were investigated. Totally, 7686 patients visited the hospital. Of which, 1807 patients suffered from exogenous diseases, such as trauma, burns, crush syndrome, deep venous thrombosis, and infectious diseases. Patients who suffered from hypothermia were the most frequently seen within the first 2 weeks after the earthquake. Interestingly, most patients' conditions were not severe and required only simple treatments. Four patients (0.2% of patients with exogenous diseases) were secondarily transported to the referral medical centers in the inland area and only four patients were surgically treated because of a lack of available implants, surgical devices, and electric power supply. The Great East Japan Earthquake and subsequent tsunami, which occurred during an early spring afternoon, resulted in a unique orthopedic patient population, which included few severely injured patients compared with numerous deaths. We believe that each coastal region hospital should develop its own emergency medical care system to address future tsunami events while considering their surrounding environment. The information described in the present study should be important for preparation toward future events involving massive earthquakes followed by tsunami disasters. Copyright © 2016 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

The long reach of Alzheimer's disease: patients, practice, and policy.

PubMed

Bynum, Julie P W

2014-04-01

The impact of Alzheimer's disease and related dementias reaches well beyond the health care needs of the person with dementia. As dementia inexorably progresses, the patient becomes increasingly dependent on others for basic daily care and routine tasks, a physically safe environment, and protection from exploitation or abuse. Addressing the diverse medical and social care needs of the burgeoning US population with Alzheimer's disease and related dementias requires the adoption of a broad-based policy framework and agenda that explicitly acknowledge the complex and unique needs of people with dementia and the impacts of dementia on caregivers and society at large. Public policies related to social service providers, agencies that provide appropriate housing, financial and legal services, and law enforcement must complement other policies focused on prevention and risk reduction, effective treatment development, and efficient health care delivery.

Cultural Humility: An Active Concept to Drive Correctional Nursing Practice.

PubMed

Steefel, Lorraine

Correctional nursing practice is focused on a unique patient population: inmates who present with their own ethnicities and have an imposed culture from the prison structure. As such, culture must be considered to provide holistic care. Madeleine Leininger's Theory of Culture Care Diversity and Universality, which maintains that care is the essence of nursing (without inclusion of culture, there is no care), suggests three nursing actions: to maintain the patient's culture, make accommodations for it, and/or repattern cultural ways that may be unhealthful. Given that correctional nurses work within the context (and culture) of custody, Leininger's nursing actions may not always be feasible; however, showing an underlying attitude of cultural humility is. In this article, cultural humility, the basis of culturally competent care, is described in a manner that can drive nursing practice in corrections.

Profiling Patients' Healthcare Needs to Support Integrated, Person-Centered Models for Long-Term Disease Management (Profile): Research Design.

PubMed

Elissen, Arianne Mj; Hertroijs, Dorijn Fl; Schaper, Nicolaas C; Vrijhoef, Hubertus Jm; Ruwaard, Dirk

2016-04-29

This article presents the design of PROFILe, a study investigating which (bio)medical and non-(bio)medical patient characteristics should guide more tailored chronic care. Based on this insight, the project aims to develop and validate 'patient profiles' that can be used in practice to determine optimal treatment strategies for subgroups of chronically ill with similar healthcare needs and preferences. PROFILe is a practice-based research comprising four phases. The project focuses on patients with type 2 diabetes. During the first study phase, patient profiles are drafted based on a systematic literature research, latent class growth modeling, and expert collaboration. In phase 2, the profiles are validated from a clinical, patient-related and statistical perspective. Phase 3 involves a discrete choice experiment to gain insight into the patient preferences that exist per profile. In phase 4, the results from all analyses are integrated and recommendations formulated on which patient characteristics should guide tailored chronic care. PROFILe is an innovative study which uses a uniquely holistic approach to assess the healthcare needs and preferences of chronically ill. The patient profiles resulting from this project must be tested in practice to investigate the effects of tailored management on patient experience, population health and costs.

Native American health: traditional healing and culturally competent health care internet resources.

PubMed

Carlock, Danielle

2006-01-01

Health disparities between Native Americans and the general population of the United States are a major health concern. Traditional healing and culturally competent health care offer much promise in raising the health status of Native Americans. Traditional healing, although uniquely practiced by each indigenous culture, is generally a system of medicine based on the inseparability of mind, body, and spirit. Culturally competent health care, care that is congruent with the culture and language of the patient, is a growing initiative in western medicine. This article outlines Internet sites and online resources relevant to the study and practice of traditional healing and culturally competent health care.

Ethics of End of Life Decisions in Pediatrics: A Narrative Review of the Roles of Caregivers, Shared Decision-Making, and Patient Centered Values.

PubMed

Santoro, Jonathan D; Bennett, Mariko

2018-04-26

Background: This manuscript reviews unique aspects of end of life decision-making in pediatrics. Methods: A narrative literature review of pediatric end of life issues was performed in the English language. Results: While a paternalistic approach is typically applied to children with life-limiting medical prognoses, the cognitive, language, and physical variability in this patient population is wide and worthy of review. In end of life discussions in pediatrics, the consideration of a child’s input is often not reviewed in depth, although a shared decision-making model is ideal for use, even for children with presumed limitations due to age. This narrative review of end of life decision-making in pediatric care explores nomenclature, the introduction of the concept of death, relevant historical studies, limitations to the shared decision-making model, the current state of end of life autonomy in pediatrics, and future directions and needs. Although progress is being made toward a more uniform and standardized approach to care, few non-institutional protocols exist. Complicating factors in the lack of guidelines include the unique facets of pediatric end of life care, including physical age, paternalism, the cognitive and language capacity of patients, subconscious influencers of parents, and normative values of death in pediatrics. Conclusions: Although there have been strides in end of life decision-making in pediatrics, further investigation and research is needed in this field.

Description of the case mix experienced by chiropractic students during a clinical internship.

PubMed

Puhl, Aaron A; Reinhart, Christine J; Injeyan, H Stephen; Tibbles, Anthony

2017-10-01

The primary objective of this study was to describe the case mix experienced by chiropractic students during their clinical internship at the Canadian Memorial Chiropractic College. Secondary objectives were to characterize teaching clinic patient populations, assess the similarity to previously published data for practicing chiropractors, and describe the treatment plans being recommended by interns. A prospective, observational study was conducted using a convenience sample of 24 chiropractic interns. Data were collected by interns using a standardized form that was completed for each new patient and each new complaint examined during the 1-year internship. Standardized forms included data regarding patient demographics, complaint characteristics, and treatment recommendations. Data were included for 23 of 24 participating interns, who described 828 patients and a total of 948 unique complaint presentations. Overall, 60% of patients were female, 86% were 18 to 64 years old, and 23% were naive to chiropractic care. Of all presenting complaints, 93% were pain-based, 67% were chronic, 65% included spinal complaints, and 7% presented with red flags; individual interns' experiences were variable and are described. On average, treatment recommendations called for 9.4 visits and often included multimodal treatment approaches, most commonly soft-tissue therapies (91%), home-based active care (84%), and spine manipulation (70%). The findings of this study suggest that patients presenting to CMCC teaching clinics are similar to those reported previously to attend private chiropractic clinics. While all participating interns encountered multiple complex clinical cases, very few had experience with pediatric populations. This study adds to the few that detail the characteristics of patients attending chiropractic teaching clinics; to our knowledge it is the first to describe average case loads of chiropractic interns.

Applying the WHO conceptual framework for the International Classification for Patient Safety to a surgical population

PubMed Central

McElroy, L. M.; Woods, D. M.; Yanes, A. F.; Skaro, A. I.; Daud, A.; Curtis, T.; Wymore, E.; Holl, J. L.; Abecassis, M. M.; Ladner, D. P.

2016-01-01

Objective Efforts to improve patient safety are challenged by the lack of universally agreed upon terms. The International Classification for Patient Safety (ICPS) was developed by the World Health Organization for this purpose. This study aimed to test the applicability of the ICPS to a surgical population. Design A web-based safety debriefing was sent to clinicians involved in surgical care of abdominal organ transplant patients. A multidisciplinary team of patient safety experts, surgeons and researchers used the data to develop a system of classification based on the ICPS. Disagreements were reconciled via consensus, and a codebook was developed for future use by researchers. Results A total of 320 debriefing responses were used for the initial review and codebook development. In total, the 320 debriefing responses contained 227 patient safety incidents (range: 0–7 per debriefing) and 156 contributing factors/hazards (0–5 per response). The most common severity classification was ‘reportable circumstance,’ followed by ‘near miss.’ The most common incident types were ‘resources/organizational management,’ followed by ‘medical device/equipment.’ Several aspects of surgical care were encompassed by more than one classification, including operating room scheduling, delays in care, trainee-related incidents, interruptions and handoffs. Conclusions This study demonstrates that a framework for patient safety can be applied to facilitate the organization and analysis of surgical safety data. Several unique aspects of surgical care require consideration, and by using a standardized framework for describing concepts, research findings can be compared and disseminated across surgical specialties. The codebook is intended for use as a framework for other specialties and institutions. PMID:26803539

Evaluating Adaptation of a Cancer Clinical Trial Decision Aid for Rural Cancer Patients: A Mixed-Methods Approach.

PubMed

Pathak, Swati; George, Nerissa; Monti, Denise; Robinson, Kathy; Politi, Mary C

2018-06-03

Rural-residing cancer patients often do not participate in clinical trials. Many patients misunderstand cancer clinical trials and their rights as participant. The purpose of this study is to modify a previously developed cancer clinical trials decision aid (DA), incorporating the unique needs of rural populations, and test its impact on knowledge and decision outcomes. The study was conducted in two phases. Phase I recruited 15 rural-residing cancer survivors in a qualitative usability study. Participants navigated the original DA and provided feedback regarding usability and implementation in rural settings. Phase II recruited 31 newly diagnosed rural-residing cancer patients. Patients completed a survey before and after using the revised DA, R-CHOICES. Primary outcomes included decisional conflict, decision self-efficacy, knowledge, communication self-efficacy, and attitudes towards and willingness to consider joining a trial. In phase I, the DA was viewed positively by rural-residing cancer survivors. Participants provided important feedback about factors rural-residing patients consider when thinking about trial participation. In phase II, after using R-CHOICES, participants had higher certainty about their choice (mean post-test = 3.10 vs. pre-test = 2.67; P = 0.025) and higher trial knowledge (mean percentage correct at post-test = 73.58 vs. pre-test = 57.77; P < 0.001). There was no significant change in decision self-efficacy, communication self-efficacy, and attitudes towards or willingness to join trials. The R-CHOICES improved rural-residing patients' knowledge of cancer clinical trials and reduced conflict about making a trial decision. More research is needed on ways to further support decisions about trial participation among this population.

High Prevalence of Mupirocin Resistance in Staphylococcus aureus Isolates from a Pediatric Population

PubMed Central

Antonov, Nina K.; Garzon, Maria C.; Morel, Kimberly D.; Whittier, Susan; Lauren, Christine T.

2015-01-01

Topical mupirocin is used widely to treat skin and soft tissue infections and to eradicate nasal carriage of methicillin-resistant Staphylococcus aureus (MRSA). Few studies to date have characterized the rates of S. aureus mupirocin resistance in pediatric populations. We retrospectively studied 358 unique S. aureus isolates obtained from 249 children seen in a predominantly outpatient setting by the Division of Pediatric Dermatology at a major academic center in New York City between 1 May 2012 and 17 September 2013. Mupirocin resistance rates and the associated risk factors were determined using a logistic regression analysis. In our patient population, 19.3% of patients had mupirocin-resistant S. aureus isolates at the time of their first culture, and 22.1% of patients with S. aureus infection had a mupirocin-resistant isolate at some time during the study period. Overall, 31.3% of all S. aureus isolates collected during the study period were resistant to mupirocin. Prior mupirocin use was strongly correlated (odds ratio [OR] = 26.5; P = <0.001) with mupirocin resistance. Additional risk factors for mupirocin resistance included methicillin resistance, atopic dermatitis (AD), epidermolysis bullosa (EB), immunosuppression, and residence in northern Manhattan and the Bronx. Resistance to mupirocin is widespread in children with dermatologic complaints in the New York City area, and given the strong association with mupirocin exposure, it is likely that mupirocin use contributes to the increased resistance. Routine mupirocin testing may be important for MRSA decolonization strategies or the treatment of minor skin infections in children. PMID:25824213

Molecular and genealogical evidence for a founder effect in Fanconi anemia families of the Afrikaner population of South Africa.

PubMed

Tipping, A J; Pearson, T; Morgan, N V; Gibson, R A; Kuyt, L P; Havenga, C; Gluckman, E; Joenje, H; de Ravel, T; Jansen, S; Mathew, C G

2001-05-08

Fanconi anemia (FA) is a rare, genetically heterogeneous autosomal recessive disorder associated with progressive aplastic anemia, congenital abnormalities, and cancer. FA has a very high incidence in the Afrikaner population of South Africa, possibly due to a founder effect. Previously we observed allelic association between polymorphic markers flanking the FA group A gene (FANCA) and disease chromosomes in Afrikaners. We genotyped 26 FA families with microsatellite and single nucleotide polymorphic markers and detected five FANCA haplotypes. Mutation scanning of the FANCA gene revealed association of these haplotypes with four different mutations. The most common was an intragenic deletion of exons 12-31, accounting for 60% of FA chromosomes in 46 unrelated Afrikaner FA patients, while two other mutations accounted for an additional 20%. Screening for these mutations in the European populations ancestral to the Afrikaners detected one patient from the Western Ruhr region of Germany who was heterozygous for the major deletion. The mutation was associated with the same unique FANCA haplotype as in Afrikaner patients. Genealogical investigation of 12 Afrikaner families with FA revealed that all were descended from a French Huguenot couple who arrived at the Cape on June 5, 1688, whereas mutation analysis showed that the carriers of the major mutation were descendants of this same couple. The molecular and genealogical evidence is consistent with transmission of the major mutation to Western Germany and the Cape near the end of the 17th century, confirming the existence of a founder effect for FA in South Africa.

Molecular and genealogical evidence for a founder effect in Fanconi anemia families of the Afrikaner population of South Africa

PubMed Central

Tipping, A. J.; Pearson, T.; Morgan, N. V.; Gibson, R. A.; Kuyt, L. P.; Havenga, C.; Gluckman, E.; Joenje, H.; de Ravel, T.; Jansen, S.; Mathew, C. G.

2001-01-01

Fanconi anemia (FA) is a rare, genetically heterogeneous autosomal recessive disorder associated with progressive aplastic anemia, congenital abnormalities, and cancer. FA has a very high incidence in the Afrikaner population of South Africa, possibly due to a founder effect. Previously we observed allelic association between polymorphic markers flanking the FA group A gene (FANCA) and disease chromosomes in Afrikaners. We genotyped 26 FA families with microsatellite and single nucleotide polymorphic markers and detected five FANCA haplotypes. Mutation scanning of the FANCA gene revealed association of these haplotypes with four different mutations. The most common was an intragenic deletion of exons 12–31, accounting for 60% of FA chromosomes in 46 unrelated Afrikaner FA patients, while two other mutations accounted for an additional 20%. Screening for these mutations in the European populations ancestral to the Afrikaners detected one patient from the Western Ruhr region of Germany who was heterozygous for the major deletion. The mutation was associated with the same unique FANCA haplotype as in Afrikaner patients. Genealogical investigation of 12 Afrikaner families with FA revealed that all were descended from a French Huguenot couple who arrived at the Cape on June 5, 1688, whereas mutation analysis showed that the carriers of the major mutation were descendants of this same couple. The molecular and genealogical evidence is consistent with transmission of the major mutation to Western Germany and the Cape near the end of the 17th century, confirming the existence of a founder effect for FA in South Africa. PMID:11344308

A Comprehensive Survey of Sequence Variation in the ABCA4 (ABCR) Gene in Stargardt Disease and Age-Related Macular Degeneration

PubMed Central

Rivera, Andrea; White, Karen; Stöhr, Heidi; Steiner, Klaus; Hemmrich, Nadine; Grimm, Timo; Jurklies, Bernhard; Lorenz, Birgit; Scholl, Hendrik P. N.; Apfelstedt-Sylla, Eckhart; Weber, Bernhard H. F.

2000-01-01

Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in age-related macular degeneration (AMD), a common cause of late-onset blindness, by studying 200 affected individuals with late-stage disease. Using a screening strategy based primarily on denaturing gradient gel electrophoresis, we have identified in the three study groups a total of 127 unique alterations, of which 90 have not been previously reported, and have classified 72 as probable pathogenic mutations. Of the 288 STGD chromosomes studied, mutations were identified in 166, resulting in a detection rate of ∼58%. Eight different alleles account for 61% of the identified disease alleles, and at least one of these, the L541P-A1038V complex allele, appears to be a founder mutation in the German population. When the group with AMD and the control group were analyzed with the same methodology, 18 patients with AMD and 12 controls were found to harbor possible disease-associated alterations. This represents no significant difference between the two groups; however, for detection of modest effects of rare alleles in complex diseases, the analysis of larger cohorts of patients may be required. PMID:10958763

A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration.

PubMed

Rivera, A; White, K; Stöhr, H; Steiner, K; Hemmrich, N; Grimm, T; Jurklies, B; Lorenz, B; Scholl, H P; Apfelstedt-Sylla, E; Weber, B H

2000-10-01

Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in age-related macular degeneration (AMD), a common cause of late-onset blindness, by studying 200 affected individuals with late-stage disease. Using a screening strategy based primarily on denaturing gradient gel electrophoresis, we have identified in the three study groups a total of 127 unique alterations, of which 90 have not been previously reported, and have classified 72 as probable pathogenic mutations. Of the 288 STGD chromosomes studied, mutations were identified in 166, resulting in a detection rate of approximately 58%. Eight different alleles account for 61% of the identified disease alleles, and at least one of these, the L541P-A1038V complex allele, appears to be a founder mutation in the German population. When the group with AMD and the control group were analyzed with the same methodology, 18 patients with AMD and 12 controls were found to harbor possible disease-associated alterations. This represents no significant difference between the two groups; however, for detection of modest effects of rare alleles in complex diseases, the analysis of larger cohorts of patients may be required.

Suture Button Fixation Treatment of Chronic Lisfranc Injury in Professional Dancers and High-Level Athletes.

PubMed

Charlton, Timothy; Boe, Chelsea; Thordarson, David B

2015-12-01

Chronic Lisfranc injury is a subtle and severe injury in high-level athletes, including dancers. This patient population is generally intolerant of intra-articular screw fixation and can develop significant post-traumatic arthritis with potentially career ending complications. Flexible fixation with suture-button devices provides potential restoration of physiologic motion at the joint, with appropriate support for healing that may facilitate return to en pointe activities for dancers. We hypothesized that the suture-button device would restore motion at the Lisfranc joint and allow for return to activities in this particular population without the limitations and complications of rigid fixation. We operated on seven dancers and high-level athletes with diagnosed Lisfranc injuries by installing a suture-button device. All patients had failed conservative management after late presentation. They were allowed to return to sport in 6 months, preoperative and postoperative American Orthopaedic Foot and Ankle Score (AOFAS) foot scores were obtained, and patients were followed for a minimum of 15 months. All seven returned to full activities in 6 months, with radiographic evidence of fixation and no complications to date. AOFAS foot scores improved from an average of 65 preoperatively to an average of 97 postoperatively at latest follow-up. It is concluded that flexible fixation with suture-button type device represents a viable alternative to screw fixation or fusion that may allow dancers and athletes to return to previous levels of activity after Lisfranc injury. This case series represents to our knowledge the first application of this device to a unique population that requires flexibility at the Lisfranc joint for performance.

Integration of genotoxicity and population genetic analyses in kangaroo rats (Dipodomys merriami) exposed to radionuclide contamination at the Nevada Test Site, USA

USGS Publications Warehouse

Theodorakis, Christopher W.; Bickham, John W.; Lamb, Trip; Medica, Philip A.; Lyne, T. Barrett

2001-01-01

We examined effects of radionuclide exposure at two atomic blast sites on kangaroo rats (Dipodomys merriami) at the Nevada Test Site, Nevada, USA, using genotoxicity and population genetic analyses. We assessed chromosome damage by micronucleus and flow cytometric assays and genetic variation by randomly amplified polymorphic DNA (RAPD) and mitochondrial DNA (mtDNA) analyses. The RAPD analysis showed no population structure, but mtDNA exhibited differentiation among and within populations. Genotoxicity effects were not observed when all individuals were analyzed. However, individuals with mtDNA haplotypes unique to the contaminated sites had greater chromosomal damage than contaminated-site individuals with haplotypes shared with reference sites. When interpopulation comparisons used individuals with unique haplotypes, one contaminated site had greater levels of chromosome damage than one or both of the reference sites. We hypothesize that shared-haplotype individuals are potential migrants and that unique-haplotype individuals are potential long-term residents. A parsimony approach was used to estimate the minimum number of migration events necessary to explain the haplotype distributions on a phylogenetic tree. The observed predominance of migration events into the contaminated sites supported our migration hypothesis. We conclude the atomic blast sites are ecological sinks and that immigration masks the genotoxic effects of radiation on the resident populations.

Outcomes and Disability After Massive Proximal Upper Extremity Reconstruction in a Resource-Limited Setting.

PubMed

Giladi, Aviram M; Shanmugakrishnan, R Raja; Venkatramani, Hari; Raja Sekaran, S; Chung, Kevin C; Sabapathy, S Raja

2017-06-01

At Ganga Hospital in Coimbatore, India, a unique approach is applied to treat massive upper limb injuries. However, long-term outcomes of complex reconstruction performed in the resource-limited setting are not known. This hinders understanding of outcomes and disability from these injuries and prevents systematically addressing care delivery around upper extremity trauma in the developing world. This project aims to analyze the details of the unique Ganga Hospital reconstruction experience and use patient-reported outcome measures for the first time in this patient population to evaluate post-injury recovery and disability . Forty-six patients were evaluated 6 months or more after massive proximal upper extremity reconstruction at Ganga Hospital. Patients completed functional tests, Jebsen-Taylor test (JTT), and patient-reported outcomes (PROs)-Michigan Hand Questionnaire (MHQ), Disability of Arm, Shoulder, and Hand questionnaire (DASH), and Short-Form 36 (SF-36). Correlations between metrics were assessed with Pearson's correlation coefficients. Linear regression modeling evaluated associations between severity, reconstruction, and outcomes. MHQ and DASH results correlated with functional test performance, JTT performance, and SF-36 scores (Pearson's coefficients all ≥0.33, p ≤ 0.05). In this cohort, mean MHQ score was 79 ± 15 and mean DASH score was 13 ± 15, which are not significantly different than scores for long-term outcomes after other complex upper extremity procedures. The following factors predicted PROs and functional performance after reconstruction: extent of soft tissue reconstruction, multi-segmental ulna fractures, median nerve injury, and ability for patients to return to work and maintain their job after injury. Complex proximal upper extremity salvage can be performed in the resource-limited setting with excellent long-term functional and patient-reported outcomes. PRO questionnaires are useful for reporting outcomes that correlate to functional and sensory testing and may be used to assess post-traumatic disability.

The Pediatric Patient-Centered Medical Home: Innovative models for improving behavioral health.

PubMed

Asarnow, Joan Rosenbaum; Kolko, David J; Miranda, Jeanne; Kazak, Anne E

2017-01-01

This article examines the concept of the Patient-Centered Medical Home (PCMH) as it applies to children and adolescents, emphasizing care for behavioral health conditions, the role of psychology and psychological science, and next steps for developing evidence-informed models for the Pediatric-PCMH. The PCMH concept for pediatric populations offers unique opportunities for psychological science to inform and enhance the transformation of the United States health care system and improve health in our nation. Available evidence on the outcomes of PCMH implementation for pediatric populations is limited, underscoring the need for additional research evaluating Pediatric-PCMH models and concepts. While behavioral health has only recently been emphasized as a formal part of the PCMH, accumulating evidence supports the effectiveness of some approaches for providing behavioral health care through pediatric primary care. These approaches suggest that a comprehensive Pediatric-PCMH model that includes behavioral health care has the potential to optimize the availability, quality, benefits, and cost-effectiveness of behavioral health services. This could ultimately enhance youth health and behavioral health, with effects potentially extending through the adult years. Rigorous research and demonstration projects are needed to guide further development of optimal strategies for improving health and behavioral health in pediatric populations and advancing the public health impact of behavioral health care services. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Urinary incontinence, fecal incontinence and pelvic organ prolapse in a population-based, racially diverse cohort. Prevalence and risk factors

PubMed Central

RORTVEIT, Guri; SUBAK, Leslee L.; THOM, David H.; CREASMAN, Jennifer M.; VITTINGHOFF, Eric; VAN DEN EEDEN, Stephen K.; BROWN, Jeanette S.

2016-01-01

Objectives We investigated the prevalence of and risk factors for combinations of urinary incontinence (UI), fecal incontinence (FI) and pelvic organ prolapse (POP) in racially diverse women over age 40. Methods The Reproductive Risks for Incontinence Study at Kaiser (RRISK) is a population-based study with data from 2106 women > 40 years. Pelvic floor conditions were determined by self-report. Risk factors were assessed by self-report, interview and record review. Independent risk factors were identified by multinomial logistic regression analysis. Results At least one pelvic floor condition was reported by 714 (34%) women. Of these, 494 (69%) had UI only, 60 (8%) POP only, and 46 (6%) had FI only. Both UI and FI were reported by 64 (9%), both UI and POP by 51 (7%). Among women with FI, 60% reported more than one condition. Corresponding figures for POP and UI were 49% and 18%. Estrogen use and constipation were shared risk factors for UI, FI and POP. BMI was a unique risk factor for UI only, diabetes for FI only and parity for POP only. No clear pattern could be found to support the hypothesis that risk factors for single conditions are more strongly associated with combined conditions. Conclusions Patients with FI or POP often have concomitant UI. These diseases both share and have unique risk factors in a complex pattern. PMID:22453506

The Contributions of Phonological and Morphological Awareness to Literacy Skills in the Adult Basic Education Population.

PubMed

Fracasso, Lucille E; Bangs, Kathryn; Binder, Katherine S

2016-01-01

The Adult Basic Education (ABE) population consists of a wide range of abilities with needs that may be unique to this set of learners. The purpose of this study was to better understand the relative contributions of phonological decoding and morphological awareness to spelling, vocabulary, and comprehension across a sample of ABE students. In this study, phonological decoding was a unique predictor of spelling ability, listening comprehension, and reading comprehension. We also found that morphological awareness was a unique predictor of spelling ability, vocabulary, and listening comprehension. Morphological awareness indirectly contributed to reading comprehension through vocabulary. These findings suggest the need for morphological interventions for this group of learners. © Hammill Institute on Disabilities 2014.

Learning Needs of Hospitalized Patients With Heart Failure in Singapore: A Descriptive Correlational Study.

PubMed

Ong, Shu-Fen; Foong, Pamela Pei-Mei; Seah, Juanna Shen-Hwei; Elangovan, Lavanya; Wang, Wenru

2017-11-28

Understanding the learning needs of patients with heart failure (HF) is important in reducing the incidence of HF-related hospital readmissions. Sociocultural differences are known to influence patient learning needs. However, most HF learning needs studies have been conducted on Western populations. The aim of this study was to investigate the learning needs of hospitalized patients with HF in Singapore. A cross-sectional, descriptive correlational design was adopted using a questionnaire survey that included the Heart Failure Learning Needs Inventory and sociodemographic and clinical datasheets. A convenience sample of 97 patients with HF was recruited from an acute hospital in Singapore. Findings revealed that education topics relating to signs and symptoms, risk factors, general HF information, and medications were perceived by participants as the most important. Contrastingly, education topics relating to diet, activity, and psychological factors were poorly valued. The only significant demographic factor that was correlated to the patients' learning needs was monthly household income, which correlated to education on HF risk factors and general HF information. This study supports the necessity of carefully prioritizing patient education topics in line with patient learning needs. Furthermore, education should be culturally sensitive and take into account the unique values, needs, and situations of patients.