Transposon Variants and Their Effects on Gene Expression in Arabidopsis
Wang, Xi; Weigel, Detlef; Smith, Lisa M.
2013-01-01
Transposable elements (TEs) make up the majority of many plant genomes. Their transcription and transposition is controlled through siRNAs and epigenetic marks including DNA methylation. To dissect the interplay of siRNA–mediated regulation and TE evolution, and to examine how TE differences affect nearby gene expression, we investigated genome-wide differences in TEs, siRNAs, and gene expression among three Arabidopsis thaliana accessions. Both TE sequence polymorphisms and presence of linked TEs are positively correlated with intraspecific variation in gene expression. The expression of genes within 2 kb of conserved TEs is more stable than that of genes next to variant TEs harboring sequence polymorphisms. Polymorphism levels of TEs and closely linked adjacent genes are positively correlated as well. We also investigated the distribution of 24-nt-long siRNAs, which mediate TE repression. TEs targeted by uniquely mapping siRNAs are on average farther from coding genes, apparently because they more strongly suppress expression of adjacent genes. Furthermore, siRNAs, and especially uniquely mapping siRNAs, are enriched in TE regions missing in other accessions. Thus, targeting by uniquely mapping siRNAs appears to promote sequence deletions in TEs. Overall, our work indicates that siRNA–targeting of TEs may influence removal of sequences from the genome and hence evolution of gene expression in plants. PMID:23408902
[siRNAs with high specificity to the target: a systematic design by CRM algorithm].
Alsheddi, T; Vasin, L; Meduri, R; Randhawa, M; Glazko, G; Baranova, A
2008-01-01
'Off-target' silencing effect hinders the development of siRNA-based therapeutic and research applications. Common solution to this problem is an employment of the BLAST that may miss significant alignments or an exhaustive Smith-Waterman algorithm that is very time-consuming. We have developed a Comprehensive Redundancy Minimizer (CRM) approach for mapping all unique sequences ("targets") 9-to-15 nt in size within large sets of sequences (e.g. transcriptomes). CRM outputs a list of potential siRNA candidates for every transcript of the particular species. These candidates could be further analyzed by traditional "set-of-rules" types of siRNA designing tools. For human, 91% of transcripts are covered by candidate siRNAs with kernel targets of N = 15. We tested our approach on the collection of previously described experimentally assessed siRNAs and found that the correlation between efficacy and presence in CRM-approved set is significant (r = 0.215, p-value = 0.0001). An interactive database that contains a precompiled set of all human siRNA candidates with minimized redundancy is available at http://129.174.194.243. Application of the CRM-based filtering minimizes potential "off-target" silencing effects and could improve routine siRNA applications.
Dendrimer Nanovectors for SiRNA Delivery.
Liu, Xiaoxuan; Peng, Ling
2016-01-01
Small interfering RNA (SiRNA) delivery remains a major challenge in RNAi-based therapy. Dendrimers are emerging as appealing nonviral vectors for SiRNA delivery thanks to their well-defined architecture and their unique cooperativity and multivalency confined within a nanostructure. We have recently demonstrated that structurally flexible poly(amidoamine) (PAMAM) dendrimers are safe and effective nanovectors for SiRNA delivery in various disease models in vitro and in vivo. The present chapter showcases these dendrimers can package different SiRNA molecules into stable and nanosized particles, which protect SiRNA from degradation and promote cellular uptake of SiRNA, resulting in potent gene silencing at both mRNA and protein level in the prostate cancer cell model. Our results demonstrate this set of flexible PAMAM dendrimers are indeed safe and effective nonviral vectors for SiRNA delivery and hold great promise for further applications in functional genomics and RNAi-based therapies.
Krishna, Srikar; Nair, Aparna; Cheedipudi, Sirisha; Poduval, Deepak; Dhawan, Jyotsna; Palakodeti, Dasaradhi; Ghanekar, Yashoda
2013-01-07
Small non-coding RNAs such as miRNAs, piRNAs and endo-siRNAs fine-tune gene expression through post-transcriptional regulation, modulating important processes in development, differentiation, homeostasis and regeneration. Using deep sequencing, we have profiled small non-coding RNAs in Hydra magnipapillata and investigated changes in small RNA expression pattern during head regeneration. Our results reveal a unique repertoire of small RNAs in hydra. We have identified 126 miRNA loci; 123 of these miRNAs are unique to hydra. Less than 50% are conserved across two different strains of Hydra vulgaris tested in this study, indicating a highly diverse nature of hydra miRNAs in contrast to bilaterian miRNAs. We also identified siRNAs derived from precursors with perfect stem-loop structure and that arise from inverted repeats. piRNAs were the most abundant small RNAs in hydra, mapping to transposable elements, the annotated transcriptome and unique non-coding regions on the genome. piRNAs that map to transposable elements and the annotated transcriptome display a ping-pong signature. Further, we have identified several miRNAs and piRNAs whose expression is regulated during hydra head regeneration. Our study defines different classes of small RNAs in this cnidarian model system, which may play a role in orchestrating gene expression essential for hydra regeneration.
Krishna, Srikar; Nair, Aparna; Cheedipudi, Sirisha; Poduval, Deepak; Dhawan, Jyotsna; Palakodeti, Dasaradhi; Ghanekar, Yashoda
2013-01-01
Small non-coding RNAs such as miRNAs, piRNAs and endo-siRNAs fine-tune gene expression through post-transcriptional regulation, modulating important processes in development, differentiation, homeostasis and regeneration. Using deep sequencing, we have profiled small non-coding RNAs in Hydra magnipapillata and investigated changes in small RNA expression pattern during head regeneration. Our results reveal a unique repertoire of small RNAs in hydra. We have identified 126 miRNA loci; 123 of these miRNAs are unique to hydra. Less than 50% are conserved across two different strains of Hydra vulgaris tested in this study, indicating a highly diverse nature of hydra miRNAs in contrast to bilaterian miRNAs. We also identified siRNAs derived from precursors with perfect stem–loop structure and that arise from inverted repeats. piRNAs were the most abundant small RNAs in hydra, mapping to transposable elements, the annotated transcriptome and unique non-coding regions on the genome. piRNAs that map to transposable elements and the annotated transcriptome display a ping–pong signature. Further, we have identified several miRNAs and piRNAs whose expression is regulated during hydra head regeneration. Our study defines different classes of small RNAs in this cnidarian model system, which may play a role in orchestrating gene expression essential for hydra regeneration. PMID:23166307
Wu, Sherry Y; Yang, Xianbin; Gharpure, Kshipra M; Hatakeyama, Hiroto; Egli, Martin; McGuire, Michael H; Nagaraja, Archana S; Miyake, Takahito M; Rupaimoole, Rajesha; Pecot, Chad V; Taylor, Morgan; Pradeep, Sunila; Sierant, Malgorzata; Rodriguez-Aguayo, Cristian; Choi, Hyun J; Previs, Rebecca A; Armaiz-Pena, Guillermo N; Huang, Li; Martinez, Carlos; Hassell, Tom; Ivan, Cristina; Sehgal, Vasudha; Singhania, Richa; Han, Hee-Dong; Su, Chang; Kim, Ji Hoon; Dalton, Heather J; Kovvali, Chandra; Keyomarsi, Khandan; McMillan, Nigel A J; Overwijk, Willem W; Liu, Jinsong; Lee, Ju-Seog; Baggerly, Keith A; Lopez-Berestein, Gabriel; Ram, Prahlad T; Nawrot, Barbara; Sood, Anil K
2014-03-12
Improving small interfering RNA (siRNA) efficacy in target cell populations remains a challenge to its clinical implementation. Here, we report a chemical modification, consisting of phosphorodithioate (PS2) and 2'-O-Methyl (2'-OMe) MePS2 on one nucleotide that significantly enhances potency and resistance to degradation for various siRNAs. We find enhanced potency stems from an unforeseen increase in siRNA loading to the RNA-induced silencing complex, likely due to the unique interaction mediated by 2'-OMe and PS2. We demonstrate the therapeutic utility of MePS2 siRNAs in chemoresistant ovarian cancer mouse models via targeting GRAM domain containing 1B (GRAMD1B), a protein involved in chemoresistance. GRAMD1B silencing is achieved in tumours following MePS2-modified siRNA treatment, leading to a synergistic anti-tumour effect in combination with paclitaxel. Given the previously limited success in enhancing siRNA potency with chemically modified siRNAs, our findings represent an important advance in siRNA design with the potential for application in numerous cancer types.
SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.
Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli
2017-02-01
RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.
Bousios, Alexandros; Diez, Concepcion M; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S
2016-02-01
Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host-TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. © 2016 Bousios et al.; Published by Cold Spring Harbor Laboratory Press.
Wu, Sherry Y.; Yang, Xianbin; Gharpure, Kshipra M.; Hatakeyama, Hiroto; Egli, Martin; McGuire, Michael H.; Nagaraja, Archana S.; Miyake, Takahito M.; Rupaimoole, Rajesha; Pecot, Chad V.; Taylor, Morgan; Pradeep, Sunila; Sierant, Malgorzata; Rodriguez-Aguayo, Cristian; Choi, Hyun J.; Previs, Rebecca A.; Armaiz-Pena, Guillermo N.; Huang, Li; Martinez, Carlos; Hassell, Tom; Ivan, Cristina; Sehgal, Vasudha; Singhania, Richa; Han, Hee-Dong; Su, Chang; Kim, Ji Hoon; Dalton, Heather J.; Kowali, Chandra; Keyomarsi, Khandan; McMillan, Nigel A.J.; Overwijk, Willem W.; Liu, Jinsong; Lee, Ju-Seog; Baggerly, Keith A.; Lopez-Berestein, Gabriel; Ram, Prahlad T.; Nawrot, Barbara; Sood, Anil K.
2014-01-01
Improving small interfering RNA (siRNA) efficacy in target cell populations remains a challenge to its clinical implementation. Here, we report a chemical modification, consisting of phosphorodithioate (PS2) and 2’-O-Methyl (2’-OMe) MePS2 on one nucleotide that significantly enhances potency and resistance to degradation for various siRNAs. We find enhanced potency stems from an unforeseen increase in siRNA loading to the RNA-induced silencing complex, likely due to the unique interaction mediated by 2’-OMe and PS2. We demonstrate the therapeutic utility of MePS2 siRNAs in chemoresistant ovarian cancer mouse models via targeting GRAM Domain Containing 1B (GRAMD1B), a protein involved in chemoresistance. GRAMD1B silencing is achieved in tumors following MePS2-modified siRNA treatment, leading to a synergistic anti-tumor effect in combination with paclitaxel. Given the previously limited success in enhancing siRNA potency with chemically modified siRNAs, our findings represent an important advance in siRNA design with the potential for application in numerous cancer types. PMID:24619206
siRNAmod: A database of experimentally validated chemically modified siRNAs.
Dar, Showkat Ahmad; Thakur, Anamika; Qureshi, Abid; Kumar, Manoj
2016-01-28
Small interfering RNA (siRNA) technology has vast potential for functional genomics and development of therapeutics. However, it faces many obstacles predominantly instability of siRNAs due to nuclease digestion and subsequently biologically short half-life. Chemical modifications in siRNAs provide means to overcome these shortcomings and improve their stability and potency. Despite enormous utility bioinformatics resource of these chemically modified siRNAs (cm-siRNAs) is lacking. Therefore, we have developed siRNAmod, a specialized databank for chemically modified siRNAs. Currently, our repository contains a total of 4894 chemically modified-siRNA sequences, comprising 128 unique chemical modifications on different positions with various permutations and combinations. It incorporates important information on siRNA sequence, chemical modification, their number and respective position, structure, simplified molecular input line entry system canonical (SMILES), efficacy of modified siRNA, target gene, cell line, experimental methods, reference etc. It is developed and hosted using Linux Apache MySQL PHP (LAMP) software bundle. Standard user-friendly browse, search facility and analysis tools are also integrated. It would assist in understanding the effect of chemical modifications and further development of stable and efficacious siRNAs for research as well as therapeutics. siRNAmod is freely available at: http://crdd.osdd.net/servers/sirnamod.
Chan, Wen-Ling; Yang, Wen-Kuang; Huang, Hsien-Da; Chang, Jan-Gowth
2013-01-01
RNA interference (RNAi) is a gene silencing process within living cells, which is controlled by the RNA-induced silencing complex with a sequence-specific manner. In flies and mice, the pseudogene transcripts can be processed into short interfering RNAs (siRNAs) that regulate protein-coding genes through the RNAi pathway. Following these findings, we construct an innovative and comprehensive database to elucidate siRNA-mediated mechanism in human transcribed pseudogenes (TPGs). To investigate TPG producing siRNAs that regulate protein-coding genes, we mapped the TPGs to small RNAs (sRNAs) that were supported by publicly deep sequencing data from various sRNA libraries and constructed the TPG-derived siRNA-target interactions. In addition, we also presented that TPGs can act as a target for miRNAs that actually regulate the parental gene. To enable the systematic compilation and updating of these results and additional information, we have developed a database, pseudoMap, capturing various types of information, including sequence data, TPG and cognate annotation, deep sequencing data, RNA-folding structure, gene expression profiles, miRNA annotation and target prediction. As our knowledge, pseudoMap is the first database to demonstrate two mechanisms of human TPGs: encoding siRNAs and decoying miRNAs that target the parental gene. pseudoMap is freely accessible at http://pseudomap.mbc.nctu.edu.tw/. Database URL: http://pseudomap.mbc.nctu.edu.tw/
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Huang, Weizhe; He, Ziying
2013-01-01
RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498
Li, Xiao C; Hopfer, Ulrich; Zhuo, Jia L
2009-11-01
Angiotensin II (ANG II) is taken up by proximal tubule (PT) cells via AT1 (AT1a) receptor-mediated endocytosis, but the underlying cellular mechanisms remain poorly understood. The present study tested the hypothesis that the microtubule- rather than the clathrin-dependent endocytic pathway regulates AT1-mediated uptake of ANG II and ANG II-induced sodium and hydrogen exchanger-3 (NHE-3) expression in PT cells. The expression of AT1 receptors, clathrin light (LC) and heavy chain (HC) proteins, and type 1 microtubule-associated proteins (MAPs; MAP-1A and MAP-1B) in PT cells were knocked down by their respective small interfering (si) RNAs before AT1-mediated FITC-ANG II uptake and ANG II-induced NHE-3 expression were studied. AT1 siRNAs inhibited AT1 expression and blocked ANG II-induced NHE-3 expression in PT cells, as expected (P < 0.01). Clathrin LC or HC siRNAs knocked down their respective proteins by approximately 90% with a peak response at 24 h, and blocked the clathrin-dependent uptake of Alexa Fluor 594-transferrin (P < 0.01). However, neither LC nor HC siRNAs inhibited AT1-mediated uptake of FITC-ANG II or affected ANG II-induced NHE-3 expression. MAP-1A or MAP-1B siRNAs markedly knocked down MAP-1A or MAP-1B proteins in a time-dependent manner with peak inhibitions at 48 h (>76.8%, P < 0.01). MAP protein knockdown resulted in approximately 52% decreases in AT1-mediated FITC-ANG II uptake and approximately 66% decreases in ANG II-induced NHE-3 expression (P < 0.01). These effects were associated with threefold decreases in ANG II-induced MAP kinases ERK 1/2 activation (P < 0.01), but not with altered AT1 expression or clathrin-dependent transferrin uptake. Both losartan and AT1a receptor deletion in mouse PT cells completely abolished the effects of MAP-1A knockdown on ANG II-induced NHE-3 expression and activation of MAP kinases ERK1/2. Our findings suggest that the alternative microtubule-dependent endocytic pathway, rather than the canonical clathrin-dependent pathway, plays an important role in AT1 (AT1a)-mediated uptake of extracellular ANG II and ANG II-induced NHE-3 expression in PT cells.
Misinterpreting the therapeutic effects of small interfering RNA caused by immune stimulation.
Robbins, Marjorie; Judge, Adam; Ambegia, Ellen; Choi, Catherine; Yaworski, Ed; Palmer, Lorne; McClintock, Kevin; MacLachlan, Ian
2008-10-01
Activation of innate immunity has direct effects in modulating viral replication, tumor growth, angiogenesis, and inflammatory and other immunological processes. It is now established that unmodified siRNA can activate this innate immune response and therefore there is real potential for siRNA to elicit nonspecific therapeutic effects in a wide range of disease models. Here we demonstrate that in a murine model of influenza infection, the antiviral activity of siRNA is due primarily to immune stimulation elicited by the active siRNA duplexes and is not the result of therapeutic RNA interference (RNAi) as previously reported. We show that the misinterpretation stems from the use of a particular control green fluorescent protein (GFP) siRNA that we identify as having unusually low immunostimulatory activity compared with the active anti-influenza siRNA. Curiously, this GFP siRNA has served as a negative control for a surprising number of groups reporting therapeutic effects of siRNA. The inert immunologic profile of the GFP sequence was unique among a broad panel of published siRNAs, all of which could elicit significant interferon induction from primary immune cells. This panel included eight active siRNAs against viral, angiogenic, and oncologic targets, the reported therapeutic efficacy of which was based on comparison with the nonimmunostimulatory GFP siRNA. These results emphasize the need for researchers to anticipate, monitor, and adequately control for siRNA-mediated immune stimulation and calls into question the interpretation of numerous published reports of therapeutic RNAi in vivo. The use of chemically modified siRNA with minimal immunostimulatory capacity will help to delineate more accurately the mechanism of action underlying such studies.
HIVsirDB: a database of HIV inhibiting siRNAs.
Tyagi, Atul; Ahmed, Firoz; Thakur, Nishant; Sharma, Arun; Raghava, Gajendra P S; Kumar, Manoj
2011-01-01
Human immunodeficiency virus (HIV) is responsible for millions of deaths every year. The current treatment involves the use of multiple antiretroviral agents that may harm patients due to their toxic nature. RNA interference (RNAi) is a potent candidate for the future treatment of HIV, uses short interfering RNA (siRNA/shRNA) for silencing HIV genes. In this study, attempts have been made to create a database HIVsirDB of siRNAs responsible for silencing HIV genes. HIVsirDB is a manually curated database of HIV inhibiting siRNAs that provides comprehensive information about each siRNA or shRNA. Information was collected and compiled from literature and public resources. This database contains around 750 siRNAs that includes 75 partially complementary siRNAs differing by one or more bases with the target sites and over 100 escape mutant sequences. HIVsirDB structure contains sixteen fields including siRNA sequence, HIV strain, targeted genome region, efficacy and conservation of target sequences. In order to facilitate user, many tools have been integrated in this database that includes; i) siRNAmap for mapping siRNAs on target sequence, ii) HIVsirblast for BLAST search against database, iii) siRNAalign for aligning siRNAs. HIVsirDB is a freely accessible database of siRNAs which can silence or degrade HIV genes. It covers 26 types of HIV strains and 28 cell types. This database will be very useful for developing models for predicting efficacy of HIV inhibiting siRNAs. In summary this is a useful resource for researchers working in the field of siRNA based HIV therapy. HIVsirDB database is accessible at http://crdd.osdd.net/raghava/hivsir/.
Tumor-targeted pH/redox dual-sensitive unimolecular nanoparticles for efficient siRNA delivery.
Chen, Guojun; Wang, Yuyuan; Xie, Ruosen; Gong, Shaoqin
2017-08-10
A unique pH/redox dual-sensitive cationic unimolecular nanoparticle (NP) enabling excellent endosomal/lysosomal escape and efficient siRNA decomplexation inside the target cells was developed for tumor-targeted delivery of siRNA. siRNA was complexed into the cationic core of the unimolecular NP through electrostatic interactions. The cationic core used for complexing siRNA contained reducible disulfide bonds that underwent intracellular reduction owing to the presence of high concentrations of reduced glutathione (GSH) inside the cells, thereby facilitating the decomplexation of siRNA from the unimolecular NPs. The cationic polymers were conjugated onto the hyperbranched core (H40) via a pH-sensitive bond, which further facilitated the decomplexation of siRNA from the NPs. In vitro studies on the siRNA release behaviors showed that dual stimuli (pH=5.3, 10mM GSH) induced the quickest release of siRNA from the NPs. In addition, the imidazole groups attached to the cationic polymer segments enhanced the endosomal/lysosomal escape of NPs via the proton sponge effect. Intracellular tracking studies revealed that siRNA delivered by unimolecular NPs was efficiently released to the cytosol. Moreover, the GE11 peptide, an anti-EGFR peptide, enhanced the cellular uptake of NPs in MDA-MB-468, an EFGR-overexpressing triple negative breast cancer (TNBC) cell line. The GE11-conjugated, GFP-siRNA-complexed NPs exhibited excellent GFP gene silencing efficiency in GFP-MDA-MB-468 TNBC cells without any significant cytotoxicity. Therefore, these studies suggest that this smart unimolecular NP could be a promising nanoplatform for targeted siRNA delivery to EFGR-overexpressing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Carbon nanotube-mediated siRNA delivery for gene silencing in cancer cells
NASA Astrophysics Data System (ADS)
Hong, Tu; Guo, Honglian; Xu, Yaqiong
2011-10-01
Small interfering RNA (siRNA) is potentially a promising tool in influencing gene expression with a high degree of target specificity. However, its poor intracellular uptake, instability in vivo, and non-specific immune stimulations impeded its effect in clinical applications. In this study, carbon nanotubes (CNTs) functionalized with two types of phospholipid-polyethylene glycol (PEG) have shown capabilities to stabilize siRNA in cell culture medium during the transfection and efficiently deliver siRNA into neuroblastoma and breast cancer cells. Moreover, the intrinsic optical properties of CNTs have been investigated through absorption and fluorescence measurements. We have found that the directly-functionalized groups play an important role on the fluorescence imaging of functionalized CNTs. The unique fluorescence imaging and high delivery efficiency make CNTs a promising material to deliver drugs and evaluate the treatment effect simultaneously.
2011-01-01
A novel triblock poly(amido amine)-poly(ethylene glycol)-poly-l-lysine (PAMAM-PEG-PLL) nanocarrier was designed, synthesized, and evaluated for the delivery of siRNA. The design of the nanocarrier is unique and provides a solution to most of the common problems associated with the delivery and therapeutic applications of siRNA. Every component in the triblock nanocarrier plays a significant role and performs multiple functions: (1) tertiary amine groups in the PAMAM dendrimer work as a proton sponge and play a vital role in the endosomal escape and cytoplasmic delivery of siRNA; (2) PEG, a linker connecting PLL and PAMAM dendrimers renders nuclease stability and protects siRNA in human plasma; (3) PLL provides primary amines to form polyplexes with siRNA through electrostatic interaction and also acts as penetration enhancer; and (4) conjugation to PEG and PAMAM reduced toxicity of PLL and the entire triblock nanocarrier PAMAM-PEG-PLL. The data obtained show that the polyplexes resulted from the conjugation of siRNA, and the proposed nanocarriers were effectively taken up by cancer cells and induced the knock down of the target BCL2 gene. In addition, triblock nanocarrier/siRNA polyplexes showed excellent stability in human plasma. PMID:21322531
Exosomes as nanocarriers for siRNA delivery: paradigms and challenges.
Shahabipour, Fahimeh; Banach, Maciej; Sahebkar, Amirhossein
2016-12-01
Exosomes are nano-sized vesicles that facilitate intercellular communications through carrying genetic materials and functional biomolecules. Owing to their unique size and structure, exosomes have emerged as a useful tool to overcome the limitations of siRNA delivery. The use of exosomes as siRNA delivery vehicles lacks certain disadvantages of the existing foreign delivery systems such as viruses, polycationic polymers and liposomes, and introduces several advantages including inherent capacity to pass through biological barriers and escape from phagocytosis by the reticuloendothelial system, as well as being biocompatible, non-toxic, and immunologically inert. Different strategies have been employed to harness exosome-based delivery systems, including surface modification with targeting ligands, and using exosome-display technology, virus-modified exosomes, and exosome-mimetic vesicles. The present review provides a capsule summary of the recent advances and current challenges in the field of exosome-mediated siRNA delivery.
Heterochromatic siRNAs and DDM1 Independently Silence Aberrant 5S rDNA Transcripts in Arabidopsis
Blevins, Todd; Pontes, Olga; Pikaard, Craig S.; Meins, Frederick
2009-01-01
5S ribosomal RNA gene repeats are arranged in heterochromatic arrays (5S rDNA) situated near the centromeres of Arabidopsis chromosomes. The chromatin remodeling factor DDM1 is known to maintain 5S rDNA methylation patterns while silencing transcription through 5S rDNA intergenic spacers (IGS). We mapped small-interfering RNAs (siRNA) to a composite 5S rDNA repeat, revealing a high density of siRNAs matching silenced IGS transcripts. IGS transcript repression requires proteins of the heterochromatic siRNA pathway, including RNA polymerase IV (Pol IV), RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3). Using molecular and cytogenetic approaches, we show that the DDM1 and siRNA-dependent silencing effects are genetically independent. DDM1 suppresses production of the siRNAs, however, thereby limiting RNA-directed DNA methylation at 5S rDNA repeats. We conclude that DDM1 and siRNA-dependent silencing are overlapping processes that both repress aberrant 5S rDNA transcription and contribute to the heterochromatic state of 5S rDNA arrays. PMID:19529764
Mapping Optimal Charge Density and Length of ROMP-Based PTDMs for siRNA Internalization.
Caffrey, Leah M; deRonde, Brittany M; Minter, Lisa M; Tew, Gregory N
2016-10-10
A fundamental understanding of how polymer structure impacts internalization and delivery of biologically relevant cargoes, particularly small interfering ribonucleic acid (siRNA), is of critical importance to the successful design of improved delivery reagents. Herein we report the use of ring-opening metathesis polymerization (ROMP) methods to synthesize two series of guanidinium-rich protein transduction domain mimics (PTDMs): one based on an imide scaffold that contains one guanidinium moiety per repeat unit, and another based on a diester scaffold that contains two guanidinium moieties per repeat unit. By varying both the degree of polymerization and, in effect, the relative number of cationic charges in each PTDM, the performances of the two ROMP backbones for siRNA internalization were evaluated and compared. Internalization of fluorescently labeled siRNA into Jurkat T cells demonstrated that fluorescein isothiocyanate (FITC)-siRNA internalization had a charge content dependence, with PTDMs containing approximately 40 to 60 cationic charges facilitating the most internalization. Despite this charge content dependence, the imide scaffold yielded much lower viabilities in Jurkat T cells than the corresponding diester PTDMs with similar numbers of cationic charges, suggesting that the diester scaffold is preferred for siRNA internalization and delivery applications. These developments will not only improve our understanding of the structural factors necessary for optimal siRNA internalization, but will also guide the future development of optimized PTDMs for siRNA internalization and delivery.
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-01-01
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441
Patterns of HIV-1 Protein Interaction Identify Perturbed Host-Cellular Subsystems
MacPherson, Jamie I.; Dickerson, Jonathan E.; Pinney, John W.; Robertson, David L.
2010-01-01
Human immunodeficiency virus type 1 (HIV-1) exploits a diverse array of host cell functions in order to replicate. This is mediated through a network of virus-host interactions. A variety of recent studies have catalogued this information. In particular the HIV-1, Human Protein Interaction Database (HHPID) has provided a unique depth of protein interaction detail. However, as a map of HIV-1 infection, the HHPID is problematic, as it contains curation error and redundancy; in addition, it is based on a heterogeneous set of experimental methods. Based on identifying shared patterns of HIV-host interaction, we have developed a novel methodology to delimit the core set of host-cellular functions and their associated perturbation from the HHPID. Initially, using biclustering, we identify 279 significant sets of host proteins that undergo the same types of interaction. The functional cohesiveness of these protein sets was validated using a human protein-protein interaction network, gene ontology annotation and sequence similarity. Next, using a distance measure, we group host protein sets and identify 37 distinct higher-level subsystems. We further demonstrate the biological significance of these subsystems by cross-referencing with global siRNA screens that have been used to detect host factors necessary for HIV-1 replication, and investigate the seemingly small intersect between these data sets. Our results highlight significant host-cell subsystems that are perturbed during the course of HIV-1 infection. Moreover, we characterise the patterns of interaction that contribute to these perturbations. Thus, our work disentangles the complex set of HIV-1-host protein interactions in the HHPID, reconciles these with siRNA screens and provides an accessible and interpretable map of infection. PMID:20686668
Genetic and Functional Diversification of Small RNA Pathways in Plants
Gustafson, Adam M; Kasschau, Kristin D; Lellis, Andrew D; Zilberman, Daniel; Jacobsen, Steven E
2004-01-01
Multicellular eukaryotes produce small RNA molecules (approximately 21–24 nucleotides) of two general types, microRNA (miRNA) and short interfering RNA (siRNA). They collectively function as sequence-specific guides to silence or regulate genes, transposons, and viruses and to modify chromatin and genome structure. Formation or activity of small RNAs requires factors belonging to gene families that encode DICER (or DICER-LIKE [DCL]) and ARGONAUTE proteins and, in the case of some siRNAs, RNA-dependent RNA polymerase (RDR) proteins. Unlike many animals, plants encode multiple DCL and RDR proteins. Using a series of insertion mutants of Arabidopsis thaliana, unique functions for three DCL proteins in miRNA (DCL1), endogenous siRNA (DCL3), and viral siRNA (DCL2) biogenesis were identified. One RDR protein (RDR2) was required for all endogenous siRNAs analyzed. The loss of endogenous siRNA in dcl3 and rdr2 mutants was associated with loss of heterochromatic marks and increased transcript accumulation at some loci. Defects in siRNA-generation activity in response to turnip crinkle virus in dcl2 mutant plants correlated with increased virus susceptibility. We conclude that proliferation and diversification of DCL and RDR genes during evolution of plants contributed to specialization of small RNA-directed pathways for development, chromatin structure, and defense. PMID:15024409
Aldayel, Abdulaziz M; Naguib, Youssef W; O'Mary, Hannah L; Li, Xu; Niu, Mengmeng; Ruwona, Tinashe B; Cui, Zhengrong
2016-01-01
There has been growing interest in utilizing small interfering RNA (siRNA) specific to pro-inflammatory cytokines, such as tumor necrosis factor-α ( TNF-α), in chronic inflammation therapy. However, delivery systems that can increase the distribution of the siRNA in chronic inflammation sites after intravenous administration are needed. Herein we report that innovative functionalization of the surface of siRNA-incorporated poly (lactic-co-glycolic) acid (PLGA) nanoparticles significantly increases the delivery of the siRNA in the chronic inflammation sites in a mouse model. The TNF-α siRNA incorporated PLGA nanoparticles were prepared by the standard double emulsion method, but using stearoyl-hydrazone-polyethylene glycol 2000, a unique acid-sensitive surface active agent, as the emulsifying agent, which renders (i) the nanoparticles PEGylated and (ii) the PEGylation sheddable in low pH environment such as that in chronic inflammation sites. In a mouse model of lipopolysaccharide-induced chronic inflammation, the acid-sensitive sheddable PEGylated PLGA nanoparticles showed significantly higher accumulation or distribution in chronic inflammation sites than PLGA nanoparticles prepared with an acid-insensitive emulsifying agent (i.e., stearoyl-amide-polyethylene glycol 2000) and significantly increased the distribution of the TNF-α siRNA incorporated into the nanoparticles in inflamed mouse foot. PMID:27434685
Delivery of multiple siRNAs using lipid-coated PLGA nanoparticles for treatment of prostate cancer.
Hasan, Warefta; Chu, Kevin; Gullapalli, Anuradha; Dunn, Stuart S; Enlow, Elizabeth M; Luft, J Christopher; Tian, Shaomin; Napier, Mary E; Pohlhaus, Patrick D; Rolland, Jason P; DeSimone, Joseph M
2012-01-11
Nanotechnology can provide a critical advantage in developing strategies for cancer management and treatment by helping to improve the safety and efficacy of novel therapeutic delivery vehicles. This paper reports the fabrication of poly(lactic acid-co-glycolic acid)/siRNA nanoparticles coated with lipids for use as prostate cancer therapeutics made via a unique soft lithography particle molding process called Particle Replication In Nonwetting Templates (PRINT). The PRINT process enables high encapsulation efficiency of siRNA into neutral and monodisperse PLGA particles (32-46% encapsulation efficiency). Lipid-coated PLGA/siRNA PRINT particles were used to deliver therapeutic siRNA in vitro to knockdown genes relevant to prostate cancer. © 2011 American Chemical Society
In vitro validation of self designed "universal human Influenza A siRNA".
Jain, Bhawana; Jain, Amita; Prakash, Om; Singh, Ajay Kr; Dangi, Tanushree; Singh, Mastan; Singh, K P
2015-08-01
The genomic variability of Influenza A virus (IAV) makes it difficult for the existing vaccines or anti-influenza drugs to control. The siRNA targeting viral gene induces RNAi mechanism in the host and silent the gene by cleaving mRNA. In this study, we developed an universal siRNA and validated its efficiency in vitro. The siRNA was designed rationally, targeting the most conserved region (delineated with the help of multiple sequence alignment) of M gene of IAV strains. Three level screening method was adopted, and the most efficient one was selected on the basis of its unique position in the conserved region. The siRNA efficacy was confirmed in vitro with the Madin Darby Canine Kidney (MDCK) cell line for IAV propagation using two clinical isolates i.e., Influenza A/H3N2 and Influenza A/pdmH1N1. Of the total 168 strains worldwide and 33 strains from India, 97 bp long (position 137-233) conserved region was identified. The longest ORF of matrix gene was targeted by the selected siRNA, which showed 73.6% inhibition in replication of Influenza A/pdmH1N1 and 62.1% inhibition in replication of Influenza A/H3N2 at 48 h post infection on MDCK cell line. This study provides a basis for the development of siRNA which can be used as universal anti-IAV therapeutic agent.
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-12-15
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
An RNA Origami Octahedron with Intrinsic siRNAs for Potent Gene Knockdown.
Høiberg, Hans Christian; Sparvath, Steffen M; Andersen, Veronica L; Kjems, Jørgen; Andersen, Ebbe S
2018-05-26
The fields of DNA and RNA nanotechnology have established nucleic acids as valuable building blocks for functional nanodevices with applications in nanomedicine. Here, a simple method for designing and assembling a 3D scaffolded RNA origami wireframe structure with intrinsic functioning small interfering RNAs (siRNAs) embedded is introduced. Uniquely, the method uses an mRNA fragment as scaffold strand, which is folded by sequence-complementarity of nine shorter synthetic strands. High-yield production of the intended 3D structure is verified by transmission electron microscopy (TEM). Production of functional siRNAs is facilitated by incorporating recognition sites for Dicer at selected locations in the structure, and efficient silencing of a target reporter gene is demonstrated. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Solid nano-in-nanoparticles for potential delivery of siRNA.
Amsalem, Orit; Nassar, Taher; Benhamron, Sandrine; Lazarovici, Philip; Benita, Simon; Yavin, Eylon
2017-07-10
siRNA-based therapeutics possess great potential to treat a wide variety of genetic disorders. However, they suffer from low cellular uptake and short half-lives in blood circulation; issues that remain to be addressed. This work is, to the best of our knowledge, the first to report the production of solid nano-in-nanoparticles, termed double nano carriers (DNCs) by means of the innovative technology of nano spray drying. DNCs (with a median size of 580-770nm) were produced by spraying at low temperatures (50°C) to prevent damage to heat-sensitive biomacromolecules like siRNA. DNCs consisting of Poly (d,l-lactide-co-glycolide) used as a wall material, encapsulating 20% human serum albumin primary nanoparticles (PNPs) loaded with siRNA, were obtained as a dry nanoparticulate powder with smooth spherical surfaces and a unique inner morphology. Incubation of pegylated or non-pegylated DNCs under sink conditions at 37°C, elicited a controlled release profile of the siRNA for up to 12 or 24h, respectively, with a minimal burst effect. Prolonged incubation of pegylated DNCs loaded with active siRNA (anti EGFR) in an A549 epithelial cell culture monolayer did not induce any apparent cytotoxicity. A slow degradation of the internalized DNCs by the cells was also observed resulting in the progressive release of the siRNA for up to 6days, as corroborated by laser confocal microscopy. The structural integrity and silencing activity of the double encapsulated siRNA were fully preserved, as demonstrated by HPLC, gel electrophoresis, and potent RNAi activity of siRNA extracted from DNCs. These results demonstrate the potential use of DNCs as a nano drug delivery system for systemic administration and controlled release of siRNA and potentially other sensitive bioactive macromolecules. Copyright © 2016 Elsevier B.V. All rights reserved.
siMacro: A Fast and Easy Data Processing Tool for Cell-Based Genomewide siRNA Screens.
Singh, Nitin Kumar; Seo, Bo Yeun; Vidyasagar, Mathukumalli; White, Michael A; Kim, Hyun Seok
2013-03-01
Growing numbers of studies employ cell line-based systematic short interfering RNA (siRNA) screens to study gene functions and to identify drug targets. As multiple sources of variations that are unique to siRNA screens exist, there is a growing demand for a computational tool that generates normalized values and standardized scores. However, only a few tools have been available so far with limited usability. Here, we present siMacro, a fast and easy-to-use Microsoft Office Excel-based tool with a graphic user interface, designed to process single-condition or two-condition synthetic screen datasets. siMacro normalizes position and batch effects, censors outlier samples, and calculates Z-scores and robust Z-scores, with a spreadsheet output of >120,000 samples in under 1 minute.
siMacro: A Fast and Easy Data Processing Tool for Cell-Based Genomewide siRNA Screens
Singh, Nitin Kumar; Seo, Bo Yeun; Vidyasagar, Mathukumalli; White, Michael A.
2013-01-01
Growing numbers of studies employ cell line-based systematic short interfering RNA (siRNA) screens to study gene functions and to identify drug targets. As multiple sources of variations that are unique to siRNA screens exist, there is a growing demand for a computational tool that generates normalized values and standardized scores. However, only a few tools have been available so far with limited usability. Here, we present siMacro, a fast and easy-to-use Microsoft Office Excel-based tool with a graphic user interface, designed to process single-condition or two-condition synthetic screen datasets. siMacro normalizes position and batch effects, censors outlier samples, and calculates Z-scores and robust Z-scores, with a spreadsheet output of >120,000 samples in under 1 minute. PMID:23613684
Ashley, Carlee E.; Carnes, Eric C.; Epler, Katharine E.; Padilla, David P.; Phillips, Genevieve K.; Castillo, Robert E.; Wilkinson, Dan C.; Wilkinson, Brian S.; Burgard, Cameron A.; Sewell, Robin M.; Townson, Jason L.; Chackerian, Bryce; Willman, Cheryl L.; Peabody, David S.; Wharton, Walker; Brinker, C. Jeffrey
2012-01-01
The therapeutic potential of small interfering RNAs (siRNAs) is severely limited by the availability of delivery platforms that protect siRNA from degradation, deliver it to the target cell with high specificity and efficiency, and promote its endosomal escape and cytosolic dispersion. Here we report that mesoporous silica nanoparticle-supported lipid bilayers (or ‘protocells’), exhibit multiple properties that overcome many of the limitations of existing delivery platforms. Protocells have a 10- to 100-fold greater capacity for siRNA than corresponding lipid nanoparticles and are markedly more stable when incubated under physiological conditions. Protocells loaded with a cocktail of siRNAs bind to cells in a manner dependent on the presence of an appropriate targeting peptide and, through an endocytic pathway followed by endosomal disruption, promote delivery of the silencing nucleotides to the cytoplasm. The expression of each of the genes targeted by the siRNAs was shown to be repressed at the protein level, resulting in a potent induction of growth arrest and apoptosis. Incubation of control cells that lack expression of the antigen recognized by the targeting peptide with siRNA-loaded protocells induced neither repression of protein expression nor apoptosis, indicating the precise specificity of cytotoxic activity. In terms of loading capacity, targeting capabilities, and potency of action, protocells provide unique attributes as a delivery platform for therapeutic oligonucleotides. PMID:22309035
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop
2012-08-15
Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less
Inter-molecular β-sheet structure facilitates lung-targeting siRNA delivery
NASA Astrophysics Data System (ADS)
Zhou, Jihan; Li, Dong; Wen, Hao; Zheng, Shuquan; Su, Cuicui; Yi, Fan; Wang, Jue; Liang, Zicai; Tang, Tao; Zhou, Demin; Zhang, Li-He; Liang, Dehai; Du, Quan
2016-03-01
Size-dependent passive targeting based on the characteristics of tissues is a basic mechanism of drug delivery. While the nanometer-sized particles are efficiently captured by the liver and spleen, the micron-sized particles are most likely entrapped within the lung owing to its unique capillary structure and physiological features. To exploit this property in lung-targeting siRNA delivery, we designed and studied a multi-domain peptide named K-β, which was able to form inter-molecular β-sheet structures. Results showed that K-β peptides and siRNAs formed stable complex particles of 60 nm when mixed together. A critical property of such particles was that, after being intravenously injected into mice, they further associated into loose and micron-sized aggregates, and thus effectively entrapped within the capillaries of the lung, leading to a passive accumulation and gene-silencing. The large size aggregates can dissociate or break down by the shear stress generated by blood flow, alleviating the pulmonary embolism. Besides the lung, siRNA enrichment and targeted gene silencing were also observed in the liver. This drug delivery strategy, together with the low toxicity, biodegradability, and programmability of peptide carriers, show great potentials in vivo applications.
Zhu, Jia; Qiao, Mingxi; Wang, Qi; Ye, Yuqing; Ba, Shuang; Ma, Jingjing; Hu, Haiyang; Zhao, Xiuli; Chen, Dawei
2018-04-01
Despite the extracellular barriers for siRNA delivery have been overcome by utilizing advanced nanoparticle delivery systems, the key intracellular barriers after internalization including efficient disassembly of siRNA and endosomal escape still remains challenging. To address the issues, we developed a unique pH- and redox potential-responsive polyplex delivery system based on the copolymer of mPEG-b-PLA-PHis-ssPEI1.8 k, which is composed of a pH-responsive copolymer of PEG-b-PLA-PHis (Mw 5 k) and a branched PEI (Mw1.8 k) linked with redox cleavable disulfide bond. The copolymer showed excellent siRNA complexation and protection abilities against endogenous substances at the relatively low N/P ratio of 6. The siRNA release from the polyplexes (N/P 6) was markedly increased from 13.62% to 58.67% under conditions simulating the endosomal microenvironment. Fluorescence resonance energy transfer (FRET) test also indicated a higher disassembly extent of siRNA from the copolymer. The accelerated siRNA release from the polyplexes was markedly restrained when the N/P ratio was raised above 10 due to the increasing of electrostatic interactions. The efficient endosomal escape of siRNA after internalization was confirmed by confocal microscopy, which was attributed to the cleavaged PEI chains inducing membrane destabilization, the "proton sponge effect" of PHis and PEI as well as the relative small size of after disassembly. The enhanced disassembly and endosomal escape were elucidated as the leading cause for polyplexes (N/P 6) showed more efficient Bcl-2 silencing (85.45%) than those polyplexes with higher N/P ratios (N/P 10 and 15). In vivo results further demonstrated that polyplexes (N/P 6) delivery of siBcl-2 significantly inhibited the MCF-7 breast tumor growth as compared to its counterparts. The incorporation of convertible non-electrical interactions at a balance with electrostatic interactions in complexation siRNA has been demonstrated as an effective strategy to achieve efficient disassembly from stable polyplexes. Moreover, polyplexes equipped with the enhanced disassembly and endosomal escape provides a new potential way to tackle the intracellular delivery bottleneck for siRNA delivery. Copyright © 2018 Elsevier Ltd. All rights reserved.
Role of Increased n-acetylaspartate Levels in Cancer
Zand, Behrouz; Previs, Rebecca A.; Zacharias, Niki M.; Rupaimoole, Rajesha; Mitamura, Takashi; Nagaraja, Archana Sidalaghatta; Guindani, Michele; Dalton, Heather J.; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Hu, Wei; Pecot, Chad V.; Ivan, Cristina; Wu, Sherry Y.; McCullough, Christopher R.; Gharpure, Kshipra M.; Shoshan, Einav; Pradeep, Sunila; Mangala, Lingegowda S.; Rodriguez-Aguayo, Cristian; Wang, Ying; Nick, Alpa M.; Davies, Michael A.; Armaiz-Pena, Guillermo; Liu, Jinsong; Lutgendorf, Susan K.; Baggerly, Keith A.; Eli, Menashe Bar; Lopez-Berestein, Gabriel; Nagrath, Deepak; Bhattacharya, Pratip K.
2016-01-01
Background: The clinical and biological effects of metabolic alterations in cancer are not fully understood. Methods: In high-grade serous ovarian cancer (HGSOC) samples (n = 101), over 170 metabolites were profiled and compared with normal ovarian tissues (n = 15). To determine NAT8L gene expression across different cancer types, we analyzed the RNA expression of cancer types using RNASeqV2 data available from the open access The Cancer Genome Atlas (TCGA) website (http://www.cbioportal.org/public-portal/). Using NAT8L siRNA, molecular techniques and histological analysis, we determined cancer cell viability, proliferation, apoptosis, and tumor growth in in vitro and in vivo (n = 6–10 mice/group) settings. Data were analyzed with the Student’s t test and Kaplan-Meier analysis. Statistical tests were two-sided. Results: Patients with high levels of tumoral NAA and its biosynthetic enzyme, aspartate N-acetyltransferase (NAT8L), had worse overall survival than patients with low levels of NAA and NAT8L. The overall survival duration of patients with higher-than-median NAA levels (3.6 years) was lower than that of patients with lower-than-median NAA levels (5.1 years, P = .03). High NAT8L gene expression in other cancers (melanoma, renal cell, breast, colon, and uterine cancers) was associated with worse overall survival. NAT8L silencing reduced cancer cell viability (HEYA8: control siRNA 90.61%±2.53, NAT8L siRNA 39.43%±3.00, P < .001; A2780: control siRNA 90.59%±2.53, NAT8L siRNA 7.44%±1.71, P < .001) and proliferation (HEYA8: control siRNA 74.83%±0.92, NAT8L siRNA 55.70%±1.54, P < .001; A2780: control siRNA 50.17%±4.13, NAT8L siRNA 26.52%±3.70, P < .001), which was rescued by addition of NAA. In orthotopic mouse models (ovarian cancer and melanoma), NAT8L silencing reduced tumor growth statistically significantly (A2780: control siRNA 0.52 g±0.15, NAT8L siRNA 0.08 g±0.17, P < .001; HEYA8: control siRNA 0.79 g±0.42, NAT8L siRNA 0.24 g±0.18, P = .008, A375-SM: control siRNA 0.55 g±0.22, NAT8L siRNA 0.21 g±0.17g, P = .001). NAT8L silencing downregulated the anti-apoptotic pathway, which was mediated through FOXM1. Conclusion: These findings indicate that the NAA pathway has a prominent role in promoting tumor growth and represents a valuable target for anticancer therapy. Altered energy metabolism is a hallmark of cancer (1). Proliferating cancer cells have much greater metabolic requirements than nonproliferating differentiated cells (2,3). Moreover, altered cancer metabolism elevates unique metabolic intermediates, which can promote cancer survival and progression (4,5). Furthermore, emerging evidence suggests that proliferating cancer cells exploit alternative metabolic pathways to meet their high demand for energy and to accumulate biomass (6–8). PMID:26819345
Smalheiser, Neil R; Lugli, Giovanni; Thimmapuram, Jyothi; Cook, Edwin H; Larson, John
2011-01-01
We previously proposed that endogenous siRNAs may regulate synaptic plasticity and long-term gene expression in the mammalian brain. Here, a hippocampal-dependent task was employed in which adult mice were trained to execute a nose-poke in a port containing one of two simultaneously present odors in order to obtain a reward. Mice demonstrating olfactory discrimination training were compared to pseudo-training and nose-poke control groups; size-selected hippocampal RNA was subjected to Illumina deep sequencing. Sequences that aligned uniquely and exactly to the genome without uncertain nucleotide assignments, within exons or introns of MGI annotated genes, were examined further. The data confirm that small RNAs having features of endogenous siRNAs are expressed in brain; that many of them derive from genes that regulate synaptic plasticity (and have been implicated in neuropsychiatric diseases); and that hairpin-derived endo-siRNAs and the 20- to 23-nt size class of small RNAs show a significant increase during an early stage of training. The most abundant putative siRNAs arose from an intronic inverted repeat within the SynGAP1 locus; this inverted repeat was a substrate for dicer in vitro, and SynGAP1 siRNA was specifically associated with Argonaute proteins in vivo. Unexpectedly, a dramatic increase with training (more than 100-fold) was observed for a class of 25- to 30-nt small RNAs derived from specific sites within snoRNAs and abundant noncoding RNAs (Y1 RNA, RNA component of mitochondrial RNAse P, 28S rRNA, and 18S rRNA). Further studies are warranted to characterize the role(s) played by endogenous siRNAs and noncoding RNA-derived small RNAs in learning and memory.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352
Hierarchically assembled theranostic nanostructures for siRNA delivery and imaging applications.
Shrestha, Ritu; Elsabahy, Mahmoud; Luehmann, Hannah; Samarajeewa, Sandani; Florez-Malaver, Stephanie; Lee, Nam S; Welch, Michael J; Liu, Yongjian; Wooley, Karen L
2012-10-24
Dual functional hierarchically assembled nanostructures, with two unique functions of carrying therapeutic cargo electrostatically and maintaining radiolabeled imaging agents covalently within separate component building blocks, have been developed via the supramolecular assembly of several spherical cationic shell cross-linked nanoparticles clustered around a central anionic shell cross-linked cylinder. The shells of the cationic nanoparticles and the hydrophobic core domain of the anionic central cylindrical nanostructure of the assemblies were utilized to complex negatively charged nucleic acids (siRNA) and to undergo radiolabeling, respectively, for potential theranostic applications. The assemblies exhibited exceptional cell transfection and radiolabeling efficiencies, providing an overall advantage over the individual components, which could each facilitate only one or the other of the functions.
Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates
Flores-Jasso, C. Fabián; Salomon, William E.; Zamore, Phillip D.
2013-01-01
Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2′-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete. PMID:23249751
Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates.
Flores-Jasso, C Fabián; Salomon, William E; Zamore, Phillip D
2013-02-01
Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2'-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete.
Nakamura, Takashi; Yamada, Koharu; Fujiwara, Yuki; Sato, Yusuke; Harashima, Hideyoshi
2018-06-04
Introducing siRNA into human immune cells by an artificial delivery system continues to be a challenging issue. We previously developed a multifunctional envelope-type nanodevice (MEND) containing the YSK12-C4, a fusogenic cationic lipid, (YSK12-MEND) and succeeded in the efficient delivery of siRNA into human immune cell lines. Significant cytotoxicity, however, was observed at siRNA doses needed for gene silencing in NK-92 cells. NK-92 cells, a unique natural killer (NK) cell line, would be applicable for use in clinical NK therapy. Thus, reducing the cytotoxicity of the YSK12-MEND in NK-92 cells would strengthen the efficacy of NK-92 cell-based therapy. The amount of the YSK12-C4 in the MEND needed to be reduced to reduce the cytotoxicity, because the cytotoxicity was directly associated with the YSK12-C4. In the present study, we decreased the total amount of lipid, including the YSK12-C4, by introducing a core formed by electrostatic interactions of siRNA with a polycation (protamine) (siRNA core), which led to a decrease in cytotoxicity in NK-92 cells. We prepared a YSK12-MEND containing an siRNA core (YSK12-MEND/core) at charge ratios (CR: YSK12-C4/siRNA) of 10, 5, 3, and 2.5 and compared the YSK12-MEND/core with that for a YSK12-MEND (CR16.9). Cell viability was increased by more than 2 times at a CR5 or less. On the other hand, the YSK12-MEND/core (CR5) maintained the same gene silencing efficiency (60%) as the YSK12-MEND. Interestingly, the cellular uptake efficiency and hemolytic activity of the YSK12-MEND/core (CR5) was reduced compared to that for the YSK12-MEND. In calculating the silencing activity per cellular uptake efficiency and hemolytic activity, the value for the YSK12-MEND/core (CR5) was more than 2 times as high as that of the YSK12-MEND. The fact indicates that after endosomal escape, the process can be enhanced by using a YSK12-MEND/core (CR5). Thus, introducing an siRNA core into lipid nanoparticles can be a potent strategy for decreasing cytotoxicity without an appreciable loss of gene silencing activity in NK-92 cells.
Tam, Ying K; Madden, Thomas D; Hope, Michael J
2016-11-01
For the best part of 40 years, lipids and membrane fusion have been at the center of Pieter's research. Projects range from the purely academic quest of understanding the roles of lipids in biological membranes, to the translation of this knowledge into the most advanced lipid nanoparticle (LNP) drug delivery systems in clinical trials to-date. Pieter's pioneering work in lipid polymorphism and characterizing the unique properties of unsaturated phospatidyethanolamines (PE), together with the introduction of ionizable, dialkylamino lipids to trigger membrane fusion at acidic pH, provided the foundation on which a new generation of highly potent, well-tolerated LNPs for intravenous delivery of nucleic acid therapeutics has been built. In this contribution to the special edition honoring Pieter's achievements we highlight key research conducted in Pieter's laboratory and at several biotechnology companies, some spun out of his research group, which resulted in the development of a fusogenic delivery system for siRNA therapeutics. Patisiran®, an LNP encapsulating siRNA for hepatic gene silencing, is currently in Phase III clinical trials for treatment of Transthyretin amyloidosis as are several other siRNA products employing this delivery technology. Finally, we describe more recent work in which the platform shows real promise in the rapidly growing new field of mRNA therapeutics.
Apple miRNAs and tasiRNAs with novel regulatory networks
2012-01-01
Background MicroRNAs (miRNAs) and their regulatory functions have been extensively characterized in model species but whether apple has evolved similar or unique regulatory features remains unknown. Results We performed deep small RNA-seq and identified 23 conserved, 10 less-conserved and 42 apple-specific miRNAs or families with distinct expression patterns. The identified miRNAs target 118 genes representing a wide range of enzymatic and regulatory activities. Apple also conserves two TAS gene families with similar but unique trans-acting small interfering RNA (tasiRNA) biogenesis profiles and target specificities. Importantly, we found that miR159, miR828 and miR858 can collectively target up to 81 MYB genes potentially involved in diverse aspects of plant growth and development. These miRNA target sites are differentially conserved among MYBs, which is largely influenced by the location and conservation of the encoded amino acid residues in MYB factors. Finally, we found that 10 of the 19 miR828-targeted MYBs undergo small interfering RNA (siRNA) biogenesis at the 3' cleaved, highly divergent transcript regions, generating over 100 sequence-distinct siRNAs that potentially target over 70 diverse genes as confirmed by degradome analysis. Conclusions Our work identified and characterized apple miRNAs, their expression patterns, targets and regulatory functions. We also discovered that three miRNAs and the ensuing siRNAs exploit both conserved and divergent sequence features of MYB genes to initiate distinct regulatory networks targeting a multitude of genes inside and outside the MYB family. PMID:22704043
Thiebaut, Flávia; Rojas, Cristian A; Grativol, Clícia; Motta, Mariana Romeiro; Vieira, Tauan; Regulski, Michael; Martienssen, Robert A; Farinelli, Laurent; Hemerly, Adriana S; Ferreira, Paulo C G
2014-09-06
Small RNA (sRNA) has been described as a regulator of gene expression. In order to understand the role of maize sRNA (Zea mays-hybrid UENF 506-8) during association with endophytic nitrogen-fixing bacteria, we analyzed the sRNA regulated by its association with two diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense. Deep sequencing analysis was done with RNA extracted from plants inoculated with H. seropedicae, allowing the identification of miRNA and siRNA. A total of 25 conserved miRNA families and 15 novel miRNAs were identified. A dynamic regulation in response to inoculation was also observed. A hypothetical model involving copper-miRNA is proposed, emphasizing the fact that the up-regulation of miR397, miR398, miR408 and miR528, which is followed by inhibition of their targets, can facilitate association with diazotrophic bacteria. Similar expression patterns were observed in samples inoculated with A. brasilense. Moreover, novel miRNA and siRNA were classified in the Transposable Elements (TE) database, and an enrichment of siRNA aligned with TE was observed in the inoculated samples. In addition, an increase in 24-nt siRNA mapping to genes was observed, which was correlated with an increase in methylation of the coding regions and a subsequent reduction in transcription. Our results show that maize has RNA-based silencing mechanisms that can trigger specific responses when plants interact with beneficial endophytic diazotrophic bacteria. Our findings suggest important roles for sRNA regulation in maize, and probably in other plants, during association with diazotrophic bacteria, emphasizing the up-regulation of Cu-miRNA.
Gomes, Maria João; Fernandes, Carlos; Martins, Susana; Borges, Fernanda; Sarmento, Bruno
2017-03-01
Blood-brain barrier is a tightly packed layer of endothelial cells surrounding the brain that acts as the main obstacle for drugs enter the central nervous system (CNS), due to its unique features, as tight junctions and drug efflux systems. Therefore, since the incidence of CNS disorders is increasing worldwide, medical therapeutics need to be improved. Consequently, aiming to surpass blood-brain barrier and overcome CNS disabilities, silencing P-glycoprotein as a drug efflux transporter at brain endothelial cells through siRNA is considered a promising approach. For siRNA enzymatic protection and efficient delivery to its target, two different nanoparticles platforms, solid lipid (SLN) and poly-lactic-co-glycolic (PLGA) nanoparticles were used in this study. Polymeric PLGA nanoparticles were around 115 nm in size and had 50 % of siRNA association efficiency, while SLN presented 150 nm and association efficiency close to 52 %. Their surface was functionalized with a peptide-binding transferrin receptor, in a site-oriented manner confirmed by NMR, and their targeting ability against human brain endothelial cells was successfully demonstrated by fluorescence microscopy and flow cytometry. The interaction of modified nanoparticles with brain endothelial cells increased 3-fold compared to non-modified lipid nanoparticles, and 4-fold compared to non-modified PLGA nanoparticles, respectively. These nanosystems, which were also demonstrated to be safe for human brain endothelial cells, without significant cytotoxicity, bring a new hopeful breath to the future of brain diseases therapies.
NASA Astrophysics Data System (ADS)
Li, Xin; Sun, A.-ning; Liu, Yu-jie; Zhang, Wen-jie; Pang, Ning; Cheng, Shi-xuan; Qi, Xian-rong
2018-04-01
Combinations of chemotherapeutics with small interfering RNA (siRNA) can incorporate the advantages of their different mechanisms to exert a synergetic effect. A safe and effective vehicle for simultaneous delivery of the components to tumor cells is a prerequisite for obtaining the optimum effect. We developed an amphiphilic dendrimer engineered nanocarrier system (ADENS) for co-delivering paclitaxel and siRNA for cancer treatment. This nanocarrier possesses a unique hollow core/shell structure in which siRNA is incorporated in the hydrophilic cavity and large quantities of paclitaxel are stored in the hydrophobic interlayer, while the outer PEG layer serves to prolong the circulation time. Further modification by tumor microenvironment-sensitive polypeptides (TMSP) significantly enhanced the cellular uptake, tumor penetration and tumor accumulation of the ADENS by a tumor microenvironment-triggered mechanism. TMSP-ADENS had prominent therapeutic effects at a relatively low drug dose both in vitro and in vivo. In A375 xenograft mice, TMSP-ADENS/siRNA/PTX showed the highest VEGF mRNA inhibition rate of 73% and suppressed tumor growth and relapse, while Taxol did not show an effect on tumor relapse. The anti-tumor and anti-angiogenic effects were further confirmed in an HT-1080 xenograft tumor model. Our findings, combined with the known biodegradability and tunable physicochemical properties of these polymers, suggest that this TMSP-ADENS can be a robust co-delivery system for cancer combination therapy in the future.
Held, Michael A.; Penning, Bryan; Brandt, Amanda S.; Kessans, Sarah A.; Yong, Weidong; Scofield, Steven R.; Carpita, Nicholas C.
2008-01-01
Small-interfering RNAs (siRNAs) from natural cis-antisense pairs derived from the 3′-coding region of the barley (Hordeum vulgare) CesA6 cellulose synthase gene substantially increase in abundance during leaf elongation. Strand-specific RT-PCR confirmed the presence of an antisense transcript of HvCesA6 that extends ≥1230 bp from the 3′ end of the CesA-coding sequence. The increases in abundance of the CesA6 antisense transcript and the 21-nt and 24-nt siRNAs derived from the transcript are coincident with the down-regulation of primary wall CesAs, several Csl genes, and GT8 glycosyl transferase genes, and are correlated with the reduction in rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Virus induced gene silencing using unique target sequences derived from HvCesA genes attenuated expression not only of the HvCesA6 gene, but also of numerous nontarget Csls and the distantly related GT8 genes and reduced the incorporation of D-14C-Glc into cellulose and into mixed-linkage (1 → 3),(1 → 4)-β-D-glucans of the developing leaves. Unique target sequences for CslF and CslH conversely silenced the same genes and lowered rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Our results indicate that the expression of individual members of the CesA/Csl superfamily and glycosyl transferases share common regulatory control points, and siRNAs from natural cis-antisense pairs derived from the CesA/Csl superfamily could function in this global regulation of cell-wall synthesis. PMID:19075248
Krishnamurthy, Sateesh; Behlke, Mark A; Apicella, Michael A; McCray, Paul B; Davidson, Beverly L
2014-07-15
Well-differentiated human airway epithelia present formidable barriers to efficient siRNA delivery. We previously reported that treatment of airway epithelia with specific small molecules improves oligonucleotide uptake and facilitates RNAi responses. Here, we exploited the platelet activating factor receptor (PAFR) pathway, utilized by specific bacteria to transcytose into epithelia, as a trigger for internalization of Dicer-substrate siRNAs (DsiRNA). PAFR is a G-protein coupled receptor which can be engaged and activated by phosphorylcholine residues on the lipooligosaccharide (LOS) of nontypeable Haemophilus influenzae and the teichoic acid of Streptococcus pneumoniae as well as by its natural ligand, platelet activating factor (PAF). When well-differentiated airway epithelia were simultaneously treated with either nontypeable Haemophilus influenzae LOS or PAF and transduced with DsiRNA formulated with the peptide transductin, we observed silencing of both endogenous and exogenous targets. PAF receptor antagonists prevented LOS or PAF-assisted DsiRNA silencing, demonstrating that ligand engagement of PAFR is essential for this process. Additionally, PAF-assisted DsiRNA transfection decreased CFTR protein expression and function and reduced exogenous viral protein levels and titer in human airway epithelia. Treatment with spiperone, a small molecule identified using the Connectivity map database to correlate gene expression changes in response to drug treatment with those associated with PAFR stimulation, also induced silencing. These results suggest that the signaling pathway activated by PAFR binding can be manipulated to facilitate siRNA entry and function in difficult to transfect well-differentiated airway epithelial cells.
Roles of small RNAs in the immune defense mechanisms of crustaceans.
He, Yaodong; Ju, Chenyu; Zhang, Xiaobo
2015-12-01
Small RNAs, 21-24 nucleotides in length, are non-coding RNAs found in most multicellular organisms, as well as in some viruses. There are three main types of small RNAs including microRNA (miRNA), small-interfering RNA (siRNA), and piwi-interacting RNA (piRNA). Small RNAs play key roles in the genetic regulation of eukaryotes; at least 50% of all eukaryote genes are the targets of small RNAs. In recent years, studies have shown that some unique small RNAs are involved in the immune response of crustaceans, leading to lower or higher immune responses to infections and diseases. SiRNAs could be used as therapy for virus infection. In this review, we provide an overview of the diverse roles of small RNAs in the immune defense mechanisms of crustaceans. Copyright © 2015 Elsevier Ltd. All rights reserved.
Park, Hyun-Jung; Baen, Ji-Yeon; Lee, Ye-Ji; Choi, Youn-Hee; Kang, Jihee Lee
2012-08-01
The TAM receptor protein tyrosine kinases Tyro3, Axl, and Mer play important roles in macrophage function. We investigated the roles of the TAM receptors in mediating the induction of hepatocyte growth factor (HGF) during the interaction of macrophages with apoptotic cells. Mer-specific neutralizing antibody, small interfering RNA (siRNA), and a recombinant Mer protein (Mer/Fc) inhibited HGF mRNA and protein expression, as well as activation of RhoA, Akt, and specific mitogen-activated protein (MAP) kinases in response to apoptotic cells. Inhibition of Axl or Tyro3 with specific antibodies, siRNA, or Fc-fusion proteins did not prevent apoptotic cell-induced HGF mRNA and protein expression and did not inhibit activation of the postreceptor signaling molecules RhoA and certain MAP kinases, including extracellular signal-regulated protein kinase and c-Jun NH(2)-terminal kinase. However, Axl- and Tyro3-specific blockers did inhibit the activation of Akt and p38 MAP kinase in response to apoptotic cells. In addition, none of the TAM receptors mediated the effects of apoptotic cells on transforming growth factor-β or epidermal growth factor mRNA expression. However, they were involved in the induction of vascular endothelial growth factor mRNA expression. Our data provide evidence that when macrophages interact with apoptotic cells, only Mer of the TAM-family receptors is responsible for mediating transcriptional HGF production through a RhoA-dependent pathway.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L
2018-02-01
Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.
Krishnamurthy, Sateesh; Behlke, Mark A; Apicella, Michael A; McCray, Paul B; Davidson, Beverly L
2014-01-01
Well-differentiated human airway epithelia present formidable barriers to efficient siRNA delivery. We previously reported that treatment of airway epithelia with specific small molecules improves oligonucleotide uptake and facilitates RNAi responses. Here, we exploited the platelet activating factor receptor (PAFR) pathway, utilized by specific bacteria to transcytose into epithelia, as a trigger for internalization of Dicer-substrate siRNAs (DsiRNA). PAFR is a G-protein coupled receptor which can be engaged and activated by phosphorylcholine residues on the lipooligosaccharide (LOS) of nontypeable Haemophilus influenzae and the teichoic acid of Streptococcus pneumoniae as well as by its natural ligand, platelet activating factor (PAF). When well-differentiated airway epithelia were simultaneously treated with either nontypeable Haemophilus influenzae LOS or PAF and transduced with DsiRNA formulated with the peptide transductin, we observed silencing of both endogenous and exogenous targets. PAF receptor antagonists prevented LOS or PAF-assisted DsiRNA silencing, demonstrating that ligand engagement of PAFR is essential for this process. Additionally, PAF-assisted DsiRNA transfection decreased CFTR protein expression and function and reduced exogenous viral protein levels and titer in human airway epithelia. Treatment with spiperone, a small molecule identified using the Connectivity map database to correlate gene expression changes in response to drug treatment with those associated with PAFR stimulation, also induced silencing. These results suggest that the signaling pathway activated by PAFR binding can be manipulated to facilitate siRNA entry and function in difficult to transfect well-differentiated airway epithelial cells. PMID:25025465
Micelle-like Nanoparticles as Carriers for DNA and siRNA
Navarro, Gemma; Pan, Jiayi; Torchilin, Vladimir P.
2015-01-01
Gene therapy represents a potential efficient approach of disease prevention and therapy. However, due to their poor in vivo stability, gene molecules need to be associated with delivery systems to overcome extracellular and intracellular barriers and allow access to the site of action. Cationic polymeric nanoparticles are popular carriers for small interfering RNA (siRNA) and DNA-based therapeutics for which efficient and safe delivery are important factors that need to be optimized. Micelle-like nanoparticles (MNP) (half micelles, half polymeric nanoparticles) can overcome some of the disadvantages of such cationic carriers by unifying in one single carrier the best of both delivery systems. In this review, we will discuss how the unique properties of MNP including self-assembly, condensation and protection of nucleic acids, improved cell association and gene transfection, and low toxicity may contribute to the successful application of siRNA- and DNA-based therapeutics into the clinic. Recent developments of MNP involving the addition of stimulus-sensitive functions to respond specifically to pathological or externally applied “triggers” (e.g., temperature, pH or enzymatic catalysis, light, or magnetic fields) will be discussed. Finally, we will overview the use of MNP as two-in-one carriers for the simultaneous delivery of different agents (small molecules, imaging agents) and nucleic acid combinations. PMID:25557580
Li, Yan; Liu, Ruiyuan; Shi, Yuanjie; Zhang, Zhenzhong; Zhang, Xin
2015-01-01
For efficient delivery of small interfering RNA (siRNA) to the target diseased site in vivo, it is important to design suitable vehicles to control the blood circulation of siRNA. It has been shown that surface modification of cationic liposome/siRNA complexes (lipoplexes) with polyethylene glycol (PEG) could enhance the circulation time of lipoplexes. However, the first injection of PEGylated lipoplexes in vivo induces accelerated blood clearance and enhances hepatic accumulation of the following injected PEGylated lipoplexes, which is known as the accelerated blood clearance (ABC) phenomenon. Herein, we developed zwitterionic poly(carboxybetaine) (PCB) modified lipoplexes for the delivery of siRNA therapeutics, which could avoid protein adsorption and enhance the stability of lipoplexes as that for PEG. Quite different from the PEGylation, the PCBylated lipoplexes could avoid ABC phenomenon, which extended the blood circulation time and enhanced the tumor accumulation of lipoplexes in vivo. After accumulation in tumor site, the PCBylation could promote the cellular uptake and endosomal/lysosomal escape of lipoplexes due to its unique chemical structure and pH-sensitive ability. With excellent tumor accumulation, cellular uptake and endosomal/lysosomal escape abilities, the PCBylated lipoplexes significantly inhibited tumor growth and induced tumor cell apoptosis.
Blocking the association of HDAC4 with MAP1S accelerates autophagy clearance of mutant Huntingtin
Yue, Fei; Li, Wenjiao; Zou, Jing; Chen, Qi; Xu, Guibin; Huang, Hai; Xu, Zhen; Zhang, Sheng; Gallinari, Paola; Wang, Fen; McKeehan, Wallace L.; Liu, Leyuan
2015-01-01
Autophagy controls and executes the turnover of abnormally aggregated proteins. MAP1S interacts with the autophagy marker LC3 and positively regulates autophagy flux. HDAC4 associates with the aggregation-prone mutant huntingtin protein (mHTT) that causes Huntington's disease, and colocalizes with it in cytosolic inclusions. It was suggested HDAC4 interacts with MAP1S in a yeast two-hybrid screening. Here, we found that MAP1S interacts with HDAC4 via a HDAC4-binding domain (HBD). HDAC4 destabilizes MAP1S, suppresses autophagy flux and promotes the accumulation of mHTT aggregates. This occurs by an increase in the deacetylation of the acetylated MAP1S. Either suppression of HDAC4 with siRNA or overexpression of the MAP1S HBD leads to stabilization of MAP1S, activation of autophagy flux and clearance of mHTT aggregates. Therefore, specific interruption of the HDAC4-MAP1S interaction with short peptides or small molecules to enhance autophagy flux may relieve the toxicity of mHTT associated with Huntington's disease and improve symptoms of HD patients. PMID:26540094
NASA Astrophysics Data System (ADS)
Itakura, Shoko; Hama, Susumu; Matsui, Ryo; Kogure, Kentaro
2016-05-01
Condensing siRNA with cationic polymers is a major strategy used in the development of siRNA carriers that can avoid degradation by nucleases and achieve effective delivery of siRNA into the cytoplasm. However, ineffective release of siRNA from such condensed forms into the cytoplasm is a limiting step for induction of RNAi effects, and can be attributed to tight condensation of siRNA with the cationic polymers, due to potent electrostatic interactions. Here, we report that siRNA condensed with a slightly acidic pH-sensitive peptide (SAPSP), whose total charge is inverted from positive to negative in response to cytoplasmic pH, is effectively released via electrostatic repulsion of siRNA with negatively charged SAPSP at cytoplasmic pH (7.4). The condensed complex of siRNA and positively-charged SAPSP at acidic pH (siRNA/SAPSP) was found to result in almost complete release of siRNA upon charge inversion of SAPSP at pH 7.4, with the resultant negatively-charged SAPSP having no undesirable interactions with endogenous mRNA. Moreover, liposomes encapsulating siRNA/SAPSP demonstrated knockdown efficiencies comparable to those of commercially available siRNA carriers. Taken together, SAPSP may be very useful as a siRNA condenser, as it facilitates effective cytoplasmic release of siRNA, and subsequent induction of specific RNAi effects.Condensing siRNA with cationic polymers is a major strategy used in the development of siRNA carriers that can avoid degradation by nucleases and achieve effective delivery of siRNA into the cytoplasm. However, ineffective release of siRNA from such condensed forms into the cytoplasm is a limiting step for induction of RNAi effects, and can be attributed to tight condensation of siRNA with the cationic polymers, due to potent electrostatic interactions. Here, we report that siRNA condensed with a slightly acidic pH-sensitive peptide (SAPSP), whose total charge is inverted from positive to negative in response to cytoplasmic pH, is effectively released via electrostatic repulsion of siRNA with negatively charged SAPSP at cytoplasmic pH (7.4). The condensed complex of siRNA and positively-charged SAPSP at acidic pH (siRNA/SAPSP) was found to result in almost complete release of siRNA upon charge inversion of SAPSP at pH 7.4, with the resultant negatively-charged SAPSP having no undesirable interactions with endogenous mRNA. Moreover, liposomes encapsulating siRNA/SAPSP demonstrated knockdown efficiencies comparable to those of commercially available siRNA carriers. Taken together, SAPSP may be very useful as a siRNA condenser, as it facilitates effective cytoplasmic release of siRNA, and subsequent induction of specific RNAi effects. Electronic supplementary information (ESI) available: De-condensation of siRNA cores by addition of heparin; time-lapse moving image of the siRNA release. See DOI: 10.1039/c5nr08365f
Suzuki, Jun-ichi; Ogawa, Masahito; Takayama, Kiyoshi; Taniyama, Yoshiaki; Morishita, Ryuichi; Hirata, Yasunobu; Nagai, Ryozo; Isobe, Mitsuaki
2010-03-02
The purpose of this study was to investigate the efficiency of small interfering ribonucleic acid (siRNA) in murine arteries. We transfected it using a nonviral ultrasound-microbubble-mediated in vivo gene delivery system. siRNA is an effective methodology to suppress gene function. The siRNA can be synthesized easily; however, a major obstacle in the use of siRNA as therapeutics is the difficulty involved in effective in vivo delivery. To investigate the efficiency of nonviral ultrasound-microbubble-mediated in vivo siRNA delivery, we used a fluorescein-labeled siRNA, green fluorescent protein (GFP) siRNA, and intercellular adhesion molecule (ICAM)-1 siRNA in murine arteries. Murine femoral arteries were injured using flexible wires to establish arterial injury. The fluorescein-labeled siRNA and GFP siRNA showed that this nonviral approach could deliver siRNA into target arteries effectively without any tissue damage and systemic adverse effects. ICAM-1 siRNA transfection into murine injured arteries significantly suppressed the development of neointimal formation in comparison to those in the control group. Immunohistochemistry revealed that accumulation of T cells and adhesion molecule positive cells was observed in nontreated injured arteries, whereas siRNA suppressed accumulation. The nonviral ultrasound-microbubble delivery of siRNA ensures effective transfection into target arteries. ICAM-1 siRNA has the potential to suppress arterial neointimal formation. Transfection of siRNA can be beneficial for the clinical treatment of cardiovascular and other inflammatory diseases. Copyright 2010 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin
2017-07-18
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin
2017-01-01
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023
[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].
Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye
2013-01-01
To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.
NASA Astrophysics Data System (ADS)
Huang, Jia-Lin; Jiang, Gan; Song, Qing-Xiang; Gu, Xiao; Hu, Meng; Wang, Xiao-Lin; Song, Hua-Hua; Chen, Le-Pei; Lin, Ying-Ying; Jiang, Di; Chen, Jun; Feng, Jun-Feng; Qiu, Yong-Ming; Jiang, Ji-Yao; Jiang, Xin-Guo; Chen, Hong-Zhuan; Gao, Xiao-Ling
2017-05-01
Hyperactivated Ras regulates many oncogenic pathways in several malignant human cancers including glioblastoma and it is an attractive target for cancer therapies. Ras activation in cancer cells drives protein internalization via macropinocytosis as a key nutrient-gaining process. By utilizing this unique endocytosis pathway, here we create a biologically inspired nanostructure that can induce cancer cells to `drink drugs' for targeting activating transcription factor-5 (ATF5), an overexpressed anti-apoptotic transcription factor in glioblastoma. Apolipoprotein E3-reconstituted high-density lipoprotein is used to encapsulate the siRNA-loaded calcium phosphate core and facilitate it to penetrate the blood-brain barrier, thus targeting the glioblastoma cells in a macropinocytosis-dependent manner. The nanostructure carrying ATF5 siRNA exerts remarkable RNA-interfering efficiency, increases glioblastoma cell apoptosis and inhibits tumour cell growth both in vitro and in xenograft tumour models. This strategy of targeting the macropinocytosis caused by Ras activation provides a nanoparticle-based approach for precision therapy in glioblastoma and other Ras-activated cancers.
Establishment of cells to monitor Microprocessor through fusion genes of microRNA and GFP
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsutsui, Motomu; Hasegawa, Hitoki; Adachi, Koichi
Microprocessor, the complex of Drosha and DGCR8, promotes the processing of primary microRNA to precursor microRNA, which is a crucial step for microRNA maturation. So far, no convenient assay systems have been developed for observing this step in vivo. Here we report the establishment of highly sensitive cellular systems where we can visually monitor the function of Microprocessor. During a series of screening of transfectants with fusion genes of the EGFP cDNA and primary microRNA genes, we have obtained certain cell lines where introduction of siRNA against DGCR8 or Drosha strikingly augments GFP signals. In contrast, these cells have notmore » responded to Dicer siRNA; thus they have a unique character that GFP signals should be negatively and specifically correlated to the action of Microprocessor among biogenesis of microRNA. These cell lines can be useful tools for real-time analysis of Microprocessor action in vivo and identifying its novel modulators.« less
Designing highly active siRNAs for therapeutic applications.
Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina
2010-12-01
The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.
Tanudji, Marcel; Machalek, Dorothy; Arndt, Greg M; Rivory, Laurent
2010-02-01
Cotransfection of a mixture of siRNAs species is typically used when simultaneous targeting of more than one mRNA is required. However, competition between siRNAs could occur and reduce the activity of some siRNAs within the mixture. To further study the factors affecting the degree of competition between siRNAs, we cotransfected luciferase targeting siRNAs with various irrelevant (ie, nonluciferase targeting) siRNAs into cells and examined differences in their competition profiles by assessing the effect on luciferase expression. We show that the degree of competition varies between irrelevant siRNAs and occurs at the point of RISC loading. Although the competition profile appears to be related to the calculated RNA-induced silencing complex (RISC) loading potential, empirical testing is required to confirm the competitive effects. We also observed reduced competition with siRNAs in the Dicer-substrate format, presumably due to more efficient RISC loading as a consequence of the physical transfer of the processed siRNA from Dicer.
Efficient siRNA delivery system using carboxilated single-wall carbon nanotubes in cancer treatment.
Neagoe, Ioana Berindan; Braicu, Cornelia; Matea, Cristian; Bele, Constantin; Florin, Graur; Gabriel, Katona; Veronica, Chedea; Irimie, Alexandru
2012-08-01
Several functionalized carbon nanotubes have been designed and tested for the purpose of nucleic acid delivery. In this study, the capacity of SWNTC-COOH for siRNA deliverey were investigated delivery in parallel with an efficient commercial system. Hep2G cells were reverse-transfected with 50 nM siRNA (p53 siRNA, TNF-alphasiRNA, VEGFsiRNA) using the siPORT NeoFX (Ambion) transfection agent in paralel with SWNTC-COOH, functionalised with siRNA. The highest level of gene inhibition was observed in the cases treated with p53 siRNA gene; in the case of transfection with siPort, the NeoFX value was 33.8%, while in the case of SWNTC-COOH as delivery system for p53 siRNA was 37.5%. The gene silencing capacity for VEGF was 53.7%, respectively for TNF-alpha 56.7% for siPORT NeoFX delivery systems versus 47.7% (VEGF) and 46.5% (TNF-alpha) for SWNTC-COOH delivery system. SWNTC-COOH we have been showed to have to be an efficient carrier system. The results from the inhibition of gene expresion for both transfection systems were confirmed at protein level. Overall, the lowest mRNA expression was confirmed at protein level, especially in the case of p53 siRNA and TNF-alpha siRNA transfection. Less efficient reduction protein expressions were observed in the case of VEGF siRNA, for both transfection systems at 24 h; only at 48 h, there was a statistically significant reduction of VEGF protein expression. SWCNT-COOH determined an efficient delivery of siRNA. SWNTC-COOH, combined with suitable tumor markers like p53 siRNA, TNFalpha siRNA or VEGF siRNA can be used for the efficient delivery of siRNA.
Ambardekar, Vishakha V.; Han, Huai-Yun; Varney, Michelle L.; Vinogradov, Serguei V.; Singh, Rakesh K.; Vetro, Joseph A.
2010-01-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3′ cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. PMID:21047680
Ambardekar, Vishakha V; Han, Huai-Yun; Varney, Michelle L; Vinogradov, Serguei V; Singh, Rakesh K; Vetro, Joseph A
2011-02-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3' cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. Copyright © 2010 Elsevier Ltd. All rights reserved.
2014-11-13
PIM kinases are not required for essential cellular functions . Furthermore, the presence of a unique hinge region in the ATP-binding site of PIM1...washing and blocking, cells were incubated with the appropriate primary antibodies overnight and incubated with fluorescent secondary antibodies...determined after 72 hrs of reverse transfection by using the CellTiter-Glo Luminescent cell viability assay and the results were normalized to RISC -free siRNA
Bramsen, Jesper B.; Pakula, Malgorzata M.; Hansen, Thomas B.; Bus, Claus; Langkjær, Niels; Odadzic, Dalibor; Smicius, Romualdas; Wengel, Suzy L.; Chattopadhyaya, Jyoti; Engels, Joachim W.; Herdewijn, Piet; Wengel, Jesper; Kjems, Jørgen
2010-01-01
Small interfering RNAs (siRNAs) are now established as the preferred tool to inhibit gene function in mammalian cells yet trigger unintended gene silencing due to their inherent miRNA-like behavior. Such off-target effects are primarily mediated by the sequence-specific interaction between the siRNA seed regions (position 2–8 of either siRNA strand counting from the 5′-end) and complementary sequences in the 3′UTR of (off-) targets. It was previously shown that chemical modification of siRNAs can reduce off-targeting but only very few modifications have been tested leaving more to be identified. Here we developed a luciferase reporter-based assay suitable to monitor siRNA off-targeting in a high throughput manner using stable cell lines. We investigated the impact of chemically modifying single nucleotide positions within the siRNA seed on siRNA function and off-targeting using 10 different types of chemical modifications, three different target sequences and three siRNA concentrations. We found several differently modified siRNAs to exercise reduced off-targeting yet incorporation of the strongly destabilizing unlocked nucleic acid (UNA) modification into position 7 of the siRNA most potently reduced off-targeting for all tested sequences. Notably, such position-specific destabilization of siRNA–target interactions did not significantly reduce siRNA potency and is therefore well suited for future siRNA designs especially for applications in vivo where siRNA concentrations, expectedly, will be low. PMID:20453030
Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito
2018-07-01
Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.
The impact of target site accessibility on the design of effective siRNAs.
Tafer, Hakim; Ameres, Stefan L; Obernosterer, Gregor; Gebeshuber, Christoph A; Schroeder, Renée; Martinez, Javier; Hofacker, Ivo L
2008-05-01
Small-interfering RNAs (siRNAs) assemble into RISC, the RNA-induced silencing complex, which cleaves complementary mRNAs. Despite their fluctuating efficacy, siRNAs are widely used to assess gene function. Although this limitation could be ascribed, in part, to variations in the assembly and activation of RISC, downstream events in the RNA interference (RNAi) pathway, such as target site accessibility, have so far not been investigated extensively. In this study we present a comprehensive analysis of target RNA structure effects on RNAi by computing the accessibility of the target site for interaction with the siRNA. Based on our observations, we developed a novel siRNA design tool, RNAxs, by combining known siRNA functionality criteria with target site accessibility. We calibrated our method on two data sets comprising 573 siRNAs for 38 genes, and tested it on an independent set of 360 siRNAs targeting four additional genes. Overall, RNAxs proves to be a robust siRNA selection tool that substantially improves the prediction of highly efficient siRNAs.
Cho, Jun Sik; Lee, Shin-Wha; Kim, Yong-Man; Kim, Dongho; Kim, Dae-Yeon; Kim, Young-Tak
2015-05-01
This study was to identify small inhibitory RNAs (siRNAs) that are effective in inhibiting growth of cervical cancer cell lines harboring human papilloma virus (HPV) and to examine how siRNAs interact with interferon beta (IFN-β) and thimerosal. The HPV18-positive HeLa and C-4I cell lines were used. Four types of siRNAs were designed according to their target (both E6 and E7 vs. E6 only) and sizes (21- vs. 27-nucleotides); Ex-18E6/21, Ex-18E6/27, Sp-18E6/21, and Sp-18E6/27. Each siRNA-transfected cells were cultured with or without IFN-b and thimerosal and their viability was measured. The viabilities of HPV18-positive tumor cells were reduced by 21- and 27-nucleotide siRNAs in proportion to the siRNA concentrations. Of the two types of siRNAs, the 27-nucleotide siRNA constructs showed greater inhibitory efficacy. Sp-18E6 siRNAs, which selectively downregulates E6 protein only, were more effective than the E6- and E7-targeting Ex-18E6 siRNAs. siRNAs and IFN-β showed the synergistic effect to inhibit HeLa cell survival and the effect was proportional to both siRNA and IFN-β concentrations. Thimerosal in the presence of siRNA exerted a dose-dependent inhibition of C-4I cell survival. Finally, co-treatment with siRNA, IFN-β, and thimerosal induced the most profound decrease in the viability of both cell lines. Long (27-nucleotides) siRNAs targeting E6-E7 mRNAs effectively reduce the viability of HPV18-positive cervical cancer cells and show the synergistic effect in combination with IFN-b and thimerosal. It is necessary to find the rational design of siRNAs and effective co-factors to eradicate particular cervical cancer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp; Yanagihara, Kazuyoshi; Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045
2012-10-05
Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, suchmore » as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.« less
Targeting siRNA Missiles to Her2+ Breast Cancer
2009-06-01
that HerPBK10 protects siRNA from serum nuclease-mediated degradation, T7 transcribed siRNA is more cytotoxic than synthetic siRNA when delivered to...nuclease-mediated degradation, T7 transcribed siRNA is more cytotoxic than synthetic siRNA when delivered to HER2+ breast cancer cells by HerPBK10...produced either synthetically by a commercial vendor (Dharmacon), or from a T7 transcription kit (Ambion), and shRNA, which is reportedly a more effective
Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon
2018-05-01
Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥-34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3' overhang at the 3' end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms.
Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon
2018-01-01
Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥−34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3′ overhang at the 3′ end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms. PMID:29223142
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Design of siRNA Therapeutics from the Molecular Scale
Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick
2013-01-01
While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875
A novel program to design siRNAs simultaneously effective to highly variable virus genomes.
Lee, Hui Sun; Ahn, Jeonghyun; Jun, Eun Jung; Yang, Sanghwa; Joo, Chul Hyun; Kim, Yoo Kyum; Lee, Heuiran
2009-07-10
A major concern of antiviral therapy using small interfering RNAs (siRNAs) targeting RNA viral genome is high sequence diversity and mutation rate due to genetic instability. To overcome this problem, it is indispensable to design siRNAs targeting highly conserved regions. We thus designed CAPSID (Convenient Application Program for siRNA Design), a novel bioinformatics program to identify siRNAs targeting highly conserved regions within RNA viral genomes. From a set of input RNAs of diverse sequences, CAPSID rapidly searches conserved patterns and suggests highly potent siRNA candidates in a hierarchical manner. To validate the usefulness of this novel program, we investigated the antiviral potency of universal siRNA for various Human enterovirus B (HEB) serotypes. Assessment of antiviral efficacy using Hela cells, clearly demonstrates that HEB-specific siRNAs exhibit protective effects against all HEBs examined. These findings strongly indicate that CAPSID can be applied to select universal antiviral siRNAs against highly divergent viral genomes.
Ultrasound-Targeted Microbubble Destruction to Deliver siRNA Cancer Therapy
Carson, Andrew R; McTiernan, Charles F; Lavery, Linda; Grata, Michelle; Leng, Xiaoping; Wang, Jianjun; Chen, Xucai; Villanueva, Flordeliza S
2012-01-01
Microbubble contrast agents can specifically deliver nucleic acids to target tissues when exposed to ultrasound treatment parameters that mediate microbubble destruction. In this study, we evaluated whether microbubbles and ultrasound targeted microbubble destruction (UTMD) could be used to enhance delivery of EGFR-directed small inhibitory RNA (siRNA) to murine squamous cell carcinomas. Custom designed microbubbles efficiently bound siRNA and mediated RNAse protection. UTMD-mediated delivery of microbubbles loaded with EGFR-directed siRNA to murine squamous carcinoma cells in vitro reduced EGFR expression and EGF-dependent growth, relative to delivery of control siRNA. Similarly, serial UTMD-mediated delivery of EGFR siRNA to squamous cell carcinoma in vivo decreased EGFR expression and increased tumor doubling times, relative to controls receiving EGFR siRNA loaded microbubbles but not ultrasound or control siRNA loaded microbubbles and UTMD. Taken together, our results offer a preclinical proof of concept for customized microbubbles and UTMD to deliver gene-targeted siRNA for cancer therapy. PMID:23010078
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimizu, Takashi, E-mail: shimizut@obihiro.ac.jp; Hirai, Yuko; Murayama, Chiaki
2011-08-19
Highlights: {yields} Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression. {yields}Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom. {yields} Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. {yields}Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. {yields} The expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. -- Abstract: Circadian Clock genes are associated with the estrous cycle in female animals. Treatment with Per2 and Clock siRNAs decreased the number ofmore » granulosa cells and LHr expression in follicle-stimulating hormone FSH-treated granulosa cells. Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom, whereas Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. Similarly, expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. Our data provide a new insight that Per2 and Clock have different action on ovarian granulosa cell functions.« less
[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].
Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e
2010-06-01
To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.
Wang, Lei; Griffel, Benjamin; Xu, Xiaoyang
2017-01-01
The effective delivery of small interfering RNA (siRNA) to tumor cells remains a challenge for applications in cancer therapy. The development of polymeric nanoparticles with high siRNA loading efficacy has shown great potential for cancer targets. Double emulsion solvent evaporation technique is a useful tool for encapsulation of hydrophilic molecules (e.g., siRNA). Here we describe a versatile platform for siRNA delivery based on PLGA-PEG-cationic lipid nanoparticles by using the double emulsion method. The resulting nanoparticles show high encapsulation efficiency for siRNA (up to 90%) and demonstrate effective downregulation of the target genes in vitro and vivo.
Hydroxychloroquine-conjugated gold nanoparticles for improved siRNA activity.
Perche, F; Yi, Y; Hespel, L; Mi, P; Dirisala, A; Cabral, H; Miyata, K; Kataoka, K
2016-06-01
Current technology of siRNA delivery relies on pharmaceutical dosage forms to route maximal doses of siRNA to the tumor. However, this rationale does not address intracellular bottlenecks governing silencing activity. Here, we tested the impact of hydroxychloroquine conjugation on the intracellular fate and silencing activity of siRNA conjugated PEGylated gold nanoparticles. Addition of hydroxychloroquine improved endosomal escape and increased siRNA guide strand distribution to the RNA induced silencing complex (RISC), both crucial obstacles to the potency of siRNA. This modification significantly improved gene downregulation in cellulo. Altogether, our data suggest the benefit of this modification for the design of improved siRNA delivery systems. Copyright © 2016 Elsevier Ltd. All rights reserved.
Targeting the Blind Spot of Polycationic Nanocarrier-Based siRNA Delivery
Zheng, Mengyao; Pavan, Giovanni M.; Neeb, Manuel; Schaper, Andreas K.; Danani, Andrea; Klebe, Gerhard; Merkel, Olivia M.; Kissel, Thomas
2013-01-01
Polycationic nanocarriers attract increasing attention to the field of siRNA delivery. We investigated the self-assembly of siRNA vs pDNA with polycations, which are broadly used for nonviral gene and siRNA delivery. Although polyethyleneimine (PEI) was routinely adopted as siRNA carrier based on its efficacy in delivering pDNA, it has not been investigated yet why PEI efficiently delivers pDNA to cells but is controversially discussed in terms of efficacy for siRNA delivery. We are the first to investigate the self-assembly of PEI/siRNA vs PEI/pDNA and the steps of complexation and aggregation through different levels of hierarchy on the atomic and molecular scale with the novel synergistic use of molecular modeling, molecular dynamics simulation, isothermal titration calorimetry, and other characterization techniques. We are also the fist to elucidate atomic interactions, size, shape, stoichiometry, and association dynamics for polyplexes containing siRNA vs pDNA. Our investigation highlights differences in the hierarchical mechanism of formation of related polycation–siRNA and polycation–pDNA complexes. The results of fluorescence quenching assays indicated a biphasic behavior of siRNA binding with polycations where molecular reorganization of the siRNA within the polycations occurred at lower N/P ratios (nitrogen/phosphorus). Our results, for the first time, emphasize a biphasic behavior in siRNA complexation and the importance of low N/P ratios, which allow for excellent siRNA delivery efficiency. Our investigation highlights the formulation of siRNA complexes from a thermodynamic point of view and opens new perspectives to advance the rational design of new siRNA delivery systems. PMID:23036046
Wang, Xu-Li; Ramusovic, Sergej; Nguyen, Thanh; Lu, Zheng-Rong
2007-01-01
Small interfering RNA (siRNA) is a promising new therapeutic modality that can specifically silence disease-related genes. The main challenge for successful clinical development of therapeutic siRNA is the lack of efficient delivery systems. In this study, we have designed and synthesized a small library of novel multifunctional siRNA carriers, polymerizable surfactants with pH-sensitive amphiphilicity based on the hypothesis that pH-sensitive amphiphilicity and environmentally sensitive siRNA release can result in efficient siRNA delivery. The polymerizable surfactants comprise a protonatable amino head group, two cysteine residues, and two lipophilic tails. The surfactants demonstrated pH-sensitive amphiphilic hemolytic activity or cell membrane disruption with rat red blood cells. Most of the surfactants resulted in low hemolysis at pH 7.4 and high hemolysis at reduced pH (6.5 and 5.4). The pH-sensitive cell membrane disruption can facilitate endosomal-lysosomal escape of siRNA delivery systems at the endosomal-lysosomal pH. The surfactants formed compact nanoparticles (160-260 nm) with siRNA at N/P ratios of 8 and 10 via charge complexation with the amino head group, lipophilic condensation, and autoxidative polymerization of dithiols. The siRNA complexes with the surfactants demonstrated low cytotoxicity. The cellular siRNA delivery efficiency and RNAi activity of the surfactants correlated well with their pH-sensitive amphiphilic cell membrane disruption. The surfactants mediated 40-88% silencing of luciferase expression with 100 nM siRNA and 35-75% with 20 nM siRNA in U87-luc cells. Some of the surfactants resulted in similar or higher gene silencing efficiency than TransFast. EHCO with no hemolytic activity at pH 7.4 and 6.5 and high hemolytic activity at pH 5.4 resulted in the best siRNA delivery efficiency. The polymerizable surfactants with pH-sensitive amphiphilicity are promising for efficient siRNA delivery.
Lau, Shannen; Graham, Bim; Cao, Nga; Boyd, Ben J; Pouton, Colin W; White, Paul J
2012-01-01
A potential barrier to progression of siRNA therapeutics to the clinic is the ability of these agents to cross the vascular endothelium to reach target cells. This study aimed to bypass the endothelial barrier by harnessing the extravasation capability of the serum protein albumin to allow siRNA to reach cardiomyocytes. A strategy for conjugating siRNA to albumin in vivo was developed that involved activating 3'-amine, 2'-O-methyl, phosphorothioate modified siRNA with succinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate (SMCC) to yield maleimide-functionalized siRNA ("activated siRNA"); this thiol-reactive species can then irreversibly link to the single surface-exposed cysteine residue of endogenous albumin following intravenous administration. An IGF-I-receptor (IGF-IR) siRNA sequence which was effective in vitro was used to test the ability of the siRNA-albumin conjugate to bypass the endothelial barrier in Balb/C mice and produce silencing. In situ conjugation of maleimide-functionalized siRNA to albumin in mouse serum occurred within minutes of addition, and the resulting conjugate was found to be nuclease stable by SDS-PAGE analysis. In Sprague-Dawley rats, activated siRNA showed a significantly enhanced elimination half-life (75.9 ± 18.2 min) compared to unactivated siRNA (5.1 ± 0.2 min). Intravenous injection of this activated siRNA (1 mg/kg daily for four days) significantly reduced left ventricle IGF-IR mRNA to 64.1 ± 4.1% of that in vehicle-treated animals (mean ± SEM), while the control siRNA (unconjugated) had no effect (n = 4, P > 0.05). Imaging of microvessels from mice treated with fluorescein-labeled activated siRNA showed clear evidence of extravasation and cellular uptake in capillary endothelial cells, cardiomyocytes and vascular smooth muscle cells for mice treated with the activated siRNA but not mice treated with the unactivated siRNA. siRNA-albumin constructs are therefore capable of extravasation to the myocardium resulting in silencing in this otherwise silencing-resistant organ.
Randall, Matthew J; Spiess, Page C; Hristova, Milena; Hondal, Robert J; van der Vliet, Albert
2013-01-01
Cigarette smoking remains a major health concern worldwide, and many of the adverse effects of cigarette smoke (CS) can be attributed to its abundant electrophilic aldehydes, such as acrolein (2-propenal). Previous studies indicate that acrolein readily reacts with thioredoxin reductase 1 (TrxR1), a critical enzyme involved in regulation of thioredoxin (Trx)-mediated redox signaling, by alkylation at its selenocysteine (Sec) residue. Because alkylation of Sec within TrxR1 has significant implications for its enzymatic function, we explored the potential importance of TrxR1 alkylation in acrolein-induced activation or injury of bronchial epithelial cells. Exposure of human bronchial epithelial HBE1 cells to acrolein (1-30 μM) resulted in dose-dependent loss of TrxR thioredoxin reductase activity, which coincided with its alkylation, as determined by biotin hydrazide labeling, and was independent of initial GSH status. To test the involvement of TrxR1 in acrolein responses in HBE1 cells, we suppressed TrxR1 using siRNA silencing or augmented TrxR1 by cell supplementation with sodium selenite. Acrolein exposure of HBE1 cells induced dose-dependent activation of the MAP kinases, extracellular regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, and activation of JNK was markedly enhanced after selenite-mediated induction of TrxR1, and was associated with increased alkylation of TrxR1. Conversely, siRNA silencing of TrxR1 significantly suppressed the ability of acrolein to activate JNK, and also appeared to attenuate acrolein-dependent activation of ERK and p38. Alteration of initial TrxR1 levels by siRNA or selenite supplementation also affected initial Trx1 redox status and acrolein-mediated alkylation of Trx1, but did not significantly affect acrolein-mediated activation of HO-1 or cytotoxicity. Collectively, our findings indicate that alkylation of TrxR1 and/or Trx1 may contribute directly to acrolein-mediated activation of MAP kinases such as JNK, and may therefore be important in acrolein-induced alterations in airway epithelial function, as a contributing mechanism in tobacco-related respiratory disease.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Zhou, Yinjian; Zhang, Chunling; Liang, Wei
2014-11-10
RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.
Hyper-dependence of breast cancer cell types on the nuclear transporter Importin β1.
Kuusisto, Henna V; Jans, David A
2015-08-01
We previously reported that overexpression of members of the Importin (Imp) superfamily of nuclear transporters results in increased nuclear trafficking through conventional transport pathways in tumour cells. Here we show for the first time that the extent of overexpression of Impβ1 correlates with disease state in the MCF10 human breast tumour progression system. Excitingly, we find that targeting Impβ1 activity through siRNA is >30 times more efficient in decreasing the viability of malignant ductal carcinoma cells compared to isogenic non-transformed counterparts, and is highly potent and tumour selective at subnanomolar concentrations. Tumour cell selectivity of the siRNA effects was unique to Impβ1 and not other Imps, with flow cytometric analysis showing >60% increased cell death compared to controls concomitant with reduced nuclear import efficiency as indicated by confocal microscopic analysis. This hypersensitivity of malignant cell types to Impβ1 knockdown raises the exciting possibility of anti-cancer therapies targeted at Impβ1. Copyright © 2015 Elsevier B.V. All rights reserved.
Intracellular ROS mediates gas plasma-facilitated cellular transfection in 2D and 3D cultures
Xu, Dehui; Wang, Biqing; Xu, Yujing; Chen, Zeyu; Cui, Qinjie; Yang, Yanjie; Chen, Hailan; Kong, Michael G.
2016-01-01
This study reports the potential of cold atmospheric plasma (CAP) as a versatile tool for delivering oligonucleotides into mammalian cells. Compared to lipofection and electroporation methods, plasma transfection showed a better uptake efficiency and less cell death in the transfection of oligonucleotides. We demonstrated that the level of extracellular aqueous reactive oxygen species (ROS) produced by gas plasma is correlated with the uptake efficiency and that this is achieved through an increase of intracellular ROS levels and the resulting increase in cell membrane permeability. This finding was supported by the use of ROS scavengers, which reduced CAP-based uptake efficiency. In addition, we found that cold atmospheric plasma could transfer oligonucleotides such as siRNA and miRNA into cells even in 3D cultures, thus suggesting the potential for unique applications of CAP beyond those provided by standard transfection techniques. Together, our results suggest that cold plasma might provide an efficient technique for the delivery of siRNA and miRNA in 2D and 3D culture models. PMID:27296089
Hattori, Yoshiyuki; Arai, Shohei; Okamoto, Ryou; Hamada, Megumi; Kawano, Kumi; Yonemochi, Etsuo
2014-12-10
In this study, we developed novel siRNA transfer method to the liver by sequential intravenous injection of anionic polymer and cationic liposome/cholesterol-modified siRNA complex (cationic lipoplex). When cationic lipoplex was intravenously injected into mice, the accumulation of siRNA was mainly observed in the lungs. In contrast, when cationic lipoplex was intravenously injected at 1 min after intravenous injection of poly-L-glutamic acid (PGA) or chondroitin sulfate C (CS), siRNA was accumulated in the liver. In terms of suppression of gene expression in vivo, apolipoprotein B (ApoB) mRNA in the liver and low-density-lipoprotein (LDL) and very low-density-lipoprotein (VLDL) cholesterol level in serum were reduced at 48 h after single sequential injection of PGA or CS plus cationic lipoplex of cholesterol-modified ApoB siRNA. Furthermore, sequential injections of PGA plus cationic lipoplex of cholesterol-modified luciferase siRNA could reduce luciferase activity in tumor xenografts bearing liver metastasis of human breast tumor MCF-7-Luc. From these findings, sequential injection of anionic polymer and cationic lipoplex of siRNA might produce a systemic vector of siRNA to the liver. Copyright © 2014 Elsevier B.V. All rights reserved.
Björkman, Mari; Rantala, Juha; Nees, Matthias; Kallioniemi, Olli
2010-10-01
Alterations in epigenetic processes probably underlie most human malignancies. Novel genome-wide techniques, such as chromatin immunoprecipitation and high-throughput sequencing, have become state-of-the-art methods to map the epigenomic landscape of development and disease, such as in cancers. Despite these advances, the functional significance of epigenetic enzymes in cancer progression, such as prostate cancer, remain incompletely understood. A comprehensive mapping and functional understanding of the cancer epigenome will hopefully help to facilitate development of novel cancer therapy targets and improve future diagnostics. The authors have developed a novel cell microarray-based high-content siRNA screening technique suitable to address the putative functional role and impact of all known putative and novel epigenetic enzymes in cancer, including prostate cancer.
Multifunctional pH-Sensitive Amino Lipids for siRNA Delivery.
Gujrati, Maneesh; Vaidya, Amita; Lu, Zheng-Rong
2016-01-20
RNA interference (RNAi) represents a powerful modality for human disease therapy that can regulate gene expression signature using small interfering RNA (siRNA). Successful delivery of siRNA into the cytoplasm of target cells is imperative for efficient RNAi and also constitutes the primary stumbling block in the clinical applicability of RNAi. Significant progress has been made in the development of lipid-based siRNA delivery systems, which have practical advantages like simple chemistry and easy formulation of nanoparticles with siRNA. This review discusses the recent development of pH-sensitive amino lipids, with particular focus on multifunctional pH-sensitive amino lipids for siRNA delivery. The key components of these multifunctional lipids include a protonatable amino head group, distal lipid tails, and two cross-linkable thiol groups, which together facilitate the facile formation of stable siRNA-nanoparticles, easy surface modification for target-specific delivery, endosomal escape in response to the pH decrease during subcellular trafficking, and reductive dissociation of the siRNA-nanoparticles for cytoplasmic release of free siRNA. By virtue of these properties, multifunctional pH-sensitive lipids can mediate efficient cytosolic siRNA delivery and gene silencing. Targeted siRNA nanoparticles can be readily formulated with these lipids, without the need for other helper lipids, to promote systemic delivery of therapeutic siRNAs. Such targeted siRNA nanoparticles have been shown to effectively regulate the expression of cancer-related genes, resulting in significant efficacy in the treatment of aggressive tumors, including metastatic triple negative breast cancer. These multifunctional pH-sensitive lipids constitute a promising platform for the systemic and targeted delivery of therapeutic siRNA for the treatment of human diseases. This review summarizes the structure-property relationship of the multifunctional pH-sensitive lipids and their efficacy in in vitro and in vivo siRNA delivery and gene silencing.
Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study
2010-01-01
Background Gene silencing using exogenous small interfering RNAs (siRNAs) is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC) to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. Results An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs) have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. Conclusions The knowledge gained from our study provides useful insights on how to analyze various cross-platform RNAi data for uncovering of their complex mechanism. PMID:20380733
Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study.
Liu, Qi; Xu, Qian; Zheng, Vincent W; Xue, Hong; Cao, Zhiwei; Yang, Qiang
2010-04-10
Gene silencing using exogenous small interfering RNAs (siRNAs) is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC) to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs) have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. The knowledge gained from our study provides useful insights on how to analyze various cross-platform RNAi data for uncovering of their complex mechanism.
Whole-Genome Thermodynamic Analysis Reduces siRNA Off-Target Effects
Chen, Xi; Liu, Peng; Chou, Hui-Hsien
2013-01-01
Small interfering RNAs (siRNAs) are important tools for knocking down targeted genes, and have been widely applied to biological and biomedical research. To design siRNAs, two important aspects must be considered: the potency in knocking down target genes and the off-target effect on any nontarget genes. Although many studies have produced useful tools to design potent siRNAs, off-target prevention has mostly been delegated to sequence-level alignment tools such as BLAST. We hypothesize that whole-genome thermodynamic analysis can identify potential off-targets with higher precision and help us avoid siRNAs that may have strong off-target effects. To validate this hypothesis, two siRNA sets were designed to target three human genes IDH1, ITPR2 and TRIM28. They were selected from the output of two popular siRNA design tools, siDirect and siDesign. Both siRNA design tools have incorporated sequence-level screening to avoid off-targets, thus their output is believed to be optimal. However, one of the sets we tested has off-target genes predicted by Picky, a whole-genome thermodynamic analysis tool. Picky can identify off-target genes that may hybridize to a siRNA within a user-specified melting temperature range. Our experiments validated that some off-target genes predicted by Picky can indeed be inhibited by siRNAs. Similar experiments were performed using commercially available siRNAs and a few off-target genes were also found to be inhibited as predicted by Picky. In summary, we demonstrate that whole-genome thermodynamic analysis can identify off-target genes that are missed in sequence-level screening. Because Picky prediction is deterministic according to thermodynamics, if a siRNA candidate has no Picky predicted off-targets, it is unlikely to cause off-target effects. Therefore, we recommend including Picky as an additional screening step in siRNA design. PMID:23484018
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ying, Bo; Campbell, Robert B., E-mail: robert.campbell@mcphs.edu
2014-04-04
Highlights: • siRNA-lipid nanoparticles are solid particles not lipid bilayers with aqueous core. • High, but not low, PEG content can prevent nanoparticle encapsulation of siRNA. • PEG reduces cellular toxicity of cationic nanoparticles in vitro. • PEG reduces zeta potential while improving gene silencing of siRNA nanoparticles. • Kinesin spindle protein can be an effective target for tumor vascular targeting. - Abstract: The ideal siRNA delivery system should selectively deliver the construct to the target cell, avoid enzymatic degradation, and evade uptake by phagocytes. In the present study, we evaluated the importance of polyethylene glycol (PEG) on lipid-based carriermore » systems for encapsulating, and delivering, siRNA to tumor vessels using cellular models. Lipid nanoparticles containing different percentage of PEG were evaluated based on their physical chemical properties, density compared to water, siRNA encapsulation, toxicity, targeting efficiency and gene silencing in vitro. siRNA can be efficiently loaded into lipid nanoparticles (LNPs) when DOTAP is included in the formulation mixture. However, the total amount encapsulated decreased with increase in PEG content. In the presence of siRNA, the final formulations contained a mixed population of particles based on density. The major population which contains the majority of siRNA exhibited a density of 4% glucose, and the minor fraction associated with a decreased amount of siRNA had a density less than PBS. The inclusion of 10 mol% PEG resulted in a greater amount of siRNA associated with the minor fraction. Finally, when kinesin spindle protein (KSP) siRNA was encapsulated in lipid nanoparticles containing a modest amount of PEG, the proliferation of endothelial cells was inhibited due to the efficient knock down of KSP mRNA. The presence of siRNA resulted in the formation of solid lipid nanoparticles when prepared using the thin film and hydration method. LNPs with a relatively modest amount of PEG can sufficiently encapsulate siRNA, improve cellular uptake and the efficiency of gene silencing.« less
A genome-wide siRNA screen was employed to identify genes that were selectively toxic for a non-small cell lung cancer (NSCLC) cell line that lacked expression of SMARCA4, but were not toxic in non-cancerous immortalized human bronchial epithelial cells lacking SMARCA4 expression. Among the selectively toxic genes were several mapping to the molecular machinery regulating activity of Aurora kinase A on the mitotic spindle.
A genome-wide siRNA screen was employed to identify genes that were selectively toxic for a non-small cell lung cancer (NSCLC) cell line that lacked expression of SMARCA4, but were not toxic in non-cancerous immortalized human bronchial epithelial cells lacking SMARCA4 expression. Among the selectively toxic genes were several mapping to the molecular machinery regulating activity of Aurora kinase A on the mitotic spindle.
Progress and perspective of inorganic nanoparticles based siRNA delivery system
Jiang, Ying; Huo, Shuaidong; Hardie, Joseph; Liang, Xing-Jie; Rotello, Vincent M.
2016-01-01
Introduction Small interfering RNA (siRNA) is an effective method for regulating the expression of proteins, even “undruggable” ones that are nearly impossible to target through traditional small molecule therapeutics. Delivery to the cell and then to the cytosol is the primary requirement for realization of therapeutic potential of siRNA. Areas covered We summarize recent advances in the design of inorganic nanoparticle with surface functionality and physicochemical properties engineered for siRNA delivery. Specifically, we discuss the main approaches developed so far to load siRNA into/onto NPs, and NP surface chemistry engineered for enhanced intracellular siRNA delivery, endosomal escape, and targeted delivery of siRNA to disease cells and tissues. Expert Opinion Several challenges remain in developing inorganic NPs for efficient and effective siRNA delivery. Getting the material to the chosen site is important, however the greatest hurdle may well be delivery into the cytosol, either through efficient endosomal escape or by direct cytosolic siRNA delivery. Effective delivery at the organismic and cellular level coupled with biocompatible vehicles with low immunogenic response will facilitate the clinical translation of RNAi for the treatment of genetic diseases. PMID:26735861
Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting
De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.
2007-01-01
RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355
Intranasal delivery of antiviral siRNA.
Barik, Sailen
2011-01-01
Intranasal administration of synthetic siRNA is an effective modality of RNAi delivery for the prevention and therapy of respiratory diseases, including pulmonary infections. Vehicles used for nasal siRNA delivery include established as well as novel reagents, many of which have been recently optimized. In general, they all promote significant uptake of siRNA into the lower respiratory tract, including the lung. When properly designed and optimized, these siRNAs offer significant protection against respiratory viruses such as influenza virus, parainfluenza virus and respiratory syncytial virus (RSV). Nasally administered siRNA remains within the lung and does not access systemic blood flow, as judged by its absence in other major organs such as liver, heart, kidney, and skeletal muscle. Adverse immune reaction is generally not encountered, especially when immunogenic and/or off-target siRNA sequences and toxic vehicles are avoided. In fact, siRNA against RSV has entered Phase II clinical trials in human with promising results. Here, we provide a standardized procedure for using the nose as a specific route for siRNA delivery into the lung of laboratory animals. It should be clear that this simple and efficient system has enormous potential for therapeutics.
Petrova, Natalya S; Chernikov, Ivan V; Meschaninova, Mariya I; Dovydenko, Iiya S; Venyaminova, Aliya G; Zenkova, Marina A; Vlassov, Valentin V; Chernolovskaya, Elena L
2012-03-01
The conjugation of siRNA to molecules, which can be internalized into the cell via natural transport mechanisms, can result in the enhancement of siRNA cellular uptake. Herein, the carrier-free cellular uptake of nuclease-resistant anti-MDR1 siRNA equipped with lipophilic residues (cholesterol, lithocholic acid, oleyl alcohol and litocholic acid oleylamide) attached to the 5'-end of the sense strand via oligomethylene linker of various length was investigated. A convenient combination of H-phosphonate and phosphoramidite methods was developed for the synthesis of 5'-lipophilic conjugates of siRNAs. It was found that lipophilic siRNA are able to effectively penetrate into HEK293, HepG2 and KB-8-5 cancer cells when used in a micromolar concentration range. The efficiency of the uptake is dependent upon the type of lipophilic moiety, the length of the linker between the moiety and the siRNA and cell type. Among all the conjugates tested, the cholesterol-conjugated siRNAs with linkers containing from 6 to 10 carbon atoms demonstrate the optimal uptake and gene silencing properties: the shortening of the linker reduces the efficiency of the cellular uptake of siRNA conjugates, whereas the lengthening of the linker facilitates the uptake but retards the gene silencing effect and decreases the efficiency of the silencing.
Prabhakar, Neeraj; Zhang, Jixi; Desai, Diti; Casals, Eudald; Gulin-Sarfraz, Tina; Näreoja, Tuomas; Westermarck, Jukka; Rosenholm, Jessica M
2016-01-01
Small interfering RNA (siRNA) is a highly potent drug in gene-based therapy with the challenge being to deliver it in a sustained manner. The combination of mesoporous silica nanoparticles (MSNs) and polycations in the confined pore space allows for incorporation and controlled release of therapeutic siRNA payloads. We hereby constructed MSNs with expanded mesopores and pore-surface-hyperbranched poly(ethyleneimine) (PEI) tethered with redox-cleavable linkers that could carry a high payload of siRNA (120 mg·g−1). The developed nanocarriers were efficiently taken up by cancer cells and were subsequently able to escape to the cytoplasm from the endosomes, most likely owing to the integrated PEI. Triggered by the intracellular redox conditions, the siRNA was sustainably released inside the cells over a period of several days. Functionality of siRNAs was demonstrated by using cell-killing siRNA as cargo. Despite not being the aim of the developed system, in vitro experiments using cell-killing siRNAs showed that the efficacy of siRNA transfection was comparable to the commercial in vitro transfection agent Lipofectamine. Consequently, the developed MSN-based delivery system offers a potential approach to hybrid nanocarriers for more efficient and long-term siRNA delivery and, in a longer perspective, in vivo gene silencing for RNA interference (RNAi) therapy. PMID:27994460
Raja, Priya; Jackel, Jamie N; Li, Sizhun; Heard, Isaac M; Bisaro, David M
2014-03-01
Arabidopsis encodes five double-stranded RNA binding (DRB) proteins. DRB1 and DRB2 are involved in microRNA (miRNA) biogenesis, while DRB4 functions in cytoplasmic posttranscriptional small interfering RNA (siRNA) pathways. DRB3 and DRB5 are not involved in double-stranded RNA (dsRNA) processing but assist in silencing transcripts targeted by DRB2-associated miRNAs. The goal of this study was to determine which, if any, of the DRB proteins might also participate in a nuclear siRNA pathway that leads to geminivirus genome methylation. Here, we demonstrate that DRB3 functions with Dicer-like 3 (DCL3) and Argonaute 4 (AGO4) in methylation-mediated antiviral defense. Plants employ repressive viral genome methylation as an epigenetic defense against geminiviruses, using an RNA-directed DNA methylation (RdDM) pathway similar to that used to suppress endogenous invasive DNAs such as transposons. Chromatin methylation inhibits virus replication and transcription, and methylation-deficient host plants are hypersusceptible to geminivirus infection. Using a panel of drb mutants, we found that drb3 plants uniquely exhibit a similar hypersensitivity and that viral genome methylation is substantially reduced in drb3 compared to wild-type plants. In addition, like dcl3 and ago4 mutants, drb3 plants fail to recover from infection and cannot accomplish the viral genome hypermethylation that is invariably observed in asymptomatic, recovered tissues. Small RNA analysis, bimolecular fluorescence complementation, and coimmunoprecipitation experiments show that DRB3 acts downstream of siRNA biogenesis and suggest that it associates with DCL3 and AGO4 in distinct subnuclear compartments. These studies reveal that in addition to its previously established role in the miRNA pathway, DRB3 also functions in antiviral RdDM. Plants use RNA-directed DNA methylation (RdDM) as an epigenetic defense against geminiviruses. RNA silencing pathways in Arabidopsis include five double-stranded RNA binding proteins (DRBs) related to Drosophila R2D2 and mammalian TRBP and PACT. While DRB proteins have defined roles in miRNA and cytoplasmic siRNA pathways, a role in nuclear RdDM was elusive. Here, we used the geminivirus system to show that DRB3 is involved in methylation-mediated antiviral defense. Beginning with a panel of Arabidopsis drb mutants, we demonstrated that drb3 plants uniquely show enhanced susceptibility to geminiviruses. Further, like dcl3 and ago4 mutants, drb3 plants fail to hypermethylate the viral genome, a requirement for host recovery. We also show that DRB3 physically interacts with the RdDM pathway components DCL3 and AGO4 in the nucleus. This work highlights the utility of geminiviruses as models for de novo RdDM and places DRB3 protein in this fundamental epigenetic pathway.
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
Liu, Wanlu; Duttke, Sascha H; Hetzel, Jonathan; Groth, Martin; Feng, Suhua; Gallego-Bartolome, Javier; Zhong, Zhenhui; Kuo, Hsuan Yu; Wang, Zonghua; Zhai, Jixian; Chory, Joanne; Jacobsen, Steven E
2018-03-01
Small RNAs regulate chromatin modifications such as DNA methylation and gene silencing across eukaryotic genomes. In plants, RNA-directed DNA methylation (RdDM) requires 24-nucleotide small interfering RNAs (siRNAs) that bind to ARGONAUTE 4 (AGO4) and target genomic regions for silencing. RdDM also requires non-coding RNAs transcribed by RNA polymerase V (Pol V) that probably serve as scaffolds for binding of AGO4-siRNA complexes. Here, we used a modified global nuclear run-on protocol followed by deep sequencing to capture Pol V nascent transcripts genome-wide. We uncovered unique characteristics of Pol V RNAs, including a uracil (U) common at position 10. This uracil was complementary to the 5' adenine found in many AGO4-bound 24-nucleotide siRNAs and was eliminated in a siRNA-deficient mutant as well as in the ago4/6/9 triple mutant, suggesting that the +10 U signature is due to siRNA-mediated co-transcriptional slicing of Pol V transcripts. Expression of wild-type AGO4 in ago4/6/9 mutants was able to restore slicing of Pol V transcripts, but a catalytically inactive AGO4 mutant did not correct the slicing defect. We also found that Pol V transcript slicing required SUPPRESSOR OF TY INSERTION 5-LIKE (SPT5L), an elongation factor whose function is not well understood. These results highlight the importance of Pol V transcript slicing in RNA-mediated transcriptional gene silencing, which is a conserved process in many eukaryotes.
Addition of poly (propylene glycol) to multiblock copolymer to optimize siRNA delivery.
Dai, Zhi; Arévalo, Maria T; Li, Junwei; Zeng, Mingtao
2014-01-01
Previous studies have examined different strategies for siRNA delivery with varying degrees of success. These include use of viral vectors, cationic liposomes, and polymers. Several copolymers were designed and synthesized based on blocks of poly(ethylene glycol) PEG, poly(propylene glycol) PPG, and poly(l-lysine). These were designated as P1, P2, and P3. We studied the copolymer self-assembly, siRNA binding, particle size, surface potential, architecture of the complexes, and siRNA delivery. Silencing of GFP using copolymer P3 to deliver GFP-specific siRNA to Neuro-2a cells expressing GFP was almost as effective as using Lipofectamine 2000, with minimal cytotoxicity. Thus, we have provided a new copolymer platform for siRNA delivery that we can continue to modify for improved delivery of siRNA in vitro and eventually in vivo.
Perche, Phanélie; Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Kotera, Mitsuharu; Remy, Jean-Serge
2013-08-28
Despite its considerable interest in human therapy, in vivo siRNA delivery is still suffering from hurdles of vectorization. We have shown recently efficient gene silencing by non-vectorized cationic siRNA. Here, we describe the synthesis and in vitro evaluation of new amphiphilic cationic siRNA. C₁₂-, (C₁₂)₂- and cholesteryl-spermine(x)-siRNA were capable of luciferase knockdown at nanomolar concentrations without vectorization (i.e. one to two orders of magnitude more potent than commercially available cholesteryl siRNA). Moreover, incubation in the presence of serum did not impair their efficiency. Finally, amphiphilic cationic siRNA was pre-loaded on albumin. In A549Luc cells in the presence of serum, these siRNA conjugates were highly effective and had low toxicity. Copyright © 2013. Published by Elsevier B.V.
Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics
Hong, Cheol Am; Nam, Yoon Sung
2014-01-01
Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170
Current Progress of siRNA/shRNA Therapeutics in Clinical Trials
Burnett, John C.; Rossi, John J.; Tiemann, Katrin
2012-01-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502
Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.
Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa
2018-03-21
Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.
Xie, Yuran; Kim, Na Hyung; Nadithe, Venkatareddy; Schalk, Dana; Thakur, Archana; Kılıç, Ayşe; Lum, Lawrence G.; Bassett, David JP; Merkel, Olivia M
2016-01-01
Asthma is a worldwide health problem. Activated T cells (ATCs) in the lung, particularly T helper 2 cells (Th2), are strongly associated with inducing airway inflammatory responses and chemoattraction of inflammatory cells in asthma. Small interfering RNA (siRNA) as a promising anti-sense molecule can specifically silence inflammation related genes in ATCs, however, lack of safe and efficient siRNA delivery systems limits the application of siRNA as a therapeutic molecule in asthma. Here, we designed a novel pulmonary delivery system of siRNA, transferrin-polyethylenimine (Tf-PEI), to selectively deliver siRNA to ATCs in the lung. Tf-PEI polyplexes demonstrated optimal physicochemical properties such as size, distribution, zeta-potential, and siRNA condensation efficiency. Moreover, in vitro studies showed significantly enhanced cellular uptake and gene knockdown mediated by Tf-PEI polyplexes in human primary ATCs. Biodistribution of polyplexes in a murine asthmatic model confirmed that Tf-PEI polyplexes can efficiently and selectively deliver siRNA to ATCs. In conclusion, the present work proves the feasibility to target ATCs in asthma via Tf receptor. This strategy could potentially be used to design an efficient siRNA delivery system for asthma therapy. PMID:27001893
Xie, Yuran; Kim, Na Hyung; Nadithe, Venkatareddy; Schalk, Dana; Thakur, Archana; Kılıç, Ayşe; Lum, Lawrence G; Bassett, David J P; Merkel, Olivia M
2016-05-10
Asthma is a worldwide health problem. Activated T cells (ATCs) in the lung, particularly T helper 2 cells (Th2), are strongly associated with inducing airway inflammatory responses and chemoattraction of inflammatory cells in asthma. Small interfering RNA (siRNA) as a promising anti-sense molecule can specifically silence inflammation related genes in ATCs, however, lack of safe and efficient siRNA delivery systems limits the application of siRNA as a therapeutic molecule in asthma. Here, we designed a novel pulmonary delivery system of siRNA, transferrin-polyethylenimine (Tf-PEI), to selectively deliver siRNA to ATCs in the lung. Tf-PEI polyplexes demonstrated optimal physicochemical properties such as size, distribution, zeta-potential, and siRNA condensation efficiency. Moreover, in vitro studies showed significantly enhanced cellular uptake and gene knockdown mediated by Tf-PEI polyplexes in human primary ATCs. Biodistribution of polyplexes in a murine asthmatic model confirmed that Tf-PEI polyplexes can efficiently and selectively deliver siRNA to ATCs. In conclusion, the present work proves the feasibility to target ATCs in asthma via Tf receptor. This strategy could potentially be used to design an efficient siRNA delivery system for asthma therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Intravenous siRNA of brain cancer with receptor targeting and avidin-biotin technology.
Xia, Chun-Fang; Zhang, Yufeng; Zhang, Yun; Boado, Ruben J; Pardridge, William M
2007-12-01
The effective delivery of short interfering RNA (siRNA) to brain following intravenous administration requires the development of a delivery system for transport of the siRNA across the brain capillary endothelial wall, which forms the blood-brain barrier in vivo. siRNA was delivered to brain in vivo with the combined use of a receptor-specific monoclonal antibody delivery system, and avidin-biotin technology. The siRNA was mono-biotinylated on either terminus of the sense strand, in parallel with the production of a conjugate of the targeting MAb and streptavidin. Rat glial cells (C6 or RG-2) were permanently transfected with the luciferase gene, and implanted in the brain of adult rats. Following the formation of intra-cranial tumors, the rats were treated with a single intravenous injection of 270 microg/kg of biotinylated siRNA attached to a transferrin receptor antibody via a biotin-streptavidin linker. The intravenous administration of the siRNA caused a 69-81% decrease in luciferase gene expression in the intracranial brain cancer in vivo. Brain delivery of siRNA following intravenous administration is possible with siRNAs that are targeted to brain with the combined use of receptor specific antibody delivery systems and avidin-biotin technology.
Current progress of siRNA/shRNA therapeutics in clinical trials.
Burnett, John C; Rossi, John J; Tiemann, Katrin
2011-09-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Jiang, Xinglu; Wang, Guobao; Liu, Ru; Wang, Yaling; Wang, Yongkui; Qiu, Xiaozhong; Gao, Xueyun
2013-07-01
To date, RNase degradation and endosome/lysosome trapping are still serious problems for siRNA-based molecular therapy, although different kinds of delivery formulations have been tried. In this report, a cell penetrating peptide (CPP, including a positively charged segment, a linear segment, and a hydrophobic segment) and a single wall carbon nanotube (SWCNT) are applied together by a simple method to act as a siRNA delivery system. The siRNAs first form a complex with the positively charged segment of CPP via electrostatic forces, and the siRNA-CPP further coats the surface of the SWCNT via hydrophobic interactions. This siRNA delivery system is non-sensitive to RNase and can avoid endosome/lysosome trapping in vitro. When this siRNA delivery system is studied in Hela cells, siRNA uptake was observed in 98% Hela cells, and over 70% mRNA of mammalian target of rapamycin (mTOR) is knocked down, triggering cell apoptosis on a significant scale. Our siRNA delivery system is easy to handle and benign to cultured cells, providing a very efficient approach for the delivery of siRNA into the cell cytosol and cleaving the target mRNA therein.
Kudsiova, Laila; Welser, Katharina; Campbell, Frederick; Mohammadi, Atefeh; Dawson, Natalie; Cui, Lili; Hailes, Helen C; Lawrence, M Jayne; Tabor, Alethea B
2016-03-01
Ternary nanocomplexes, composed of bifunctional cationic peptides, lipids and siRNA, as delivery vehicles for siRNA have been investigated. The study is the first to determine the optimal sequence and architecture of the bifunctional cationic peptide used for siRNA packaging and delivery using lipopolyplexes. Specifically three series of cationic peptides of differing sequence, degrees of branching and cell-targeting sequences were co-formulated with siRNA and vesicles prepared from a 1 : 1 molar ratio of the cationic lipid DOTMA and the helper lipid, DOPE. The level of siRNA knockdown achieved in the human alveolar cell line, A549-luc cells, in both reduced serum and in serum supplemented media was evaluated, and the results correlated to the nanocomplex structure (established using a range of physico-chemical tools, namely small angle neutron scattering, transmission electron microscopy, dynamic light scattering and zeta potential measurement); the conformational properties of each component (circular dichroism); the degree of protection of the siRNA in the lipopolyplex (using gel shift assays) and to the cellular uptake, localisation and toxicity of the nanocomplexes (confocal microscopy). Although the size, charge, structure and stability of the various lipopolyplexes were broadly similar, it was clear that lipopolyplexes formulated from branched peptides containing His-Lys sequences perform best as siRNA delivery agents in serum, with protection of the siRNA in serum balanced against efficient release of the siRNA into the cytoplasm of the cell.
Targets of small interfering RNA restriction during human immunodeficiency virus type 1 replication.
Gao, Yong; Lobritz, Michael A; Roth, Justin; Abreha, Measho; Nelson, Kenneth N; Nankya, Immaculate; Moore-Dudley, Dawn M; Abraha, Awet; Gerson, Stanton L; Arts, Eric J
2008-03-01
Small interfering RNAs (siRNAs) have been shown to effectively inhibit human immunodeficiency virus type 1 (HIV-1) replication in vitro. The mechanism(s) for this inhibition is poorly understood, as siRNAs may interact with multiple HIV-1 RNA species during different steps of the retroviral life cycle. To define susceptible HIV-1 RNA species, siRNAs were first designed to specifically inhibit two divergent primary HIV-1 isolates via env and gag gene targets. A self-inactivating lentiviral vector harboring these target sequences confirmed that siRNA cannot degrade incoming genomic RNA. Disruption of the incoming core structure by rhesus macaque TRIM5alpha did, however, provide siRNA-RNA-induced silencing complex access to HIV-1 genomic RNA and promoted degradation. In the absence of accelerated core disruption, only newly transcribed HIV-1 mRNA in the cytoplasm is sensitive to siRNA degradation. Inhibitors of HIV-1 mRNA nuclear export, such as leptomycin B and camptothecin, blocked siRNA restriction. All HIV-1 RNA regions and transcripts found 5' of the target sequence, including multiply spliced HIV-1 RNA, were degraded by unidirectional 3'-to-5' siRNA amplification and spreading. In contrast, HIV-1 RNA 3' of the target sequence was not susceptible to siRNA. Even in the presence of siRNA, full-length HIV-1 RNA is still encapsidated into newly assembled viruses. These findings suggest that siRNA can target only a relatively "naked" cytoplasmic HIV-1 RNA despite the involvement of viral RNA at nearly every step in the retroviral life cycle. Protection of HIV-1 RNA within the core following virus entry, during encapsidation/virus assembly, or within the nucleus may reflect virus evolution in response to siRNA, TRIM5alpha, or other host restriction factors.
Landry, Breanne; Aliabadi, Hamidreza Montazeri; Samuel, Anuja; Gül-Uludağ, Hilal; Jiang, Xiaoyan; Kutsch, Olaf; Uludağ, Hasan
2012-01-01
Use of small interfering RNA (siRNA) is a promising approach for AML treatment as the siRNA molecule can be designed to specifically target proteins that contribute to aberrant cell proliferation in this disease. However, a clinical-relevant means of delivering siRNA molecules must be developed, as the cellular delivery of siRNA is problematic. Here, we report amphiphilic carriers combining a cationic polymer (2 kDa polyethyleneimine, PEI2) with lipophilic moieties to facilitate intracellular delivery of siRNA to AML cell lines. Complete binding of siRNA by the designed carriers was achieved at a polymer:siRNA ratio of ≈ 0.5 and led to siRNA/polymer complexes of ≈ 100 nm size. While the native PEI2 did not display cytotoxicity on AML cell lines THP-1, KG-1 and HL-60, lipid-modification on PEI2 slightly increased the cytotoxicity, which was consistent with increased interaction of polymers with cell membranes. Cellular delivery of siRNA was dependent on the nature of lipid substituent and the extent of lipid substitution, and varied among the three AML cell lines used. Linoleic acid-substituted polymers performed best among the prepared polymers and gave a siRNA delivery equivalent to better performing commercial reagents. Using THP-1 cells and a reporter (GFP) and an endogenous (CXCR4) target, effective silencing of the chosen targets was achieved with 25 to 50 nM of siRNA concentrations, and without adversely affecting subsequent cell growth. We conclude that lipid-substituted PEI2 can serve as an effective delivery of siRNA to leukemic cells and could be employed in molecular therapy of leukemia.
Landry, Breanne; Aliabadi, Hamidreza Montazeri; Samuel, Anuja; Gül-Uludağ, Hilal; Jiang, Xiaoyan; Kutsch, Olaf; Uludağ, Hasan
2012-01-01
Use of small interfering RNA (siRNA) is a promising approach for AML treatment as the siRNA molecule can be designed to specifically target proteins that contribute to aberrant cell proliferation in this disease. However, a clinical-relevant means of delivering siRNA molecules must be developed, as the cellular delivery of siRNA is problematic. Here, we report amphiphilic carriers combining a cationic polymer (2 kDa polyethyleneimine, PEI2) with lipophilic moieties to facilitate intracellular delivery of siRNA to AML cell lines. Complete binding of siRNA by the designed carriers was achieved at a polymer:siRNA ratio of ∼0.5 and led to siRNA/polymer complexes of ∼100 nm size. While the native PEI2 did not display cytotoxicity on AML cell lines THP-1, KG-1 and HL-60, lipid-modification on PEI2 slightly increased the cytotoxicity, which was consistent with increased interaction of polymers with cell membranes. Cellular delivery of siRNA was dependent on the nature of lipid substituent and the extent of lipid substitution, and varied among the three AML cell lines used. Linoleic acid-substituted polymers performed best among the prepared polymers and gave a siRNA delivery equivalent to better performing commercial reagents. Using THP-1 cells and a reporter (GFP) and an endogenous (CXCR4) target, effective silencing of the chosen targets was achieved with 25 to 50 nM of siRNA concentrations, and without adversely affecting subsequent cell growth. We conclude that lipid-substituted PEI2 can serve as an effective delivery of siRNA to leukemic cells and could be employed in molecular therapy of leukemia. PMID:22952927
Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong
2018-06-22
Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.
Murali, Reena; John, Philips George; Peter S, David
2015-05-15
The ability of small interfering RNA (siRNA) to do posttranscriptional gene regulation by knocking down targeted genes is an important research topic in functional genomics, biomedical research and in cancer therapeutics. Many tools had been developed to design exogenous siRNA with high experimental inhibition. Even though considerable amount of work has been done in designing exogenous siRNA, design of effective siRNA sequences is still a challenging work because the target mRNAs must be selected such that their corresponding siRNAs are likely to be efficient against that target and unlikely to accidentally silence other transcripts due to sequence similarity. In some cases, siRNAs may tolerate mismatches with the target mRNA, but knockdown of genes other than the intended target could make serious consequences. Hence to design siRNAs, two important concepts must be considered: the ability in knocking down target genes and the off target possibility on any nontarget genes. So before doing gene silencing by siRNAs, it is essential to analyze their off target effects in addition to their inhibition efficacy against a particular target. Only a few methods have been developed by considering both efficacy and off target possibility of siRNA against a gene. In this paper we present a new design of neural network model with whole stacking energy (ΔG) that enables to identify the efficacy and off target effect of siRNAs against target genes. The tool lists all siRNAs against a particular target with their inhibition efficacy and number of matches or sequence similarity with other genes in the database. We could achieve an excellent performance of Pearson Correlation Coefficient (R=0. 74) and Area Under Curve (AUC=0.906) when the threshold of whole stacking energy is ≥-34.6 kcal/mol. To the best of the author's knowledge, this is one of the best score while considering the "combined efficacy and off target possibility" of siRNA for silencing a gene. The proposed model shall be useful for designing exogenous siRNA for therapeutic applications and gene silencing techniques in the area of bioinformatics. The software is developed as a desktop application and available at http://opsid.in/opsid/. Copyright © 2015 Elsevier B.V. All rights reserved.
The first genetic map of pigeon pea based on diversity arrays technology (DArT) markers.
Yang, Shi Ying; Saxena, Rachit K; Kulwal, Pawan L; Ash, Gavin J; Dubey, Anuja; Harper, John D I; Upadhyaya, Hari D; Gothalwal, Ragini; Kilian, Andrzej; Varshney, Rajeev K
2011-04-01
With an objective to develop a genetic map in pigeon pea (Cajanus spp.), a total of 554 diversity arrays technology (DArT) markers showed polymorphism in a pigeon pea F(2) mapping population of 72 progenies derived from an interspecific cross of ICP 28 (Cajanus cajan) and ICPW 94 (Cajanus scarabaeoides). Approximately 13% of markers did not conform to expected segregation ratio. The total number of DArT marker loci segregating in Mendelian manner was 405 with 73.1% (P > 0.001) of DArT markers having unique segregation patterns. Two groups of genetic maps were generated using DArT markers. While the maternal genetic linkage map had 122 unique DArT maternal marker loci, the paternal genetic linkage map has a total of 172 unique DArT paternal marker loci. The length of these two maps covered 270.0 cM and 451.6 cM, respectively. These are the first genetic linkage maps developed for pigeon pea, and this is the first report of genetic mapping in any grain legume using diversity arrays technology.
Targeting Sirna Missiles to Her2+ Breast Cancer
2008-06-01
intact and appears to be protected from serum nucleases (Fig. 1) . T7 -transcribed siRNA induces higher breast cancer cell cytotoxicity than synthetic...cytotoxicity of T7 transcribed vs s y n t h e t i c anti-HER2 siRNA on HER2+ cells. We acquired a 21 nucleotide (nt) s y n t h e t i c anti-HER2...ErbB2) siRNA and also produced a T7 -transcribed molecule (Silencer Principal Investigator: Medina-Kauwe, Lali K. 2 siRNA construction kit; Ambion) using
Hlawaty, Hanna; San Juan, Aurélie; Jacob, Marie-Paule; Vranckx, Roger; Letourneur, Didier; Feldman, Laurent J
2009-01-01
Small interfering RNA (siRNA) delivery is a promising approach for the treatment of cardiovascular diseases. Matrix metalloproteinase (MMP) 2 over-expression in the arterial wall has been implicated in restenosis after percutaneous coronary intervention, as well as in spontaneous atherosclerotic plaque rupture. We hypothesized that in vivo local delivery of siRNA targeted at MMP2 (MMP2-siRNA) in the balloon-injured carotid artery of hypercholesterolemic rabbits may lead to inhibition of MMP2 expression. Two weeks after balloon injury, 5 micromol/l of Tamra-tagged MMP2-siRNA, scramble siRNA or saline was locally injected in the carotid artery and incubated for 1 h. Fluorescent microscopy studies showed the circumferential uptake of siRNA in the superficial layers of neointimal cells. MMP2 mRNA levels, measured by the real-time reverse transcriptase-polymerase chain reaction, was decreased by 79 +/- 25% in MMP2-siRNA- versus scramble siRNA-transfected arteries (p < 0.05). MMP2 activity, measured by gelatin zymography performed on the conditioned media of MMP2-siRNA versus scramble siRNA transfected arteries, decreased by 53 +/- 29%, 50 +/- 24% and 46 +/- 14% at 24, 48 and 72 h, respectively (p < 0.005 for all). No effect was observed on MMP9, pro-MMP9 and TIMP-2 levels. The results obtained in the present study suggest that significant inhibition of gene expression can be achieved with local delivery of siRNA in the arterial wall in vivo. (c) 2008 John Wiley & Sons, Ltd.
Systemic delivery of siRNA with cationic lipid assisted PEG-PLA nanoparticles for cancer therapy.
Yang, Xian-Zhu; Dou, Shuang; Sun, Tian-Meng; Mao, Cheng-Qiong; Wang, Hong-Xia; Wang, Jun
2011-12-10
Delivery of small interfering RNA (siRNA) has been one of the major hurdles for the application of RNA interference in therapeutics. Here, we describe a cationic lipid assisted polymeric nanoparticle system with stealthy property for efficient siRNA encapsulation and delivery, which was fabricated with poly(ethylene glycol)-b-poly(d,l-lactide), siRNA and a cationic lipid, using a double emulsion-solvent evaporation technique. By incorporation of the cationic lipid, the encapsulation efficiency of siRNA into the nanoparticles could be above 90% and the siRNA loading weight ratio was up to 4.47%, while the diameter of the nanoparticles was around 170 to 200nm. The siRNA retained its integrity within the nanoparticles, which were effectively internalized by cancer cells and escaped from the endosome, resulting in significant gene knockdown. This effect was demonstrated by significant down-regulation of luciferase expression in HepG2-luciferase cells which stably express luciferase, and suppression of polo-like kinase 1 (Plk1) expression in HepG2 cells, following delivery of specific siRNAs by the nanoparticles. Furthermore, the nanoparticles carrying siRNA targeting the Plk1 gene were found to induce remarkable apoptosis in both HepG2 and MDA-MB-435s cancer cells. Systemic delivery of specific siRNA by nanoparticles significantly inhibited luciferase expression in an orthotopic murine liver cancer model and suppressed tumor growth in a MDA-MB-435s murine xenograft model, suggesting its therapeutic promise in disease treatment. Copyright © 2011 Elsevier B.V. All rights reserved.
RNA helicase A is not required for RISC activity.
Liang, Xue-Hai; Crooke, Stanley T
2013-10-01
It has been shown that siRNAs can compete with each other or with endogenous miRNAs for RISC components. This competition may complicate the interpretations of phenotypes observed through siRNA-mediated knockdown of genes, especially those genes implicated in the RISC pathway. In this study, we re-examined the function of RNA helicase A (RHA), which has been previously proposed to function in RISC loading based on siRNA-mediated knockdown studies. Here we show that reduced RISC activity or loading of siRNAs was observed only in cells depleted of RHA using siRNA, but not using RNaseH-dependent antisense oligonucleotides (ASOs), suggesting that the impaired RISC function stems from the competition between pre-existing and newly transfected siRNAs, but not from reduction of the RHA protein. This view is further supported by the findings that cells depleted of a control protein, NCL1, using siRNA, but not ASO, exhibited similar defects on the loading and activity of a subsequently transfected siRNA. Transfection of RHA or NCL1 siRNAs, but not ASOs, reduced the levels of endogenous miRNAs, suggesting a competition mechanism. As a positive control, we showed that reduction of MOV10 by either siRNA or ASO decreased siRNA activity, confirming its role in RISC function. Together, our results indicate that RHA is not required for RISC activity or loading, and suggest that proper controls are required when using siRNAs to functionalize genes to avoid competition effects. © 2013. Published by Elsevier B.V. All rights reserved.
Single-step assembly of cationic lipid-polymer hybrid nanoparticles for systemic delivery of siRNA.
Yang, Xian-Zhu; Dou, Shuang; Wang, Yu-Cai; Long, Hong-Yan; Xiong, Meng-Hua; Mao, Cheng-Qiong; Yao, Yan-Dan; Wang, Jun
2012-06-26
The clinical success of therapeutics of small interfering RNA (siRNA) is still hindered by its delivery systems. Cationic polymer or lipid-based vehicles as the major delivery systems of siRNA cannot sufficiently satisfy siRNA therapeutic applications. It is hypothesized that cationic lipid-polymer hybrid nanoparticles may take advantage of both polymeric and lipid-based nanoparticles for siRNA delivery, while diminishing the shortcomings of both. In this study, cationic lipid-polymer hybrid nanoparticles were prepared by a single-step nanoprecipitation of a cationic lipid (N,N-bis(2-hydroxyethyl)-N-methyl-N-(2-cholesteryloxycarbonyl aminoethyl) ammonium bromide, BHEM-Chol) and amphiphilic polymers for systemic delivery of siRNA. The formed hybrid nanoparticles comprised a hydrophobic polylactide core, a hydrophilic poly(ethylene glycol) shell, and a cationic lipid monolayer at the interface of the core and the shell. Such hybrid nanoparticles exhibited excellent stability in serum and showed significantly improved biocompatibility compared to that of pure BHEM-Chol particles. The hybrid nanoparticles were capable of delivering siRNA into BT474 cells and facilitated the escape of loaded siRNA from the endosome into the cytoplasm. The hybrid nanoparticles carrying polo-like kinase 1 (Plk1)-specific siRNA (siPlk1) remarkably and specifically downregulated expression of the oncogene Plk1 and induced cancer cell apoptosis both in vitro and in vivo and significantly suppressed tumor growth following systemic administration. We demonstrate that this system is stable, nontoxic, highly efficient, and easy to scale up, bringing the clinical application of siRNA therapy one important step closer to reality.
PLGA microspheres encapsulating siRNA.
De Rosa, Giuseppe; Salzano, Giuseppina
2015-01-01
The therapeutic use of small interfering RNA (siRNA) represents a new and powerful approach to suppress the expression of pathologically genes. However, biopharmaceutical drawbacks, such as short half-life, poor cellular uptake, and unspecific distribution into the body, hamper the development of siRNA-based therapeutics. Poly(lactide-co-glycolide), (PLGA) microspheres can be a useful tool to overcome these issues. siRNA can be encapsulated into the PLGA microspheres, which protects the loaded nucleic acid against the enzymatic degradation. Moreover, PLGA microspheres can be injected directly into the action site, where the siRNA can be released in controlled manner, thus avoiding the need of frequent invasive administrations. The complete biodegradability of PLGA to monomers easily metabolized by the body, and its approval by FDA and EMA for parenteral administration, assure the safety of this copolymer and do not require the removal of the device after the complete drug release. In chapter, a basic protocol for the preparation of PLGA microspheres encapsulating siRNA is described. This protocol is based on a double emulsion/solvent evaporation technique, a well known and easy to reproduce method. This specific protocol has been developed to encapsulate a siRNA anti-TNFα in PLGA microspheres, and it has been designed and optimized to achieve high siRNA encapsulation efficiency and slow siRNA release in vitro. However, it can be extended also to other siRNA as well as other RNA or DNA-based oligonucleotides (miRNA, antisense, decoy, etc.). Depending on the applications, chemical modifications of the backbone and site-specific modification within the siRNA sequences could be required.
N-Alkyl-PEI Functional Iron Oxide Nanocluster for Efficient siRNA Delivery**
Liu, Gang; Xie, Jin; Zhang, Fan; Wang, Zhi-Yong; Luo, Kui; Zhu, Lei; Quan, Qi-Meng; Niu, Gang; Lee, Seulki
2013-01-01
Small interfering RNA (siRNA) is an emerging class of therapeutics, working by regulating the expression of a specific gene involved in disease progression. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. In this study, a non-viral nanoparticle gene carrier has been developed and its efficiency for siRNA delivery and transfection has been validated at both in vitro and in vivo levels. Such a nanocarrier, abbreviated as Alkyl-PEI2k-IO, was constructed with a core of iron oxide (IO) and a shell of alkylated PEI2000 (Alkyl-PEI2k). It was found to be able to bind with siRNA, resulting in well-dispersed nanoparticles with a controlled clustering structure and narrow size distribution. Electrophoresis studies showed that the Alkyl-PEI2k-IOs could retard siRNA completely at N/P ratios above 10, protect siRNA from enzymatic degradation in serum and release complexed siRNA efficiently in the presence of polyanionic heparin. The knockdown efficiency of the siRNA loaded nanocarriers was assessed with 4T1 cells stably expressing luciferase (fluc-4T1) and further, with a fluc-4T1 xenograft model. Significant downregulation of luciferase was observed, and unlike the high molecular weight analogs, the Alkyl-PEI2k coated IOs showed a good biocompatibility. In conclusion, Alkyl-PEI2k-IOs demonstrate highly efficient delivery of siRNA and an innocuous toxic profile, making it a potential carrier for gene therapy. PMID:21861295
Chandra, Partha K; Kundu, Anup K; Hazari, Sidhartha; Chandra, Sruti; Bao, Lili; Ooms, Tara; Morris, Gilbert F; Wu, Tong; Mandal, Tarun K; Dash, Srikanta
2012-01-01
Sustained antiviral responses of chronic hepatitis C virus (HCV) infection have improved recently by the use of direct-acting antiviral agents along with interferon (IFN)-α and ribavirin. However, the emergence of drug-resistant variants is expected to be a major problem. We describe here a novel combinatorial small interfering RNA (siRNA) nanosome-based antiviral approach to clear HCV infection. Multiple siRNAs targeted to the highly conserved 5′-untranslated region (UTR) of the HCV genome were synthesized and encapsulated into lipid nanoparticles called nanosomes. We show that siRNA can be repeatedly delivered to 100% of cells in culture using nanosomes without toxicity. Six siRNAs dramatically reduced HCV replication in both the replicon and infectious cell culture model. Repeated treatments with two siRNAs were better than a single siRNA treatment in minimizing the development of an escape mutant, resulting in rapid inhibition of viral replication. Systemic administration of combinatorial siRNA-nanosomes is well tolerated in BALB/c mice without liver injury or histological toxicity. As a proof-of-principle, we showed that systemic injections of siRNA nanosomes significantly reduced HCV replication in a liver tumor-xenotransplant mouse model of HCV. Our results indicate that systemic delivery of combinatorial siRNA nanosomes can be used to minimize the development of escape mutants and inhibition of HCV infection. PMID:22617108
Parvani, Jenny G; Jackson, Mark W
2017-04-01
Over the past decade, RNA interference (RNAi) has been ubiquitously utilized to study biological function in vitro ; however, limitations were associated with its utility in vivo More recently, small interfering RNA (siRNA) nanoparticles with improved biocompatibility have gained prevalence as a potential therapeutic option for the treatment of various diseases. The adaptability of siRNA nanoparticles enables the delivery of virtually any siRNA, which is especially advantageous for therapeutic applications in heterogeneous diseases that lack unifying molecular features, such as triple-negative breast cancer (TNBC). TNBC is an aggressive subtype of breast cancer that is stratified by the lack of estrogen receptor/progesterone receptor expression and HER2 amplification. There are currently no FDA-approved targeted therapies for the treatment of TNBCs, making cytotoxic chemotherapy the only treatment option available to these patients. In this review, we outline the current status of siRNA nanoparticles in clinical trials for cancer treatment and discuss the promising preclinical approaches that have utilized siRNA nanoparticles for TNBC treatment. Next, we address TNBC subtype-specific therapeutic interventions and highlight where and how siRNA nanoparticles fit into these strategies. Lastly, we point out ongoing challenges in the field of siRNA nanoparticle research that, if addressed, would significantly improve the efficacy of siRNA nanoparticles as a therapeutic option for cancer treatment. © 2017 Society for Endocrinology.
Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.
Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng
2009-09-01
Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively.
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
Graft-transmissible movement of inverted-repeat-induced siRNA signals into flowers.
Zhang, Wenna; Kollwig, Gregor; Stecyk, Ewelina; Apelt, Federico; Dirks, Rob; Kragler, Friedrich
2014-10-01
In plants, small interfering RNAs (siRNA) and microRNAs move to distant tissues where they control numerous developmental and physiological processes such as morphogenesis and stress responses. Grafting techniques and transient expression systems have been employed to show that sequence-specific siRNAs with a size of 21-24 nucleotides traffic to distant organs. We used inverted-repeat constructs producing siRNA targeting the meiosis factor DISRUPTED MEIOTIC cDNA 1 (DMC1) and GFP to test whether silencing signals move into meiotically active tissues. In grafted Nicotiana tabacum, a transgenic DMC1 siRNA signal made in source tissues preferably entered the anthers formed in the first flowers. Here, the DMC1 siRNA interfered with meiotic progression and, consequently, the flowers were at least partially sterile. In agro-infiltrated N. benthamiana plants, a GFP siRNA signal produced in leaves was allocated and active in most flower tissues including anthers. In hypocotyl-grafted Arabidopsis thaliana plants, the DMC1 silencing signal consistently appeared in leaves, petioles, and stem, and only a small number of plants displayed DMC1 siRNA signals in flowers. In all three tested plant species the systemic silencing signal penetrated male sporogenic tissues suggesting that plants harbour an endogenous long-distance small RNA transport pathway facilitating siRNA signalling into meiotically active cells. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Robbins, Marjorie; Judge, Adam; MacLachlan, Ian
2009-06-01
Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.
Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors.
Song, Erwei; Zhu, Pengcheng; Lee, Sang-Kyung; Chowdhury, Dipanjan; Kussman, Steven; Dykxhoorn, Derek M; Feng, Yi; Palliser, Deborah; Weiner, David B; Shankar, Premlata; Marasco, Wayne A; Lieberman, Judy
2005-06-01
Delivery of small interfering RNAs (siRNAs) into cells is a key obstacle to their therapeutic application. We designed a protamine-antibody fusion protein to deliver siRNA to HIV-infected or envelope-transfected cells. The fusion protein (F105-P) was designed with the protamine coding sequence linked to the C terminus of the heavy chain Fab fragment of an HIV-1 envelope antibody. siRNAs bound to F105-P induced silencing only in cells expressing HIV-1 envelope. Additionally, siRNAs targeted against the HIV-1 capsid gene gag, inhibited HIV replication in hard-to-transfect, HIV-infected primary T cells. Intratumoral or intravenous injection of F105-P-complexed siRNAs into mice targeted HIV envelope-expressing B16 melanoma cells, but not normal tissue or envelope-negative B16 cells; injection of F105-P with siRNAs targeting c-myc, MDM2 and VEGF inhibited envelope-expressing subcutaneous B16 tumors. Furthermore, an ErbB2 single-chain antibody fused with protamine delivered siRNAs specifically into ErbB2-expressing cancer cells. This study demonstrates the potential for systemic, cell-type specific, antibody-mediated siRNA delivery.
Tiemann, Katrin; Höhn, Britta; Ehsani, Ali; Forman, Stephen J.; Rossi, John J.; Sætrom, Pål
2010-01-01
We have developed an algorithm for the prediction of dual-targeting short interfering RNAs (siRNAs) in which both strands are deliberately designed to separately target different mRNA transcripts with complete complementarity. An advantage of this approach versus the use of two separate duplexes is that only two strands, as opposed to four, are competing for entry into the RNA-induced silencing complex. We chose to design our dual-targeting siRNAs as Dicer substrate 25/27mer siRNAs, since design features resembling pre-microRNAs (miRNAs) can be introduced for Dicer processing. Seven different dual-targeting siRNAs targeting genes that are potential targets in cancer therapy have been developed including Bcl2, Stat3, CCND1, BIRC5, and MYC. The dual-targeting siRNAs have been characterized for dual target knockdown in three different cell lines (HEK293, HCT116, and PC3), where they were as effective as their corresponding single-targeting siRNAs in target knockdown. The algorithm developed in this study should prove to be useful for predicting dual-targeting siRNAs in a variety of different targets and is available from http://demo1.interagon.com/DualTargeting/. PMID:20410240
Enhancing endosomal escape for nanoparticle mediated siRNA delivery
NASA Astrophysics Data System (ADS)
Ma, Da
2014-05-01
Gene therapy with siRNA is a promising biotechnology to treat cancer and other diseases. To realize siRNA-based gene therapy, a safe and efficient delivery method is essential. Nanoparticle mediated siRNA delivery is of great importance to overcome biological barriers for systemic delivery in vivo. Based on recent discoveries, endosomal escape is a critical biological barrier to be overcome for siRNA delivery. This feature article focuses on endosomal escape strategies used for nanoparticle mediated siRNA delivery, including cationic polymers, pH sensitive polymers, calcium phosphate, and cell penetrating peptides. Work has been done to develop different endosomal escape strategies based on nanoparticle types, administration routes, and target organ/cell types. Also, enhancement of endosomal escape has been considered along with other aspects of siRNA delivery to ensure target specific accumulation, high cell uptake, and low toxicity. By enhancing endosomal escape and overcoming other biological barriers, great progress has been achieved in nanoparticle mediated siRNA delivery.
In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.
Watanabe, Tsunamasa; Hatakeyama, Hiroto; Matsuda-Yasui, Chiho; Sato, Yusuke; Sudoh, Masayuki; Takagi, Asako; Hirata, Yuichi; Ohtsuki, Takahiro; Arai, Masaaki; Inoue, Kazuaki; Harashima, Hideyoshi; Kohara, Michinori
2014-04-23
The development of RNA interference (RNAi)-based therapy faces two major obstacles: selecting small interfering RNA (siRNA) sequences with strong activity, and identifying a carrier that allows efficient delivery to target organs. Additionally, conservative region at nucleotide level must be targeted for RNAi in applying to virus because hepatitis C virus (HCV) could escape from therapeutic pressure with genome mutations. In vitro preparation of Dicer-generated siRNAs targeting a conserved, highly ordered HCV 5' untranslated region are capable of inducing strong RNAi activity. By dissecting the 5'-end of an RNAi-mediated cleavage site in the HCV genome, we identified potent siRNA sequences, which we designate as Dicer-hunting siRNAs (dh-siRNAs). Furthermore, formulation of the dh-siRNAs in an optimized multifunctional envelope-type nano device inhibited ongoing infectious HCV replication in human hepatocytes in vivo. Our efforts using both identification of optimal siRNA sequences and delivery to human hepatocytes suggest therapeutic potential of siRNA for a virus.
Transdermal Delivery of siRNA through Microneedle Array
NASA Astrophysics Data System (ADS)
Deng, Yan; Chen, Jiao; Zhao, Yi; Yan, Xiaohui; Zhang, Li; Choy, Kwongwai; Hu, Jun; Sant, Himanshu J.; Gale, Bruce K.; Tang, Tao
2016-02-01
Successful development of siRNA therapies has significant potential for the treatment of skin conditions (alopecia, allergic skin diseases, hyperpigmentation, psoriasis, skin cancer, pachyonychia congenital) caused by aberrant gene expression. Although hypodermic needles can be used to effectively deliver siRNA through the stratum corneum, the major challenge is that this approach is painful and the effects are restricted to the injection site. Microneedle arrays may represent a better way to deliver siRNAs across the stratum corneum. In this study, we evaluated for the first time the ability of the solid silicon microneedle array for punching holes to deliver cholesterol-modified housekeeping gene (Gapdh) siRNA to the mouse ear skin. Treating the ear with microneedles showed permeation of siRNA in the skin and could reduce Gapdh gene expression up to 66% in the skin without accumulation in the major organs. The results showed that microneedle arrays could effectively deliver siRNA to relevant regions of the skin noninvasively.
Redox-sensitive dendrimersomes assembled from amphiphilic Janus dendrimers for siRNA delivery.
Du, Xiao-Jiao; Wang, Ze-Yu; Wang, Yu-Cai
2018-06-14
The development of delivery systems for small interfering RNA (siRNA) plays a key role in its clinical application. As the major delivery systems for siRNA, cationic polymer- or lipid-based vehicles are plagued by inherent issues. As proof of concept, a disulfide bond-containing amphiphilic Janus dendrimer (ssJD), which could be conveniently synthesized and readily scaled up with high reproducibility, was explored as a siRNA delivery system to circumvent these issues. The cationic hydrophilic head of this Janus dendrimer ensured strong and stable binding with negatively charged siRNA via electrostatic interactions, and the loaded siRNA was rapidly released from the obtained complexes under a redox environment. Therefore, after efficient internalization into tumor cells, redox-sensitive dendrimersome (RSDs)/siRNA exhibited significantly improved gene silencing efficacy.
Preserving a Unique Archive for Long-Term Solar Variability Studies
NASA Astrophysics Data System (ADS)
Webb, David F.; Hewins, Ian; McFadden, Robert; Emery, Barbara; Gibson, Sarah; Denig, William
2016-05-01
In 1964 (solar cycle 20) Patrick McIntosh began creating hand-drawn synoptic maps of solar activity, based on Hydrogen alpha (Hα) imaging measurements. These synoptic maps were unique because they traced the polarity inversion lines (PILs), connecting widely separated filaments, fibril patterns and plage corridors to reveal the large-scale organization of the solar magnetic field. He and his assistants later included coronal hole (CH) boundaries to the maps, usually from ground-based He-I 10830 images. They continued making these maps until 2010 (the start of solar cycle 24), yielding more than 40 years (~ 540 Carrington rotations) or nearly four complete solar cycles (SCs) of synoptic maps. The McIntosh collection of maps forms a unique and consistent set of global solar magnetic field data, and are unique tools for studying the structure and evolution of the large-scale solar fields and polarity boundaries, because: 1) they have excellent spatial resolution for defining polarity boundaries, 2) the organization of the fields into long-lived, coherent features is clear, and 3) the data are relatively homogeneous over four solar cycles. After digitization and archiving, these maps -- along with computer codes permitting efficient searches of the map arrays -- will be made publicly available at NOAA’s National Centers for Environmental Information (NCEI) in their final, searchable form. This poster is a progress report of the project so far and some suggested scientific applications.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung
2012-07-17
Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide bonds for facile generation of original siRNA in the cytosol and for target-specific gene silencing. These newly developed siRNA-based structures greatly enhance intracellular uptake and gene silencing both in vitro and in vivo, making them promising biomaterials for siRNA therapeutics.
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. (c) 2008 Wiley Periodicals, Inc.
Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks
Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael
2017-01-01
DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606
Impact of target mRNA structure on siRNA silencing efficiency: a large-scale study
Gredell, Joseph A.; Berger, Angela K.; Walton, S. Patrick
2009-01-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5’- and 3’-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5’-end or 3’-end were silenced, on average, ~10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. PMID:18306428
Zha, Lisha; He, Lichun; Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo.
Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O.; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo. PMID:28562667
Strategies for Improving siRNA-Induced Gene Silencing Efficiency
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-01-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency. PMID:29399550
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Bakan, Feray; Kara, Goknur; Cokol Cakmak, Melike; Cokol, Murat; Denkbas, Emir Baki
2017-10-01
Small interfering RNAs (siRNA) are short nucleic acid fragments of about 20-27 nucleotides, which can inhibit the expression of specific genes. siRNA based RNAi technology has emerged as a promising method for the treatment of a variety of diseases. However, a major limitation in the therapeutic use of siRNA is its rapid degradation in plasma and cellular cytoplasm, resulting in short half-life. In addition, as siRNA molecules cannot penetrate into the cell efficiently, it is required to use a carrier system for its delivery. In this work, chemically and morphologically different calcium phosphate (CaP) nanoparticles, including spherical-like hydroxyapatite (HA-s), needle-like hydroxyapatite (HA-n) and calcium deficient hydroxyapatite (CDHA) nanoparticles were synthesized by the sol-gel technique and the effects of particle characteristics on the binding capacity of siRNA were investigated. In order to enhance the gene loading efficiency, the nanoparticles were functionalized with arginine and the morphological and their structural characteristics were analyzed. The addition of arginine did not significantly change the particle sizes; however, it provided a significantly increased binding of siRNA for all types of CaP nanoparticles, as revealed by spectrophotometric measurements analysis. Arginine functionalized HA-n nanoparticles showed the best binding behavior with siRNA among the other nanoparticles due to its high, positive zeta potential (+18.8mV) and high surface area of Ca ++ rich "c" plane. MTT cytotoxicity assays demonstrated that all the nanoparticles tested herein were biocompatible. Our results suggest that high siRNA entrapment in each of the three modified non-toxic CaP nanoparticles make them promising candidates as a non-viral vector for delivering therapeutic siRNA molecules to treat cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
pH-Sensitive carboxymethyl chitosan-modified cationic liposomes for sorafenib and siRNA co-delivery.
Yao, Yao; Su, Zhihui; Liang, Yanchao; Zhang, Na
2015-01-01
Combination of chemotherapeutic drug and small interfering RNA (siRNA) can affect multiple disease pathways and has been proven effective in suppressing tumor progression. Co-delivery of drug and siRNA within a same nanocarrier is a vital means in this field. The present study aimed at the development of a pH-sensitive liposome to co-deliver drug and siRNA to tumor region. Driven by the electrostatic interaction, the pH-sensitive material, carboxymethyl chitosan (CMCS), was coated onto the surface of the cationic liposome (CL) preloaded with sorafenib (Sf) and siRNA (Si). To evaluate whether the resulting CMCS-modified Sf and siRNA co-delivery cationic liposome (CMCS-SiSf-CL) enhanced antitumor efficiency after systematic administration, in vitro and in vivo experiments were evaluated in HepG2 cells and the H22 cells-bearing Kunming mice model. The experimental results demonstrated that CMCS-SiSf-CL was able to condense siRNA efficiently and protect siRNA from being degraded by serum and RNase. The release rate of Sf from CMCS-modified liposome exhibited pH-sensitive release behavior. Furthermore, in vitro cellular uptake results showed that CMCS-SiSf-CL yielded higher fluorescence intensity at pH 6.5 than at pH 7.4, and that siRNA could be delivered to tumor site by CMCS-SiSf-CL in vivo. The in vivo antitumor efficacy showed that CMCS-Sf-CL inhibits tumor growth effectively when compared with free Sf solution. In current experimental conditions, this liposomal formulation did not show significant toxicity both in vitro and in vivo. Therefore, co-delivering Sf with siRNA by CMCS-SiSf-CL might provide a promising approach for tumor therapy.
Effects of RNA interference therapy against herpes simplex virus type 1 encephalitis.
da Silva, Alexandre S; Raposo, Jéssica V; Pereira, Tiago C; Pinto, Marcelo A; de Paula, Vanessa S
2016-01-01
Herpetic encephalitis (HSE) is caused mainly by herpes simplex virus type 1 (HSV-1) with an annual incidence of 1-4 cases/million inhabitants. Currently, HSE treatment faces difficulties such as the use of antivirals with elevated toxicity, metabolic side effects and HSV-1 resistance. An alternative to antivirals is the use of small interfering RNA (siRNA) as a viral replication inhibitor. In this work, siRNA targeting the UL-39 region was evaluated for HSE treatment in vivo. BALB/c mice were inoculated with HSV-1 and treated with siRNA. The treatment was evaluated through kinetics of HSV-1 replication inhibition, number of siRNA doses administered and treatment with siRNA plus acyclovir. All groups were evaluated for signs of HSE, mortality and HSV-1 replication inhibition. The treated group of the kinetic experiment demonstrated a reduction of HSE signs and an HSV-1 replication inhibition of 43.6-99.9% in the brain and 53-98% in trigeminal ganglia (TG). Animals treated with one or two doses of siRNA had a prolonged survival time, reduced clinical signs of HSE and HSV-1 replication inhibition of 67.7% in brains and 85.7% in TG of animals treated with two doses of siRNA. Also, animals treated with siRNA plus acyclovir demonstrated reduced signs of HSE and mortality, as well as HSV-1 replication inhibition in the brain (83.2%) and TG (74.5%). These findings demonstrated that siRNA was capable of reducing HSE clinical signs, prolonging survival time and inhibiting HSV-1 replication in mice. Thus, siRNA can be a potential alternative to the standard HSE treatment especially to reduce clinical signs and extend survival time in vivo.
Takenaka, Satoshi; Naka, Norifumi; Araki, Nobuhito; Hashimoto, Nobuyuki; Ueda, Takafumi; Yoshioka, Kiyoko; Yoshikawa, Hideki; Itoh, Kazuyuki
2010-04-01
Synovial sarcoma (SS) is an aggressive soft-tissue malignancy characterized by a unique t(X;18) translocation resulting in expression of SS18-SSX fusion protein. In order to investigate the biological function of this fusion protein and to develop a novel therapeutic option, we examined downregulation of SS18-SSX1 expression by small interfering RNA targeting SS18-SSX1 in three human SS cell lines. Microarray analysis comparing SS18-SSX1-silenced cells with control cells in three SS cell lines showed that SS18-SSX1 mainly affected the focal adhesion pathway. In accord with the array data, silencing of SS18-SSX1 enhances adhesion to the extracellular matrix through the induction of expression of myosin light-chain kinase. Furthermore, the silencing of SS18-SSX1 inhibits anchorage-independent growth in vitro and systemic delivery of siRNA against SS18-SSX1 using a nanoparticle system inhibited tumor growth in a nude mouse xenograft model. Our results demonstrate that siRNA targeting of SS18-SSX1 has therapeutic potential for the treatment of SS.
Aptamer-Mediated Delivery and Cell-Targeting Aptamers: Room for Improvement.
Yan, Amy C; Levy, Matthew
2018-06-01
Targeting cells with aptamers for the delivery of therapeutic cargoes, in particular oligonucleotides, represents one of the most exciting applications of the aptamer field. Perhaps nowhere has there been more excitement in the field than around the targeted delivery of siRNA or miRNA. However, when industry leaders in the field of siRNA delivery have tried to recapitulate aptamer-siRNA delivery results, they have failed. This problem stems from more than just the age-old problem of delivery to the cytoplasm, a challenge that has stymied the targeted delivery of therapeutic oligonucleotides since its inception. With aptamers, the problem is compounded further by the fact that many aptamers simply do not function as reported. This is distressing, as clearly, all published aptamers should be able to function as described. However, it is often challenging to recognize the details that might flag an unreliable aptamer from a viable one. As such, unreliable aptamers continue to be peer reviewed and published. We need to raise the bar and level of rigor in the field. Only then can we think about taking advantage of the unique attributes of these molecules and address the issues associated with their use as agents for targeted delivery.
Shen, Jianliang; Kim, Han-Cheon; Su, Hua; Wang, Feng; Wolfram, Joy; Kirui, Dickson; Mai, Junhua; Mu, Chaofeng; Ji, Liang-Nian; Mao, Zong-Wan; Shen, Haifa
2014-01-01
Effective delivery holds the key to successful in vivo application of therapeutic small interfering RNA (siRNA). In this work, we have developed a universal siRNA carrier consisting of a mesoporous silica nanoparticle (MSNP) functionalized with cyclodextrin-grafted polyethylenimine (CP). CP provides positive charge for loading of siRNA through electrostatic interaction and enables effective endosomal escape of siRNA. Using intravital microscopy we were able to monitor tumor enrichment of CP-MSNP/siRNA particles in live mice bearing orthotopic MDA-MB-231 xenograft tumors. CP-MSNP delivery of siRNA targeting the M2 isoform of the glycolytic enzyme pyruvate kinase (PKM2) resulted in effective knockdown of gene expression in vitro and in vivo. Suppression of PKM2 led to inhibition of tumor cell growth, invasion, and migration. PMID:24672582
Nanocarriers for delivery of siRNA and co-delivery of siRNA and other therapeutic agents.
Zhao, Jing; Feng, Si-Shen
2015-07-01
A major problem in cancer treatment is the multidrug resistance. siRNA inhibitors have great advantages to solve the problem, if the bottleneck of their delivery could be well addressed by the various nanocarriers. Moreover, co-delivery of siRNA together with the various anticancer agents in one nanocarrier may maximize their additive or synergistic effect. This review provides a comprehensive summary on the state-of-the-art of the nanocarriers, which may include prodrugs, micelles, liposomes, dendrimers, nanohydrogels, solid lipid nanoparticles, nanoparticles of biodegradable polymers and nucleic acid nanocarriers for delivery of siRNA and co-delivery of siRNA together with anticancer agents with focus on synthesis of the nanocarrier materials, design and characterization, in vitro and in vivo evaluation, and prospect and challenges of nanocarriers.
Systemic Administration of siRNA via cRGD-containing Peptide.
Huang, Yuanyu; Wang, Xiaoxia; Huang, Weiyan; Cheng, Qiang; Zheng, Shuquan; Guo, Shutao; Cao, Huiqing; Liang, Xing-Jie; Du, Quan; Liang, Zicai
2015-08-24
Although small interfering RNAs (siRNAs) have been demonstrated to specifically silence their target genes in disease models and clinical trials, in vivo siRNA delivery is still the technical bottleneck that limits their use in therapeutic applications. In this study, a bifunctional peptide named RGD10-10R was designed and tested for its ability to deliver siRNA in vitro and in vivo. Because of their electrostatic interactions with polyarginine (10R), negatively charged siRNAs were readily complexed with RGD10-10R peptides, forming spherical RGD10-10R/siRNA nanoparticles. In addition to enhancing their serum stability by preventing RNase from attacking siRNA through steric hindrance, peptide binding facilitated siRNA transfection into MDA-MB-231 cells, as demonstrated by FACS and confocal microscopy assays and by the repressed expression of target genes. When RGD10 peptide, a receptor competitor of RGD10-10R, was added to the transfection system, the cellular internalization of RGD10-10R/siRNA was significantly compromised, suggesting a mechanism of ligand/receptor interaction. Tissue distribution assays indicated that the peptide/siRNA complex preferentially accumulated in the liver and in several exocrine/endocrine glands. Furthermore, tumor-targeted delivery of siRNA was also demonstrated by in vivo imaging and cryosection assays. In summary, RGD10-10R might constitute a novel siRNA delivery tool that could potentially be applied in tumor treatment.
Systemic Administration of siRNA via cRGD-containing Peptide
Huang, Yuanyu; Wang, Xiaoxia; Huang, Weiyan; Cheng, Qiang; Zheng, Shuquan; Guo, Shutao; Cao, Huiqing; Liang, Xing-Jie; Du, Quan; Liang, Zicai
2015-01-01
Although small interfering RNAs (siRNAs) have been demonstrated to specifically silence their target genes in disease models and clinical trials, in vivo siRNA delivery is still the technical bottleneck that limits their use in therapeutic applications. In this study, a bifunctional peptide named RGD10-10R was designed and tested for its ability to deliver siRNA in vitro and in vivo. Because of their electrostatic interactions with polyarginine (10R), negatively charged siRNAs were readily complexed with RGD10-10R peptides, forming spherical RGD10-10R/siRNA nanoparticles. In addition to enhancing their serum stability by preventing RNase from attacking siRNA through steric hindrance, peptide binding facilitated siRNA transfection into MDA-MB-231 cells, as demonstrated by FACS and confocal microscopy assays and by the repressed expression of target genes. When RGD10 peptide, a receptor competitor of RGD10-10R, was added to the transfection system, the cellular internalization of RGD10-10R/siRNA was significantly compromised, suggesting a mechanism of ligand/receptor interaction. Tissue distribution assays indicated that the peptide/siRNA complex preferentially accumulated in the liver and in several exocrine/endocrine glands. Furthermore, tumor-targeted delivery of siRNA was also demonstrated by in vivo imaging and cryosection assays. In summary, RGD10-10R might constitute a novel siRNA delivery tool that could potentially be applied in tumor treatment. PMID:26300278
Shi, Bin; Keough, Ed; Matter, Andrea; Leander, Karen; Young, Stephanie; Carlini, Ed; Sachs, Alan B; Tao, Weikang; Abrams, Marc; Howell, Bonnie; Sepp-Lorenzino, Laura
2011-08-01
Chemically stabilized small interfering RNA (siRNA) can be delivered systemically by intravenous injection of lipid nanoparticles (LNPs) in rodents and primates. The biodistribution and kinetics of LNP-siRNA delivery in mice at organ and cellular resolution have been studied using immunofluorescence (IF) staining and quantitative polymerase chain reaction (qPCR). At 0.5 and 2 hr post tail vein injection of Cy5-labeled siRNA encapsulated in LNP, the organ rank-order of siRNA levels is liver > spleen > kidney, with only negligible accumulation in duodenum, lung, heart, and brain. Similar conclusions were drawn by using qPCR to measure tissue siRNA levels as a secondary end point. siRNA levels in these tissues decreased by more than 10-fold after 24 hr. Within the liver, LNPs delivered siRNA to hepatocytes, Kupffer cells, and sinusoids in a time-dependent manner, as revealed by IF staining and signal quantitation methods established using OPERA/Columbus software. siRNA first accumulated in liver sinusoids and trafficked to hepatocytes by 2 hr post dose, corresponding to the onset of target mRNA silencing. Fluorescence in situ hybridization methods were used to detect both strands of siRNA in fixed tissues. Collectively, the authors have implemented a platform to evaluate biodistribution of siRNA across cell types and across tissues in vivo, with the objective of elucidating the pharmacokinetic and pharmacodynamic relationship to guide optimization of delivery vehicles. © The Author(s) 2011
Shi, Bin; Keough, Ed; Matter, Andrea; Leander, Karen; Young, Stephanie; Carlini, Ed; Sachs, Alan B.; Tao, Weikang; Abrams, Marc; Howell, Bonnie; Sepp-Lorenzino, Laura
2011-01-01
Chemically stabilized small interfering RNA (siRNA) can be delivered systemically by intravenous injection of lipid nanoparticles (LNPs) in rodents and primates. The biodistribution and kinetics of LNP–siRNA delivery in mice at organ and cellular resolution have been studied using immunofluorescence (IF) staining and quantitative polymerase chain reaction (qPCR). At 0.5 and 2 hr post tail vein injection of Cy5-labeled siRNA encapsulated in LNP, the organ rank-order of siRNA levels is liver > spleen > kidney, with only negligible accumulation in duodenum, lung, heart, and brain. Similar conclusions were drawn by using qPCR to measure tissue siRNA levels as a secondary end point. siRNA levels in these tissues decreased by more than 10-fold after 24 hr. Within the liver, LNPs delivered siRNA to hepatocytes, Kupffer cells, and sinusoids in a time-dependent manner, as revealed by IF staining and signal quantitation methods established using OPERA/Columbus software. siRNA first accumulated in liver sinusoids and trafficked to hepatocytes by 2 hr post dose, corresponding to the onset of target mRNA silencing. Fluorescence in situ hybridization methods were used to detect both strands of siRNA in fixed tissues. Collectively, the authors have implemented a platform to evaluate biodistribution of siRNA across cell types and across tissues in vivo, with the objective of elucidating the pharmacokinetic and pharmacodynamic relationship to guide optimization of delivery vehicles. PMID:21804077
Hlawaty, Hanna; San Juan, Aurélie; Jacob, Marie-Paule; Vranckx, Roger; Letourneur, Didier; Feldman, Laurent J
2007-12-01
Matrix metalloproteinase-2 (MMP-2) is constitutively expressed in vascular smooth muscle cells (VSMCs). Using small interfering RNA (siRNA), we evaluated the effect of MMP-2 inhibition in VSMCs in vitro and ex vivo. Rabbit VSMCs were transfected in vitro with 50 nmol/l MMP-2 siRNA or scramble siRNA. Flow cytometry and confocal microscopy showed cellular uptake of siRNA in approximately 80% of VSMCs. MMP-2 mRNA levels evaluated by real-time RT-PCR, pro-MMP-2 activity from conditioned culture media evaluated by gelatin zymography, and VSMC migration were reduced by 44 +/- 19%, 43 +/- 14%, and 36 +/- 14%, respectively, in MMP-2 siRNA-transfected compared with scramble siRNA-transfected VSMCs (P < 0.005 for all). Ex vivo MMP-2 siRNA transfection was performed 2 wk after balloon injury of hypercholesterolemic rabbit carotid arteries. Fluorescence microscopy showed circumferential siRNA uptake in neointimal cells. Gelatin zymography of carotid artery culture medium demonstrated a significant decrease of pro-MMP-2 activity in MMP-2 siRNA-transfected compared with scramble siRNA-transfected arteries (P < 0.01). Overall, our results demonstrate that in vitro MMP-2 siRNA transfection in VSMCs markedly inhibits MMP-2 gene expression and VSMC migration and that ex vivo delivery of MMP-2 siRNA in balloon-injured arteries reduces pro-MMP-2 activity in neointimal cells, suggesting that siRNA could be used to modify arterial biology in vivo.
[Efficacy of siRNA on feline leukemia virus replication in vitro].
Lehmann, Melanie; Weber, Karin; Rauch, Gisep; Hofmann-Lehmann, Regina; Hosie, Margaret J; Meli, Marina L; Hartmann, Katrin
2015-01-01
Feline leukemia virus (FeLV) can lead to severe clinical signs in cats. Until now, there is no effective therapy for FeLV-infected cats. RNA interference-based antiviral therapy is a new concept. Specific small interfering RNA (siRNA) are designed complementary to the mRNA of a target region, and thus inhibit replication. Several studies have proven efficacy of siRNAs in inhibiting virus replication. The aim of this study was to evaluate the inhibitory potential of siRNAs against FeLV replication in vitro. siRNAs against the FeLV env gene and the host cell surface receptor (feTHTR1) which is used by FeLV-A for entry as well as siRNA that were not complementary to the FeLV or cat genome, were tested. Crandell feline kidney cells (CrFK cells) were transfected with FeLV-A/Glasgow-1. On day 13, infected cells were transfected with siRNAs. As control, cells were mock-transfected or treated with azidothymidine (AZT) (5 μg/ml). Culture supernatants were analyzed for FeLV RNA using quantitative real-time RT-PCR and for FeLV p27 by ELISA every 24 hours for five days. All siRNAs significantly reduced viral RNA and p27 production, starting after 48 hours. The fact that non-complementary siRNAs also inhibited virus replication may lead to the conclusion that unspecific mechanisms rather than specific binding lead to inhibition.
The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans
Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P.; Mak, Ho Yi
2014-01-01
Summary RNA interference (RNAi) is a potent mechanism for down-regulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi and other eukaryotes [1–3]. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary siRNAs [4–6]. Exogenous double stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis [7, 8]. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear if the sub-cellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively [9–11]. We report that RDE-12, a conserved FG domain containing DEAD-box helicase, localizes in P-granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA targeted mRNA in distinct cytoplasmic compartments. PMID:24684930
Treating respiratory viral diseases with chemically modified, second generation intranasal siRNAs.
Barik, Sailen
2009-01-01
Chemically synthesized short interfering RNA (siRNA) of pre-determined sequence has ushered a new era in the application of RNA interference (RNAi) against viral genes. We have paid particular attention to respiratory viruses that wreak heavy morbidity and mortality worldwide. The clinically significant ones include respiratory syncytial virus (RSV), parainfluenza virus (PIV) and influenza virus. As the infection by these viruses is clinically restricted to the respiratory tissues, mainly the lungs, the logical route for the application of the siRNA was also the same, i.e., via the nasal route. Following the initial success of intranasal siRNA against RSV, second-generation siRNAs were made against the viral polymerase large subunit (L) that were chemically modified and screened for improved stability, activity and pharmacokinetics. 2'-O-methyl (2'-O-Me) and 2'-deoxy-2'-fluoro (2'-F) substitutions in the ribose ring were incorporated in different positions of the sense and antisense strands and the resultant siRNAs were tested with various transfection reagents intranasally against RSV. Based on these results, we propose the following consensus for designing intranasal antiviral siRNAs: (i) modified 19-27 nt long double-stranded siRNAs are functional in the lung, (ii) excessive 2'-OMe and 2'-F modifications in either or both strands of these siRNAs reduce efficacy, and (iii) limited modifications in the sense strand are beneficial, although their precise efficacy may be position-dependent.
Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong
2012-01-01
Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268
Jung, Hun Soon; Rajasekaran, Nirmal; Song, Sang Yong; Kim, Young Deug; Hong, Sungyoul; Choi, Hyuck Jae; Kim, Young Seok; Choi, Jong-Sun; Choi, Yoon-La; Shin, Young Kee
2015-01-01
The functional inactivation of TP53 and Rb tumor suppressor proteins by the HPV-derived E6 and E7 oncoproteins is likely an important step in cervical carcinogenesis. We have previously shown siRNA technology to selectively silence both E6/E7 oncogenes and demonstrated that the synthetic siRNAs could specifically block its expression in HPV-positive cervical cancer cells. Herein, we investigated the potentiality of E6/E7 siRNA candidates as radiosensitizers of radiotherapy for the human cervical carcinomas. HeLa and SiHa cells were transfected with HPV E6/E7 siRNA; the combined cytotoxic effect of E6/E7 siRNA and radiation was assessed by using the cell viability assay, flow cytometric analysis and the senescence-associated β-galactosidase (SA-β-Gal) assay. In addition, we also investigated the effect of combined therapy with irradiation and E6/E7 siRNA intravenous injection in an in vivo xenograft model. Combination therapy with siRNA and irradiation efficiently retarded tumor growth in established tumors of human cervical cancer cell xenografted mice. In addition, the chemically-modified HPV16 and 18 E6/E7 pooled siRNA in combination with irradiation strongly inhibited the growth of cervical cancer cells. Our results indicated that simultaneous inhibition of HPV E6/E7 oncogene expression with radiotherapy can promote potent antitumor activity and radiosensitizing activity in human cervical carcinomas. PMID:26035754
Li, Na; Luo, Heng-Cong; Ren, Meng; Zhang, Li-Ming; Wang, Wei; Pan, Cheng-Lin; Yang, Li-Qun; Lao, Guo-Juan; Deng, Jun-Jie; Mai, Kai-Jin; Sun, Kan; Yang, Chuan; Yan, Li
2017-05-24
Overexpression of matrix metalloproteinase-9 (MMP-9) is critical for diabetic chronic wounds involved in the refractory wound healing process. We aimed to develop a strategy through RNAi to decrease MMP-9 expression and improve diabetic wound healing. We had explored β-CD-(D 3 ) 7 as a gene carrier to take siRNA and effectively interfere with MMP-9 expression. It has been proven that β-CD-(D 3 ) 7 could be used as an effective siRNA delivery system. In this study, we want to know about the efficiency and safety of β-CD-(D 3 ) 7 /MMP-9 siRNA for improving wound healing in diabetic rats. β-CD-(D3)7/MMP-9 siRNA treated animals show lower levels of MMP-9 expression, which induce faster wound-close rates. Histological evaluation indicates that β-CD-(D3)7/MMP-9 siRNA significantly increases the content of collagen around the injured tissues. The number of neutrophilic ganulocytes was significantly decreased through treatment of β-CD-(D3)7/MMP-9 siRNA. In vivo fluorescence imaging assessment shows that β-CD-(D3)7/MMP-9 siRNA could not cause organ damage and organ accumulation. The results suggest that β-CD-(D 3 ) 7 /MMP-9 siRNA might be developed as a novel topical agent for the diabetic wounds treatment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele
Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less
Kim, Taejin; Afonin, Kirill A.; Viard, Mathias; Koyfman, Alexey Y; Sparks, Selene; Heldman, Eliahu; Grinberg, Sarina; Linder, Charles; Blumenthal, Robert P; Shapiro, Bruce A
2013-01-01
Specific small interfering RNAs (siRNAs) designed to silence different oncogenic pathways can be used for cancer therapy. However, non-modified naked siRNAs have short half-lives in blood serum and encounter difficulties in crossing biological membranes due to their negative charge. These obstacles can be overcome by using siRNAs complexed with bolaamphiphiles, consisting of two positively charged head groups that flank an internal hydrophobic chain. Bolaamphiphiles have relatively low toxicities, long persistence in the blood stream, and most importantly, in aqueous conditions can form poly-cationic micelles thus, becoming amenable to association with siRNAs. Herein, two different bolaamphiphiles with acetylcholine head groups attached to an alkyl chain in two distinct configurations are compared for their abilities to complex with siRNAs and deliver them into cells inducing gene silencing. Our explicit solvent molecular dynamics (MD) simulations showed that bolaamphiphiles associate with siRNAs due to electrostatic, hydrogen bonding, and hydrophobic interactions. These in silico studies are supported by various in vitro and in cell culture experimental techniques as well as by some in vivo studies. Results demonstrate that depending on the application, the extent of siRNA chemical protection, delivery efficiency, and further intracellular release can be varied by simply changing the type of bolaamphiphile used. PMID:23511334
Timin, Alexander S; Muslimov, Albert R; Petrova, Aleksandra V; Lepik, Kirill V; Okilova, Maria V; Vasin, Andrey V; Afanasyev, Boris V; Sukhorukov, Gleb B
2017-03-07
The implementation of RNAi technology into the clinical practice has been significantly postponing due to the issues regarding to the delivery of naked siRNA predominantly to target cells. Here we report the approach to enhance the efficiency of siRNA delivery by encapsulating the siRNA into new carrier systems which are obtained via the combination of widely used layer-by-layer technique and in situ modification by sol-gel chemistry. We used three types of siRNAs (NP-717, NP-1155 and NP-1496) in encapsulated form as new therapeutic agents against H1N1 influenza virus infection. By employing the hybrid microcontainers for the siRNA encapsulation we demonstrate the reduction of viral nucleoprotein (NP) level and inhibition of influenza virus production in infected cell lines (MDCK and A549). The obtained hybrid carriers based on assembled biodegradable polyelectrolytes and sol-gel coating possess several advantages such as a high cell uptake efficiency, low toxicity, efficient intracellular delivery of siRNAs and the protection of siRNAs from premature degradation before reaching the target cells. These findings underpin a great potential of versatile microencapsulation technology for the development of anti-viral RNAi delivery systems against influenza virus infection.
Cancer-targeting siRNA delivery from porous silicon nanoparticles.
Wan, Yuan; Apostolou, Sinoula; Dronov, Roman; Kuss, Bryone; Voelcker, Nicolas H
2014-10-01
Porous silicon nanoparticles (pSiNPs) with tunable pore size are biocompatible and biodegradable, suggesting that they are suitable biomaterials as vehicles for drug delivery. Loading of small interfering RNA (siRNA) into the pores of pSiNPs can protect siRNA from degradation as well as improve the cellular uptake. We aimed to deliver MRP1 siRNA loaded into pSiNPs to glioblastoma cells, and to demonstrate downregulation of MRP1 at the mRNA and protein levels. 50-220 nm pSiNPs with an average pore size of 26 nm were prepared, followed by electrostatic adsorption of siRNA into pores. Oligonucleotide loading and release profiles were investigated; MRP1 mRNA and protein expression, cell viability and cell apoptosis were studied. Approximately 7.7 µg of siRNA was loaded per mg of pSiNPs. Cells readily took up nanoparticles after 30 min incubation. siRNA-loaded pSiNPs were able to effectively downregulate target mRNA (~40%) and protein expression (31%), and induced cell apoptosis and necrosis (33%). siRNA loaded pSiNPs downregulated mRNA and protein expression and induced cell death. This novel siRNA delivery system may pave the way towards developing more effective tumor therapies.
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
Huang, Kuan-Wei; Lai, Yu-Tsung; Chern, Guann-Jen; Huang, Shao-Feng; Tsai, Chia-Lung; Sung, Yun-Chieh; Chiang, Cheng-Chin; Hwang, Pi-Bei; Ho, Ting-Lun; Huang, Rui-Lin; Shiue, Ting-Yun; Chen, Yunching; Wang, Sheng-Kai
2018-05-29
Successful siRNA therapy requires suitable delivery systems with targeting moieties such as small molecules, peptides, antibodies, or aptamers. Galactose (Gal) residues recognized by the asialoglycoprotein receptor (ASGPR) can serve as potent targeting moieties for hepatocellular carcinoma (HCC) cells. However, efficient targeting to HCC via galactose moieties rather than normal liver tissues in HCC patients remains a challenge. To achieve more efficient siRNA delivery in HCC, we synthesized various galactoside derivatives and investigated the siRNA delivery capability of nanoparticles modified with those galactoside derivatives. In this study, we assembled lipid/calcium/phosphate nanoparticles (LCP NPs) conjugated with eight types of galactoside derivatives and demonstrated that phenyl β-d-galactoside-decorated LCP NPs (L4-LCP NPs) exhibited a superior siRNA delivery into HCC cells compared to normal hepatocytes. VEGF siRNAs delivered by L4-LCP NPs downregulated VEGF expression in HCC in vitro and in vivo and led to a potent antiangiogenic effect in the tumor microenvironment of a murine orthotopic HCC model. The efficient delivery of VEGF siRNA by L4-LCP NPs that resulted in significant tumor regression indicates that phenyl galactoside could be a promising HCC-targeting ligand for therapeutic siRNA delivery to treat liver cancer.
Biomimetic nanoparticles for siRNA delivery in the treatment of leukaemia.
Guo, Jianfeng; Cahill, Mary R; McKenna, Sharon L; O'Driscoll, Caitriona M
2014-12-01
Leukaemia is a bone marrow cancer occurring in acute and chronic subtypes. Acute leukaemia is a rapidly fatal cancer potentially causing death within a few weeks, if untreated. Leukaemia arises as a result of disruption to haematopoietic precursors, caused either by acquired gene fusions, gene mutations or inappropriate expression of the relevant oncogenes. Current treatment options have made significant progress, but the 5 year survival for acute leukaemia remains under 10% in elderly patients, and less than 50% for some types of acute leukaemia in younger adults. For chronic leukaemias longer survival is generally expected and for chronic myeloid leukaemia patients on tyrosine kinase inhibitors the median survival is not yet reached and is expected to exceed 10 years. Chemotherapy and haematopoietic stem cell transplantation (HSCT) for acute leukaemia provide the mainstay of therapy for patients under 65 and both carry significant morbidity and mortality. Alternative and superior therapeutic strategies for acute leukaemias are urgently required. Recent molecular-based knowledge of recurring chromosome rearrangements, in particular translocations and inversions, has resulted in significant advances in understanding the molecular pathogenesis of leukaemia. Identification of a number of unique fusion genes has facilitated the development of highly specific small interfering RNAs (siRNA). Although delivery of siRNA using multifunctional nanoparticles has been investigated to treat solid cancers, the application of this approach to blood cancers is at an early stage. This review describes current treatments for leukaemia and highlights the potential of leukaemic fusion genes as therapeutic targets for RNA interference (RNAi). In addition, the design of biomimetic nanoparticles which are capable of responding to the physiological environment of leukaemia and their potential to advance RNAi therapeutics to the clinic will be critically evaluated. Copyright © 2014 Elsevier Inc. All rights reserved.
Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin
2016-01-01
ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363
NASA Astrophysics Data System (ADS)
El-Ariss, Mohamad
Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and siARN_2M are complementary to a sequence shifted slightly downstream in the same gene (583-607 nucleic acids). RNA duplexes siRNA_1 and siARN_2 consist exclusively of DNA while "modifed" siRNA_1M and si RNA_2M consist of RNA overhangs. siRNA duplexes (siRNA_1 and siRNA_2) were chosen from the work published by Hao Wu et al. (2003), Stege et al. (2004) and Miletti-Gonzalez et al. (2005) which showed that these siRNA sequences are effective to silence MDR1 gene in cancer cells (breast cancer cells MCF-7 / AdrR and MCF-7 / BC-19 and stomach cancer cells: EPG85-257RDB).[3-5] Moreover, Strapps et al. (2010) showed that the use of siRNA having overhangs formed of ribonucleotides leads to a similar silencing but lasting longer in vivo and in vitro compared to the use of siRNA containing deoxyribonucleotides overhangs.[6] Thus siARN_1M and siARN_2M sequences correspond to siARN_1 and siARN_2 sequences but whose overhangs are formed of ribonucleotides. These siRNA specific to the MDR1 gene (MDR1-siRNA) were combined to chitosan to form nanoparticles capable of protecting these MDR1-siRNA and delivering it into the MCF-7 MDR cells. Chitosan used here as a delivery system, is a natural and biodegradable polysaccharide whose biological properties are defined by its average molecular weight (MW) and by its degree of deacetylation (DD). When the positively charged chitosan is added with the negatively charged siRNA, there is formation of nanoparticles by electrostatic attraction. In this project, chitosan 92-10 (DDA- MW) was used as a delivery system with a N:P (ratio chitosan amino groups: RNA phosphate) of 5. Analysis by dynamic light scattering (DLS) demonstrated that the nanoparticles have a diameter between 62.56 and 82.72 nm and a zeta potential ranging from 17.4 to 23.5 mV. Analysis by confocal microscopy showed that chitosan (92-10-5)/labeled siRNA are internalized in MCF-7 MDR cells and that siRNAs are released in the cytoplasm. MCF-7 cells resistant MDR were transfected in vitro with different chitosan nanoparticles 92-10/MDR1-siRNA. qPCR quantification showed that transfection of MCF-7 MDR cells leads to inhibition of the expression of the MDR1 gene by 71%. In addition, induced cytotoxicity tests showed that the use of nanoparticles allows resensitizing cells to doxorubicin. In fact, the mortality rate of MDR MCF-7 cells exposed to doxorubicin increased to 60% after transfecting the cells with the nanoparticles chitosane (92-10-5)/ MDR1-siRNA. In conclusion, we have developed Chitosan (92-10-5)/ MDR1-siRNA nanoparticles that reduce the expression of P-gp in cells and allow the latter to re-sensitize to Doxorubicin. This study demonstrated the potential of chitosan nanoparticles (92-10-5)/ MDR1-siRNA for the treatment of cancers resistant to chemotherapy.
siRNA Versus miRNA as Therapeutics for Gene Silencing
Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S
2015-01-01
Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed. PMID:26372022
Nanotherapeutics Using an HIV-1 Poly A and Transactivator of the HIV-1 LTR-(TAR-) Specific siRNA
Mahajan, Supriya D.; Aalinkeel, Ravikumar; Reynolds, Jessica L.; Nair, Bindukumar; Sykes, Donald E.; Law, Wing-Cheung; Ding, Hong; Bergey, Earl J.; Prasad, Paras N.; Schwartz, Stanley A.
2011-01-01
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. We used a well-validated siRNA (si510) which targets the poly A/TAR (transactivator of the HIV-1 LTR) site and suppresses viral replication. Nanotechnology holds much potential for impact in the field of HIV-1 therapeutics, and nanoparticles such as quantum rods (QRs) can be easily functionalized to incorporate siRNA forming stable nanoplexes that can be used for gene silencing. We evaluated the efficacy of the QR-si510 HIV-1 siRNA nanoplex in suppressing viral replication in the HIV-1-infected monocytic cell line THP-1 by measuring p24 antigen levels and gene expression levels of HIV-1 LTR. Our results suggest that the QR-si510 HIV-1 siRNA nanoplex is not only effective in delivering siRNA, but also in suppressing HIV-1 viral replication for a longer time period. HIV-1 nanotherapeutics can thus enhance systemic bioavailability and offer multifunctionality. PMID:21660279
Pardo, Marta; Cheng, Yuyan; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Martinez, Ana; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore
2017-03-23
Molecular mechanisms underlying learning and memory remain imprecisely understood, and restorative interventions are lacking. We report that intranasal administration of siRNAs can be used to identify targets important in cognitive processes and to improve genetically impaired learning and memory. In mice modeling the intellectual deficiency of Fragile X syndrome, intranasally administered siRNA targeting glycogen synthase kinase-3β (GSK3β), histone deacetylase-1 (HDAC1), HDAC2, or HDAC3 diminished cognitive impairments. In WT mice, intranasally administered brain-derived neurotrophic factor (BDNF) siRNA or HDAC4 siRNA impaired learning and memory, which was partially due to reduced insulin-like growth factor-2 (IGF2) levels because the BDNF siRNA- or HDAC4 siRNA-induced cognitive impairments were ameliorated by intranasal IGF2 administration. In Fmr1 -/- mice, hippocampal IGF2 was deficient, and learning and memory impairments were ameliorated by IGF2 intranasal administration. Therefore intranasal siRNA administration is an effective means to identify mechanisms regulating cognition and to modulate therapeutic targets.
Attarwala, Husain; Clausen, Valerie; Chaturvedi, Prasoon; Amiji, Mansoor M
2017-09-05
In this study, we have developed a type B gelatin nanoparticle based siRNA delivery system for silencing of intestinal transglutaminase-2 (TG2) and interleukin-15 (IL-15) genes in cultured human intestinal epithelial cells (Caco-2) and murine alveolar macrophage cells (J774A.1). Small interfering RNA (siRNA) targeting the TG2 or IL-15 gene was encapsulated within gelatin nanoparticles using ethanol-water solvent displacement method. Size, charge, and morphology of gelatin nanoparticles were evaluated using a Zetasizer instrument and transmission electron microscopy. siRNA encapsulation efficiency was determined using an siRNA specific stem-loop quantitative polymerase chain reaction (qPCR) assay. Cellular uptake of siRNA-containing gelatin nanoparticles was determined using fluorescent microscopy and stem-loop qPCR assay. siRNA loading in the RISC (RNA-induced silencing complex) was determined by immunoprecipitation of argonaute 2 (AGO2) protein followed by stem-loop qPCR for siRNA quantification. Gene expression analysis of TG2, IL-15, and the proinflammatory cytokines, tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ), was performed using qPCR assays. Efficacy of silencing TG2 and IL-15 knockdown was evaluated in an in vitro model of celiac disease by utilizing immunogenic α-gliadin peptide p31-43 in cultured J774A.1 cells. siRNA-containing gelatin nanoparticles were spherical in shape with mean particle size and charge of 217 ± 8.39 nm and -6.2 ± 0.95 mV, respectively. siRNA loading efficiency within gelatin nanoparticles was found to be 89.3 ± 3.05%. Evaluations of cellular uptake using fluorescent microscopy showed rapid internalization of gelatin nanoparticles within 2 h of dosing, with cytosolic localization of delivered siRNA in Caco-2 cells. Gelatin nanoparticles showed greater intracellular siRNA exposure with a longer half-life, when compared to Lipofectamine-mediated siRNA delivery. Approximately 0.1% of total intracellular siRNA was associated in the RISC complex. A maximum knockdown of 60% was observed at 72 h post siRNA treatment for both TG2 and IL-15 genes, which corresponded to ∼200 copies of RISC associated siRNA. Further, efficacy of gelatin nanoparticle mediated knockdown of TG2 and IL-15 mRNA was tested in an in vitro model of celiac disease. Significant suppression in the levels of proinflammatory cytokines (TNF-α and IFN-γ) was observed in p31-43 stimulated J774A.1 cells upon either IL-15 or IL-15 + TG2 siRNA treatment. The results from this study indicate that gelatin nanoparticle mediated TG2 and IL-15 siRNA gene silencing is a very promising approach for the treatment of celiac disease.
NASA Astrophysics Data System (ADS)
Möller, Karin; Müller, Katharina; Engelke, Hanna; Bräuchle, Christoph; Wagner, Ernst; Bein, Thomas
2016-02-01
A new general route for siRNA delivery is presented combining porous core-shell silica nanocarriers with a modularly designed multifunctional block copolymer. Specifically, the internal storage and release of siRNA from mesoporous silica nanoparticles (MSN) with orthogonal core-shell surface chemistry was investigated as a function of pore-size, pore morphology, surface properties and pH. Very high siRNA loading capacities of up to 380 μg per mg MSN were obtained with charge-matched amino-functionalized mesoporous cores, and release profiles show up to 80% siRNA elution after 24 h. We demonstrate that adsorption and desorption of siRNA is mainly driven by electrostatic interactions, which allow for high loading capacities even in medium-sized mesopores with pore diameters down to 4 nm in a stellate pore morphology. The negatively charged MSN shell enabled the association with a block copolymer containing positively charged artificial amino acids and oleic acid blocks, which acts simultaneously as capping and endosomal release agent. The potential of this multifunctional delivery platform is demonstrated by highly effective cell transfection and siRNA delivery into KB-cells. A luciferase reporter gene knock-down of up to 80-90% was possible using extremely low cell exposures with only 2.5 μg MSN containing 0.5 μg siRNA per 100 μL well.A new general route for siRNA delivery is presented combining porous core-shell silica nanocarriers with a modularly designed multifunctional block copolymer. Specifically, the internal storage and release of siRNA from mesoporous silica nanoparticles (MSN) with orthogonal core-shell surface chemistry was investigated as a function of pore-size, pore morphology, surface properties and pH. Very high siRNA loading capacities of up to 380 μg per mg MSN were obtained with charge-matched amino-functionalized mesoporous cores, and release profiles show up to 80% siRNA elution after 24 h. We demonstrate that adsorption and desorption of siRNA is mainly driven by electrostatic interactions, which allow for high loading capacities even in medium-sized mesopores with pore diameters down to 4 nm in a stellate pore morphology. The negatively charged MSN shell enabled the association with a block copolymer containing positively charged artificial amino acids and oleic acid blocks, which acts simultaneously as capping and endosomal release agent. The potential of this multifunctional delivery platform is demonstrated by highly effective cell transfection and siRNA delivery into KB-cells. A luciferase reporter gene knock-down of up to 80-90% was possible using extremely low cell exposures with only 2.5 μg MSN containing 0.5 μg siRNA per 100 μL well. Electronic supplementary information (ESI) available: MSN synthesis and analysis, sample preparation for cell transfections as well as additional studies including experiments with a second cell line and a toxicity assay. See DOI: 10.1039/c5nr06246b
Qiao, Wenjie; Zarzyńska-Nowak, Aleksandra; Nerva, Luca; Kuo, Yen-Wen; Falk, Bryce W
2018-04-28
RNA silencing is a conserved antiviral defense mechanism that has been used to develop robust resistance against plant virus infections. Previous efforts have been made to develop RNA silencing-mediated resistance to criniviruses, yet none have given immunity. In this study, transgenic Nicotiana benthamiana plants harboring a hairpin construct of the Lettuce infectious yellows virus (LIYV) RdRp sequence exhibited immunity to systemic LIYV infection. Deep-sequencing analysis was performed to characterize virus-derived siRNAs (vsiRNAs) generated upon systemic LIYV infection in non-transgenic N. benthamiana plants as well as transgene-derived siRNAs (t-siRNAs) derived from the immune transgenic plants before and after LIYV inoculation. Interestingly, a similar sequence distribution pattern was obtained with t-siRNAs and vsiRNAs mapped to the transgene region in both immune and susceptible plants except a significant increase of t-siRNAs of 24 nt in length, which was consistent with small RNA northern blot results that showed the abundance of t-siRNAs of 21-, 22-, and 24- nt in length. The accumulated 24-nt sequences haven't yet been reported in transgenic plants partially resistant to criniviruses, thus may indicate their correlation with crinivirus immunity. To further test this hypothesis, we developed transgenic melon (Cucumis melo) plants immune to systemic infection of another crinivirus, Cucurbit yellow stunting disorder virus (CYSDV). As predicted, the accumulation of 24-nt t-siRNAs was detected in transgenic melon plants by northern blot. Together with our findings and previous studies on crinivirus resistance, we propose that the accumulation of 24 nt t-siRNAs is associated with crinivirus immunity in transgenic plants. This article is protected by copyright. All rights reserved. © 2018 BSPP and John Wiley & Sons Ltd.
Effect of Surface Properties on Liposomal siRNA Delivery
Xia, Yuqiong; Tian, Jie; Chen, Xiaoyuan
2015-01-01
Liposomes are one of the most widely investigated carriers for siRNA delivery. The surface properties of liposomal carriers, including the surface charge, PEGylation, and ligand modification can significantly affect the gene silencing efficiency. Three barriers of systemic siRNA delivery (long blood circulation, efficient tumor penetration and efficient cellular uptake/endosomal escape) are analyzed on liposomal carriers with different surface charges, PEGylations and ligand modifications. Cationic formulations dominate siRNA delivery and neutral formulations also have good performance while anionic formulations are generally not proper for siRNA delivery. The PEG dilemma (prolonged blood circulation vs. reduced cellular uptake/endosomal escape) and the side effect of repeated PEGylated formulation (accelerated blood clearance) were discussed. Effects of ligand modification on cationic and neutral formulations were analyzed. Finally, we summarized the achievements in liposomal siRNA delivery, outlined existing problems and provided some future perspectives. PMID:26695117
Mechanisms of Nanoparticle Mediated siRNA Transfection by Melittin-Derived Peptides
Hou, Kirk K.; Pan, Hua; Ratner, Lee; Schlesinger, Paul H.; Wickline, Samuel A.
2014-01-01
Traditional peptide-mediated siRNA transfection via peptide transduction domains exhibits limited cytoplasmic delivery of siRNA due to endosomal entrapment. This work overcomes these limitations with the use of membrane-destabilizing peptides derived from melittin for the knockdown of NFkB signaling in a model of adult T-Cell leukemia/lymphoma. While the mechanism of siRNA delivery into the cytoplasmic compartment by peptide transduction domains has not been well studied, our analysis of melittin derivatives indicates that concurrent nanocomplex disassembly and peptide-mediated endosomolysis are crucial to siRNA transfection. Importantly, in the case of the most active derivative, p5RHH, this process is initiated by acidic pH, indicating that endosomal acidification after macropinocytosis can trigger siRNA release into the cytoplasm. These data provide general principles regarding nanocomplex response to endocytosis which may guide the development of peptide/siRNA nanocomplex-based transfection. PMID:24053333
Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.
Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J
2010-04-01
Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.
Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less
Waite, Carolyn L.; Roth, Charles M.
2011-01-01
Generation 5 poly(amidoamine) (PAMAM) dendrimers were modified by the addition of cyclic RGD targeting peptides and were evaluated for their ability to associate with siRNA and mediate siRNA delivery to U87 malignant glioma cells. PAMAM-RGD conjugates were able to complex with siRNA to form complexes of approximately 200 nm in size. Modest siRNA delivery was observed in U87 cells using either PAMAM or PAMAM-RGD conjugates. PAMAM-RGD conjugates prevented the adhesion of U87 cells to fibrinogen coated plates, in a manner that depends on the number of RGD ligands per dendrimer. The delivery of siRNA through three-dimensional multicellular spheroids of U87 cells was enhanced using PAMAM-RGD conjugates compared to the native PAMAM dendrimers, presumably by interfering with integrin-ECM contacts present in a three-dimensional tumor model. PMID:19775120
Andrzejewska, W; Pietralik, Z; Skupin, M; Kozak, M
2016-10-01
Dicationic (gemini) surfactants are agents that can be used for the preparation of stable complexes of nucleic acids, particularly siRNA for therapeutic purposes. In this study, we demonstrated that bis-imidazolium gemini surfactants with variable lengths of dioxyalkyl linker groups (from dioxyethyl to dioxydodecyl) and dodecyl side chains are excellent for the complexation of siRNA. All of these compounds effectively complexed siRNA in a charge ratio range (p/n) of 1.5-10. The low resolution structure of siRNA oligomers was characterised by small angle scattering of synchrotron radiation (SR-SAXS) and ab initio modelling. The structures of the formed complexes were also analysed using SR-SAXS, circular dichroism studies and electrophoretic mobility tests. The most promising agents for complexation with siRNA were the surfactants that contained dioxyethyl and dioxyhexyl spacer groups. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ozeki, Nobuaki; Kawai, Rie; Hase, Naoko
We previously reported that interleukin 1β acts via matrix metalloproteinase (MMP)-3 to regulate cell proliferation and suppress apoptosis in α2 integrin-positive odontoblast-like cells differentiated from mouse embryonic stem (ES) cells. Here we characterize the signal cascade underpinning odontoblastic differentiation in mouse ES cells. The expression of α2 integrin, extracellular matrix metalloproteinase inducer (Emmprin), and MMP-3 mRNA and protein were all potently increased during odontoblastic differentiation. Small interfering RNA (siRNA) disruption of the expression of these effectors potently suppressed the expression of the odontoblastic biomarkers dentin sialophosphoprotein, dentin matrix protein-1 and alkaline phosphatase, and blocked odontoblast calcification. Our siRNA, western blotmore » and blocking antibody analyses revealed a unique sequential cascade involving α2 integrin, Emmprin and MMP-3 that drives ES cell differentiation into odontoblasts. This cascade requires the interaction between α2 integrin and Emmprin and is potentiated by exogenous MMP-3. Finally, although odontoblast-like cells potently express α2, α6, αV, β1, and β3, integrins, we confirmed that β1 integrin acts as the trigger for ES cell differentiation, apparently in complex with α2 integrin. These results demonstrate a unique and unanticipated role for an α2 integrin-, Emmprin-, and MMP-3-mediated signaling cascade in driving mouse ES cell differentiation into odontoblast-like cells. - Highlights: • Odontoblast differentiation requires activation of α2 integrin, Emmprin and MMP-3. • α2 integrin, Emmprin and MMP-3 form a sequential signaling cascade. • β1 integrin acts a specific trigger for odontoblast differentiation. • The role of these effectors is highly novel and unanticipated.« less
Unique Variants in OPN1LW Cause Both Syndromic and Nonsyndromic X-Linked High Myopia Mapped to MYP1.
Li, Jiali; Gao, Bei; Guan, Liping; Xiao, Xueshan; Zhang, Jianguo; Li, Shiqiang; Jiang, Hui; Jia, Xiaoyun; Yang, Jianhua; Guo, Xiangming; Yin, Ye; Wang, Jun; Zhang, Qingjiong
2015-06-01
MYP1 is a locus for X-linked syndromic and nonsyndromic high myopia. Recently, unique haplotypes in OPN1LW were found to be responsible for X-linked syndromic high myopia mapped to MYP1. The current study is to test if such variants in OPN1LW are also responsible for X-linked nonsyndromic high myopia mapped to MYP1. The proband of the family previously mapped to MYP1 was initially analyzed using whole-exome sequencing and whole-genome sequencing. Additional probands with early-onset high myopia were analyzed using whole-exome sequencing. Variants in OPN1LW were selected and confirmed by Sanger sequencing. Long-range and second PCR were used to determine the haplotype and the first gene of the red-green gene array. Candidate variants were further validated in family members and controls. The unique LVAVA haplotype in OPN1LW was detected in the family with X-linked nonsyndromic high myopia mapped to MYP1. In addition, this haplotype and a novel frameshift mutation (c.617_620dup, p.Phe208Argfs*51) in OPN1LW were detected in two other families with X-linked high myopia. The unique haplotype cosegregated with high myopia in the two families, with a maximum LOD score of 3.34 and 2.31 at θ = 0. OPN1LW with the variants in these families was the first gene in the red-green gene array and was not present in 247 male controls. Reevaluation of the clinical data in both families with the unique haplotype suggested nonsyndromic high myopia. Our study confirms the findings that unique variants in OPN1LW are responsible for both syndromic and nonsyndromic X-linked high myopia mapped to MYP1.
Bai, Wenxia; Bai, Jian'an; Li, Yanhai; Tian, Delong; Shi, Ruihua
2017-04-08
Many autophagy-related genes, to our knowledge, have been identified as Crohn's disease (CD) polymorphic sites by genomic wide studies. As a novel member of the microtubule-associated protein 1 (MAP1) family, MAP1S is a microtubule-binding proteins involved in autophagy. However, its expression and potential functions in CD have not been understood. For the first time, we discovered the up-regulated MAP1S and autophagy level (indicated by LC3-Ⅱ/LC3-Ⅰ) in inflamed epithelium among CD patients. Similarly, in TNBS-induced murine colitis model, MAP1S expression was obviously increased. Meanwhile, we found the co-location of MAP1S and active-caspase 3 which acted as "apoptotic executor" which might indicate the basis of their co-efficient. At the cellular level, MAP1S silencing inhibited starvation-induced over-expression of active-caspase 3 partially via Wnt/β-catenin signaling activation in HCT-116 cells. Finally, we demonstrated that IWP-2, an inhibitor of the Wnt/β-catenin signaling, reversed the down-regulation of active-caspase 3 induced by MAP1S siRNA in HCT-116 cells. Taken together, our results suggested that MAP1S were up-regulated among CD patients and MAP1S-related autophagy inhibits apoptosis of intestinal epithelial cells (IECs) through Wnt/β-catenin signaling pathway which might play a vital role in the protection of intestinal mucosal barrier and inhibition the progression of CD. Copyright © 2017 Elsevier Inc. All rights reserved.
Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production
Kandasamy, Suresh K.
2016-01-01
The enzyme Dicer produces small silencing RNAs such as micro-RNAs (miRNAs) and small interfering RNAs (siRNAs). In Drosophila, Dicer-1 produces ∼22–24-nt miRNAs from pre-miRNAs, whereas Dicer-2 makes 21-nt siRNAs from long double-stranded RNAs (dsRNAs). How Dicer-2 precisely makes 21-nt siRNAs with a remarkably high fidelity is unknown. Here we report that recognition of the 5′-monophosphate of a long dsRNA substrate by a phosphate-binding pocket in the Dicer-2 PAZ (Piwi, Argonaute, and Zwille/Pinhead) domain is crucial for the length fidelity, but not the efficiency, in 21-nt siRNA production. Loss of the length fidelity, meaning increased length heterogeneity of siRNAs, caused by point mutations in the phosphate-binding pocket of the Dicer-2 PAZ domain decreased RNA silencing activity in vivo, showing the importance of the high fidelity to make 21-nt siRNAs. We propose that the 5′-monophosphate of a long dsRNA substrate is anchored by the phosphate-binding pocket in the Dicer-2 PAZ domain and the distance between the pocket and the RNA cleavage active site in the RNaseIII domain corresponds to the 21-nt pitch in the A-form duplex of a long dsRNA substrate, resulting in high-fidelity 21-nt siRNA production. This study sheds light on the molecular mechanism by which Dicer-2 produces 21-nt siRNAs with a remarkably high fidelity for efficient RNA silencing. PMID:27872309
Therapeutic opportunities of small interfering RNA.
Goyal, Bhoomika R; Patel, Mayur M; Soni, Mithil K; Bhadada, Shraddha V
2009-08-01
Formation of small interfering RNA (siRNA) occurs in two steps involving binding of the RNA nucleases to a large double-stranded RNA (dsRNA) and its cleavage into fragments called siRNA. In the second step, these siRNAs join a multinuclease complex, which degrades the homologous single-stranded mRNAs. The delivery of siRNA involves viral- and non-viral-mediated delivery systems; the approaches for chemical modifications have also been developed. It has various therapeutic applications for disorders like cardiovascular diseases, central nervous system (CNS) disorders, cancer, human immunodeficiency virus (HIV), hepatic disorders, etc. The present review gives an overview of the applications of siRNA and their potential for treating many hitherto untreatable diseases.
Ohyama, Ayumu; Higashi, Taishi; Motoyama, Keiichi; Arima, Hidetoshi
2017-06-01
We previously developed a tumor-selective siRNA carrier by preparing polyamidoamine dendrimer (generation 4, G4) conjugates with α-cyclodextrin and folate-polyethylene glycol (Fol-PαC (G4)). In the present study, we developed ternary complexes of Fol-PαC (G4)/siRNA with low-molecular-weight-sacrans to achieve more effective siRNA transfer activity. Among the different molecular-weight sacrans, i.e. sacran 100, 1000 and 10,000 (MW 44,889Da, 943,692Da and 1,488,281Da, respectively), sacran 100 significantly increased the cellular uptake and the RNAi effects of Fol-PαC (G4)/siRNA binary complex with negligible cytotoxicity in KB cells (folate receptor-α positive cells). In addition, the ζ-potential and particle size of Fol-PαC (G4)/siRNA complex were decreased by the ternary complexation with sacran 100. Importantly, the in vivo RNAi effect of the ternary complex after the intravenous administration to tumor-bearing BALB/c mice was significantly higher than that of the binary complex. In conclusion, Fol-PαC (G4)/siRNA/sacran 100 ternary complex has a potential as a novel tumor-selective siRNA delivery system. Copyright © 2017 Elsevier B.V. All rights reserved.
More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature
Ladunga, Istvan
2007-01-01
Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992
Mokhtarieh, Amir Abbas; Lee, Jieun; Kim, Semi; Lee, Myung Kyu
2018-06-01
Previously a scalable and extrusion-free method has been developed for efficient liposomal encapsulation of DNA by twice stepwise mixing of lipids in ethanol and DNA solution using T-shape mixing chamber. In this study, we prepared nanoliposomes encapsulating siRNA by simply discontinuous mixing of lipids in ethanol/ether/water mixture and acidic siRNA solution without use of special equipment. The simple mixing siRNA/liposomal particles (siRNA/SMLs) prepared using ethanol/ether/water (3:1:1) mixture showed 120.4 ± 20.2 nm particle size, 0.174 ± 0.033 polydispersity and 86.5 ± 2.76% siRNA encapsulation rate. In addition, the SMLs almost completely protected the encapsulated siRNA from RNase A digestion. Coupling of anti-human epidermal growth factor receptor (EGFR) Fab' to siRNA/SMLs enhanced EGFR-specific cell penetration of SMLs and induced siRNA dependent gene silencing. Unexpectedly, the Cy5.5-labeled Fab' showed almost no in vivo targeting to the xenografted A549 tumors in SCID-NOD mice. However, multiple injection of the unmodified siRNA/SMLs accumulated in the tumors and induced siRNA-dependent in vivo gene silencing. These results demonstrate that the siRNA/SMLs can be used as a siRNA delivery tool for gene therapy. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong Junmei; Wei Na; Chalk, Alistair
RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests thatmore » the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi.« less
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Focusing on RISC assembly in mammalian cells.
Hong, Junmei; Wei, Na; Chalk, Alistair; Wang, Jue; Song, Yutong; Yi, Fan; Qiao, Ren-Ping; Sonnhammer, Erik L L; Wahlestedt, Claes; Liang, Zicai; Du, Quan
2008-04-11
RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests that the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi.
Xu, Lexing; Wang, Xin; He, Hongwei; Zhou, Jinming; Li, Xiaoyu; Ma, Hongtao; Li, Zelin; Zeng, Yi; Shao, Rongguang; Cen, Shan; Wang, Yucheng
2015-02-10
Short interfering RNAs (siRNAs) are broadly used to manipulate gene expression in mammalian cells. Although chemical modification is useful for increasing the potency of siRNAs in vivo, rational optimization of siRNA performance through chemical modification is still a challenge. In this work, we designed and synthesized a set of siRNAs containing modified two-nucleotide 3'-overhangs with the aim of strengthening the interaction between the 3'-end of the siRNA strand and the PAZ domain of Ago2. Their efficiency of binding to the PAZ domain was calculated using a computer modeling program, followed by measurement of RNA-Ago2 interaction in a surface plasmon resonance biochemical assay. The results suggest that increasing the level of binding of the 3'-end of the guiding strand with the PAZ domain, and/or reducing the level of binding of the sense strand through modifying the two-nucleotide 3'-overhangs, affects preferential strand selection and improves siRNA activity, while we cannot exclude the possibility that the modifications at the 3'-end of the sense strand may also affect the recognition of the 5'-end of the guiding strand by the MID domain. Taken together, our work presents a strategy for optimizing siRNA performance through asymmetric chemical modification of 3'-overhangs and also helps to develop the computer modeling method for rational siRNA design.
Hattori, Yoshiyuki; Arai, Shohei; Kikuchi, Takuto; Ozaki, Kei-Ichi; Kawano, Kumi; Yonemochi, Etsuo
2016-04-01
Previously, we developed a novel siRNA transfer method to the liver by sequential intravenous injection of anionic polymer and cationic liposome/siRNA complex (cationic lipoplex). In this study, we investigated whether siRNA delivered by this sequential injection could significantly suppress mRNA expression of the targeted gene in liver metastasis and inhibit tumor growth. When cationic lipoplex was intravenously injected into mice bearing liver metastasis of human breast tumor MCF-7 at 1 min after intravenous injection of chondroitin sulfate C (CS) or poly-l-glutamic acid (PGA), siRNA was accumulated in tumor-metastasized liver. In terms of a gene silencing effect, sequential injections of CS or PGA plus cationic lipoplex of luciferase siRNA could reduce luciferase activity in liver MCF-7-Luc metastasis. Regarding the side effects, sequential injections of CS plus cationic lipoplex did not exhibit hepatic damage or induction of inflammatory cytokines in serum after repeated injections, but sequential injections of PGA plus cationic lipoplex did. Finally, sequential injections of CS plus cationic lipoplex of protein kinase N3 siRNA could suppress tumor growth in the mice bearing liver metastasis. From these findings, sequential injection of CS and cationic lipoplex of siRNA might be a novel systemic method of delivering siRNA to liver metastasis.
NASA Astrophysics Data System (ADS)
Tran, Melissa A.; Gowda, Raghavendra; Park, Eun-Joo; Adair, James; Smith, Nadine; Kester, Mark; Robertson, Gavin P.
2009-04-01
Melanoma is the most deadly form of skin cancer. Currently early surgical removal is the best treatment option for melanoma patients with little hope of successful treatment of late stage melanoma. Clearly new treatment options must be explored. Topical administration of drugs provides the advantage of being able to apply large quantities of drug in close proximity to the tumor without the issue of systemic side effects. However, the natural barrier formed by the skin must first be overcome for topical treatment to become a viable option. With this in mind we have sought to use low-frequency ultrasound to transiently permeabilize the stratum corneum and successfully deliver liposomal siRNA to melanoma cells residing at the basement membrane. B-Raf is one of the most frequently activated genes in melanoma, making it an ideal candidate for targeting via siRNA. The novel liposomes used in this study load siRNA, protect if from the outside environment and lead to knockdown of target message. Combining ultrasound with liposomal siRNA we show that siRNA can be delivered into melanoma cells. Additionally, we show that siRNA to mutant B-Raf can effectively inhibit melanoma growth in reconstructs and in mice by 60% and 30% respectively. Therefore, ultrasound with liposomal siRNA is a potentially valuable treatment option for melanoma patients.
Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam
2012-01-01
Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770
Cantini, Liliana; Attaway, Christopher C.; Butler, Betsy; Andino, Lourdes M.; Sokolosky, Melissa L.; Jakymiw, Andrew
2013-01-01
Despite a better understanding of the pathogenesis of oral cancer, its treatment outcome remains poor. Thus, there is a need for new therapeutic strategies to improve the prognosis of this disease. RNA interference (RNAi) appears to be a promising therapeutic tool for the treatment of many diseases, including oral cancer. However, an obstacle for RNAi-mediated therapies has been delivery, in particular, the retention of small interfering RNAs (siRNAs) in endosomes and their subsequent degradation in lysosomes, resulting in inefficient gene silencing. Thus, the current study examined the feasibility of designing and utilizing a peptide, termed 599, consisting of a synthetic influenza virus-derived endosome-disruptive fusogenic peptide sequence and a stretch of cationic cell-penetrating nona(D-arginine) residues, to deliver siRNAs into oral cancer cells and induce silencing of the therapeutic target, CIP2A, an oncoprotein overexpressed in various human malignancies including oral cancer. Increasing the 599 peptide-to-siRNA molar ratio demonstrated a higher binding capacity for siRNA molecules and enhanced siRNA delivery into the cytoplasm of oral cancer cells. In fact, quantitative measurements of siRNA delivery into cells demonstrated that a 50∶1 peptide-to-siRNA molar ratio could deliver 18-fold higher amounts of siRNAs compared to cells treated with siRNA alone with no significant long-term cytotoxic effects. Most importantly, the 599 peptide-mediated siRNA delivery promoted significant CIP2A mRNA and protein silencing which resulted in decreased oral cancer cell invasiveness and anchorage-independent growth. Together, these data demonstrate that a chimeric peptide consisting of a fusogenic sequence, in combination with cell-penetrating residues, can be used to effectively deliver siRNAs into oral cancer cells and induce the silencing of its target gene, potentially offering a new therapeutic strategy in combating oral cancer. PMID:24019920
Yhee, Ji Young; Song, Seungyong; Lee, So Jin; Park, Sung-Gurl; Kim, Ki-Suk; Kim, Myung Goo; Son, Sejin; Koo, Heebeom; Kwon, Ick Chan; Jeong, Ji Hoon; Jeong, Seo Young; Kim, Sun Hwa; Kim, Kwangmeyung
2015-01-28
P-glycoprotein (Pgp) mediated multi-drug resistance (MDR) is a major cause of failure in chemotherapy. In this study, small interfering RNA (siRNA) for Pgp down-regulation was delivered to tumors to overcome MDR in cancer. To achieve an efficient siRNA delivery in vivo, self-polymerized 5'-end thiol-modified siRNA (poly-siRNA) was incorporated in tumor targeting glycol chitosan nanoparticles. Pgp-targeted poly-siRNA (psi-Pgp) and thiolated glycol chitosan polymers (tGC) formed stable nanoparticles (psi-Pgp-tGC NPs), and the resulting nanoparticles protected siRNA molecules from enzymatic degradation. The psi-Pgp-tGC NPs could release functional siRNA molecules after cellular delivery, and they were able to facilitate siRNA delivery to Adriamycin-resistant breast cancer cells (MCF-7/ADR). After intravenous administration, the psi-Pgp-tGC NPs accumulated in MCF-7/ADR tumors and down-regulated P-gp expression to sensitize cancer cells. Consequently, chemo-siRNA combination therapy significantly inhibited tumor growth without systemic toxicity. These psi-Pgp-tGC NPs showed great potential as a supplementary therapeutic agent for drug-resistant cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Fernandes, Julio C; Qiu, Xingping; Winnik, Francoise M; Benderdour, Mohamed; Zhang, Xiaoling; Dai, Kerong; Shi, Qin
2012-01-01
The low transfection efficiency of chitosan is one of its drawbacks as a gene delivery carrier. Low molecular weight chitosan may help to form small-sized polymer-DNA or small interfering RNA (siRNA) complexes. Folate conjugation may improve gene transfection efficiency because of the promoted uptake of folate receptor-bearing cells. In the present study, chitosan was conjugated with folate and investigated for its efficacy as a delivery vector for siRNA in vitro. We demonstrate that the molecular weight of chitosan has a major influence on its biological and physicochemical properties, and very low molecular weight chitosan (below 10 kDa) has difficulty in forming stable complexes with siRNA. In this study, chitosan 25 kDa and 50 kDa completely absorbed siRNA and formed nanoparticles (≤220 nm) at a chitosan to siRNA weight ratio of 50:1. The introduction of a folate ligand onto chitosan decreased nanoparticle toxicity. Compared with chitosan-siRNA, folate-chitosan-siRNA nanoparticles improved gene silencing transfection efficiency. Therefore, folate-chitosan shows potential as a viable candidate vector for safe and efficient siRNA delivery. PMID:23209368
Recent advances in magnetofection and its potential to deliver siRNAs in vitro.
Mykhaylyk, Olga; Zelphati, Olivier; Hammerschmid, Edelburga; Anton, Martina; Rosenecker, Joseph; Plank, Christian
2009-01-01
This chapter describes how to design and conduct experiments to deliver siRNA to adherent mammalian cells in vitro by magnetic force-assisted transfection using self-assembled complexes of small interfering RNA (siRNA) and cationic lipids or polymers that are associated with magnetic nanoparticles. These magnetic complexes are targeted to the cell surface by the application of a magnetic gradient field. In this chapter, first we describe the synthesis of magnetic nanoparticles for magnetofection and the association of siRNA with the magnetic components of the transfection complex. Second, a simple protocol is described in order to evaluate magnetic responsiveness of the magnetic siRNA transfection complexes and estimate the complex loading with magnetic nanoparticles. Third, protocols are provided for the preparation of magnetic lipoplexes and polyplexes of siRNA, magnetofection, downregulation of gene expression, and the determination of cell viability. The addition of INF-7 peptide, a fusogenic peptide, to the magnetic transfection triplexes improved gene silencing in HeLa cells. The described protocols are also valuable for screening vector compositions and novel magnetic nanoparticle preparations to optimize siRNA transfection by magnetofection in every cell type.
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
NASA Astrophysics Data System (ADS)
Wu, Lijuan; Wu, Changlin; Liu, Guangwan; Liao, Nannan; Zhao, Fang; Yang, Xuxia; Qu, Hongyuan; Peng, Bo; Chen, Li; Yang, Guang
2016-12-01
siRNA delivery remains highly challenging because of its hydrophilic and anionic nature and its sensitivity to nuclease degradation. Effective siRNA loading and improved transfection efficiency into cells represents a key problem. In our study, we prepared Chitosan/Hyaluronic acid-siRNA multilayer films through layer-by-layer self-assembly, in which siRNAs can be effectively loaded and protected. The construction process was characterized by FTIR, 13C NMR (CP/MAS), UV-vis spectroscopy, and atomic force microscopy (AFM). We presented the controlled-release performance of the films during incubation in 1 M NaCl solution for several days through UV-vis spectroscopy and polyacrylamide gel electrophoresis (PAGE). Additionally, we verified the stability and integrity of the siRNA loaded on multilayer films. Finally, the biological efficacy of the siRNA delivery system was evaluated via cells adhesion and gene silencing analyses in eGFP-HEK 293T cells. This new type of surface-mediated non-viral multilayer films may have considerable potential in the localized and controlled-release delivery of siRNA in mucosal tissues, and tissue engineering application.
Wang, Chuandong; Yuan, Weien; Xiao, Fei; Gan, Yaokai; Zhao, Xiaotian; Zhai, Zhanjing; Zhao, Xiaoying; Zhao, Chen; Cui, Penglei; Jin, Tuo; Chen, Xiaodong; Zhang, Xiaoling
2017-01-01
Small-interfering RNA (siRNA) provides a rapid solution for drug design and provides new methods to develop customizable medicines. Polyethyleneimine 25 kDa (PEI25kDa) is an effective transfection agent used in siRNA delivery. However, the lack of degradable linkage causes undesirable toxicity, hindering its clinical application. We designed a low-molecular-weight cross-linked polyethylenimine named PEI-Et (Mn:1220, Mw:2895) by using degradable ethylene biscarbamate linkage with lower cytotoxicity and higher knockdown efficiency than PEI25kDa in delivery Chordin siRNA to human bone mesenchymal stem cells (hBMSCs). Suppression of Chordin by using anti-Chordin siRNA delivered by PEI-Et improved bone regeneration in vitro and in vivo associated with the bone morphogenetic protein-2 (BMP-2) mediated smad1/5/8 signaling pathway. Results of this study suggest that Chordin siRNA can be potentially used to improve osteogenesis associated with the BMP-2-mediated Smad1/5/8 signaling pathway and biodegradable biscarbamate cross-linked low-molecular-weight polyethylenimine (PEI-Et) is a therapeutically feasible carrier material to deliver anti-Chordin siRNA to hBMSCs.
Unique Sensor Plane Maps Invisible Toxins for First Responders
Kroutil, Robert; Thomas, Mark; Aten, Keith
2018-05-30
A unique airborne emergency response tool, ASPECT is a Los Alamos/U.S. Environmental Protection Agency project that can put chemical and radiological mapping tools in the air over an accident scene. The name ASPECT is an acronym for Airborne Spectral Photometric Environmental Collection Technology.
Peptide- and Amine-Modified Glucan Particles for the Delivery of Therapeutic siRNA
Aouadi, Myriam; Vangala, Pranitha; Tencerova, Michaela; Amano, Shinya U.; Nicoloro, Sarah M.; Yawe, Joseph C.; Czech, Michael P.
2016-01-01
Translation of siRNA technology into the clinic is limited by the need for improved delivery systems that target specific cell types. Macrophages are particularly attractive targets for RNAi therapy because they promote pathogenic inflammatory responses in a number of important human diseases. We previously demonstrated that a multi-component formulation of β-1,3-D-glucan-encapsulated siRNA particles (GeRPs) can specifically and potently silence genes in mouse macrophages. A major advance would be to simplify the GeRP system by reducing the number of delivery components, thus enabling more facile manufacturing and future commercialization. Here we report the synthesis and evaluation of a simplified glucan-based particle (GP) capable of delivering siRNA in vivo to selectively silence macrophage genes. Covalent attachment of small-molecule amines and short peptides containing weak bases to GPs facilitated electrostatic interaction of the particles with siRNA and aided in the endosomal release of siRNA by the proton-sponge effect. Modified GPs were non-toxic and were efficiently internalized by macrophages in vitro. When injected intraperitoneally (i.p.), several of the new peptide-modified GPs were found to efficiently deliver siRNA to peritoneal macrophages in lean, healthy mice. In an animal model of obesity-induced inflammation, i.p. administration of one of the peptide-modified GPs (GP-EP14) bound to siRNA selectively reduced the expression of target inflammatory cytokines in the visceral adipose tissue macrophages. Decreasing adipose tissue inflammation resulted in an improvement of glucose metabolism in these metabolically challenged animals. Thus, modified GPs represent a promising new simplified system for the efficient delivery of therapeutic siRNAs specifically to phagocytic cells in vivo for modulation of inflammation responses. PMID:26815386
Ye, Dong; Luo, Hai; Lai, Zhouyi; Zou, Lili; Zhu, Linyan; Mao, Jianwen; Jacob, Tim; Ye, Wencai; Wang, Liwei; Chen, Lixin
2016-01-01
It was shown in this study that knockdown of ClC-3 expression by ClC-3 siRNA prevented the activation of hypotonicity-induced chloride currents, and arrested cells at the G0/G1 phase in nasopharyngeal carcinoma CNE-2Z cells. Reconstitution of ClC-3 expression with ClC-3 expression plasmids could rescue the cells from the cell cycle arrest caused by ClC-3 siRNA treatments. Transfection of cells with ClC-3 siRNA decreased the expression of cyclin D1, cyclin dependent kinase 4 and 6, and increased the expression of cyclin dependent kinase inhibitors (CDKIs), p21 and p27. Pretreatments of cells with p21 and p27 siRNAs depleted the inhibitory effects of ClC-3 siRNA on the expression of CDK4 and CDK6, but not on that of cyclin D1, indicating the requirement of p21 and p27 for the inhibitory effects of ClC-3 siRNA on CDK4 and CDK6 expression. ClC-3 siRNA inhibited cells to progress from the G1 phase to the S phase, but pretreatments of cells with p21 and p27 siRNAs abolished the inhibitory effects of ClC-3 siRNA on the cell cycle progress. Our data suggest that ClC-3 may regulate cell cycle transition between G0/G1 and S phases by up-regulation of the expression of CDK4 and CDK6 through suppression of p21 and p27 expression. PMID:27451945
Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas
2013-05-21
Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.
2013-01-01
Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071
Park, Jong-Beom; Park, Chanjoo
2017-10-01
In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.
The pH-Triggered Triblock Nanocarrier Enabled Highly Efficient siRNA Delivery for Cancer Therapy.
Du, Lili; Zhou, Junhui; Meng, Lingwei; Wang, Xiaoxia; Wang, Changrong; Huang, Yuanyu; Zheng, Shuquan; Deng, Liandong; Cao, Huiqing; Liang, Zicai; Dong, Anjie; Cheng, Qiang
2017-01-01
Small interfering RNA (siRNA) therapies have been hampered by lack of delivery systems in the past decades. Nowadays, a few promising vehicles for siRNA delivery have been developed and it is gradually revealed that enhancing siRNA release from endosomes into cytosol is a very important factor for successful delivery. Here, we designed a novel pH-sensitive nanomicelle, PEG-PTTMA-P(GMA-S-DMA) (PTMS), for siRNA delivery. Owing to rapid hydrolysis in acidic environment, PTMS NPs underwent hydrophobic-to-hydrophilic transition in endosomes that enabled combination of proton sponge effect and raised osmotic pressure in endosomes, resulting in vigorous release of siRNAs from endosomes into cytosol. In vitro results demonstrated that PTMS/siRNA complexes exhibited excellent gene silencing effects in several cell lines. Their gene silencing efficiency could reach ~91%, ~87% and ~90% at the N/P ratio of 50/1 in MDA-MB-231, A549 and Hela cells respectively, which were better than that obtained with Lipofectamine 2000. The highly efficient gene silencing was then proven from enhanced siRNA endosomal release, which is mainly attributed to pH-triggered degradation of polymer and acid-accelerated siRNA release. In vivo experiments indicated that NPs/siRNA formulation rapidly accumulated in tumor sites after i.v. injection. Tumor growth was effectively inhibited and ~45% gene knockdown efficacy was determined at the siRRM2 dose of 1mg/kg. Meanwhile, no significant toxicity was observed during the whole treatment. We also found that PTMS/siRNA formulations could lead to significant gene silencing effects in liver (~63%) and skin (~80%) when injected by i.v. and s.c., respectively. This research work gives a rational strategy to optimize siRNA delivery systems for tumor treatments.
Ibaraki, Hisako; Kanazawa, Takanori; Takashima, Yuuki; Okada, Hiroaki; Seta, Yasuo
2018-05-05
Nucleic acid-based targeting of nuclear factor kappaB (NF-κB) is gaining attention as a treatment option for skin diseases like atopic dermatitis (AD). Transdermal administration improves patient quality of life because of non-invasive; however, siRNA delivery into the skin can be challenging owing to the barrier of tight junctions in the granular layer. Therefore, we aimed to develop a delivery system of siRNA for topical skin application using functional peptides. We previously reported that combined treatment with a cytoplasm-responsive stearylated-arginine-rich peptide (STR-CH 2 R 4 H 2 C) and a tight junction opening peptide (AT1002) showed high siRNA permeability in the skin of AD-induced and normal mice. Here, we used murine macrophage RAW264.7 cells to examine siRNA permeation and the therapeutic effect of anti-NF-κB (RelA) siRNA (siRelA) complexed with STR-CH 2 R 4 H 2 C and AT1002 for AD-induced mice. We showed that significantly higher siRNA cellular uptake occurs after this treatment as well as decreased TNF-α and IL-6 expression. Additionally, we showed that effective siRNA transdermal delivery occurs with the suppression of the tight junction protein ZO-1. Moreover, topical skin application of siRelA with STR-CH 2 R 4 H 2 C and AT1002 improved AD-like symptoms in model mice. Thus, the combined treatment of STR-CH 2 R 4 H 2 C and AT1002 could serve as an effective transdermal siRNA therapeutic system for AD. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhao, Ji-Jun; Wu, Zhao-Feng; Yu, Ying-Hao; Wang, Ling; Cheng, Li
2018-09-01
To explore the effects of IL-7/IL-7R on the RANKL-mediated osteoclast differentiation in vitro and OVX-induced bone loss in vivo. BMMs and RAW264.7 were transfected with IL-7, IL-7R siRNA, c-Fos siRNA, and c-jun siRNA and later stimulated by RANKL. TRAP and toluidine blue staining were used to observe osteoclast formation and bone resorption, respectively. HE and TRAP staining were used to detect trabecular bone microstructure and osteoclasts of mice, respectively. qRT-PCR and Western blot analysis were used to examine expression. IL-7 unregulated the expression of CTSK, NFATc1, MMP9, and the phosphorylation of p38 and Akt by activating the c-Fos/c-Jun pathway, which increased osteoclast numbers and bone resorption in RANKL-stimulated macrophages. While IL-7R siRNA and c-Fos siRNA decreased the expression, as well as and the phosphorylation of p38 and Akt.IL-7 decreased the BMD and OPG expression in OVX-induced mice and increased the TRAP positive cells, the mRNA expression of c-fos, c-jun, and RANKL, which was contradictory to IL-7R siRNA, and c-Fos siRNA. Furthermore, IL-7R siRNA and c-Fos siRNA caused thicker trabeculae, increased trabecular number, and decreased osteolysis in OVX mice. IL-7/IL-7R can promote RANKL-mediated osteoclast formation and bone resorption by activating the c-Fos/c-Jun pathway, as well as inducing bone loss in OVX mice. © 2018 Wiley Periodicals, Inc.
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Abrams, Marc
2013-01-01
Small interfering RNA (siRNA) therapeutics have advanced from bench to clinical trials in recent years, along with new tools developed to enable detection of siRNA delivered at the organ, cell, and subcellular levels. Preclinical models of siRNA delivery have benefitted from methodologies such as stem-loop quantitative polymerase chain reaction, histological in situ immunofluorescent staining, endosomal escape assay, and RNA-induced silencing complex loading assay. These technologies have accelerated the detection and optimization of siRNA platforms to overcome the challenges associated with delivering therapeutic oligonucleotides to the cytosol of specific target cells. This review focuses on the methodologies and their application in the biodistribution of siRNA delivered by lipid nanoparticles. PMID:23504369
NASA Astrophysics Data System (ADS)
Jang, Mihue; Kim, Jong Hwan; Nam, Hae Yun; Kwon, Ick Chan; Ahn, Hyung Jun
2015-08-01
For therapeutic applications of siRNA, there are technical challenges with respect to targeted and systemic delivery. We here report a new siRNA carrier, RNAtr NPs, in a way that multiple tandem copies of RNA hairpins as a result of rolling circle transcription (RCT) can be readily adapted in tumour-targeted and systemic siRNA delivery. RNAtr NPs provide a means of condensing large amounts of multimeric RNA transcripts into the compact nanoparticles, especially without the aid of polycationic agents, and thus reduce the risk of immunogenicity and cytotoxicity by avoiding the use of synthetic polycationic reagents. This strategy allows the design of a platform technology for systemic delivery of siRNA to tumour sites, because RCT reaction, which enzymatically generates RNA polymers in multiple copy numbers at low cost, can lead to directly accessible routes to targeted and systemic delivery. Therefore, RNAtr NPs suggest great potentials as the siRNA therapeutics for cancer treatment.
Development of antibody-siRNA conjugate targeted to cardiac and skeletal muscles.
Sugo, Tsukasa; Terada, Michiko; Oikawa, Tatsuo; Miyata, Kenichi; Nishimura, Satoshi; Kenjo, Eriya; Ogasawara-Shimizu, Mari; Makita, Yukimasa; Imaichi, Sachiko; Murata, Shumpei; Otake, Kentaro; Kikuchi, Kuniko; Teratani, Mika; Masuda, Yasushi; Kamei, Takayuki; Takagahara, Shuichi; Ikeda, Shota; Ohtaki, Tetsuya; Matsumoto, Hirokazu
2016-09-10
Despite considerable efforts to develop efficient carriers, the major target organ of short-interfering RNAs (siRNAs) remains limited to the liver. Expanding the application outside the liver is required to increase the value of siRNAs. Here we report on a novel platform targeted to muscular organs by conjugation of siRNAs with anti-CD71 Fab' fragment. This conjugate showed durable gene-silencing in the heart and skeletal muscle for one month after intravenous administration in normal mice. In particular, 1μg siRNA conjugate showed significant gene-silencing in the gastrocnemius when injected intramuscularly. In a mouse model of peripheral artery disease, the treatment with myostatin-targeting siRNA conjugate by intramuscular injection resulted in significant silencing of myostatin and hypertrophy of the gastrocnemius, which was translated into the recovery of running performance. These data demonstrate the utility of antibody conjugation for siRNA delivery and the therapeutic potential for muscular diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
Minami, Kosuke; Okamoto, Koji; Doi, Kent; Harano, Koji; Noiri, Eisei; Nakamura, Eiichi
2014-05-12
The efficient treatment of lung diseases requires lung-selective delivery of agents to the lung. However, lung-selective delivery is difficult because the accumulation of micrometer-sized carriers in the lung often induces inflammation and embolization-related toxicity. Here we demonstrate a lung-selective delivery system of small interfering RNA (siRNA) by controlling the size of carrier vehicle in blood vessels. The carrier is made of tetra(piperazino)fullerene epoxide (TPFE), a water-soluble cationic tetraamino fullerene. TPFE and siRNA form sub-micrometer-sized complexes in buffered solution and these complexes agglutinate further with plasma proteins in the bloodstream to form micrometer-sized particles. The agglutinate rapidly clogs the lung capillaries, releases the siRNA into lung cells to silence expression of target genes, and is then cleared rapidly from the lung after siRNA delivery. We applied our delivery system to an animal model of sepsis, indicating the potential of TPFE-based siRNA delivery for clinical applications.
NASA Astrophysics Data System (ADS)
Minami, Kosuke; Okamoto, Koji; Doi, Kent; Harano, Koji; Noiri, Eisei; Nakamura, Eiichi
2014-05-01
The efficient treatment of lung diseases requires lung-selective delivery of agents to the lung. However, lung-selective delivery is difficult because the accumulation of micrometer-sized carriers in the lung often induces inflammation and embolization-related toxicity. Here we demonstrate a lung-selective delivery system of small interfering RNA (siRNA) by controlling the size of carrier vehicle in blood vessels. The carrier is made of tetra(piperazino)fullerene epoxide (TPFE), a water-soluble cationic tetraamino fullerene. TPFE and siRNA form sub-micrometer-sized complexes in buffered solution and these complexes agglutinate further with plasma proteins in the bloodstream to form micrometer-sized particles. The agglutinate rapidly clogs the lung capillaries, releases the siRNA into lung cells to silence expression of target genes, and is then cleared rapidly from the lung after siRNA delivery. We applied our delivery system to an animal model of sepsis, indicating the potential of TPFE-based siRNA delivery for clinical applications.
CDE-1 affects chromosome segregation through uridylation of CSR-1-bound siRNAs.
van Wolfswinkel, Josien C; Claycomb, Julie M; Batista, Pedro J; Mello, Craig C; Berezikov, Eugene; Ketting, René F
2009-10-02
We have studied the function of a conserved germline-specific nucleotidyltransferase protein, CDE-1, in RNAi and chromosome segregation in C. elegans. CDE-1 localizes specifically to mitotic chromosomes in embryos. This localization requires the RdRP EGO-1, which physically interacts with CDE-1, and the Argonaute protein CSR-1. We found that CDE-1 is required for the uridylation of CSR-1 bound siRNAs, and that in the absence of CDE-1 these siRNAs accumulate to inappropriate levels, accompanied by defects in both meiotic and mitotic chromosome segregation. Elevated siRNA levels are associated with erroneous gene silencing, most likely through the inappropriate loading of CSR-1 siRNAs into other Argonaute proteins. We propose a model in which CDE-1 restricts specific EGO-1-generated siRNAs to the CSR-1 mediated, chromosome associated RNAi pathway, thus separating it from other endogenous RNAi pathways. The conserved nature of CDE-1 suggests that similar sorting mechanisms may operate in other animals, including mammals.
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
Castanotto, Daniela; Sakurai, Kumi; Lingeman, Robert; Li, Haitang; Shively, Louise; Aagaard, Lars; Soifer, Harris; Gatignol, Anne; Riggs, Arthur; Rossi, John J.
2007-01-01
Despite the great potential of RNAi, ectopic expression of shRNA or siRNAs holds the inherent risk of competition for critical RNAi components, thus altering the regulatory functions of some cellular microRNAs. In addition, specific siRNA sequences can potentially hinder incorporation of other siRNAs when used in a combinatorial approach. We show that both synthetic siRNAs and expressed shRNAs compete against each other and with the endogenous microRNAs for transport and for incorporation into the RNA induced silencing complex (RISC). The same siRNA sequences do not display competition when expressed from a microRNA backbone. We also show that TAR RNA binding protein (TRBP) is one of the sensors for selection and incorporation of the guide sequence of interfering RNAs. These findings reveal that combinatorial siRNA approaches can be problematic and have important implications for the methodology of expression and use of therapeutic interfering RNAs. PMID:17660190
Caplen, Natasha J.; Parrish, Susan; Imani, Farhad; Fire, Andrew; Morgan, Richard A.
2001-01-01
Short interfering RNAs (siRNAs) are double-stranded RNAs of ≈21–25 nucleotides that have been shown to function as key intermediaries in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants and RNA interference in invertebrates. siRNAs have a characteristic structure, with 5′-phosphate/3′-hydroxyl ends and a 2-base 3′ overhang on each strand of the duplex. In this study, we present data that synthetic siRNAs can induce gene-specific inhibition of expression in Caenorhabditis elegans and in cell lines from humans and mice. In each case, the interference by siRNAs was superior to the inhibition of gene expression mediated by single-stranded antisense oligonucleotides. The siRNAs seem to avoid the well documented nonspecific effects triggered by longer double-stranded RNAs in mammalian cells. These observations may open a path toward the use of siRNAs as a reverse genetic and therapeutic tool in mammalian cells. PMID:11481446
MINAMI, Kosuke; OKAMOTO, Koji; DOI, Kent; HARANO, Koji; NOIRI, Eisei; NAKAMURA, Eiichi
2014-01-01
The efficient treatment of lung diseases requires lung-selective delivery of agents to the lung. However, lung-selective delivery is difficult because the accumulation of micrometer-sized carriers in the lung often induces inflammation and embolization-related toxicity. Here we demonstrate a lung-selective delivery system of small interfering RNA (siRNA) by controlling the size of carrier vehicle in blood vessels. The carrier is made of tetra(piperazino)fullerene epoxide (TPFE), a water-soluble cationic tetraamino fullerene. TPFE and siRNA form sub-micrometer-sized complexes in buffered solution and these complexes agglutinate further with plasma proteins in the bloodstream to form micrometer-sized particles. The agglutinate rapidly clogs the lung capillaries, releases the siRNA into lung cells to silence expression of target genes, and is then cleared rapidly from the lung after siRNA delivery. We applied our delivery system to an animal model of sepsis, indicating the potential of TPFE-based siRNA delivery for clinical applications. PMID:24814863
Stanislaus, Anthony; Bakhtiar, Athirah; Salleh, Diyana; Tiash, Snigdha; Fatemian, Tahereh; Hossain, Sharif; Akaike, Toshihiro; Chowdhury, Ezharul Hoque
2012-06-18
RNA interference (RNAi) is a powerful approach in functional genomics to selectively silence messenger mRNA (mRNA) expression and can be employed to rapidly develop potential novel drugs against a complex disease like cancer. However, naked siRNA being anionic is unable to cross the anionic cell membrane through passive diffusion and therefore, delivery of siRNA remains a major hurdle to overcome before the potential of siRNA technology can fully be exploited in cancer. pH-sensitive carbonate apatite has recently been developed as an efficient tool to deliver siRNA into the mammalian cells by virtue of its high affinity interaction with the siRNA and the desirable size distribution of the resulting siRNA-apatite complex for effective cellular endocytosis. Moreover, internalized siRNA was found to escape from the endosomes in a time-dependent manner and efficiently silence gene expression. Here we show that carbonate apatite-mediated delivery of siRNA against PLC-gamma-2 (PLCG2) and calmodulin 1 (CALM1) genes has led to the sensitization of a human cervical cancer cell line to doxorubicin- and paclitaxel depending on the dosage of the individual drug whereas no such enhancement in cell death was observed with cisplatin irrespective of the dosage following intracellular delivery of the siRNAs. Thus, PLCG2 and CALM1 genes are two potential targets for gene knockdown in doxorubicin and paclitaxel-based chemotherapy of cervical cancer.
Li, Hua; Zheng, Xiangtao; Koren, Viktoria; Vashist, Yogesh Kumar; Tsui, Tung Yu
2014-07-20
Small interfering RNAs (siRNAs) delivery remains a bottleneck for RNA interference (RNAi) - based therapies in the clinic. In the present study, a fusion protein with two cell-penetrating peptides (CPP), Hph1-Hph1, and a double-stranded RNA binding domain (dsRBD), was constructed for the siRNA delivery: dsRBD was designed to bind siRNA, and CPP would subsequently transport the dsRBD/siRNA complex into cells. We assessed the efficiency of the fusion protein, Hph1-Hph1-dsRBD, as a siRNA carrier. Calcium-condensed effects were assessed on GAPDH and green fluorescent protein (GFP) genes by western blot, real time polymerase chain reaction (RT-PCR), and flow cytometry analysis in vitro. Evaluations were also made in an in vivo heart transplantation model. The results demonstrated that the fusion protein, Hph1-Hph1-dsRBD, is highly efficient at delivering siRNA in vitro, and exhibits efficiency on GAPDH and GFP genes similar to or greater than lipofectamine. Interestingly, the calcium-condensed effects dramatically enhanced cellular uptake of the protein-siRNA complex. In vivo, Hph1-Hph1-dsRBD transferred and distributed ^ targeted siRNA throughout the whole mouse heart graft. Together, these results indicate that Hph1-Hph1-dsRBD has potential as an siRNA carrier for applications in the clinic or in biomedical research. Copyright © 2014 Elsevier B.V. All rights reserved.
Yang, Xiaoqian; lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng
2015-01-01
Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer. PMID:25687880
Lin, Qiaoya; Jin, Cheng S; Huang, Huang; Ding, Lili; Zhang, Zhihong; Chen, Juan; Zheng, Gang
2014-08-13
The abilities to deliver siRNA to its intended action site and assess the delivery efficiency are challenges for current RNAi therapy, where effective siRNA delivery will join force with patient genetic profiling to achieve optimal treatment outcome. Imaging could become a critical enabler to maximize RNAi efficacy in the context of tracking siRNA delivery, rational dosimetry and treatment planning. Several imaging modalities have been used to visualize nanoparticle-based siRNA delivery but rarely did they guide treatment planning. We report a multimodal theranostic lipid-nanoparticle, HPPS(NIR)-chol-siRNA, which has a near-infrared (NIR) fluorescent core, enveloped by phospholipid monolayer, intercalated with siRNA payloads, and constrained by apoA-I mimetic peptides to give ultra-small particle size (<30 nm). Using fluorescence imaging, we demonstrated its cytosolic delivery capability for both NIR-core and dye-labeled siRNAs and its structural integrity in mice through intravenous administration, validating the usefulness of NIR-core as imaging surrogate for non-labeled therapeutic siRNAs. Next, we validated the targeting specificity of HPPS(NIR)-chol-siRNA to orthotopic tumor using sequential four-steps (in vivo, in situ, ex vivo and frozen-tissue) fluorescence imaging. The image co-registration of computed tomography and fluorescence molecular tomography enabled non-invasive assessment and treatment planning of siRNA delivery into the orthotopic tumor, achieving efficacious RNAi therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
CTLA4 aptamer delivers STAT3 siRNA to tumor-associated and malignant T cells
Herrmann, Andreas; Priceman, Saul J.; Kujawski, Maciej; Xin, Hong; Cherryholmes, Gregory A.; Zhang, Wang; Zhang, Chunyan; Lahtz, Christoph; Kowolik, Claudia; Forman, Steve J.; Kortylewski, Marcin; Yu, Hua
2014-01-01
Intracellular therapeutic targets that define tumor immunosuppression in both tumor cells and T cells remain intractable. Here, we have shown that administration of a covalently linked siRNA to an aptamer (apt) that selectively binds cytotoxic T lymphocyte–associated antigen 4 (CTLA4apt) allows gene silencing in exhausted CD8+ T cells and Tregs in tumors as well as CTLA4-expressing malignant T cells. CTLA4 expression was upregulated in CD8+ T cells in the tumor milieu; therefore, CTLA4apt fused to a STAT3-targeting siRNA (CTLA4apt–STAT3 siRNA) resulted in internalization into tumor-associated CD8+ T cells and silencing of STAT3, which activated tumor antigen–specific T cells in murine models. Both local and systemic administration of CTLA4apt–STAT3 siRNA dramatically reduced tumor-associated Tregs. Furthermore, CTLA4apt–STAT3 siRNA potently inhibited tumor growth and metastasis in various mouse tumor models. Importantly, CTLA4 expression is observed in T cells of patients with blood malignancies, and CTLA4apt–STAT3 siRNA treatment of immunodeficient mice bearing human T cell lymphomas promoted tumor cell apoptosis and tumor growth inhibition. These data demonstrate that a CTLA4apt-based siRNA delivery strategy allows gene silencing in both tumor-associated T cells and tumor cells and inhibits tumor growth and metastasis. PMID:24892807
The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans.
Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P; Mak, Ho Yi
2014-04-14
RNAi is a potent mechanism for downregulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi, and other eukaryotes. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary small interfering RNAs (siRNAs). Exogenous double-stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA-dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear whether the subcellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively. We report that RDE-12, a conserved phenylalanine-glycine (FG) domain-containing DEAD box helicase, localizes in P granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA-targeted mRNA in distinct cytoplasmic compartments. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Wang, Jianxin
Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.
NASA Astrophysics Data System (ADS)
Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng
2015-02-01
Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.
Jose, Anup; Labala, Suman; Ninave, Kunal Manoj; Gade, Sudeep Kumar; Venuganti, Venkata Vamsi Krishna
2018-01-01
The aim of the present study was to evaluate the effectiveness of iontophoretic co-delivery of curcumin and anti-STAT3 siRNA using cationic liposomes against skin cancer. Curcumin was encapsulated in DOTAP-based cationic liposomes and then complexed with STAT3 siRNA. This nanocomplex was characterized for the average particle size, zeta-potential, and encapsulation efficiency. The cell viability studies in B16F10 mouse melanoma cells have shown that the co-delivery of curcumin and STAT3 siRNA significantly (p < 0.05) inhibited the cancer cell growth compared with either liposomal curcumin or STAT3 siRNA alone. The curcumin-loaded liposomes were able to penetrate up to a depth of 160 μm inside the skin after iontophoretic (0.47 mA/cm 2 ) application. The in vivo efficacy studies were performed in the mouse model of melanoma skin cancer. Co-administration of the curcumin and STAT3 siRNA using liposomes significantly (p < 0.05) inhibited the tumor progression as measured by tumor volume and tumor weight compared with either liposomal curcumin or STAT3 siRNA alone. Furthermore, the iontophoretic administration of curcumin-loaded liposome-siRNA complex showed similar effectiveness in inhibiting tumor progression and STAT3 protein suppression compared with intratumoral administration. Taken together, cationic liposomes can be utilized for topical iontophoretic co-delivery of small molecule and siRNA for effective treatment of skin diseases.
Schyth, Brian Dall; Bramsen, Jesper Bertram; Pakula, Malgorzata Maria; Larashati, Sekar; Kjems, Jørgen; Wengel, Jesper; Lorenzen, Niels
2012-01-01
Small interfering RNAs (siRNAs) are promising new active compounds in gene medicine but the induction of non-specific immune responses following their delivery continues to be a serious problem. With the purpose of avoiding such effects chemically modified siRNAs are tested in screening assay but often only examining the expression of specific immunologically relevant genes in selected cell populations typically blood cells from treated animals or humans. Assays using a relevant physiological state in biological models as read-out are not common. Here we use a fish model where the innate antiviral effect of siRNAs is functionally monitored as reduced mortality in challenge studies involving an interferon sensitive virus. Modifications with locked nucleic acid (LNA), altritol nucleic acid (ANA) and hexitol nucleic acid (HNA) reduced the antiviral protection in this model indicative of altered immunogenicity. For LNA modified siRNAs, the number and localization of modifications in the single strands was found to be important and a correlation between antiviral protection and the thermal stability of siRNAs was found. The previously published sisiRNA will in some sequences, but not all, increase the antiviral effect of siRNAs. The applied fish model represents a potent tool for conducting fast but statistically and scientifically relevant evaluations of chemically optimized siRNAs with respect to non-specific antiviral effects in vivo. PMID:22287630
Kang, Lin; Fan, Bo; Sun, Ping; Huang, Wei; Jin, Mingji; Wang, Qiming; Gao, Zhonggao
2016-10-15
Hypoxia is a feature of most solid tumors, targeting hypoxia is considered as the best validated yet not extensively exploited strategy in cancer therapy. Here, we reported a novel tumor-targeting strategy using a hypoxia-sensitive siRNA delivery system. In the study, 2-nitroimidazole (NI), a hydrophobic component that can be converted to hydrophilic 2-aminoimidazole (AI) through bioreduction under hypoxic conditions, was conjugated to the alkylated polyethyleneimine (bPEI1.8k-C6) to form amphiphilic bPEI1.8k-C6-NI polycations. bPEI1.8k-C6-NI could self-assemble into micelle-like aggregations in aqueous, which contributed to the improved stability of the bPEI1.8k-C6-NI/siRNA polyplexes, resulted in increased cellular uptake. After being transported into the hypoxic tumor cells, the selective nitro-to-amino reduction would cause structural change and elicit a relatively loose structure to facilitate the siRNA dissociation in the cytoplasm, for enhanced gene silencing efficiency ultimately. Therefore, the conflict between the extracellular stability and the intracellular siRNA release ability of the polyplexes was solved by introducing the hypoxia-responsive unit. Consequently, the survivin-targeted siRNA loaded polyplexes shown remarkable anti-tumor effect not only in hypoxic cells, but also in tumor spheroids and tumor-bearing mice, indicating that the hypoxia-sensitive siRNA delivery system had great potential for tumor-targeted therapy. Hypoxia is one of the most remarkable features of most solid tumors, and targeting hypoxia is considered as the best validated strategy in cancer therapy. However, in the past decades, there were few reports about using this strategy in the drug delivery system, especially in siRNA delivery system. Therefore, we constructed a hypoxia-sensitive siRNA delivery system utilizing a hypoxia-responsive unit, 2-nitroimidazole, by which the unavoidable conflict between improved extracellular stability and promoted intracellular siRNA release in the same delivery system could be effectively solved, resulting in enhanced siRNA silencing efficiency in tumor cells. To our knowledge, the described work is the first demonstration of a siRNA delivery system using a hypoxia trigger for regulation of siRNA release, which represents a new strategy for tumor-targeted therapy, and it is expected that this meaningful strategy must be widely applied in the future. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Nanocapsule-mediated cytosolic siRNA delivery for anti-inflammatory treatment.
Jiang, Ying; Hardie, Joseph; Liu, Yuanchang; Ray, Moumita; Luo, Xiang; Das, Riddha; Landis, Ryan F; Farkas, Michelle E; Rotello, Vincent M
2018-06-05
The use of nanoparticle-stabilized nanocapsules for cytosolic siRNA delivery for immunomodulation in vitro and in vivo is reported. These NPSCs deliver siRNA directly to the cytosol of macrophages in vitro with concomitant knockdown of gene expression. In vivo studies showed directed delivery of NPSCs to the spleen, enabling gene silencing of macrophages, with preliminary studies showing 70% gene knockdown at a siRNA dose of 0.28 mg/kg. Significantly, the delivery of siRNA targeting tumor necrosis factor-α efficiently silenced TNF-α expression in LPS-challenged mice, demonstrating efficacy in modulating immune response in an organ-selective manner. This research highlights the potential of the NPSC platform for targeted immunotherapy and further manipulation of the immune system. Copyright © 2018 Elsevier B.V. All rights reserved.
Mudedla, Sathish Kumar; Azhagiya Singam, Ettayapuram Ramaprasad; Balamurugan, Kanagasabai; Subramanian, Venkatesan
2015-11-11
The complexation of small interfering RNA (siRNA) with positively charged gold nanoclusters has been studied in the present investigation with the help of classical molecular dynamics and steered molecular dynamics simulations accompanied by free energy calculations. The results show that gold nanoclusters form a stable complex with siRNA. The wrapping of siRNA around the gold nanocluster depends on the size and charge on the surface of the gold cluster. The binding pattern of the gold nanocluster with siRNA is also influenced by the presence of another cluster. The interaction between the positively charged amines in the gold nanocluster and the negatively charged phosphate group in the siRNA is responsible for the formation of complexes. The binding free energy value increases with the size of the gold cluster and the number of positive charges present on the surface of the gold nanocluster. The results reveal that the binding energy of small gold nanoclusters increases in the presence of another gold nanocluster while the binding of large gold nanoclusters decreases due to the introduction of another gold nanocluster. Overall, the findings have clearly demonstrated the effect of size and charge of gold nanoclusters on their interaction pattern with siRNA.
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the biosynthetic processes of siRNAs including cleavage of CHS-A transcripts and subsequent production of secondary siRNAs in exon 2. The data also suggest that these events occurred at multiple sites, which can be a feature of these silencing phenomena.
IRF5 regulates lung macrophages M2 polarization during severe acute pancreatitis in vitro.
Sun, Kang; He, Song-Bing; Qu, Jian-Guo; Dang, Sheng-Chun; Chen, Ji-Xiang; Gong, Ai-Hua; Xie, Rong; Zhang, Jian-Xin
2016-11-14
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) in vitro . A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in the lung were observed by hematoxylin and eosin staining. Lung macrophages were isolated from bronchoalveolar lavage fluid. The quantity and purity of lung macrophages were detected by fluorescence-activated cell sorting and evaluated by real-time polymerase chain reaction (RT-PCR). They were treated with IL-4/IRF5 specific siRNA (IRF5 siRNA) to reverse their polarization and were evaluated by detecting markers expression of M1/M2 using RT-PCR. SAP associated acute lung injury (ALI) was induced successfully by ip injections of caerulein, which was confirmed by histopathology. Lung macrophages expressed high levels of IRF5 as M1 phenotype during the early acute pancreatitis stages. Reduction of IRF5 expression by IRF5 siRNA reversed the action of macrophages from M1 to M2 phenotype in vitro . The expressions of M1 markers, including IRF5 (S + IRF5 siRNA vs S + PBS, 0.013 ± 0.01 vs 0.054 ± 0.047, P < 0.01), TNF-α (S + IRF5 siRNA vs S + PBS, 0.0003 ± 0.0002 vs 0.019 ± 0.018, P < 0.001), iNOS (S + IRF5 siRNA vs S + PBS, 0.0003 ± 0.0002 vs 0.026 ± 0.018, P < 0.001) and IL-12 (S + IRF5 siRNA vs S + PBS, 0.000005 ± 0.00004 vs 0.024 ± 0.016, P < 0.001), were decreased. In contrast, the expressions of M2 markers, including IL-10 (S + IRF5 siRNA vs S + PBS, 0.060 ± 0.055 vs 0.0230 ± 0.018, P < 0.01) and Arg-1 (S + IRF5 siRNA vs S + PBS, 0.910 ± 0.788 vs 0.0036 ± 0.0025, P < 0.001), were increased. IRF5 siRNA could reverse the lung macrophage polarization more effectively than IL-4. Treatment with IRF5 siRNA can reverse the pancreatitis-induced activation of lung macrophages from M1 phenotype to M2 phenotype in SAP associated with ALI.
Yamaguchi, Rui; Sakamoto, Arisa; Yamaguchi, Reona; Haraguchi, Misa; Narahara, Shinji; Sugiuchi, Hiroyuki; Yamaguchi, Yasuo
2018-08-01
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect of TGFβ1 on SIGIRR protein production by human M1 macrophages in response to stimulation with substance P (SP). SP caused upregulation of SIGIRR expression in a concentration-dependent manner, whereas aprepitant (an NK1R inhibitor) blunted this response. Silencing p38γMAPK or TAK-1 partially attenuated the response to SP stimulation, while TGFβ1/2/3 siRNA dramatically diminished it. SP induced much greater SIGIRR protein production than either lipopolysaccharide (a TLR4 agonist) or resiquimod (a TLR7/8 agonist). Unexpectedly, silencing of transcription factor specificity protein 1 (Sp1) led to significant upregulation of SIGIRR expression after SP stimulation, while KLF2 siRNA only partially enhanced it and Fli-1 siRNA reduced it. SP also upregulated TGFβ1 expression, along with a corresponding increase of SIGIRR protein, whereas silencing TGFβ1/2/3 blunted these responses. Sp1 siRNA or mithramycin (a gene-selective Sp1 inhibitor) significantly enhanced the expression of TGFβ1 and SIGIRR by macrophages after SP stimulation. Importantly, this effect of Sp1 siRNA on TGFβ1 and SIGIRR was blunted by siRNA for Smad2, Smad3, or Smad4, but not by TAK-1 siRNA. Next, we investigated the influence of transcription factor cross-talk on SIGIRR expression in response to SP. Co-transfection of macrophages with Sp1 siRNA and C/EBPβ or TIF1β siRNA attenuated the upregulation of SIGIRR by SP, while a combination of Sp1 siRNA and Fli-1 siRNA dramatically diminished it. In conclusion, TGFβ1 may be an intermediary between SP/NK1R activation and SIGIRR expression in Sp1 siRNA-transfected macrophages. In addition, Sp1 modulates TGFβ1/Smad signaling and negatively regulates SIGIRR protein production by macrophages after SP stimulation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Integrating Databases with Maps: The Delivery of Cultural Data through TimeMap.
ERIC Educational Resources Information Center
Johnson, Ian
TimeMap is a unique integration of database management, metadata and interactive maps, designed to contextualise and deliver cultural data through maps. TimeMap extends conventional maps with the time dimension, creating and animating maps "on-the-fly"; delivers them as a kiosk application or embedded in Web pages; links flexibly to…
NASA Astrophysics Data System (ADS)
Xiao, Yuling; Jaskula-Sztul, Renata; Javadi, Alireza; Xu, Wenjin; Eide, Jacob; Dammalapati, Ajitha; Kunnimalaiyaan, Muthusamy; Chen, Herbert; Gong, Shaoqin
2012-10-01
A multifunctional gold (Au) nanorod (NR)-based nanocarrier capable of co-delivering small interfering RNA (siRNA) against achaete-scute complex-like 1 (ASCL1) and an anticancer drug (doxorubicin (DOX)) specifically to neuroendocrine (NE) cancer cells was developed and characterized for combined chemotherapy and siRNA-mediated gene silencing. The Au NR was conjugated with (1) DOX, an anticancer drug, via a pH-labile hydrazone linkage to enable pH-controlled drug release, (2) polyarginine, a cationic polymer for complexing siRNA, and (3) octreotide (OCT), a tumor-targeting ligand, to specifically target NE cancer cells with overexpressed somatostatin receptors. The Au NR-based nanocarriers exhibited a uniform size distribution as well as pH-sensitive drug release. The OCT-conjugated Au NR-based nanocarriers (Au-DOX-OCT, targeted) exhibited a much higher cellular uptake in a human carcinoid cell line (BON cells) than non-targeted Au NR-based nanocarriers (Au-DOX) as measured by both flow cytometry and confocal laser scanning microscopy (CLSM). Moreover, Au-DOX-OCT-ASCL1 siRNA (Au-DOX-OCT complexed with ASCL1 siRNA) resulted in significantly higher gene silencing in NE cancer cells than Au-DOX-ASCL1 siRNA (non-targeted Au-DOX complexed with ASCL1 siRNA) as measured by an immunoblot analysis. Additionally, Au-DOX-OCT-ASCL1 siRNA was the most efficient nanocarrier at altering the NE phenotype of NE cancer cells and showed the strongest anti-proliferative effect. Thus, combined chemotherapy and RNA silencing using NE tumor-targeting Au NR-based nanocarriers could potentially enhance the therapeutic outcomes in treating NE cancers.A multifunctional gold (Au) nanorod (NR)-based nanocarrier capable of co-delivering small interfering RNA (siRNA) against achaete-scute complex-like 1 (ASCL1) and an anticancer drug (doxorubicin (DOX)) specifically to neuroendocrine (NE) cancer cells was developed and characterized for combined chemotherapy and siRNA-mediated gene silencing. The Au NR was conjugated with (1) DOX, an anticancer drug, via a pH-labile hydrazone linkage to enable pH-controlled drug release, (2) polyarginine, a cationic polymer for complexing siRNA, and (3) octreotide (OCT), a tumor-targeting ligand, to specifically target NE cancer cells with overexpressed somatostatin receptors. The Au NR-based nanocarriers exhibited a uniform size distribution as well as pH-sensitive drug release. The OCT-conjugated Au NR-based nanocarriers (Au-DOX-OCT, targeted) exhibited a much higher cellular uptake in a human carcinoid cell line (BON cells) than non-targeted Au NR-based nanocarriers (Au-DOX) as measured by both flow cytometry and confocal laser scanning microscopy (CLSM). Moreover, Au-DOX-OCT-ASCL1 siRNA (Au-DOX-OCT complexed with ASCL1 siRNA) resulted in significantly higher gene silencing in NE cancer cells than Au-DOX-ASCL1 siRNA (non-targeted Au-DOX complexed with ASCL1 siRNA) as measured by an immunoblot analysis. Additionally, Au-DOX-OCT-ASCL1 siRNA was the most efficient nanocarrier at altering the NE phenotype of NE cancer cells and showed the strongest anti-proliferative effect. Thus, combined chemotherapy and RNA silencing using NE tumor-targeting Au NR-based nanocarriers could potentially enhance the therapeutic outcomes in treating NE cancers. Electronic supplementary information (ESI) available: Additional flow cytometry histogram profiles of DOX fluorescence and ASCL1 knockdown results. See DOI: 10.1039/c2nr31853a
Nonviral pulmonary delivery of siRNA.
Merkel, Olivia M; Kissel, Thomas
2012-07-17
RNA interference (RNAi) is an important part of the cell's defenses against viruses and other foreign genes. Moreover, the biotechnological exploitation of RNAi offers therapeutic potential for a range of diseases for which drugs are currently unavailable. Unfortunately, the small interfering RNAs (siRNAs) that are central to RNAi in the cytoplasm are readily degradable by ubiquitous nucleases, are inefficiently targeted to desired organs and cell types, and are excreted quickly upon systemic injection. As a result, local administration techniques have been favored over the past few years, resulting in great success in the treatment of viral infections and other respiratory disorders. Because there are several advantages of pulmonary delivery over systemic administration, two of the four siRNA drugs currently in phase II clinical trials are delivered intranasally or by inhalation. The air-blood barrier, however, has only limited permeability toward large, hydrophilic biopharmaceuticals such as nucleic acids; in addition, the lung imposes intrinsic hurdles to efficient siRNA delivery. Thus, appropriate formulations and delivery devices are very much needed. Although many different formulations have been optimized for in vitro siRNA delivery to lung cells, only a few have been reported successful in vivo. In this Account, we discuss both obstacles to pulmonary siRNA delivery and the success stories that have been achieved thus far. The optimal pulmonary delivery vehicle should be neither cytotoxic nor immunogenic, should protect the payload from degradation by nucleases during the delivery process, and should mediate the intracellular uptake of siRNA. Further requirements include the improvement of the pharmacokinetics and lung distribution profiles of siRNA, the extension of lung retention times (through reduced recognition by macrophages), and the incorporation of reversible or stimuli-responsive binding of siRNA to allow for efficient release of the siRNAs at the target site. In addition, the ideal carrier would be biodegradable (to address difficulties with repeated administration for the treatment of chronic diseases) and would contain targeting moieties to enhance uptake by specific cell types. None of the currently available polymer- and lipid-based formulations meet every one of these requirements, but we introduce here several promising new approaches, including a biodegradable, nonimmunogenic polyester. We also discuss imaging techniques for following the biodistribution according to the administration route. This tracking is crucial for better understanding the translocation and clearance of nanoformulated siRNA subsequent to pulmonary delivery. In the literature, the success of pulmonary siRNA delivery is evaluated solely by relief from or prophylaxis against a disease; side effects are not studied in detail. It also remains unclear which cell types in the lung eventually take up siRNA. These are critical issues for the translational use of pulmonary siRNA formulations; accordingly, we present a flow cytometry technique that can be utilized to differentiate transfected cell populations in a mouse model that expresses transgenic enhanced green fluorescence protein (EGFP). This technique, in which different cell types are identified on the basis of their surface antigen expression, may eventually help in the development of safer carriers with minimized side effects in nontargeted tissues.
Franz-Bacon, Karin; DiTirro, Danielle N.; Ly, Tai Wei; Bacon, Kevin B.
2016-01-01
Idiopathic pulmonary fibrosis (IPF) is a progressive, debilitating disease for which two medications, pirfenidone and nintedanib, have only recently been approved for treatment. The cytokine TGF-β has been shown to be a central mediator in the disease process. We investigated the role of a novel kinase, MAP3K19, upregulated in IPF tissue, in TGF-β-induced signal transduction and in bleomycin-induced pulmonary fibrosis. MAP3K19 has a very limited tissue expression, restricted primarily to the lungs and trachea. In pulmonary tissue, expression was predominantly localized to alveolar and interstitial macrophages, bronchial epithelial cells and type II pneumocytes of the epithelium. MAP3K19 was also found to be overexpressed in bronchoalveolar lavage macrophages from IPF patients compared to normal patients. Treatment of A549 or THP-1 cells with either MAP3K19 siRNA or a highly potent and specific inhibitor reduced phospho-Smad2 & 3 nuclear translocation following TGF-β stimulation. TGF-β-induced gene transcription was also strongly inhibited by both the MAP3K19 inhibitor and nintedanib, whereas pirfenidone had a much less pronounced effect. In combination, the MAP3K19 inhibitor appeared to act synergistically with either pirfenidone or nintedanib, at the level of target gene transcription or protein production. Finally, in an animal model of IPF, inhibition of MAP3K19 strongly attenuated bleomycin-induced pulmonary fibrosis when administered either prophylactically ortherapeutically. In summary, these results strongly suggest that inhibition of MAP3K19 may have a beneficial therapeutic effect in the treatment of IPF and represents a novel strategy to target this disease. PMID:27144281
Boehme, Stefen A; Franz-Bacon, Karin; DiTirro, Danielle N; Ly, Tai Wei; Bacon, Kevin B
2016-01-01
Idiopathic pulmonary fibrosis (IPF) is a progressive, debilitating disease for which two medications, pirfenidone and nintedanib, have only recently been approved for treatment. The cytokine TGF-β has been shown to be a central mediator in the disease process. We investigated the role of a novel kinase, MAP3K19, upregulated in IPF tissue, in TGF-β-induced signal transduction and in bleomycin-induced pulmonary fibrosis. MAP3K19 has a very limited tissue expression, restricted primarily to the lungs and trachea. In pulmonary tissue, expression was predominantly localized to alveolar and interstitial macrophages, bronchial epithelial cells and type II pneumocytes of the epithelium. MAP3K19 was also found to be overexpressed in bronchoalveolar lavage macrophages from IPF patients compared to normal patients. Treatment of A549 or THP-1 cells with either MAP3K19 siRNA or a highly potent and specific inhibitor reduced phospho-Smad2 & 3 nuclear translocation following TGF-β stimulation. TGF-β-induced gene transcription was also strongly inhibited by both the MAP3K19 inhibitor and nintedanib, whereas pirfenidone had a much less pronounced effect. In combination, the MAP3K19 inhibitor appeared to act synergistically with either pirfenidone or nintedanib, at the level of target gene transcription or protein production. Finally, in an animal model of IPF, inhibition of MAP3K19 strongly attenuated bleomycin-induced pulmonary fibrosis when administered either prophylactically ortherapeutically. In summary, these results strongly suggest that inhibition of MAP3K19 may have a beneficial therapeutic effect in the treatment of IPF and represents a novel strategy to target this disease.
Yang, Yingzhen; Jittayasothorn, Yingyos; Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5' end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs.
Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5′ end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs. PMID:23874962
Yang, Tianzhi; Fogarty, Brittany; LaForge, Bret; Aziz, Salma; Pham, Thuy; Lai, Leanne; Bai, Shuhua
2017-03-01
Although small interfering RNA (siRNA) holds great therapeutic promise, its delivery to the disease site remains a paramount obstacle. In this study, we tested whether brain endothelial cell-derived exosomes could deliver siRNA across the blood-brain barrier (BBB) in zebrafish. Natural exosomes were isolated from brain endothelial bEND.3 cell culture media and vascular endothelial growth factor (VEGF) siRNA was loaded in exosomes with the assistance of a transfection reagent. While fluorescence-activated cell flow cytometry and immunocytochemistry staining studies indicated that wild-type exosomes significantly increased the uptake of fluorescence-labeled siRNA in the autologous brain endothelial cells, decreased fluorescence intensity was observed in the cells treated with the tetraspanin CD63 antibody-blocked exosome-delivered formulation (p < 0.05). In the transport study, exosomes also enhanced the permeability of rhodamine 123 in a co-cultured monolayer of brain endothelial bEND.3 cell and astrocyte. Inhibition at the expression of VEGF RNA and protein levels was observed in glioblastoma-astrocytoma U-87 MG cells treated with exosome-delivered siRNAs. Imaging results showed that exosome delivered more siRNAs across the BBB in Tg(fli1:GFP) zebrafish. In a xenotransplanted brain tumor model, exosome-delivered VEGF siRNAs decreased the fluorescence intensity of labeled cancer cells in the brain of zebrafish. Brain endothelial cell-derived exosomes could be potentially used as a natural carrier for the brain delivery of exogenous siRNA.
Yuan, Ji; Cheung, Paul K M; Zhang, Huifang M; Chau, David; Yang, Decheng
2005-02-01
Coxsackievirus B3 (CVB3) is the most common causal agent of viral myocarditis, but existing drug therapies are of limited value. Application of small interfering RNA (siRNA) in knockdown of gene expression is an emerging technology in antiviral gene therapy. To investigate whether RNA interference (RNAi) can protect against CVB3 infection, we evaluated the effects of RNAi on viral replication in HeLa cells and murine cardiomyocytes by using five CVB3-specific siRNAs targeting distinct regions of the viral genome. The most effective one is siRNA-4, targeting the viral protease 2A, achieving a 92% inhibition of CVB3 replication. The specific RNAi effects could last at least 48 h, and cell viability assay revealed that 90% of siRNA-4-pretreated cells were still alive and lacked detectable viral protein expression 48 h postinfection. Moreover, administration of siRNAs after viral infection could also effectively inhibit viral replication, indicating its therapeutic potential. Further evaluation by combination found that no enhanced inhibitory effects were observed when siRNA-4 was cotransfected with each of the other four candidates. In mutational analysis of the mechanisms of siRNA action, we found that siRNA functions by targeting the positive strand of virus and requires a perfect sequence match in the central region of the target, but mismatches were more tolerated near the 3' end than the 5' end of the antisense strand. These findings reveal an effective target for CVB3 silencing and provide a new possibility for antiviral intervention.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Role of the Trypanosoma brucei HEN1 Family Methyltransferase in Small Interfering RNA Modification
Shi, Huafang; Barnes, Rebecca L.; Carriero, Nicholas; Atayde, Vanessa D.
2014-01-01
Parasitic protozoa of the flagellate order Kinetoplastida represent one of the deepest branches of the eukaryotic tree. Among this group of organisms, the mechanism of RNA interference (RNAi) has been investigated in Trypanosoma brucei and to a lesser degree in Leishmania (Viannia) spp. The pathway is triggered by long double-stranded RNA (dsRNA) and in T. brucei requires a set of five core genes, including a single Argonaute (AGO) protein, T. brucei AGO1 (TbAGO1). The five genes are conserved in Leishmania (Viannia) spp. but are absent in other major kinetoplastid species, such as Trypanosoma cruzi and Leishmania major. In T. brucei small interfering RNAs (siRNAs) are methylated at the 3′ end, whereas Leishmania (Viannia) sp. siRNAs are not. Here we report that T. brucei HEN1, an ortholog of the metazoan HEN1 2′-O-methyltransferases, is required for methylation of siRNAs. Loss of TbHEN1 causes a reduction in the length of siRNAs. The shorter siRNAs in hen1−/− parasites are single stranded and associated with TbAGO1, and a subset carry a nontemplated uridine at the 3′ end. These findings support a model wherein TbHEN1 methylates siRNA 3′ ends after they are loaded into TbAGO1 and this methylation protects siRNAs from uridylation and 3′ trimming. Moreover, expression of TbHEN1 in Leishmania (Viannia) panamensis did not result in siRNA 3′ end methylation, further emphasizing mechanistic differences in the trypanosome and Leishmania RNAi mechanisms. PMID:24186950
Thermo-sensitive nanoparticles for triggered release of siRNA.
Yang, Zheng; Cheng, Qiang; Jiang, Qian; Deng, Liandong; Liang, Zicai; Dong, Anjie
2015-01-01
Efficient delivery of small interfering RNA (siRNA) is crucially required for cancer gene therapy. Herein, a thermo-sensitive copolymer with a simple structure, poly (ethylene glycol) methyl ether acrylate-b-poly (N-isopropylacrylamide) (mPEG-b-PNIPAM) was developed. A novel kind of thermo-sensitive nanoparticles (DENPs) was constructed for the cold-shock triggered release of siRNA by double emulsion-solvent evaporation method using mPEG-b-PNIPAM and a cationic lipid, 3β [N-(N', N'-dimethylaminoethane)-carbamoyl] cholesterol [DC-Chol]. DENPs were observed by transmission electron microscopy and dynamical light scattering before and after 'cold shock' treatment. The encapsulation efficiency (EE) of siRNA in DENPs, which was measured by fluorescence spectrophotometer was 96.8% while it was significantly reduced to be 23.2% when DC-Chol was absent. DENPs/siRNA NPs exhibited a thermo-sensitive siRNA release character that the cumulatively released amount of siRNA from cold shock was approximately 2.2 folds higher after 7 days. In vitro luciferase silencing experiments indicated that DENPs showed potent gene silencing efficacy in HeLa-Luc cells (HeLa cells steadily expressed luciferase), which was further enhanced by a cold shock. Furthermore, MTT assay showed that cell viability with DENPs/siRNA up to 200 nM remained above 80%. We also observed that most of siRNA was accumulated in kidney mediated by DENPs instead of liver and spleen in vivo experiments. Thus, DENPs as a cold shock responsive quick release model for siRNA or hydrophilic macromolecules delivery provide a new way to nanocarrier design and clinic therapy.
Fujimoto, Hiroyuki; Kato, Koichi; Iwata, Hiroo
2010-05-01
Electroporation microarrays have been developed for the high-throughput transfection of expression constructs and small interfering RNAs (siRNAs) into living mammalian cells. These techniques have potential to provide a platform for the cell-based analysis of gene functions. One of the key issues associated with microarray technology is the efficiency of transfection. The capability of attaining reasonably high transfection efficiency is the basis for obtaining functional data without false negatives. In this study, we aimed at improving the transfection efficiency in the system that siRNA loaded on an electrode is electroporated into cells cultured directly on the electrode. The strategy we adopted here is to increase the surface density of siRNA loaded onto electrodes. For this purpose, the layer-by-layer assembly of siRNA and cationic polymers, branched or linear form of poly(ethyleneimine), was performed. The multilayer thus obtained was characterized by infrared reflection-adsorption spectroscopy and surface plasmon resonance analysis. Transfection efficiency was evaluated in a system that siRNA specific for enhanced green fluorescent protein (EGFP) was electroporated on the electrode into human embryonic kidney cells stably transformed with the EGFP gene. The suppression of EGFP expression was assessed by fluorescence microscopy and flow cytometry. Our data showed that the layer-by-layer assembly of siRNA with branched poly(ethyleneimine) facilitated to increase the surface density of loaded siRNA. As a result, the expression of EGFP gene in the electroporated cells was suppressed much more on the electrodes with the multilayer of siRNA than that with the monolayer.
Zhao, Dongyan; Song, Guo-qing
2014-12-01
Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili
2016-01-01
Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.
[siRNA-mediated tissue factor knockdown in porcine neonatal islet cell clusters in vitro].
Ji, Ming; Yi, Shounan; Yu, Deling; Wang, Wei
2011-12-01
To determine the genetic modification on neonatal porcine islet cell clusters (NICC) by small interfering RNA (siRNA)-mediated tissue factor (TF) knockdown in vitro. Porcine NICC were transfected with 5 pairs of designed siRNA respectively or in different combinations with lipofectamine 2000. Transfected NICC were analyzed for TF gene by real-time PCR to select the siRNA which worked best. Meanwhile, the viability of NICC after the TF siRNA transfection was examined by FACS. The efficiency of TF gene and protein suppression was measured by real-time PCR and and FACS respectively. Real-time PCR and FACS showed that a 60% reduction in the TF gene expression and a 50% reduction in the protien level of TF on NICC were achieved by transfecting 3 pairs of selected siRNA. The siRNA transfection had no significant effect on the viability of NICC which was analyzed by FACS. The expression of TF on porcine NICC is efficiently suppressed by 3 pairs of designed siRNA in vitro.
New insights into siRNA amplification and RNAi
Zhang, Chi; Ruvkun, Gary
2012-01-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672
Kinetic analysis of the effects of target structure on siRNA efficiency
NASA Astrophysics Data System (ADS)
Chen, Jiawen; Zhang, Wenbing
2012-12-01
RNAi efficiency for target cleavage and protein expression is related to the target structure. Considering the RNA-induced silencing complex (RISC) as a multiple turnover enzyme, we investigated the effect of target mRNA structure on siRNA efficiency with kinetic analysis. The 4-step model was used to study the target cleavage kinetic process: hybridization nucleation at an accessible target site, RISC-mRNA hybrid elongation along with mRNA target structure melting, target cleavage, and enzyme reactivation. At this model, the terms accounting for the target accessibility, stability, and the seed and the nucleation site effects are all included. The results are in good agreement with that of experiments which show different arguments about the structure effects on siRNA efficiency. It shows that the siRNA efficiency is influenced by the integrated factors of target's accessibility, stability, and the seed effects. To study the off-target effects, a simple model of one siRNA binding to two mRNA targets was designed. By using this model, the possibility for diminishing the off-target effects by the concentration of siRNA was discussed.
Technologies for Controlled, Local Delivery of siRNA
Sarett, Samantha M.; Nelson, Christopher E.; Duvall, Craig L.
2015-01-01
The discovery of RNAi in the late 1990s unlocked a new realm of therapeutic possibilities by enabling potent and specific silencing of theoretically any desired genetic target. Better elucidation of the mechanism of action, the impact of chemical modifications that stabilize and reduce nonspecific effects of siRNA molecules, and the key design considerations for effective delivery systems has spurred progress toward developing clinically-successful siRNA therapies. A logical aim for initial siRNA translation is local therapies, as delivering siRNA directly to its site of action helps to ensure that a sufficient dose reaches the target tissue, lessens the potential for off-target side effects, and circumvents the substantial systemic delivery barriers. While topical siRNA delivery has progressed into numerous clinical trials, an enormous opportunity also exists to develop sustained-release, local delivery systems that enable both spatial and temporal control of gene silencing. This review focuses on material platforms that establish both localized and controlled gene silencing, with emphasis on the systems that show most promise for clinical translation. PMID:26476177
Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA
NASA Astrophysics Data System (ADS)
Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue
2018-02-01
The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.
Pardo, Marta; Cheng, Yuyan; Velmeshev, Dmitry; Magistri, Marco; Martinez, Ana; Faghihi, Mohammad A.; Jope, Richard S.; Beurel, Eleonore
2017-01-01
Molecular mechanisms underlying learning and memory remain imprecisely understood, and restorative interventions are lacking. We report that intranasal administration of siRNAs can be used to identify targets important in cognitive processes and to improve genetically impaired learning and memory. In mice modeling the intellectual deficiency of Fragile X syndrome, intranasally administered siRNA targeting glycogen synthase kinase-3β (GSK3β), histone deacetylase-1 (HDAC1), HDAC2, or HDAC3 diminished cognitive impairments. In WT mice, intranasally administered brain-derived neurotrophic factor (BDNF) siRNA or HDAC4 siRNA impaired learning and memory, which was partially due to reduced insulin-like growth factor-2 (IGF2) levels because the BDNF siRNA– or HDAC4 siRNA–induced cognitive impairments were ameliorated by intranasal IGF2 administration. In Fmr1–/– mice, hippocampal IGF2 was deficient, and learning and memory impairments were ameliorated by IGF2 intranasal administration. Therefore intranasal siRNA administration is an effective means to identify mechanisms regulating cognition and to modulate therapeutic targets. PMID:28352664
Wada, Shun-Ichi; Takesada, Anna; Nagamura, Yurie; Sogabe, Eri; Ohki, Rieko; Hayashi, Junsuke; Urata, Hidehito
2017-12-15
The conjugation of Aib-containing amphipathic helical peptide with cyclo(-Arg-Gly-Asp-d-Phe-Cys-) (cRGDfC) at the C-terminus of the helix peptide (PI) has been reported to be useful for constructing a carrier for targeted siRNA delivery into cells. In order to explore structure-activity relationships for the development of potential carriers for siRNA delivery, we synthesized conjugates of Aib-containing amphipathic helical peptide with cRGDfC at the N-terminus (PII) and both the N- and C-termini (PIII) of the helical peptide. Furthermore, to examine the influence of PI helical chain length on siRNA delivery, truncated peptides containing 16 (PIV), 12 (PV), and 8 (PVI) amino acid residues at the N-terminus of the helical chain were synthesized. PII and PIII, as well as PI, could deliver anti-luciferase siRNA into cells to induce the knockdown of luciferase stably expressed in cells. In contrast, all of the truncated peptides were unlikely to transport siRNA into cells. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mapping the Universe: Slices and Bubbles.
ERIC Educational Resources Information Center
Geller, Margaret J.
1990-01-01
Map making is described in the context of extraterrestrial areas. An analogy to terrestrial map making is used to provide some background. The status of projects designed to map extraterrestrial areas are discussed including problems unique to this science. (CW)
Yang, Xuefeng; Mei, Shuang; Wang, Xiaolei; Li, Xiang; Liu, Rui; Ma, Yan; Hao, Liping; Yao, Ping; Liu, Liegang; Sun, Xiufa; Gu, Haihua; Liu, Zhenqi; Cao, Wenhong
2013-03-29
In this study, we addressed the direct effect of leucine on insulin signaling. In investigating the associated mechanisms, we found that leucine itself does not activate the classical Akt- or ERK1/2 MAP kinase-dependent signaling pathways but can facilitate the insulin-induced phosphorylations of Akt(473) and ERK1/2 in a time- and dose-dependent manner in cultured hepatocytes. The leucine-facilitated insulin-induced phosphorylation of Akt at residue 473 was not affected by knocking down the key component of mTORC1 or -2 complexes but was blocked by inhibition of c-Src (PP2), PI3K (LY294002), Gαi protein (pertussis toxin or siRNA against Gαi1 gene, or β-arrestin 2 (siRNA)). Similarly, the leucine-facilitated insulin activation of ERK1/2 was also blunted by pertussis toxin. We further show that leucine facilitated the insulin-mediated suppression of glucose production and expression of key gluconeogenic genes in a Gαi1 protein-dependent manner in cultured primary hepatocytes. Together, these results show that leucine can directly facilitate insulin signaling through a Gαi protein-dependent intracellular signaling pathway. This is the first evidence showing that macronutrients like amino acid leucine can facilitate insulin signaling through G proteins directly.
Yang, Xuefeng; Mei, Shuang; Wang, Xiaolei; Li, Xiang; Liu, Rui; Ma, Yan; Hao, Liping; Yao, Ping; Liu, Liegang; Sun, Xiufa; Gu, Haihua; Liu, Zhenqi; Cao, Wenhong
2013-01-01
In this study, we addressed the direct effect of leucine on insulin signaling. In investigating the associated mechanisms, we found that leucine itself does not activate the classical Akt- or ERK1/2 MAP kinase-dependent signaling pathways but can facilitate the insulin-induced phosphorylations of Akt473 and ERK1/2 in a time- and dose-dependent manner in cultured hepatocytes. The leucine-facilitated insulin-induced phosphorylation of Akt at residue 473 was not affected by knocking down the key component of mTORC1 or -2 complexes but was blocked by inhibition of c-Src (PP2), PI3K (LY294002), Gαi protein (pertussis toxin or siRNA against Gαi1 gene, or β-arrestin 2 (siRNA)). Similarly, the leucine-facilitated insulin activation of ERK1/2 was also blunted by pertussis toxin. We further show that leucine facilitated the insulin-mediated suppression of glucose production and expression of key gluconeogenic genes in a Gαi1 protein-dependent manner in cultured primary hepatocytes. Together, these results show that leucine can directly facilitate insulin signaling through a Gαi protein-dependent intracellular signaling pathway. This is the first evidence showing that macronutrients like amino acid leucine can facilitate insulin signaling through G proteins directly. PMID:23404499
Marshall, Brendan; Mo, Juan; Covar, Jason; Atherton, Sally S; Zhang, Ming
2014-06-06
Retinitis induced by both human and murine cytomegaloviruses following immunosuppression is characterized by progressive loss of retinal architecture, due to necrosis of virus-infected cells as well as widespread apoptosis of uninfected bystander cells. Because small inhibitory RNA molecules (siRNA) can reduce murine cytomegalovirus (MCMV) gene expression and thereby inhibit virus replication in vitro, we tested siRNAs directed against MCMV immediate early protein-3 (IE-3) to determine if MCMV-induced retinitis could be alleviated in vivo. Immunosuppressed Balb/c mice (2.0 mg methylprednisolone acetate every 3 days beginning on day -2) were infected with 5 × 10(3) pfu of the K181 strain of MCMV via the supraciliary route. At day 2 post infection, mice were treated with various doses of IE-3-specific siRNA ranging from 0.1 nmol to 10 nmol, in a volume of 20 μL PBS via tail vein injection. Injected eyes were collected at various times post inoculation and subjected to plaque assay for virus titer, MCMV antigen staining, H&E staining, TUNEL assay, and Western blot for MCMV IE-3 protein. Small but significant amounts of fluorescently labeled IE-3-specific siRNA localized to the RPE layer 48 hours after intravenous injection. IE-3-specific siRNA significantly reduced virus titers at all concentrations tested (ranging from 0.1 nmol to 10 nmol), but the most potent effect of siRNA was observed at a dose of 1 nmol. We also observed that IE-3-specific siRNA produced a substantial decrease in MCMV titers and a substantial reduction in bystander cell apoptosis over the time course of virus infection. Systemic administration of IE-3-specific siRNA could alleviate MCMV retinitis by inhibiting virus replication and subsequent death of uninfected retinal cells. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
Marshall, Brendan; Mo, Juan; Covar, Jason; Atherton, Sally S.; Zhang, Ming
2014-01-01
Purpose. Retinitis induced by both human and murine cytomegaloviruses following immunosuppression is characterized by progressive loss of retinal architecture, due to necrosis of virus-infected cells as well as widespread apoptosis of uninfected bystander cells. Because small inhibitory RNA molecules (siRNA) can reduce murine cytomegalovirus (MCMV) gene expression and thereby inhibit virus replication in vitro, we tested siRNAs directed against MCMV immediate early protein-3 (IE-3) to determine if MCMV-induced retinitis could be alleviated in vivo. Methods. Immunosuppressed Balb/c mice (2.0 mg methylprednisolone acetate every 3 days beginning on day −2) were infected with 5 × 103 pfu of the K181 strain of MCMV via the supraciliary route. At day 2 post infection, mice were treated with various doses of IE-3–specific siRNA ranging from 0.1 nmol to 10 nmol, in a volume of 20 μL PBS via tail vein injection. Injected eyes were collected at various times post inoculation and subjected to plaque assay for virus titer, MCMV antigen staining, H&E staining, TUNEL assay, and Western blot for MCMV IE-3 protein. Results. Small but significant amounts of fluorescently labeled IE-3–specific siRNA localized to the RPE layer 48 hours after intravenous injection. IE-3–specific siRNA significantly reduced virus titers at all concentrations tested (ranging from 0.1 nmol to 10 nmol), but the most potent effect of siRNA was observed at a dose of 1 nmol. We also observed that IE-3–specific siRNA produced a substantial decrease in MCMV titers and a substantial reduction in bystander cell apoptosis over the time course of virus infection. Conclusions. Systemic administration of IE-3–specific siRNA could alleviate MCMV retinitis by inhibiting virus replication and subsequent death of uninfected retinal cells. PMID:24906861
Boyer, Cyrille; Teo, Joann; Phillips, Phoebe; Erlich, Rafael B; Sagnella, Sharon; Sharbeen, George; Dwarte, Tanya; Duong, Hien T T; Goldstein, David; Davis, Thomas P; Kavallaris, Maria; McCarroll, Joshua
2013-06-03
Cancer is one of the most common causes of death worldwide. Two types of cancer that have high mortality rates are pancreatic and lung cancer. Despite improvements in treatment strategies, resistance to chemotherapy and the presence of metastases are common. Therefore, novel therapies which target and silence genes involved in regulating these processes are required. Short-interfering RNA (siRNA) holds great promise as a therapeutic to silence disease-causing genes. However, siRNA requires a delivery vehicle to enter the cell to allow it to silence its target gene. Herein, we report on the design and synthesis of cationic star polymers as novel delivery vehicles for siRNA to silence genes in pancreatic and lung cancer cells. Dimethylaminoethyl methacrylate (DMAEMA) was polymerized via reversible addition-fragmentation transfer polymerization (RAFT) and then chain extended in the presence of both cross-linkers N,N-bis(acryloyl)cistamine and DMAEMA, yielding biodegradable well-defined star polymers. The star polymers were characterized by transmission electron microscopy, dynamic light scattering, ζ potential, and gel permeation chromatography. Importantly, the star polymers were able to self-assemble with siRNA and form small uniform nanoparticle complexes. Moreover, the ratios of star polymer required to complex siRNA were nontoxic in both pancreatic and lung cancer cells. Treatment with star polymer-siRNA complexes resulted in uptake of siRNA into both cell lines and a significant decrease in target gene mRNA and protein levels. In addition, delivery of clinically relevant amounts of siRNA complexed to the star polymer were able to silence target gene expression by 50% in an in vivo tumor setting. Collectively, these results provide the first evidence of well-defined small cationic star polymers to deliver active siRNA to both pancreatic and lung cancer cells and may be a valuable tool to inhibit key genes involved in promoting chemotherapy drug resistance and metastases.
Mysara, Mohamed; Elhefnawi, Mahmoud; Garibaldi, Jonathan M
2012-06-01
The investigation of small interfering RNA (siRNA) and its posttranscriptional gene-regulation has become an extremely important research topic, both for fundamental reasons and for potential longer-term therapeutic benefits. Several factors affect the functionality of siRNA including positional preferences, target accessibility and other thermodynamic features. State of the art tools aim to optimize the selection of target siRNAs by identifying those that may have high experimental inhibition. Such tools implement artificial neural network models as Biopredsi and ThermoComposition21, and linear regression models as DSIR, i-Score and Scales, among others. However, all these models have limitations in performance. In this work, a neural-network trained new siRNA scoring/efficacy prediction model was developed based on combining two existing scoring algorithms (ThermoComposition21 and i-Score), together with the whole stacking energy (ΔG), in a multi-layer artificial neural network. These three parameters were chosen after a comparative combinatorial study between five well known tools. Our developed model, 'MysiRNA' was trained on 2431 siRNA records and tested using three further datasets. MysiRNA was compared with 11 alternative existing scoring tools in an evaluation study to assess the predicted and experimental siRNA efficiency where it achieved the highest performance both in terms of correlation coefficient (R(2)=0.600) and receiver operating characteristics analysis (AUC=0.808), improving the prediction accuracy by up to 18% with respect to sensitivity and specificity of the best available tools. MysiRNA is a novel, freely accessible model capable of predicting siRNA inhibition efficiency with improved specificity and sensitivity. This multiclassifier approach could help improve the performance of prediction in several bioinformatics areas. MysiRNA model, part of MysiRNA-Designer package [1], is expected to play a key role in siRNA selection and evaluation. Copyright © 2012 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide
Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less
Zhou, Li; Chen, Zhifei; Wang, Feifei; Yang, Xiuqun; Zhang, Biliang
2013-04-01
A non-viral siRNA carrier composed of mono-methoxy-poly (3-hydroxybutyrate-co-4-hydroxybutyrate)-block-polyethylene glycol-block-linear polyethyleneimine (mP3/4HB-b-PEG-b-lPEI) was synthesized using 1800 Da linear polyethyleneimine and evaluated for siRNA delivery. Our study demonstrated that siRNA could be efficiently combined with mP3/4HB-b-PEG-b-lPEI (mAG) co-polymer and was protected from nuclease degradation. The combined siRNA were released from the complexes easily under heparin competition. The particle size of the mAG/siRNA complexes was 158 nm, with a ζ-potential of around 28 mV. Atomic force microscopy images displayed spherical and homogeneously distributed complexes. The mAG block co-polymer displayed low cytotoxicity and efficient cellular uptake of Cy3-siRNA in A549 cells by flow cytometry and confocal microscopy. In vitro transfection efficiency of the block co-polymer was assessed using siRNA against luciferase in cultured A549-Luc, HeLa-Luc, HLF-Luc, A375-Luc and MCF-7-Luc cells. A higher transfection efficiency and lower cytotoxicity was obtained by mAG block co-polymer in five cell lines. Furthermore, a remarkable improvement in luciferase gene silencing efficiency of the mAG complex (up to 90-95%) over that of Lipofectamine™ 2000 (70-82%) was observed in HLF-Luc and A375-Luc cells. Additionally, a mAG/p65-siRNA complex also showed a better capability than Lipofectamine™ 2000/p65-siRNA complex to drastically reduce the p65 mRNA level down to 10-16% in HeLa, U251 and HUVEC cells at an N/P ratio of 70. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Systemic siRNA Nanoparticle-Based Drugs Combined with Radiofrequency Ablation for Cancer Therapy
Ahmed, Muneeb; Kumar, Gaurav; Navarro, Gemma; Wang, Yuanguo; Gourevitch, Svetlana; Moussa, Marwan H.; Rozenblum, Nir; Levchenko, Tatyana; Galun, Eithan; Torchilin, Vladimir P.; Goldberg, S. Nahum
2015-01-01
Purpose Radiofrequency thermal ablation (RFA) of hepatic and renal tumors can be accompanied by non-desired tumorigenesis in residual, untreated tumor. Here, we studied the use of micelle-encapsulated siRNA to suppress IL-6-mediated local and systemic secondary effects of RFA. Methods We compared standardized hepatic or renal RFA (laparotomy, 1 cm active tip at 70±2°C for 5 min) and sham procedures without and with administration of 150nm micelle-like nanoparticle (MNP) anti-IL6 siRNA (DOPE-PEI conjugates, single IP dose 15 min post-RFA, C57Bl mouse:3.5 ug/100ml, Fisher 344 rat: 20ug/200ul), RFA/scrambled siRNA, and RFA/empty MNPs. Outcome measures included: local periablational cellular infiltration (α-SMA+ stellate cells), regional hepatocyte proliferation, serum/tissue IL-6 and VEGF levels at 6-72hr, and distant tumor growth, tumor proliferation (Ki-67) and microvascular density (MVD, CD34) in subcutaneous R3230 and MATBIII breast adenocarcinoma models at 7 days. Results For liver RFA, adjuvant MNP anti-IL6 siRNA reduced RFA-induced increases in tissue IL-6 levels, α-SMA+ stellate cell infiltration, and regional hepatocyte proliferation to baseline (p<0.04, all comparisons). Moreover, adjuvant MNP anti-IL6- siRNA suppressed increased distant tumor growth and Ki-67 observed in R3230 and MATBIII tumors post hepatic RFA (p<0.01). Anti-IL6 siRNA also reduced RFA-induced elevation in VEGF and tumor MVD (p<0.01). Likewise, renal RFA-induced increases in serum IL-6 levels and distant R3230 tumor growth was suppressed with anti-IL6 siRNA (p<0.01). Conclusions Adjuvant nanoparticle-encapsulated siRNA against IL-6 can be used to modulate local and regional effects of hepatic RFA to block potential unwanted pro-oncogenic effects of hepatic or renal RFA on distant tumor. PMID:26154425
Li, Na; Luo, Heng-Cong; Yang, Chuan; Deng, Jun-Jie; Ren, Meng; Xie, Xiao-Ying; Lin, Diao-Zhu; Yan, Li; Zhang, Li-Ming
2014-01-01
Excessive expression of matrix metalloproteinase-9 (MMP-9) is deleterious to the cutaneous wound-healing process in the context of diabetes. The aim of the present study was to explore whether a cationic star-shaped polymer consisting of β-cyclodextrin (β-CD) core and poly(amidoamine) dendron arms (β-CD-[D₃]₇) could be used as the gene carrier of small interfering RNA (siRNA) to reduce MMP-9 expression for enhanced diabetic wound healing. The cytotoxicity of β-CD-(D₃)₇ was investigated by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (MMT) method in the rat CRL1213 skin fibroblast cell line. The transfection efficiency of β-CD-(D₃)₇/MMP-9-small interfering RNA (siRNA) complexes was determined by confocal microscopy and flow cytometry. Quantitative real time (RT) polymerase chain reaction was performed to measure the gene expression of MMP-9 after the transfection by β-CD-(D₃)₇/MMP-9-siRNA complexes. The β-CD-(D₃)₇/MMP-9-siRNA complexes were injected on the wounds of streptozocin-induced diabetic rats. Wound closure was measured on days 4 and 7 post-wounding. β-CD-(D₃)₇ exhibited low cytotoxicity in fibroblast cells, and easily formed the complexes with MMP-9-siRNA. The β-CD-(D₃)₇/MMP-9-siRNA complexes were readily taken up by fibroblast cells, resulting in the downregulation of MMP-9 gene expression (P<0.01). Animal experiments revealed that the treatment by β-CD-(D₃)₇/MMP-9-siRNA complexes enhanced wound closure in diabetic rats on day 7 post-wounding (P<0.05). β-CD-(D₃)₇ may be used as an efficient carrier for the delivery of MMP-9-siRNA to reduce MMP-9 expression in skin fibroblast cells and promote wound healing in diabetic rats.
The goal of this project is to use siRNA screens to identify NSCLC-selective siRNAs from two genome-wide libraries that will allow us to functionally define genetic dependencies of subtypes of NSCLC. Using bioinformatics tools, the CTD2 center at the University of Texas Southwestern Medical Center are discovering associations between this functional data (siRNAs) and NSCLC mutational status, methylation arrays, gene expression arrays, and copy number variation data that will help us identify new targets and enrollment biomarkers.
The goal of this project is to use siRNA screens to identify NSCLC-selective siRNAs from two genome-wide libraries that will allow us to functionally define genetic dependencies of subtypes of NSCLC. Using bioinformatics tools, the CTD2 center at the University of Texas Southwestern Medical Center are discovering associations between this functional data (siRNAs) and NSCLC mutational status, methylation arrays, gene expression arrays, and copy number variation data that will help us identify new targets and enrollment biomarkers.
Small interfering RNA targeting nuclear factor kappa B to prevent vein graft stenosis in rat models.
Meng, X B; Bi, X L; Zhao, H L; Feng, J B; Zhang, J P; Song, G M; Sun, W Y; Bi, Y W
2013-01-01
Intimal hyperplasia plays an important role in vein graft stenosis. Inflammatory injury, especially nuclear factor kappaB (NF-κB) gene activation, is highly involved in stenosis progression. We examined whether neointimal hyperplasia and vein graft stenosis could be inhibited by silencing the NF-κB gene with small interference RNA (siRNA). Sixty adult male Sprague-Dawley rats were randomly divided into a normal vein group, a vein graft group, a scrambled siRNA group, and an NF-κB siRNA group. We performed reverse interpositional grafting of the autologous external jugular vein to the abdominal aorta. Vein grafts were treated with liposome and gel complexes containing NF-κB siRNA or scrambled siRNA. The levels of monocyte chemoattractant protein -1, tumor necrosis factor-α, and NF-κB p65 in vessel tissues were evaluated after surgery for content of proliferating cell nuclear antigen (PCNA) and vascular wall thickness. NF-κB siRNA treated vein graft showed less neointimal formation and fewer positive PCNA cells (P < .05). In addition there were lower levels of, NF-κB p65 protein and of inflammatory mediators (P < .05) compared with the vein graft group. Our study suggested that siRNA transfection suppressed NF-κB expression, reduced inflammatory factors, lessened neointimal proliferation, and suppressed PCNA. Copyright © 2013 Elsevier Inc. All rights reserved.
Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.
Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio
2016-09-01
We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.
Short-interfering RNAs Induce Retinal Degeneration via TLR3 and IRF3
Kleinman, Mark E; Kaneko, Hiroki; Cho, Won Gil; Dridi, Sami; Fowler, Benjamin J; Blandford, Alexander D; Albuquerque, Romulo JC; Hirano, Yoshio; Terasaki, Hiroko; Kondo, Mineo; Fujita, Takashi; Ambati, Balamurali K; Tarallo, Valeria; Gelfand, Bradley D; Bogdanovich, Sasha; Baffi, Judit Z; Ambati, Jayakrishna
2012-01-01
The discovery of sequence-specific gene silencing by endogenous double-stranded RNAs (dsRNA) has propelled synthetic short-interfering RNAs (siRNAs) to the forefront of targeted pharmaceutical engineering. The first clinical trials utilized 21-nucleotide (nt) siRNAs for the treatment of neovascular age-related macular degeneration (AMD). Surprisingly, these compounds were not formulated for cell permeation, which is required for bona fide RNA interference (RNAi). We showed that these “naked” siRNAs suppress neovascularization in mice not via RNAi but via sequence-independent activation of cell surface Toll-like receptor-3 (TLR3). Here, we demonstrate that noninternalized siRNAs induce retinal degeneration in mice by activating surface TLR3 on retinal pigmented epithelial cells. Cholesterol conjugated siRNAs capable of cell permeation and triggering RNAi also induce the same phenotype. Retinal degeneration was not observed after treatment with siRNAs shorter than 21-nts. Other cytosolic dsRNA sensors are not critical to this response. TLR3 activation triggers caspase-3-mediated apoptotic death of the retinal pigment epithelium (RPE) via nuclear translocation of interferon regulatory factor-3. While this unexpected adverse effect of siRNAs has implications for future clinical trials, these findings also introduce a new preclinical model of geographic atrophy (GA), a late stage of dry AMD that causes blindness in millions worldwide. PMID:21988875
Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses
USDA-ARS?s Scientific Manuscript database
Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...
Zhang, Zijun; Xing, Yi
2017-09-19
Crosslinking or RNA immunoprecipitation followed by sequencing (CLIP-seq or RIP-seq) allows transcriptome-wide discovery of RNA regulatory sites. As CLIP-seq/RIP-seq reads are short, existing computational tools focus on uniquely mapped reads, while reads mapped to multiple loci are discarded. We present CLAM (CLIP-seq Analysis of Multi-mapped reads). CLAM uses an expectation-maximization algorithm to assign multi-mapped reads and calls peaks combining uniquely and multi-mapped reads. To demonstrate the utility of CLAM, we applied it to a wide range of public CLIP-seq/RIP-seq datasets involving numerous splicing factors, microRNAs and m6A RNA methylation. CLAM recovered a large number of novel RNA regulatory sites inaccessible by uniquely mapped reads. The functional significance of these sites was demonstrated by consensus motif patterns and association with alternative splicing (splicing factors), transcript abundance (AGO2) and mRNA half-life (m6A). CLAM provides a useful tool to discover novel protein-RNA interactions and RNA modification sites from CLIP-seq and RIP-seq data, and reveals the significant contribution of repetitive elements to the RNA regulatory landscape of the human transcriptome. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Li, Angsheng; Yin, Xianchen; Pan, Yicheng
2016-01-01
In this study, we propose a method for constructing cell sample networks from gene expression profiles, and a structural entropy minimisation principle for detecting natural structure of networks and for identifying cancer cell subtypes. Our method establishes a three-dimensional gene map of cancer cell types and subtypes. The identified subtypes are defined by a unique gene expression pattern, and a three-dimensional gene map is established by defining the unique gene expression pattern for each identified subtype for cancers, including acute leukaemia, lymphoma, multi-tissue, lung cancer and healthy tissue. Our three-dimensional gene map demonstrates that a true tumour type may be divided into subtypes, each defined by a unique gene expression pattern. Clinical data analyses demonstrate that most cell samples of an identified subtype share similar survival times, survival indicators and International Prognostic Index (IPI) scores and indicate that distinct subtypes identified by our algorithms exhibit different overall survival times, survival ratios and IPI scores. Our three-dimensional gene map establishes a high-definition, one-to-one map between the biologically and medically meaningful tumour subtypes and the gene expression patterns, and identifies remarkable cells that form singleton submodules. PMID:26842724
Bielski, Elizabeth; Zhong, Qian; Mirza, Hamad; Brown, Matthew; Molla, Ashura; Carvajal, Teresa; da Rocha, Sandro R P
2017-07-15
The regulation of genes utilizing the RNA interference (RNAi) mechanism via the delivery of synthetic siRNA has great potential in the treatment of a variety of lung diseases. However, the delivery of siRNA to the lungs is challenging due to the poor bioavailability of siRNA when delivered intraveneously, and difficulty in formulating and maintaining the activity of free siRNA when delivered directly to the lungs using inhalation devices. The use of non-viral vectors such as cationic dendrimers can help enhance the stability of siRNA and its delivery to the cell cytosol. Therefore, in this work, we investigate the ability of a triphenylphosphonium (TPP) modified generation 4 poly(amidoamine) (PAMAM) dendrimer (G4NH 2 -TPP) to enhance the in vitro transfection efficiency of siRNA in a model of the pulmonary epithelium and their aerosol formulations in pressurized metered dose inhalers (pMDIs) and dry powder inhalers (DPIs). Complexes of siRNA and G4NH 2 -TPP were prepared with varying TPP densities and increasing N/P ratios. The complexation efficiency was modulated by the presence of the TPP on the dendrimer surface, allowing for a looser complexation compared to unmodified dendrimer as determined by gel electrophoresis and polyanion competition assay. An increase in TPP density and N/P ratio led to an increase in the in vitro gene knockdown of stably green fluorescent protein (eGFP) expressing lung alveolar epithelial (A549) cells. G4NH 2 -12TPP dendriplexes (G4NH 2 PAMAM dendrimers containing 12 TPP molecules on the surface complexed with siRNA) at N/P ratio 30 showed the highest in vitro gene knockdown efficiency. To assess the potential of TPP-dendriplexes for pulmonary use, we also developed micron particle technologies for both pMDIs and DPIs and determined their aerosol characteristics utilizing an Andersen Cascade Impactor (ACI). Mannitol microparticles encapsulating 12TPP-dendriplexes were shown to be effective in producing aerosols suitable for deep lung deposition for both pMDI formulations (fine particle fraction of 50-53%) and DPI formulations (fine particle fraction of 39%) with no impact on the in vitro gene knockdown efficiency of the siRNA. This work demonstrates the potential benefits of utilizing TPP-conjugated dendrimers in the formation of dendriplexes for siRNA delivery to the pulmonary epithelium and their aerosol formulation for local delivery to the lungs using portable inhalers. Copyright © 2017 Elsevier B.V. All rights reserved.
Riley, Rachel S; Dang, Megan N; Billingsley, Margaret M; Abraham, Baxter; Gundlach, Lars; Day, Emily S
2018-06-13
The ability to regulate intracellular gene expression with exogenous nucleic acids such as small interfering RNAs (siRNAs) has substantial potential to improve the study and treatment of disease. However, most transfection agents and nanoparticle-based carriers that are used for the intracellular delivery of nucleic acids cannot distinguish between diseased and healthy cells, which may cause them to yield unintended widespread gene regulation. An ideal delivery system would only silence targeted proteins in diseased tissue in response to an external stimulus. To enable spatiotemporal control over gene silencing, researchers have begun to develop nucleic acid-nanoparticle conjugates that keep their nucleic acid cargo inactive until it is released from the nanoparticle on-demand by externally applied near-infrared laser light. This strategy can overcome several limitations of other nucleic acid delivery systems, but the mechanisms by which these platforms operate remain ill understood. Here, we perform a detailed investigation of the mechanisms by which silica core/gold shell nanoshells (NSs) release conjugated siRNA upon excitation with either pulsed or continuous wave (CW) near-infrared (NIR) light, with the goal of providing insight into how these nanoconjugates can enable on-demand gene regulation. We demonstrate that siRNA release from NSs upon pulsed laser irradiation is a temperature-independent process that is substantially more efficient than siRNA release triggered by CW irradiation. Contrary to literature, which suggests that only pulsed irradiation releases siRNA duplexes, we found that both modes of irradiation release a mixture of siRNA duplexes and single-stranded oligonucleotides, but that pulsed irradiation results in a higher percentage of released duplexes. To demonstrate that the siRNA released from NSs upon pulsed irradiation remains functional, we evaluated the use of NSs coated with green fluorescent protein (GFP)-targeted siRNA (siGFP-NS) for on-demand knockdown of GFP in cells. We found that GFP-expressing cells treated with siGFP-NS and irradiated with a pulsed laser experienced a 33% decrease in GFP expression compared to cells treated with no laser. Further, we observed that light-triggered gene silencing mediated by siGFP-NS is more potent than using commercial transfection agents to deliver siRNA into cells. This work provides unprecedented insight into the mechanisms by which plasmonic NSs release siRNA upon light irradiation and demonstrates the importance of thoroughly characterizing photoresponsive nanosystems for applications in triggered gene regulation.
IRF5 regulates lung macrophages M2 polarization during severe acute pancreatitis in vitro
Sun, Kang; He, Song-Bing; Qu, Jian-Guo; Dang, Sheng-Chun; Chen, Ji-Xiang; Gong, Ai-Hua; Xie, Rong; Zhang, Jian-Xin
2016-01-01
AIM To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) in vitro. METHODS A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in the lung were observed by hematoxylin and eosin staining. Lung macrophages were isolated from bronchoalveolar lavage fluid. The quantity and purity of lung macrophages were detected by fluorescence-activated cell sorting and evaluated by real-time polymerase chain reaction (RT-PCR). They were treated with IL-4/IRF5 specific siRNA (IRF5 siRNA) to reverse their polarization and were evaluated by detecting markers expression of M1/M2 using RT-PCR. RESULTS SAP associated acute lung injury (ALI) was induced successfully by ip injections of caerulein, which was confirmed by histopathology. Lung macrophages expressed high levels of IRF5 as M1 phenotype during the early acute pancreatitis stages. Reduction of IRF5 expression by IRF5 siRNA reversed the action of macrophages from M1 to M2 phenotype in vitro. The expressions of M1 markers, including IRF5 (S + IRF5 siRNA vs S + PBS, 0.013 ± 0.01 vs 0.054 ± 0.047, P < 0.01), TNF-α (S + IRF5 siRNA vs S + PBS, 0.0003 ± 0.0002 vs 0.019 ± 0.018, P < 0.001), iNOS (S + IRF5 siRNA vs S + PBS, 0.0003 ± 0.0002 vs 0.026 ± 0.018, P < 0.001) and IL-12 (S + IRF5 siRNA vs S + PBS, 0.000005 ± 0.00004 vs 0.024 ± 0.016, P < 0.001), were decreased. In contrast, the expressions of M2 markers, including IL-10 (S + IRF5 siRNA vs S + PBS, 0.060 ± 0.055 vs 0.0230 ± 0.018, P < 0.01) and Arg-1 (S + IRF5 siRNA vs S + PBS, 0.910 ± 0.788 vs 0.0036 ± 0.0025, P < 0.001), were increased. IRF5 siRNA could reverse the lung macrophage polarization more effectively than IL-4. CONCLUSION Treatment with IRF5 siRNA can reverse the pancreatitis-induced activation of lung macrophages from M1 phenotype to M2 phenotype in SAP associated with ALI. PMID:27895424
Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki
2013-12-01
p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi
2015-12-09
Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.
Voltage Preconditioning Allows Modulated Gene Expression in Neurons Using PEI-complexed siRNA
Sridharan, Arati; Patel, Chetan; Muthuswamy, Jit
2013-01-01
We present here a high efficiency, high viability siRNA-delivery method using a voltage-controlled chemical transfection strategy to achieve modulated delivery of polyethylenimine (PEI) complexed with siRNA in an in vitro culture of neuro2A cells and neurons. Low voltage pulses were applied to adherent cells before the administration of PEI-siRNA complexes. Live assays of neuro2a cells transfected with fluorescently tagged siRNA showed an increase in transfection efficiency from 62 ± 14% to 98 ± 3.8% (after −1 V). In primary hippocampal neurons, transfection efficiencies were increased from 30 ± 18% to 76 ± 18% (after −1 V). Negligible or low-level transfection was observed after preconditioning at higher voltages, suggesting an inverse relationship with applied voltage. Experiments with propidium iodide ruled out the role of electroporation in the transfection of siRNAs suggesting an alternate electro-endocytotic mechanism. In addition, image analysis of preconditioned and transfected cells demonstrates siRNA uptake and loading that is tuned to preconditioning voltage levels. There is approximately a fourfold increase in siRNA loading after preconditioning at −1 V compared with the same at ±2–3 V. Modulated gene expression is demonstrated in a functional knockdown of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in neuro2A cells using siRNA. Cell density and dendritic morphological changes are also demonstrated in modulated knockdown of brain derived neurotrophic factor (BDNF) in primary hippocampal neurons. The method reported here has potential applications in the development of high-throughput screening systems for large libraries of siRNA molecules involving difficult-to-transfect cells like neurons. PMID:23531602
Voltage Preconditioning Allows Modulated Gene Expression in Neurons Using PEI-complexed siRNA.
Sridharan, Arati; Patel, Chetan; Muthuswamy, Jit
2013-03-26
We present here a high efficiency, high viability siRNA-delivery method using a voltage-controlled chemical transfection strategy to achieve modulated delivery of polyethylenimine (PEI) complexed with siRNA in an in vitro culture of neuro2A cells and neurons. Low voltage pulses were applied to adherent cells before the administration of PEI-siRNA complexes. Live assays of neuro2a cells transfected with fluorescently tagged siRNA showed an increase in transfection efficiency from 62 ± 14% to 98 ± 3.8% (after -1 V). In primary hippocampal neurons, transfection efficiencies were increased from 30 ± 18% to 76 ± 18% (after -1 V). Negligible or low-level transfection was observed after preconditioning at higher voltages, suggesting an inverse relationship with applied voltage. Experiments with propidium iodide ruled out the role of electroporation in the transfection of siRNAs suggesting an alternate electro-endocytotic mechanism. In addition, image analysis of preconditioned and transfected cells demonstrates siRNA uptake and loading that is tuned to preconditioning voltage levels. There is approximately a fourfold increase in siRNA loading after preconditioning at -1 V compared with the same at ±2-3 V. Modulated gene expression is demonstrated in a functional knockdown of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in neuro2A cells using siRNA. Cell density and dendritic morphological changes are also demonstrated in modulated knockdown of brain derived neurotrophic factor (BDNF) in primary hippocampal neurons. The method reported here has potential applications in the development of high-throughput screening systems for large libraries of siRNA molecules involving difficult-to-transfect cells like neurons.Molecular Therapy-Nucleic Acids (2013) 2, e82; doi:10.1038/mtna.2013.10; published online 26 March 2013.
Knockdown of antiapoptotic genes in breast cancer cells by siRNA loaded into hybrid nanoparticles
NASA Astrophysics Data System (ADS)
João de Mello, Leônidas, Jr.; Rosa Souza, Gabriela Regina; Winter, Evelyn; Silva, Adny Henrique; Pittella, Frederico; Creczynski-Pasa, Tânia Beatriz
2017-04-01
Tumorigenesis is related to an imbalance in controlling mechanisms of apoptosis. Expression of the genes BCL-2 and BCL-xL results in the promotion of cell survival by inhibiting apoptosis. Thus, a novel approach to suppress antiapoptotic genes is the use of small interfering RNA (siRNA) in cancer cells. However, there are some limitations for the application of siRNA such as the need for vectors to pass the cell membrane and deliver the nucleic acid. In this study CaP-siRNA-PEG-polyanion hybrid nanoparticles were developed to promote siRNA delivery to cultured human breast cancer cells (MCF-7) in order to evaluate whether the silencing of antiapoptotic genes BCL-2 and BCL-xL by siRNA would increase cancer cell death. After 48 h of incubation the expression of BCL-2 and BCL-xL genes decreased to 49% and 23%, respectively. The siRNA sequence used induced cancer cell death at a concentration of 200 nM siRNA after 72 h of incubation. As the targeted proteins are related to the resistance to chemotherapeutic drugs, the nanocarriers systems were also tested in the presence of doxorubicin (DOX). The results showed a significant reduction in the CC50 of the DOX, after silencing the antiapoptotic genes. In addition, an increase in apoptotic cell counts for both incubations conditions was observed as well. In conclusion, silencing antiapoptotic genes such as BCL-2 and BCL-xL through the use of siRNA carried by hybrid nanoparticles showed to be effective in vitro, and presents a promising strategy for pre-clinical analysis, especially when combined with DOX against breast cancer.
Dual-functionalized graphene oxide for enhanced siRNA delivery to breast cancer cells.
Imani, Rana; Shao, Wei; Taherkhani, Samira; Emami, Shahriar Hojjati; Prakash, Satya; Faghihi, Shahab
2016-11-01
The aim of this study is to improve hydrocolloid stability and siRNA transfection ability of a reduced graphene oxide (rGO) based nano-carrier using a phospholipid-based amphiphilic polymer (PL-PEG) and cell penetrating peptide (CPPs). The dual functionalized nano-carrier is comprehensively characterized for its chemical structure, size, surface charge and morphology as well as thermal stability. The nano-carrier cytocompatibility, siRNA condensation ability both in the presence and absence of enzyme, endosomal buffering capacity, cellular uptake and intracellular localization are also assessed. The siRNA loaded nano-carrier is used for internalization to MCF-7 cells and its gene silencing ability is compared with AllStars Hs Cell Death siRNA as a model gene. The nano-carrier remains stable in biological solution, exhibits excellent cytocompatibility, retards the siRNA migration and protects it against enzyme degradation. The buffering capacity analysis shows that incorporation of the peptide in nano-carrier structure would increase the resistance to endo/lysosomal like acidic condition (pH 6-4) The functionalized nano-carrier which is loaded with siRNA in an optimal N:P ratio presents superior internalization efficiency (82±5.1% compared to HiPerFect(®)), endosomal escape quality and capable of inducing cell death in MCF-7 cancer cells (51±3.1% compared to non-treated cells). The success of siRNA-based therapy is largely dependent on the safe and efficient delivery system, therefore; the dual functionalized rGO introduced here could have a great potential to be used as a carrier for siRNA delivery with relevancy in therapeutics and clinical applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Nanocarriers Assisted siRNA Gene Therapy for the Management of Cardiovascular Disorders.
Maheshwari, Rahul; Tekade, Muktika; Sharma, Piyoosh A; Tekade, Rakesh Kumar
2015-01-01
Cardiovascular diseases (CVDs), primarily myocardial infarction (MI), atherosclerosis, hypertension and congestive heart failure symbolize the foremost cause of death in almost all parts of the world. Besides the traditional therapeutic approaches for the management of CVDs, newer innovative strategies are also emerging on the horizon. Recently, gene silencing via small interfering RNA (siRNA) is one of the hot topics amongst various strategies involved in the management of CVDs. The siRNA mechanism involves natural catalytic processes to silence pathological genes that are overexpressed in a particular disease. Also the versatility of gene expression by siRNA deciphers a prospective tactic to down-regulate diseases associated gene, protein or receptor existing on a specific disease target. This article reviews the application of siRNA against CVDs with special emphasis on gene targets in combination with delivery systems such as cationic hydrogels, polyplexes, peptides, liposomes and dendrimers.
Autonomously folded α-helical lockers promote RNAi*
NASA Astrophysics Data System (ADS)
Guyader, Christian P. E.; Lamarre, Baptiste; de Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.
2016-10-01
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.
Autonomously folded α-helical lockers promote RNAi*
Guyader, Christian P. E.; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.
2016-01-01
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi. PMID:27721465
Autonomously folded α-helical lockers promote RNAi.
Guyader, Christian P E; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E; Slater, Nigel K; Ryadnov, Maxim G
2016-10-10
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.
Vickers, Timothy A; Crooke, Stanley T
2012-07-01
While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.
In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight
NASA Astrophysics Data System (ADS)
Dahlman, James E.; Barnes, Carmen; Khan, Omar F.; Thiriot, Aude; Jhunjunwala, Siddharth; Shaw, Taylor E.; Xing, Yiping; Sager, Hendrik B.; Sahay, Gaurav; Speciner, Lauren; Bader, Andrew; Bogorad, Roman L.; Yin, Hao; Racie, Tim; Dong, Yizhou; Jiang, Shan; Seedorf, Danielle; Dave, Apeksha; Singh Sandhu, Kamaljeet; Webber, Matthew J.; Novobrantseva, Tatiana; Ruda, Vera M.; Lytton-Jean, Abigail K. R.; Levins, Christopher G.; Kalish, Brian; Mudge, Dayna K.; Perez, Mario; Abezgauz, Ludmila; Dutta, Partha; Smith, Lynelle; Charisse, Klaus; Kieran, Mark W.; Fitzgerald, Kevin; Nahrendorf, Matthias; Danino, Dganit; Tuder, Rubin M.; von Andrian, Ulrich H.; Akinc, Akin; Panigrahy, Dipak; Schroeder, Avi; Koteliansky, Victor; Langer, Robert; Anderson, Daniel G.
2014-08-01
Dysfunctional endothelium contributes to more diseases than any other tissue in the body. Small interfering RNAs (siRNAs) can help in the study and treatment of endothelial cells in vivo by durably silencing multiple genes simultaneously, but efficient siRNA delivery has so far remained challenging. Here, we show that polymeric nanoparticles made of low-molecular-weight polyamines and lipids can deliver siRNA to endothelial cells with high efficiency, thereby facilitating the simultaneous silencing of multiple endothelial genes in vivo. Unlike lipid or lipid-like nanoparticles, this formulation does not significantly reduce gene expression in hepatocytes or immune cells even at the dosage necessary for endothelial gene silencing. These nanoparticles mediate the most durable non-liver silencing reported so far and facilitate the delivery of siRNAs that modify endothelial function in mouse models of vascular permeability, emphysema, primary tumour growth and metastasis.
Using concept maps in a modified team-based learning exercise.
Knollmann-Ritschel, Barbara E C; Durning, Steven J
2015-04-01
Medical school education has traditionally been driven by single discipline teaching and assessment. Newer medical school curricula often implement an organ-based approach that fosters integration of basic science and clinical disciplines. Concept maps are widely used in education. Through diagrammatic depiction of a variety of concepts and their specific connections with other ideas, concept maps provide a unique perspective into learning and performance that can complement other assessment methods commonly used in medical schools. In this innovation, we describe using concepts maps as a vehicle for a modified a classic Team-Based Learning (TBL) exercise. Modifications to traditional TBL in our innovation included replacing an individual assessment using multiple-choice questions with concept maps as well as combining the group assessment and application exercise whereby teams created concept maps. These modifications were made to further assess understanding of content across the Fundamentals module (the introductory module of the preclerkship curriculum). While preliminary, student performance and feedback from faculty and students support the use of concept maps in TBL. Our findings suggest concept maps can provide a unique means of determining assessment of learning and generating feedback to students. Concept maps can also demonstrate knowledge acquisition, organization of prior and new knowledge, and synthesis of that knowledge across disciplines in a unique way providing an additional means of assessment in addition to traditional multiple-choice questions. Reprint & Copyright © 2015 Association of Military Surgeons of the U.S.
NASA Astrophysics Data System (ADS)
Ying, Bo
Cancer is a major health problem in the United States and many other parts of the world. However, cancer treatment is severely limited by the lack of highly effective cytotoxic agents and selective delivery methods which can serve as the "magic bullet" (first raised by Dr. Paul Ehrlich, the goal of targeting a specific location without causing harm to surrounding tissues or to more distant regions in the body). The revolutionary finding that tumors cannot grow beyond a microscopic size without dedicated blood supply provided a highly effective alternative for the treatment of cancer. Currently, anti-angiogenic therapy and the discovery of RNA interference makes it possible to treat some conditions by silencing disorder-causing genes of targeting cells which are otherwise difficult to eradicate with more conventional therapies. However, before siRNA technology could be widely used as a therapeutic approach, the construct must be efficiently and safely delivered to target cells. Strategies used for siRNA delivery should minimize uptake by phagocytes, enzymatic degradation by nucleases and should be taken up preferentially, if not specifically, by the intended cell population. Kinesin spindle proteins (KSP) are the motor proteins which play critical roles during mitosis. Different from tubulins which are also present in post-mitotic cells, such as axons, KSP is exclusively expressed in mitotic cells, which makes them the ideal target for anti-mitotics. In the present study, we intend to develop, characterize and evaluate a liposome-based delivery system which can deliver KSP siRNA selectively to the tumor vasculature (thus inhibiting angiogenesis, destroying tumor vasculature and eventually, eradicating tumor growth). We first developed ten different liposome preparation types with different compositions of lipids. Next, the capacity for loading siRNA and efficiency of targeting the tumor vascular supply was evaluated using relevant cellular and tumor models. Pegylated cationic liposomes (PCLs) were selected as carriers for siRNA. Based on the silencing efficiency of siRNA formulated with different PCLs, DOPC based cationic liposomes, over DOPE based nanosystems, with a modest amount of polyetheleneglycol was selected to deliver KSP siRNA to tumor-bearing mice. Efficacy studies revealed that tumor suppression was observed when KSP siRNA was delivered using PCLs, but not in mice that received naked KSP siRNA or KSP siRNA in commercially available transfecting agents. The results were further supported by MRI (magnetic resonance imaging) analysis. To evaluate the role that vasculature supply plays in the development of the tumor, we also performed tumor response studies using a tumor model consisting of tumor cells which are resistant to KSP siRNA. The results showed that a prolonged suppression of tumor growth was achieved only when a large dose (5mg/kg) KSP siRNA was administered, but not with the administration of a relatively low dose (2mg/kg) of siRNA, suggesting that a combined treatment approach containing both anti-vasculature and anti-cancer agents should be considered to achieve the best treatment outcome. Finally, it was confirmed by qRT-PCR that the tumor growth inhibition was due to the successful knock-down of KSP mRNA.
A bioreducible linear poly(β-amino ester) for siRNA delivery
Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.
2014-01-01
Described here is the synthesis and characterization of a novel, bioreducible linear poly(β-amino ester) designed to condense siRNA into nanoparticles and efficiently release it upon entering the cytoplasm. Delivery of siRNA using this polymer achieved near-complete knockdown of a fluorescent marker gene in primary human glioblastoma cells with no cytotoxicity. PMID:23646347
Knocking down disease: a progress report on siRNA therapeutics
Wittrup, Anders; Lieberman, Judy
2016-01-01
Small interfering RNAs (siRNAs), which downregulate gene expression guided by sequence complementarity, can be used therapeutically to block the synthesis of disease-causing proteins. The main obstacle to siRNA drugs — their delivery into the target cell cytosol — has been overcome to allow suppression of liver gene expression. Here, we review the results of recent clinical trials of siRNA therapeutics, which show efficient and durable gene knockdown in the liver, with signs of promising clinical outcomes and little toxicity. We also discuss the barriers to more widespread applications that target tissues besides the liver and the most promising avenues to overcome them. PMID:26281785
Elkayam, Elad; Parmar, Rubina; Brown, Christopher R.; Willoughby, Jennifer L.; Theile, Christopher S.
2017-01-01
Abstract Efficient gene silencing by RNA interference (RNAi) in vivo requires the recognition and binding of the 5΄- phosphate of the guide strand of an siRNA by the Argonaute protein. However, for exogenous siRNAs it is limited by the rapid removal of the 5΄- phosphate of the guide strand by metabolic enzymes. Here, we have determined the crystal structure of human Argonaute-2 in complex with the metabolically stable 5΄-(E)-vinylphosphonate (5΄-E-VP) guide RNA at 2.5-Å resolution. The structure demonstrates how the 5΄ binding site in the Mid domain of human Argonaute-2 is able to adjust the key residues in the 5΄-nucleotide binding pocket to compensate for the change introduced by the modified nucleotide. This observation also explains improved binding affinity of the 5΄-E-VP -modified siRNA to human Argonaute-2 in-vitro, as well as the enhanced silencing in the context of the trivalent N-acetylgalactosamine (GalNAc)-conjugated siRNA in mice relative to the un-modified siRNA. PMID:27903888
Zhang, Haiyang; Wang, Yi; Bai, Ming; Wang, Junyi; Zhu, Kegan; Liu, Rui; Ge, Shaohua; Li, JiaLu; Ning, Tao; Deng, Ting; Fan, Qian; Li, Hongli; Sun, Wu; Ying, Guoguang; Ba, Yi
2018-03-01
Exosomes derived from cells have been found to mediate signal transduction between cells and to act as efficient carriers to deliver drugs and small RNA. Hepatocyte growth factor (HGF) is known to promote the growth of both cancer cells and vascular cells, and the HGF-cMET pathway is a potential clinical target. Here, we characterized the inhibitory effect of HGF siRNA on tumor growth and angiogenesis in gastric cancer. In addition, we showed that HGF siRNA packed in exosomes can be transported into cancer cells, where it dramatically downregulates HGF expression. A cell co-culture model was used to show that exosomes loaded with HGF siRNA suppress proliferation and migration of both cancer cells and vascular cells. Moreover, exosomes were able to transfer HGF siRNA in vivo, decreasing the growth rates of tumors and blood vessels. The results of our study demonstrate that exosomes have potential for use in targeted cancer therapy by delivering siRNA. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
A Role for Peptides in Overcoming Endosomal Entrapment in siRNA Delivery – A Focus on Melittin
Hou, Kirk K.; Pan, Hua; Schlesinger, Paul H.; Wickline, Samuel A.
2015-01-01
siRNA has the possibility to revolutionize medicine by enabling highly specific and efficient silencing of proteins involved in disease pathogenesis. Despite nearly 20 years of research dedicated to translating siRNA from a research tool into a clinically relevant therapeutic, minimal success has been had to date. Access to RNA interference machinery located in the cytoplasm is often overlooked, but must be considered when designing the next generation of siRNA delivery strategies. Peptide transduction domains (PTD) have demonstrated moderate siRNA transfection, which is primarily limited by endosomal entrapment. Strategies aimed at overcoming endosomal entrapment associated with peptide vectors are reviewed here, including osmotic methods, lipid conjugation, and fusogenic peptides. As an alternative to traditional PTD, the hemolytic peptide melittin exhibits the native capacity for endosomal disruption but causes cytotoxicity. However, appropriate packaging and protection of melittin with activation and release in the endosomal compartment has allowed melittin-based strategies to demonstrate both in vitro and in vivo safety and efficacy. These data suggest that melittin's membrane disruptive properties can enable safe and effective endosomolysis, building a case for melittin as a key component in a new generation of siRNA therapeutics. PMID:26025036
Targeted delivery of siRNA into breast cancer cells via phage fusion proteins.
Bedi, Deepa; Gillespie, James W; Petrenko, Vasily A; Ebner, Andreas; Leitner, Michael; Hinterdorfer, Peter; Petrenko, Valery A
2013-02-04
Nucleic acids, including antisense oligonucleotides, small interfering RNA (siRNA), aptamers, and rybozymes, emerged as versatile therapeutics due to their ability to interfere in a well-planned manner with the flow of genetic information from DNA to protein. However, a systemic use of NAs is hindered by their instability in physiological liquids and inability of intracellular accumulation in the site of action. We first evaluated the potential of cancer specific phage fusion proteins as targeting ligands that provide encapsulation, protection, and navigation of siRNA to the target cell. The tumor-specific proteins were isolated from phages that were affinity selected from a landscape phage library against target breast cancer cells. It was found that fusion phage coat protein fpVIII displaying cancer-targeting peptides can effectively encapsulate siRNAs and deliver them into the cells leading to specific silencing of the model gene GAPDH. Complexes of siRNA and phage protein form nanoparticles (nanophages), which were characterized by atomic force microscopy and ELISA, and their stability was demonstrated by resistance of encapsulated siRNA to degradation by serum nucleases. The phage protein/siRNA complexes can make a new type of highly selective, stable, active, and physiologically acceptable cancer nanomedicine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ness, Gene C., E-mail: gness@hsc.usf.edu; Edelman, Jeffrey L.; Brooks, Patricia A.
2012-03-30
Highlights: Black-Right-Pointing-Pointer siRNAs to tristetraprolin blocks transcription of HMGR in vivo in rat liver. Black-Right-Pointing-Pointer siRNAs to tristetraprolin inhibits insulin activation of HMGR transcription. Black-Right-Pointing-Pointer Insulin acts to rapidly increase tristetraprolin in liver nuclear extracts. -- Abstract: Several AU-rich RNA binding element (ARE) proteins were investigated for their possible effects on transcription of hepatic 3-hydroxy-3-methyglutaryl coenzyme A reductase (HMGR) in normal rats. Using in vivo electroporation, four different siRNAs to each ARE protein were introduced together with HMGR promoter (-325 to +20) luciferase construct and compared to saline controls. All four siRNAs to tristetraprolin (TTP) completely eliminated transcription from themore » HMGR promoter construct. Since insulin acts to rapidly increase hepatic HMGR transcription, the effect of TTP siRNA on induction by insulin was tested. The 3-fold stimulation by insulin was eliminated by this treatment. In comparison, siRNA to AU RNA binding protein/enoyl coenzyme A hydratase (AUH) had no effect. These findings indicate a role for TTP in the insulin-mediated activation of hepatic HMGR transcription.« less
Symmetries, chirp-free points, and bistability in dispersion-managed fiber lines.
Turitsyn, S K; Nijhof, J H; Mezentsev, V K; Doran, N J
1999-12-15
We show from an elementary symmetry analysis that, in dispersion-compensated systems for which a lossless model is valid, nonlinearity requires a chirp-free point at the center of symmetry (if such exists) of the map for any kind of unique periodic solution. We also present an example of a more-complex map when the periodic solution is not unique.
Concept Mapping: A Unique Means for Negotiating Meaning in Professional Studies
ERIC Educational Resources Information Center
Mackinnon, Gregory R.; Keppell, Mike
2005-01-01
Concept mapping (Novak & Gowin, 1984) has been used extensively as a graphic organiser in classroom teaching. This article addresses two particular approaches to using concept mapping that go beyond classroom planning into the realm of "idea-exchange" with concept mapping as mediator. The notion of "negotiative concept mapping" is examined in two…
Base modification strategies to modulate immune stimulation by an siRNA.
Valenzuela, Rachel Anne P; Suter, Scott R; Ball-Jones, Alexi A; Ibarra-Soza, José M; Zheng, Yuxuan; Beal, Peter A
2015-01-19
Immune stimulation triggered by siRNAs is one of the major challenges in the development of safe RNAi-based therapeutics. Within an immunostimulatory siRNA sequence, this hurdle is commonly addressed by using ribose modifications (e.g., 2'-OMe or 2'-F), which results in decreased cytokine production. However, as immune stimulation by siRNAs is a sequence-dependent phenomenon, recognition of the nucleobases by the trigger receptor(s) is also likely. Here, we use the recently published crystal structures of Toll-like receptor 8 (TLR8) bound to small-molecule agonists to generate computational models for ribonucleotide binding by this immune receptor. Our modeling suggested that modification of either the Watson-Crick or Hoogsteen face of adenosine would disrupt nucleotide/TLR8 interactions. We employed chemical synthesis to alter either the Watson-Crick or Hoogsteen face of adenosine and evaluated the effect of these modifications in an siRNA guide strand by measuring the immunostimulatory and RNA interference properties. For the siRNA guide strand tested, we found that modifying the Watson-Crick face is generally more effective at blocking TNFα production in human peripheral blood mononuclear cells (PBMCs) than modification at the Hoogsteen edge. We also observed that modifications near the 5'-end were more effective at blocking cytokine production than those placed at the 3'-end. This work advances our understanding of how chemical modifications can be used to optimize siRNA performance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Anti-EphA10 antibody-conjugated pH-sensitive liposomes for specific intracellular delivery of siRNA.
Zang, Xinlong; Ding, Huaiwei; Zhao, Xiufeng; Li, Xiaowei; Du, Zhouqi; Hu, Haiyang; Qiao, Mingxi; Chen, Dawei; Deng, Yuihui; Zhao, Xiuli
2016-01-01
Therapeutic delivery of small interfering RNA (siRNA) is a major challenge that limits its potential clinical application. Here, a pH-sensitive cholesterol-Schiff base-polyethylene glycol (Chol-SIB-PEG)-modified cationic liposome-siRNA complex, conjugated with the recombinant humanized anti-EphA10 antibody (Eph), was developed as an efficient nonviral siRNA delivery system. Chol-SIB-PEG was successfully synthesized and confirmed with FTIR and (1)H-NMR. An Eph-PEG-SIB-Chol-modified liposome-siRNA complex (EPSLR) was prepared and characterized by size, zeta potential, gel retardation, and encapsulation efficiency. Electrophoresis results showed that EPSLR was resistant to heparin replacement and protected siRNA from fetal bovine serum digestion. EPSLR exhibited only minor cytotoxicity in MCF-7/ADR cells. The results of flow cytometry and confocal laser scanning microscopy suggested that EPSLR enhanced siRNA transfection in MCF-7/ADR cells. Intracellular distribution experiment revealed that EPSLR could escape from the endo-lysosomal organelle and release siRNA into cytoplasm at 4 hours posttransfection. Western blot experiment demonstrated that EPSLR was able to significantly reduce the levels of MDR1 protein in MCF-7/ADR cells. The in vivo study of DIR-labeled complexes in mice bearing MCF-7/ADR tumor indicated that EPSLR could reach the tumor site rather than other organs more effectively. All these results demonstrate that EPSLR has much potential for effective siRNA delivery and may facilitate its therapeutic application.
Wu, Na; Zhang, Xinxin; Li, Feifei; Zhang, Tao; Gan, Yong; Li, Juan
2015-01-01
Vaginal small interfering RNA (siRNA) delivery provides a promising strategy for the prevention and treatment of vaginal diseases. However, the densely cross-linked mucus layer on the vaginal wall severely restricts nanoparticle-mediated siRNA delivery to the vaginal epithelium. In order to overcome this barrier and enhance vaginal mucus penetration, we prepared spray-dried powders containing siRNA-loaded nanoparticles. Powders with Pluronic F127 (F127), hydroxypropyl methyl cellulose (HPMC), and mannitol as carriers were obtained using an ultrasound-assisted spray-drying technique. Highly dispersed dry powders with diameters of 5-15 μm were produced. These powders showed effective siRNA protection and sustained release. The mucus-penetrating properties of the powders differed depending on their compositions. They exhibited different potential of opening mesh size of molecular sieve in simulated vaginal mucus system. A powder formulation with 0.6% F127 and 0.1% HPMC produced the maximum increase in the pore size of the model gel used to simulate vaginal mucus by rapidly extracting water from the gel and interacting with the gel; the resulting modulation of the molecular sieve effect achieved a 17.8-fold improvement of siRNA delivery in vaginal tract and effective siRNA delivery to the epithelium. This study suggests that powder formulations with optimized compositions have the potential to alter the steric barrier posed by mucus and hold promise for effective vaginal siRNA delivery.
De Backer, Lynn; Cerrada, Alejandro; Pérez-Gil, Jesús; De Smedt, Stefaan C; Raemdonck, Koen
2015-12-28
Many pathologies of the respiratory tract are inadequately treated with existing small molecule-based therapies. The emergence of RNA interference (RNAi) enables the post-transcriptional silencing of key molecular disease factors that cannot readily be targeted with conventional small molecule drugs. Pulmonary administration of RNAi effectors, such as small interfering RNA (siRNA), allows direct delivery into the lung tissue, hence reducing systemic exposure. Unfortunately, the clinical translation of RNAi is severely hampered by inefficient delivery of siRNA therapeutics towards the cytoplasm of the target cells. In order to have a better control of the siRNA delivery process, both extra- and intracellular, siRNAs are typically formulated in nanosized delivery vehicles (nanoparticles, NPs). In the lower airways, which are the targeted sites of action for multiple pulmonary disorders, these siRNA-loaded NPs will encounter the pulmonary surfactant (PS) layer, covering the entire alveolar surface. The interaction between the instilled siRNA-loaded NPs and the PS at this nano-bio interface results in the adsorption of PS components onto the surface of the NPs. The formation of this so-called biomolecular corona conceals the original NP surface and will therefore profoundly determine the biological efficacy of the NP. Though this interplay has initially been regarded as a barrier towards efficient siRNA delivery to the respiratory target cell, recent reports have illustrated that the interaction with PS might also be beneficial for local pulmonary siRNA delivery.
Bioinformatics prediction of siRNAs as potential antiviral agents against dengue viruses
Villegas-Rosales, Paula M; Méndez-Tenorio, Alfonso; Ortega-Soto, Elizabeth; Barrón, Blanca L
2012-01-01
Dengue virus (DENV 1-4) represents the major emerging arthropod-borne viral infection in the world. Currently, there is neither an available vaccine nor a specific treatment. Hence, there is a need of antiviral drugs for these viral infections; we describe the prediction of short interfering RNA (siRNA) as potential therapeutic agents against the four DENV serotypes. Our strategy was to carry out a series of multiple alignments using ClustalX program to find conserved sequences among the four DENV serotype genomes to obtain a consensus sequence for siRNAs design. A highly conserved sequence among the four DENV serotypes, located in the encoding sequence for NS4B and NS5 proteins was found. A total of 2,893 complete DENV genomes were downloaded from the NCBI, and after a depuration procedure to identify identical sequences, 220 complete DENV genomes were left. They were edited to select the NS4B and NS5 sequences, which were aligned to obtain a consensus sequence. Three different servers were used for siRNA design, and the resulting siRNAs were aligned to identify the most prevalent sequences. Three siRNAs were chosen, one targeted the genome region that codifies for NS4B protein and the other two; the region for NS5 protein. Predicted secondary structure for DENV genomes was used to demonstrate that the siRNAs were able to target the viral genome forming double stranded structures, necessary to activate the RNA silencing machinery. PMID:22829722
siRNA as a tool to improve the treatment of brain diseases: Mechanism, targets and delivery.
Gomes, Maria João; Martins, Susana; Sarmento, Bruno
2015-05-01
As the population ages, brain pathologies such as neurodegenerative diseases and brain cancer increase their incidence, being the need to find successful treatments of upmost importance. Drug delivery to the central nervous system (CNS) is required in order to reach diseases causes and treat them. However, biological barriers, mainly blood-brain barrier (BBB), are the key obstacles that prevent the effectiveness of possible treatments due to their ability to strongly limit the perfusion of compounds into the brain. Over the past decades, new approaches towards overcoming BBB and its efflux transporters had been proposed. One of these approaches here reviewed is through small interfering RNA (siRNA), which is capable to specifically target one gene and silence it in a post-transcriptional way. There are different possible functional proteins at the BBB, as the ones responsible for transport or just for its tightness, which could be a siRNA target. As important as the effective silence is the way to delivery siRNA to its anatomical site of action. This is where nanotechnology-based systems may help, by protecting siRNA circulation and providing cell/tissue-targeting and intracellular siRNA delivery. After an initial overview on incidence of brain diseases and basic features of the CNS, BBB and its efflux pumps, this review focuses on recent strategies to reach brain based on siRNA, and how to specifically target these approaches in order to treat brain diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na
Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-01-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells. PMID:21629223
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-08-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells.
RNA-Eluting Surfaces for the Modulation of Gene Expression as A Novel Stent Concept
Koenig, Olivia; Zengerle, Diane; Perle, Nadja; Hossfeld, Susanne; Neumann, Bernd; Behring, Andreas; Avci-Adali, Meltem; Walker, Tobias; Schlensak, Christian; Wendel, Hans Peter; Nolte, Andrea
2017-01-01
Presently, a new era of drug-eluting stents is continuing to improve late adverse effects such as thrombosis after coronary stent implantation in atherosclerotic vessels. The application of gene expression–modulating stents releasing specific small interfering RNAs (siRNAs) or messenger RNAs (mRNAs) to the vascular wall might have the potential to improve the regeneration of the vessel wall and to inhibit adverse effects as a new promising therapeutic strategy. Different poly (lactic-co-glycolic acid) (PLGA) resomers for their ability as an siRNA delivery carrier against intercellular adhesion molecule (ICAM)-1 with a depot effect were tested. Biodegradability, hemocompatibility, and high cell viability were found in all PLGAs. We generated PLGA coatings with incorporated siRNA that were able to transfect EA.hy926 and human vascular endothelial cells. Transfected EA.hy926 showed significant siICAM-1 knockdown. Furthermore, co-transfection of siRNA and enhanced green fluorescent protein (eGFP) mRNA led to the expression of eGFP as well as to the siRNA transfection. Using our PLGA and siRNA multilayers, we reached high transfection efficiencies in EA.hy926 cells until day six and long-lasting transfection until day 20. Our results indicate that siRNA and mRNA nanoparticles incorporated in PLGA films have the potential for the modulation of gene expression after stent implantation to achieve accelerated regeneration of endothelial cells and to reduce the risk of restenosis. PMID:28208634
Gujrati, Maneesh; Malamas, Anthony; Shin, Tesia; Jin, Erlei; Sun, Lulu; Lu, Zheng-Rong
2015-01-01
Small interfering RNA (siRNA) has garnered much attention in recent years as a promising avenue for cancer gene therapy due to its ability to silence disease-related genes. Effective gene silencing is contingent upon the delivery of siRNA into the cytosol of target cells and requires the implementation of delivery systems possessing multiple functionalities to overcome delivery barriers. The present work explores the multifunctional properties and biological activity of a recently developed cationic lipid carrier, (1-aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-ethyl)propionamide]) (ECO). The physicochemical properties and biological activity of ECO/siRNA nanoparticles were assessed over a range of N/P ratios to optimize the formulation. Potent and sustained luciferase silencing in a U87 glioblastoma cell line was observed, even in the presence of serum proteins. ECO/siRNA nanoparticles exhibited pH-dependent membrane disruption at pH levels corresponding to various stages of the intracellular trafficking pathway. It was found that disulfide linkages created during nanoparticle formation enhanced the protection of siRNA from degradation and facilitated site-specific siRNA release in the cytosol by glutathione-mediated reduction. Confocal microscopy confirmed that ECO/siRNA nanoparticles readily escaped from late endosomes prior to cytosolic release of the siRNA cargo. These results demonstrate that the rationally designed multifunctionality of ECO/siRNA nanoparticles is critical for intracellular siRNA delivery and the continuing development of safe and effective delivery systems. PMID:25020033
Han, Bin; Zhao, Jun-Ying; Wang, Wu-Tao; Li, Zheng-Wei; He, Ai-Ping; Song, Xiao-Yang
2017-05-01
Schwann cells (SCs) are unique glial cells in the peripheral nerve and may secrete multiple neurotrophic factors, adhesion molecules, extracellular matrix molecules to form the microenvironment of peripheral nerve regeneration, guiding and supporting nerve proliferation and migration. Cdc42 plays an important regulatory role in dynamic changes of the cytoskeleton. However, there is a little study referred to regulation and mechanism of Cdc42 on glial cells after peripheral nerve injury. The present study investigated the role of Cdc42 in the proliferation and migration of SCs after sciatic nerve injury. Cdc42 expression was tested, showing that the mRNA and protein expression levels of Cdc42 were significantly up-regulated after sciatic nerve injury. Then, we isolated and purified SCs from injuried sciatic nerve at day 7. The purified SCs were transfected with Cdc42 siRNA and pcDNA3.1-Cdc42, and the cell proliferation, cell cycle and migration were assessed. The results implied that Cdc42 siRNA remarkably inhibited Schwann cell proliferation and migration, and resulted in S phase arrest. While pcDNA3.1-Cdc42 showed a contrary effect. Besides, we also observed that Cdc42 siRNA down-regulated the protein expression of β-catenin, Cyclin D1, c-myc and p-p38, which were up-regulated by pcDNA3.1-Cdc42. Meanwhile, the inhibitor of Wnt/β-catenin and p38 MAPK signaling pathway IWP-2 and SB203580 significantly inhibited the effect of pcDNA3.1-Cdc42 on cell proliferation and migration. Overall, our data indicate that Cdc42 regulates Schwann cell proliferation and migration through Wnt/β-catenin and p38 MAPK signaling pathway after sciatic nerve injury, which provides further insights into the therapy of the sciatic nerve injury.
Analysis of Nuclear Lamina Proteins in Myoblast Differentiation by Functional Complementation.
Tapia, Olga; Gerace, Larry
2016-01-01
We describe straightforward methodology for structure-function mapping of nuclear lamina proteins in myoblast differentiation, using populations of C2C12 myoblasts in which the endogenous lamina components are replaced with ectopically expressed mutant versions of the proteins. The procedure involves bulk isolation of C2C12 cell populations expressing the ectopic proteins by lentiviral transduction, followed by depletion of the endogenous proteins using siRNA, and incubation of cells under myoblast differentiation conditions. Similar methodology may be applied to mouse embryo fibroblasts or to other cell types as well, for the identification and characterization of sequences of lamina proteins involved in functions that can be measured biochemically or cytologically.
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
PTN Signaling: Components and Mechanistic Insights in Human Ovarian Cancer
Sethi, Geetika; Kwon, Youngjoo; Burkhalter, Rebecca J; Pathak, Harsh B.; Madan, Rashna; McHugh, Sarah; Atay, Safinur; Murthy, Smruthi; Tawfik, Ossama W.; Godwin, Andrew K.
2015-01-01
Molecular vulnerabilities represent promising candidates for the development of targeted therapies that hold the promise to overcome the challenges encountered with non-targeted chemotherapy for the treatment of ovarian cancer. Through a synthetic lethality screen, we previously identified pleiotrophin (PTN) as a molecular vulnerability in ovarian cancer and showed that siRNA mediated PTN knockdown induced apoptotic cell death in epithelial ovarian cancer (EOC) cells. Although it is well known that PTN elicits its pro-tumorigenic effects through its receptor, protein tyrosine phosphatase receptor Z1 (PTPRZ1), little is known about the potential importance of this pathway in the pathogenesis of ovarian cancer. In this study we show that PTN is expressed, produced, and secreted in a panel of EOC cell lines. PTN levels in serous ovarian tumor tissues are on average 3.5-fold higher relative to normal tissue and PTN is detectable in serum samples of patients with EOC. PTPRZ1 is also expressed and produced by EOC cells and is found to be up-regulated in serous ovarian tumor tissue relative to normal ovarian surface epithelial tissue (p<0.05). Gene silencing of PTPRZ1 in EOC cell lines using siRNA mediated knockdown shows that PTPRZ1 is essential for viability and results in significant apoptosis with no effect on the cell cycle phase distribution. In order to determine how PTN mediates survival, we silenced the gene using siRNA mediated knockdown and performed expression profiling of 36 survival-related genes. Through computational mapping of the differentially expressed genes, members of the MAPK (mitogen-activated protein kinase) family were found to be likely effectors of PTN signaling in EOC cells. Our results provide the first experimental evidence that PTN and its signaling components may be of significance in the pathogenesis of epithelial ovarian cancer and provide a rationale for clinical evaluation of MAPK inhibitors in PTN and/or PTPRZ1 expressing ovarian tumors. PMID:25418856
The antifibrotic effects of TGF-{beta}1 siRNA on hepatic fibrosis in rats
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lang, Qing; Liu, Qi; Xu, Ning
2011-06-10
Highlights: {yields} We constructed CCL4 induced liver fibrosis model successfully. {yields} We proofed that the TGF-{beta}1 siRNA had a definite therapy effect to CCL4 induced liver fibrosis. {yields} The therapy effect of TGF-{beta}1 siRNA had dose-dependent. -- Abstract: Background/aims: Hepatic fibrosis results from the excessive secretion of matrix proteins by hepatic stellate cells (HSCs), which proliferate during fibrotic liver injury. Transforming growth factor (TGF)-{beta}1 is the dominant stimulus for extracellular matrix (ECM) production by stellate cells. Our study was designed to investigate the antifibrotic effects of using short interference RNA (siRNA) to target TGF-{beta}1 in hepatic fibrosis and its mechanismmore » in rats exposed to a high-fat diet and carbon tetrachloride (CCL4). Methods: A total of 40 healthy, male SD (Sprague-Dawley) rats were randomly divided into five even groups containing of eight rats each: normal group, model group, TGF-{beta}1 siRNA 0.125 mg/kg treatment group, TGF-{beta}1 siRNA 0.25 mg/kg treatment group and TGF-{beta}1 siRNA negative control group (0.25 mg/kg). CCL4 and a high-fat diet were used for 8 weeks to induce hepatic fibrosis. All the rats were then sacrificed to collect liver tissue samples. A portion of the liver samples were soaked in formalin for Hematoxylin-Eosin staining, classifying the degree of liver fibrosis, and detecting the expression of type I and III collagen and TGF-{beta}1; the remaining liver samples were stored in liquid nitrogen to be used for detecting TGF-{beta}1 by Western blotting and for measuring the mRNA expression of type I and III collagen and TGF-{beta}1 by quantitative real-time polymerase chain reaction. Results: Comparing the TGF-{beta}1 siRNA 0.25 mg/kg treatment group to the model group, the TGF-{beta}1 siRNA negative control group and the TGF-{beta}1 siRNA 0.125 mg/kg treatment group showed significantly reduced levels of pathological changes, protein expression and the mRNA expression of TGF-{beta}1, type I collagen and type III collagen (P < 0.01). Conclusions: Using siRNA to target TGF-{beta}1 can inhibit the expression of TGF-{beta}1 and attenuate rat hepatic fibrosis induced by a high-fat diet and CCL4. A possible mechanism is through the down-regulation of TGF-{beta}1 expression, which could inhibit HSC activation, as well as the proliferation and collagen production of collagen reducing, so that collagen deposition in the liver is reduced.« less
Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André
2011-01-19
The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.
NASA Technical Reports Server (NTRS)
1994-01-01
After concluding an oil exploration agreement with the Republic of Yemen, Chevron International needed detailed geologic and topographic maps of the area. Chevron's remote sensing team used imagery from Landsat and SPOT, combining images into composite views. The project was successfully concluded and resulted in greatly improved base maps and unique topographic maps.
Gold nanoclusters-assisted delivery of NGF siRNA for effective treatment of pancreatic cancer
Lei, Yifeng; Tang, Lixue; Xie, Yangzhouyun; Xianyu, Yunlei; Zhang, Lingmin; Wang, Peng; Hamada, Yoh; Jiang, Kai; Zheng, Wenfu; Jiang, Xingyu
2017-01-01
Pancreatic cancer is one of the deadliest human cancers, whose progression is highly dependent on the nervous microenvironment. The suppression of gene expression of nerve growth factor (NGF) may have great potential in pancreatic cancer treatment. Here we show that gold nanocluster-assisted delivery of siRNA of NGF (GNC–siRNA) allows efficient NGF gene silencing and pancreatic cancer treatment. The GNC–siRNA complex increases the stability of siRNA in serum, prolongs the circulation lifetime of siRNA in blood and enhances the cellular uptake and tumour accumulation of siRNA. The GNC–siRNA complex potently downregulates the NGF expression in Panc-1 cells and in pancreatic tumours, and effectively inhibits the tumour progression in three pancreatic tumour models (subcutaneous model, orthotopic model and patient-derived xenograft model) without adverse effects. Our study constitutes a straightforward but effective approach to inhibit pancreatic cancer via NGF knockdown, suggesting a promising therapeutic direction for pancreatic cancer. PMID:28440296
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-10-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.
Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong
2010-01-01
In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.
Gold nanoclusters-assisted delivery of NGF siRNA for effective treatment of pancreatic cancer
NASA Astrophysics Data System (ADS)
Lei, Yifeng; Tang, Lixue; Xie, Yangzhouyun; Xianyu, Yunlei; Zhang, Lingmin; Wang, Peng; Hamada, Yoh; Jiang, Kai; Zheng, Wenfu; Jiang, Xingyu
2017-04-01
Pancreatic cancer is one of the deadliest human cancers, whose progression is highly dependent on the nervous microenvironment. The suppression of gene expression of nerve growth factor (NGF) may have great potential in pancreatic cancer treatment. Here we show that gold nanocluster-assisted delivery of siRNA of NGF (GNC-siRNA) allows efficient NGF gene silencing and pancreatic cancer treatment. The GNC-siRNA complex increases the stability of siRNA in serum, prolongs the circulation lifetime of siRNA in blood and enhances the cellular uptake and tumour accumulation of siRNA. The GNC-siRNA complex potently downregulates the NGF expression in Panc-1 cells and in pancreatic tumours, and effectively inhibits the tumour progression in three pancreatic tumour models (subcutaneous model, orthotopic model and patient-derived xenograft model) without adverse effects. Our study constitutes a straightforward but effective approach to inhibit pancreatic cancer via NGF knockdown, suggesting a promising therapeutic direction for pancreatic cancer.
[Components and assembly of RNA-induced silencing complex].
Song, Xue-Mei; Yan, Fei; Du, Li-Xin
2006-06-01
Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Barik, Sailen
2010-07-01
Influenza virus is one of the most prevalent and ancient infections in humans. About a fifth of world's population is infected by influenza virus annually, leading to high morbidity and mortality, particularly in infants, the elderly and the immunocompromised. In the US alone, influenza outbreaks lead to roughly 30,000 deaths each year. Current vaccines and anti-influenza drugs are of limited use due to high mutation rate of the virus and side effects. In recent years, RNA interference, triggered by synthetic short interfering RNA (siRNA), has rapidly evolved as a potent antiviral regimen. Properly designed siRNAs have been shown to function as potent inhibitors of influenza virus replication. The siRNAs outperform traditional small molecule antivirals in a number of areas, such as ease of design, modest cost, and fast turnaround. Although specificity and tissue delivery remain major bottlenecks in the clinical applications of RNAi in general, intranasal application of siRNA against respiratory viruses including, but not limited to influenza virus, has experienced significant success and optimism, which is reviewed here.
Complete cure of persistent virus infections by antiviral siRNAs.
Saulnier, Aure; Pelletier, Isabelle; Labadie, Karine; Colbère-Garapin, Florence
2006-01-01
Small interfering RNAs (siRNAs) have been developed as antiviral agents for mammalian cells. The capacity of specific siRNAs to prevent virus infections has been demonstrated, and there is evidence that these new antiviral agents could have a partial therapeutic effect a few days after infection. We investigated the possibility of curing a persistent infection, several months after becoming established, using an in vitro model of persistent poliovirus (PV) infection in HEp-2 cells. Despite high virus titers and the presence of PV mutants, repeated treatment with a mixture of two siRNAs targeting both noncoding and coding regions, one of them in a highly conserved region, resulted in the complete cure of the majority of persistently infected cultures. No escape mutants emerged in treated cultures. The antiviral effect of specific siRNAs, consistent with a mechanism of RNA interference, correlated with a decrease in the amount of viral RNA, until its complete disappearance, resulting in cultures cured of virions and viral RNA.
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-01-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886
Bioengineered Nanoparticles for siRNA delivery
Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.
2014-01-01
Short interfering RNA (siRNA) has been an important laboratory tool in the last two decades and has allowed researchers to better understand the functions of non-protein-coding genes through RNA interference (RNAi). Although RNAi holds great promise for this purpose as well as for treatment of many diseases, efforts at using siRNA have been hampered by the difficulty of safely and effectively introducing it into cells of interest, both in vitro and in vivo. To overcome this challenge, many biomaterials and nanoparticles (NPs) have been developed and optimized for siRNA delivery, often taking cues from the DNA delivery field, although different barriers exist for these two types of molecules. In this review, we discuss general properties of biomaterials and nanoparticles that are necessary for effective nucleic acid delivery. We also discuss specific examples of bioengineered materials, including lipid-based NPs, polymeric NPs, inorganic NPs, and RNA-based NPs, which clearly illustrate the problems and successes in siRNA delivery. PMID:23821336
Monga, Isha; Qureshi, Abid; Thakur, Nishant; Gupta, Amit Kumar; Kumar, Manoj
2017-01-01
Allele-specific siRNAs (ASP-siRNAs) have emerged as promising therapeutic molecules owing to their selectivity to inhibit the mutant allele or associated single-nucleotide polymorphisms (SNPs) sparing the expression of the wild-type counterpart. Thus, a dedicated bioinformatics platform encompassing updated ASP-siRNAs and an algorithm for the prediction of their inhibitory efficacy will be helpful in tackling currently intractable genetic disorders. In the present study, we have developed the ASPsiRNA resource (http://crdd.osdd.net/servers/aspsirna/) covering three components viz (i) ASPsiDb, (ii) ASPsiPred, and (iii) analysis tools like ASP-siOffTar. ASPsiDb is a manually curated database harboring 4543 (including 422 chemically modified) ASP-siRNAs targeting 78 unique genes involved in 51 different diseases. It furnishes comprehensive information from experimental studies on ASP-siRNAs along with multidimensional genetic and clinical information for numerous mutations. ASPsiPred is a two-layered algorithm to predict efficacy of ASP-siRNAs for fully complementary mutant (Effmut) and wild-type allele (Effwild) with one mismatch by ASPsiPredSVM and ASPsiPredmatrix, respectively. In ASPsiPredSVM, 922 unique ASP-siRNAs with experimentally validated quantitative Effmut were used. During 10-fold cross-validation (10nCV) employing various sequence features on the training/testing dataset (T737), the best predictive model achieved a maximum Pearson’s correlation coefficient (PCC) of 0.71. Further, the accuracy of the classifier to predict Effmut against novel genes was assessed by leave one target out cross-validation approach (LOTOCV). ASPsiPredmatrix was constructed from rule-based studies describing the effect of single siRNA:mRNA mismatches on the efficacy at 19 different locations of siRNA. Thus, ASPsiRNA encompasses the first database, prediction algorithm, and off-target analysis tool that is expected to accelerate research in the field of RNAi-based therapeutics for human genetic diseases. PMID:28696921
2012-07-01
tumor microenvironment we intend to deliver siRNA specifically to tumor- associated-macrophages ( TAMs ). Therefore, the proposed work seeks to synthesize...characterize and assess multifunctional nanoparticles for siRNA delivery specifically to tumor-associated-macrophages ( TAMs ). The nanoparticles...knockdown protein expression of NF-κB modulators with exceptional specificity for TAMs . TAM -specific nanoparticle targeting offers an innovative approach
Chen, Min; Cooper, Helen M; Zhou, Ji Zhi; Bartlett, Perry F; Xu, Zhi Ping
2013-01-15
Small interfering RNAs (siRNAs) are a potentially powerful new class of pharmaceutical drugs for many disease. However, the delivery of unprotected siRNAs is ineffective due to their susceptibility to degradation by ubiquitous nucleases under physiological conditions. Layered double hydroxide nanoparticles (LDHs) have been found to be efficient carriers of anionic drugs and nucleic acids. Our previous research has shown that LDHs (with the Z-average particle size of approximately 110 nm) can mediate siRNA delivery in mammalian cells, resulting in gene silencing. However, short double-stranded nucleic acids are mostly adsorbed onto the external surface and not well protected by LDHs. In order to enhance the intercalation of siRNA into the LDH interlayer and the efficiency of subsequent siRNA delivery, we prepared smaller LDHs (with the Z-average particle size of approximately 45 nm) with an engineered non-aqueous method. We demonstrate here that dsDNA/siRNA is more effectively intercalated into these small LDH nanoparticles, more dsDNA/siRNA is transfected into HEK 293T cells, and more efficient silencing of the target gene is achieved using smaller LDHs. Thus, smaller LDH particles have greater potential as a delivery system for the application of RNA interference. Copyright © 2012 Elsevier Inc. All rights reserved.
Palanca-Wessels, Maria C.; Booth, Garrett C.; Convertine, Anthony J.; Lundy, Brittany B.; Berguig, Geoffrey Y.; Press, Michael F.; Stayton, Patrick S.; Press, Oliver W.
2016-01-01
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5′ RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5′ RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy. PMID:26840082
Palanca-Wessels, Maria C; Booth, Garrett C; Convertine, Anthony J; Lundy, Brittany B; Berguig, Geoffrey Y; Press, Michael F; Stayton, Patrick S; Press, Oliver W
2016-02-23
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5' RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5' RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy.
The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.
Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko
2015-12-01
RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.
Capillary electrophoresis method to determine siRNA complexation with cationic liposomes.
Furst, Tania; Bettonville, Virginie; Farcas, Elena; Frere, Antoine; Lechanteur, Anna; Evrard, Brigitte; Fillet, Marianne; Piel, Géraldine; Servais, Anne-Catherine
2016-10-01
Small interfering RNA (siRNA) inducing gene silencing has great potential to treat many human diseases. To ensure effective siRNA delivery, it must be complexed with an appropriate vector, generally nanoparticles. The nanoparticulate complex requires an optimal physiochemical characterization and the complexation efficiency has to be precisely determined. The methods usually used to measure complexation in gel electrophoresis and RiboGreen ® fluorescence-based assay. However, those approaches are not automated and present some drawbacks such as the low throughput and the use of carcinogenic reagents. The aim of this study is to develop a new simple and fast method to accurately quantify the complexation efficiency. In this study, capillary electrophoresis (CE) was used to determine the siRNA complexation with cationic liposomes. The short-end injection mode applied enabled siRNA detection in less than 5 min. Moreover, the CE technique offers many advantages compared with the other classical methods. It is automated, does not require sample preparation and expensive reagents. Moreover, no mutagenic risk is associated with the CE approach since no carcinogenic product is used. Finally, this methodology can also be extended for the characterization of other types of nanoparticles encapsulating siRNA, such as cationic polymeric nanoparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng
2012-01-01
Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.
Hattori, Yoshiyuki; Kikuchi, Takuto; Nakamura, Mari; Ozaki, Kei-Ichi; Onishi, Hiraku
2017-01-01
It has been reported that suppression of protein kinase N3 (PKN3) expression in vascular and lymphatic endothelial cells results in the inhibition of tumor progression and lymph node metastasis formation. The present study investigated whether combination therapy of small interfering RNA (siRNA) against PKN3 and doxorubicin (DXR) could increase therapeutic efficacy against liver and lung metastases. In vitro transfection of PKN3 siRNA into PKN3-positive MDA-MB-231, LLC, and Colon 26 cells and PKN3-negative MCF-7 cells did not inhibit cell growth and did not increase sensitivity to DXR. However, following in vivo treatment, PKN3 siRNA suppressed the growth of liver MDA-MB-231 and lung LLC and MCF-7 metastases, although combination therapy with DXR did not increase the therapeutic efficacy. By contrast, in liver MCF-7 metastases, PKN3 siRNA or DXR alone did not exhibit significant inhibition of tumor growth, but their combination significantly improved therapeutic efficacy. Treatment of liver MDA-MB-231 metastases with PKN3 siRNA induced a change in vasculature structure via suppression of PKN3 mRNA expression. PKN3 siRNA may induce antitumor effects in lung and liver metastases by suppression of PKN3 expression in stroma cells, such as endothelial cells. From these findings, PKN3 siRNA alone or in combination with DXR may reduce the tumor growth of liver and lung metastases regardless of PKN3 expression in tumor cells. PMID:29098022
Novel small interfering RNA-containing solution protecting donor organs in heart transplantation.
Zheng, Xiufen; Lian, Dameng; Wong, Arthur; Bygrave, Michael; Ichim, Thomas E; Khoshniat, Mahdieh; Zhang, Xusheng; Sun, Hongtao; De Zordo, Tobias; Lacefield, James C; Garcia, Bertha; Jevnikar, Anthony M; Min, Wei-Ping
2009-09-22
Ischemia/reperfusion injury is a major factor in graft quality and subsequent function in the transplantation setting. We hypothesize that the process of RNA interference may be used to "engineer" a graft to suppress expression of genes associated with inflammation, apoptosis, and complement, which are believed to cause ischemia/reperfusion injury. Such manipulation of pathological gene expression may be performed by treatment of the graft ex vivo with small interfering RNA (siRNA) as part of the preservation procedure. Heart grafts from BALB/c mice were preserved in UW solution (control) or UW solution containing siRNAs targeting tumor necrosis factor-alpha, C3, and Fas genes (siRNA solution) at 4 degrees C for 48 hours and subsequently transplanted into syngeneic recipients. Tumor necrosis factor-alpha, C3, and Fas genes were elevated by ischemia/reperfusion injury after 48 hours of preservation in UW solution. Preservation in siRNA solution knocked down gene expression at the level of messenger RNA and protein in the grafts after transplantation. All grafts preserved in siRNA solution showed strong contraction, whereas grafts preserved in control solution demonstrated no detectable contraction by high-frequency ultrasound scanning. siRNA solution-treated organs exhibited improved histology and diminished neutrophil and lymphocyte infiltration compared with control solution-treated organs. Furthermore, the treated heart grafts retained strong beating up to the end of the observation period (>100 days), whereas all control grafts lost function within 8 days. Incorporation of siRNA into organ storage solution is a feasible and effective method of attenuating ischemia/reperfusion injury, protecting cardiac function, and prolonging graft survival.
Gao, Pei; Zhang, Xiangyu; Wang, Hongzhi; Zhang, Qinghong
2016-01-01
Calcium phosphate nanoparticles are safe and effective delivery vehicles for small interfering RNA (siRNA), as a result of their excellent biocompatibility. In this work, mPEG-PE (polyethylene glycol-L-α-phosphatidylethanolamine) was synthesized and used to prepare nanoparticles composed of mPEG-PE and calcium phosphate for siRNA delivery. Calcium phosphate and mPEG-PE formed the stable hybrid nanoparticles through self-assembly resulting from electrostatic interaction in water. The average size of the hybrid nanoparticles was approximately 53.2 nm with a negative charge of approximately −16.7 mV, which was confirmed by dynamic light scattering (DLS) measurements. The nanoparticles exhibited excellent stability in serum and could protect siRNA from ribonuclease (RNase) degradation. The cellular internalization of siRNA-loaded nanoparticles was evaluated in SMMC-7721 cells using a laser scanning confocal microscope (CLSM) and flow cytometry. The hybrid nanoparticles could efficiently deliver siRNA to cells compared with free siRNA. Moreover, the in vivo distribution of Cy5-siRNA-loaded hybrid nanoparticles was observed after being injected into tumor-bearing nude mice. The nanoparticles concentrated in the tumor regions through an enhanced permeability and retention (EPR) effect based on the fluorescence intensities of tissue distribution. A safety evaluation of the nanoparticles was performed both in vitro and in vivo demonstrating that the hybrid nanoparticle delivery system had almost no toxicity. These results indicated that the mPEG-PE/CaP hybrid nanoparticles could be a stable, safe and promising siRNA nanocarrier for anticancer therapy. PMID:26625203
Yin, Tinghui; Wang, Ping; Li, Jingguo; Wang, Yiru; Zheng, Bowen; Zheng, Rongqin; Cheng, Du; Shuai, Xintao
2014-07-01
Drug resistance is a big problem in systemic chemotherapy of hepatocellular carcinoma (HCC), and nanomedicines loaded with both chemotherapeutic agents (e.g. paclitaxel, PTX) and siRNA's targeting antiapoptosis genes (e.g. BCL-2) possess the advantages to simultaneously overcome the efflux pump-mediated drug resistance and antiapoptosis-related drug resistance. However, tumor-penetrating drug delivery with this type of nanomedicines is extremely difficult due to their relatively big size compared to the single drug-loaded nanomedicines. Aiming at address this problem, US-responsive nanobubbles encapsulating both anti-cancer drug paclitaxel (PTX) and siRNA (PTX-NBs/siRNA) for HCC treatment were developed by hetero-assembly of polymeric micelles and liposomes in the present study. Utilizing an external low-frequency US force imposed to the tumor site, effective tumor-penetrating codelivery of siRNA and PTX was achieved via tail vein injection of PTX-NBs/siRNA into nude mice bearing human HepG2 xerografts. Consequently, the PTX treatment-inducible antiapoptosis in HepG2 cells was effectively suppressed by the codelivered siRNA targeting an antiapoptosis gene (BCL-2 siRNA) during chemotherapy. Owing to the synergistic anti-cancer effect of two therapeutic agents, tumor growth was completely inhibited using low-dose PTX in animal study. Our results highlight the great potential of this type of US-responsive hetero-assemblies carrying both anti-cancer drug and siRNA as an effective nanomedicinal system for HCC therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chen, X G; Liu, Y M; Lv, Q X; Ma, J
2017-01-01
We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
Meng, Huan; Liong, Monty; Xia, Tian; Li, Zongxi; Ji, Zhaoxia; Zink, Jeffrey I; Nel, Andre E
2010-08-24
Overexpression of drug efflux transporters such as P-glycoprotein (Pgp) protein is one of the major mechanisms for multiple drug resistance (MDR) in cancer cells. A new approach to overcome MDR is to use a co-delivery strategy that utilizes a siRNA to silence the expression of efflux transporter together with an appropriate anticancer drug for drug resistant cells. In this paper, we report that mesoporous silica nanoparticles (MSNP) can be functionalized to effectively deliver a chemotherapeutic agent doxorubicin (Dox) as well as Pgp siRNA to a drug-resistant cancer cell line (KB-V1 cells) to accomplish cell killing in an additive or synergistic fashion. The functionalization of the particle surface with a phosphonate group allows electrostatic binding of Dox to the porous interior, from where the drug could be released by acidification of the medium under abiotic and biotic conditions. In addition, phosphonate modification also allows exterior coating with the cationic polymer, polyethylenimine, which endows the MSNP to contemporaneously deliver Pgp siRNA. The dual delivery of Dox and siRNA in KB-V1 cells was capable of increasing the intracellular as well as intranuclear drug concentration to levels exceeding that of free Dox or the drug being delivered by MSNP in the absence of siRNA codelivery. These results demonstrate that it is possible to use the MSNP platform to effectively deliver a siRNA that knocks down gene expression of a drug exporter that can be used to improve drug sensitivity to a chemotherapeutic agent.
Meng, Huan; Liong, Monty; Xia, Tian; Li, Zongxi; Ji, Zhaoxia; Zink, Jeffrey I.; Nel, Andre E.
2014-01-01
Overexpression of drug efflux transporters such as P-glycoprotein (P-gp) protein is one of the major mechanisms for multiple drug resistance (MDR) in cancer cells. A new approach to overcome MDR is to use a co-delivery strategy that utilizes a siRNA to silence the expression of efflux transporter together with an appropriate anti-cancer drug for drug resistant cells. In this paper, we report that mesoporous silica nanoparticles (MSNP) can be functionalized to effectively deliver a chemotherapeutic agent doxorubicin (Dox) as well as Pgp siRNA to a drug-resistant cancer cell line (KB-V1 cells) to accomplish cell killing in an additive or synergistic fashion. The functionalization of the particle surface with a phosphonate group allows electrostatic binding of Dox to the porous interior, from where the drug could be released by acidification of the medium under abiotic and biotic conditions. In addition, phosphonate modification also allows exterior coating with the cationic polymer, polyethylenimine (PEI), which endows the MSNP contemporaneously deliver Pgp siRNA. The dual delivery of Dox and siRNA in KB-V1 cells was capable of increasing the intracellular as well as intranuclear drug concentration to levels exceeding that of free Dox or the drug being delivered by MSNP in the absence of siRNA co-delivery. These results demonstrate that it is possible to use the MSNP platform to effectively deliver a siRNA that knocks down gene expression of a drug exporter that can be used to improve drug sensitivity to a chemotherapeutic agent. PMID:20731437
Gao, Pei; Zhang, Xiangyu; Wang, Hongzhi; Zhang, Qinghong; Li, He; Li, Yaogang; Duan, Yourong
2016-01-19
Calcium phosphate nanoparticles are safe and effective delivery vehicles for small interfering RNA (siRNA), as a result of their excellent biocompatibility. In this work, mPEG-PE (polyethylene glycol-L-α-phosphatidylethanolamine) was synthesized and used to prepare nanoparticles composed of mPEG-PE and calcium phosphate for siRNA delivery. Calcium phosphate and mPEG-PE formed the stable hybrid nanoparticles through self-assembly resulting from electrostatic interaction in water. The average size of the hybrid nanoparticles was approximately 53.2 nm with a negative charge of approximately -16.7 mV, which was confirmed by dynamic light scattering (DLS) measurements. The nanoparticles exhibited excellent stability in serum and could protect siRNA from ribonuclease (RNase) degradation. The cellular internalization of siRNA-loaded nanoparticles was evaluated in SMMC-7721 cells using a laser scanning confocal microscope (CLSM) and flow cytometry. The hybrid nanoparticles could efficiently deliver siRNA to cells compared with free siRNA. Moreover, the in vivo distribution of Cy5-siRNA-loaded hybrid nanoparticles was observed after being injected into tumor-bearing nude mice. The nanoparticles concentrated in the tumor regions through an enhanced permeability and retention (EPR) effect based on the fluorescence intensities of tissue distribution. A safety evaluation of the nanoparticles was performed both in vitro and in vivo demonstrating that the hybrid nanoparticle delivery system had almost no toxicity. These results indicated that the mPEG-PE/CaP hybrid nanoparticles could be a stable, safe and promising siRNA nanocarrier for anticancer therapy.
Targeted delivery of siRNA to macrophages for anti-inflammatory treatment.
Kim, Sang-Soo; Ye, Chunting; Kumar, Priti; Chiu, Isaac; Subramanya, Sandesh; Wu, Haoquan; Shankar, Premlata; Manjunath, N
2010-05-01
Inflammation mediated by tumor necrosis factor-alpha (TNF-alpha) and the associated neuronal apoptosis characterizes a number of neurologic disorders. Macrophages and microglial cells are believed to be the major source of TNF-alpha in the central nervous system (CNS). Here, we show that suppression of TNF-alpha by targeted delivery of small interfering RNA (siRNA) to macrophage/microglial cells dramatically reduces lipopolysaccharide (LPS)-induced neuroinflammation and neuronal apoptosis in vivo. Because macrophage/microglia express the nicotinic acetylcholine receptor (AchR) on their surface, we used a short AchR-binding peptide derived from the rabies virus glycoprotein (RVG) as a targeting ligand. This peptide was fused to nona-D-arginine residues (RVG-9dR) to enable siRNA binding. RVG-9dR was able to deliver siRNA to induce gene silencing in macrophages and microglia cells from wild type, but not AchR-deficient mice, confirming targeting specificity. Treatment with anti-TNF-alpha siRNA complexed to RVG-9dR achieved efficient silencing of LPS-induced TNF-alpha production by primary macrophages and microglia cells in vitro. Moreover, intravenous injection with RVG-9dR-complexed siRNA in mice reduced the LPS-induced TNF-alpha levels in blood as well as in the brain, leading to a significant reduction in neuronal apoptosis. These results demonstrate that RVG-9dR provides a tool for siRNA delivery to macrophages and microglia and that suppression of TNF-alpha can potentially be used to suppress neuroinflammation in vivo.
Prediction of siRNA potency using sparse logistic regression.
Hu, Wei; Hu, John
2014-06-01
RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.
Kubota, Kohei; Onishi, Kohei; Sawaki, Kazuaki; Li, Tianshu; Mitsuoka, Kaoru; Sato, Takaaki; Takeoka, Shinji
2017-01-01
Two lipid-based nanoformulations have been used to date in clinical studies: lipoplexes and lipid nanoparticles (LNPs). In this study, we prepared small interfering RNA (siRNA)-loaded carriers using lipid components of the same composition to form molecular assemblies of differing structures, and evaluated the impact of structure on cellular uptake and immune stimulation. Lipoplexes are electrostatic complexes formed by mixing preformed cationic lipid liposomes with anionic siRNA in an aqueous environment, whereas LNPs are nanoparticles embedding siRNA prepared by mixing an alcoholic lipid solution with an aqueous siRNA solution in one step. Although the physicochemical properties of lipoplexes and LNPs were similar except for small increases in apparent size of lipoplexes and zeta potential of LNPs, siRNA uptake efficiency of LNPs was significantly higher than that of lipoplexes. Furthermore, in the case of LNPs, both siRNA and lipid were effectively incorporated into cells in a co-assembled state; however, in the case of lipoplexes, the amount of siRNA internalized into cells was small in comparison with lipid. siRNAs in lipoplexes were thought to be more likely to localize on the particle surface and thereby undergo dissociation into the medium. Inflammatory cytokine responses also appeared to differ between lipoplexes and LNPs. For tumor necrosis factor-α, release was mainly caused by siRNA. On the other hand, the release of interleukin-1β was mainly due to the cationic nature of particles. LNPs released lower amounts of tumor necrosis factor-α and interleukin-1β than lipoplexes and were thus considered to be better tolerated with respect to cytokine release. In conclusion, siRNA-loaded nanoformulations effect their cellular uptake and immune stimulation in a manner that depends on the structure of the molecular assembly; therefore, nanoformulations should be optimized before extending studies into the in vivo environment.
Bae, Yun Jung; Yoon, Young Il; Yoon, Tae-Jong; Lee, Hak Jong
2016-01-01
To evaluate the effectiveness of ultrasound and microbubble-liposome complex (MLC)-mediated delivery of siRNA and doxorubicin into prostate cancer cells and its therapeutic capabilities both in vitro and in vivo. Microbubble-liposome complexes conjugated with anti-human epidermal growth factor receptor type 2 (Her2) antibodies were developed to target human prostate cancer cell lines PC-3 and LNCaP. Intracellular delivery of MLC was observed by confocal microscopy. We loaded MLC with survivin-targeted small interfering RNA (siRNA) and doxorubicin, and delivered it into prostate cancer cells. The release of these agents was facilitated by ultrasound application. Cell viability was analyzed by MTT assay after the delivery of siRNA and doxorubicin. Survivin-targeted siRNA loaded MLC was delivered into the xenograft mouse tumor model. Western blotting was performed to quantify the expression of survivin in vivo. Confocal microscopy demonstrated substantial intracellular uptake of MLCs in LNCaP, which expresses higher levels of Her2 than PC-3. The viability of LNCaP cells was significantly reduced after the delivery of MLCs loaded with siRNA and doxorubicin (85.0 ± 2.9%), which was further potentiated by application of ultrasound (55.0 ± 3.5%, p = 0.009). Survivin expression was suppressed in vivo in LNCaP tumor xenograft model following the ultrasound and MLC-guided delivery of siRNA (77.4 ± 4.90% to 36.7 ± 1.34%, p = 0.027). Microbubble-liposome complex can effectively target prostate cancer cells, enabling intracellular delivery of the treatment agents with the use of ultrasound. Ultrasound and MLC-mediated delivery of survivin-targeted siRNA and doxorubicin can induce prostate cell apoptosis and block survivin expression in vitro and in vivo.
Watanabe, Kenichi; Arumugam, Somasundaram; Sreedhar, Remya; Thandavarayan, Rajarajan A; Nakamura, Takashi; Nakamura, Masahiko; Harima, Meilei; Yoneyama, Hiroyuki; Suzuki, Kenji
2015-07-01
Carbohydrate sulfotransferase 15 (CHST15) is a sulfotransferase responsible for biosynthesis of chondroitin sulfate E (CS-E), which plays important roles in numerous biological events such as biosynthesis of proinflammatory cytokines. However, the effects of CHST15 siRNA in rats with chronic heart failure (CHF) after experimental autoimmune myocarditis (EAM) have not yet been investigated. CHF was elicited in Lewis rats by immunization with cardiac myosin, and after immunization, the rats were divided into two groups and treated with either CHST15 siRNA (2μg/week) or vehicle. Age matched normal rats without immunizations were also included in this study. After 7weeks of treatment, we investigated the effects of CHST15 siRNA on cardiac function, proinflammatory cytokines, and cardiac remodeling in EAM rats. Myocardial functional parameters measured by hemodynamic and echocardiographic studies were significantly improved by CHST15 siRNA treatment in rats with CHF compared with that of vehicle-treated CHF rats. CHST15 siRNA significantly reduced cardiac fibrosis, and hypertrophy and its marker molecules (left ventricular (LV) mRNA expressions of transforming growth factor beta1, collagens I and III, and atrial natriuretic peptide) compared with vehicle-treated CHF rats. CHF-induced increased myocardial mRNA expressions of proinflammatory cytokines [interleukin (IL)-6, IL-1β], monocyte chemoattractant protein-1, and matrix metalloproteinases (MMP-2 and -9), and CHST15 were also suppressed by the treatment with CHST15 siRNA. Western blotting study has confirmed the results obtained from mRNA analysis as CHST15 siRNA treated rats expressed reduced levels of inflammatory and cardiac remodeling marker proteins. Our results demonstrate for the first time, that CHST15 siRNA treatment significantly improved LV function and ameliorated the progression of cardiac remodeling in rats with CHF after EAM. Copyright © 2015 Elsevier Inc. All rights reserved.
Walker, Tobias; Nolte, Andrea; Steger, Volker; Makowiecki, Christina; Mustafi, Migdat; Friedel, Godehard; Schlensak, Christian; Wendel, Hans-Peter
2013-03-01
Serum response factor (SRF), E2F1 and survivin are well-known factors involved in a multitude of cancer-related regulation processes. However, to date, no suitable means has been found to apply their potential in the therapy of non-small cell lung cancer (NSCLC). This study deals with questions of small interfering ribonucleic acid (siRNA) transfection efficiency by a non-viral transfection of NSCLC cell-lines and the power of siRNA to transiently influence cell division by specific silencing. Different NSCLC cell lines were cultured under standard conditions and transfected, with specific siRNA targeting SRF, E2F1 and survivin in a non-viral manner. Cells treated with non-specific siRNA (SCR-siRNA) served as controls. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed for messenger RNA (mRNA) expression levels. Additionally, transfection efficiency was evaluated by flow cytometry. The analysis of cell proliferation was determined with a CASY cell counter 3 days after transfection with SRF or SCR-siRNA. Transfection of the NSCLC cell lines with specific siRNAs against SRF, E2F1 and survivin resulted in a very considerable reduction of the intracellular mRNA concentration. CASY confirmation of cell viability demonstrated an excellent survival of the cell lines treated with non-specific siRNA, in contrast to with application of specific siRNA. This study reports a reliable transfectability of NSCLC-cell lines by siRNA, initially in a non-viral manner, and a reproducible knockdown of the focussed targets, consequently leading to the death of the tumour cells. This constitutes a strong candidate for a new assessment strategy in the therapy of non-small cell lung cancer.
Lin, Daoshu; Cheng, Qiang; Jiang, Qian; Huang, Yuanyu; Yang, Zheng; Han, Shangcong; Zhao, Yuning; Guo, Shutao; Liang, Zicai; Dong, Anjie
2013-05-21
A low cytotoxicity and high efficiency delivery system with the advantages of low cost and facile fabrication is needed for the application of small interfering RNA (siRNA) delivery both in vitro and in vivo. For these prerequisites, cationic polymer-mesoporous silica nanoparticles (ssCP-MSNs) were prepared by surface functionalized mesoporous silica nanoparticles with disulfide bond cross-linked poly(2-dimethylaminoethyl methacrylate) (PDMAEMA). In vitro and in vivo evaluations were performed. The synthesized ssCP-MSNs are 100-150 nm in diameter with a pore size of 10 nm and a positively charged surface with a high zeta potential of 27 mV. Consequently, the ssCP-MSNs showed an excellent binding capacity for siRNA, and an enhancement in the cell uptake and cytosolic availability of siRNA. Furthermore, the intracellular reducing cleavage of the disulfide bonds cross-linking the PDMAEMA segments led to intracellular cleavage of PDMAEMA from ssCP-MSNs, which facilitated the intracellular triggered release of siRNA. Therefore, promoted RNA interference was observed in HeLa-Luc cells, which was equal to that of Lipofectamine 2000. Significantly, compared to Lipofectamine 2000, the ssCP-MSNs were more biocompatible, with low cytotoxicity (even non-cytotoxicity) and promotion of cell proliferation to HeLa-Luc cells. The in vivo systemic distribution studies certified that ssCP-MSNs/siRNA could prolong the duration of siRNA in vivo, and that they accumulated in the adrenal gland, liver, lung, spleen, kidney, heart and thymus after intravenous injection. Encouragingly, with the ability to deliver siRNA to a tumor, ssCP-MSNs/siRNA showed a tumor suppression effect in the HeLa-Luc xenograft murine model after intravenous injection. Therefore, the ssCP-MSNs cationic polymer-mesoporous silica nanoparticles with low cytotoxicity are promising for siRNA delivery.
Wu, Jun-Yi; Wang, Zhong-Xia; Zhang, Guang; Lu, Xian; Qiang, Guang-Hui; Hu, Wei; Ji, An-Lai; Wu, Jun-Hua; Jiang, Chun-Ping
2018-01-01
FTY720, known as fingolimod, is a new immunosuppressive agent with effective anticancer properties. Although it was recently confirmed that FTY720 inhibits cancer cell proliferation, FTY720 can also induce protective autophagy and reduce cytotoxicity. Blocking autophagy with Beclin 1 siRNA after treatment with FTY720 promotes apoptosis. The objective of this study was to enhance the anticancer effect of FTY720 in hepatocellular carcinoma (HCC) by targeted co-delivery of FTY720 and Beclin 1 siRNA using calcium phosphate (CaP) nanoparticles (NPs). First, the siRNA was encapsulated within the CaP core. To form an asymmetric lipid bilayer structure, we then used an anionic lipid for the inner leaflet and a cationic lipid for the outer leaflet; after removing chloroform by rotary evaporation, these lipids were dispersed in a saline solution with FTY720. The NPs were analyzed by transmission electron microscopy, dynamic light scattering and ultraviolet-visible spectrophotometry. Cancer cell viability and cell death were analyzed by MTT assays, fluorescence-activated cell sorting analysis and Western blotting. In addition, the in vivo effects of the NPs were investigated using an athymic nude mouse subcutaneous transplantation tumor model. When the CaP NPs, called LCP-II NPs, were loaded with FTY720 and siRNA, they exhibited the expected size and were internalized by cells. These NPs were stable in systemic circulation. Furthermore, co-delivery of FTY720 and Beclin 1 siRNA significantly increased cytotoxicity in vitro and in vivo compared with that caused by treatment with the free drug alone. The CaP NP system can be further developed for co-delivery of FTY720 and Beclin 1 siRNA to treat HCC, enhancing the anticancer efficacy of FTY720. Our findings provide a new insight into HCC treatment with co-delivered small molecules and siRNA, and these results can be readily translated into cancer clinical trials.
Overcoming the Challenges of siRNA Delivery: Nanoparticle Strategies.
Shajari, Neda; Mansoori, Behzad; Davudian, Sadaf; Mohammadi, Ali; Baradaran, Behzad
2017-01-01
Despite therapeutics based on siRNA have an immense potential for the treatment of incurable diseases such as cancers. However, the in vivo utilization of siRNA and also the delivery of this agent to the target site is one of the most controversial challenges. The helpful assistance by nanoparticles can improve stable delivery and also enhance efficacy. More nanoparticle-based siRNA therapeutics is expected to become available in the near future. The search strategy followed the guidelines of the Centre of Reviews and Dissemination. The studies were identified from seven databases (Scopus, Web of Science, Academic Search Premiere, CINAHL, Medline Ovid, Eric and Cochrane Library). Studies was selected based on titles, abstracts and full texts. One hundred twenty nine papers were included in the review. These papers defined hurdles in RNAi delivery and also strategies to overcome these hurdles. This review discussed the existing hurdles for systemic administration of siRNA as therapeutic agents and highlights the various strategies to overcome these hurdles, including lipid-based nanoparticles and polymeric nanoparticles, and we also briefly reviewed chemical modification. Delivery of siRNA to the target site is the biggest challenge for its application in the clinic. The findings of this review confirmed by encapsulation siRNA in the nanoparticles can overcome these challenges. The rapid progress in nanotechnology has enabled the development of effective nanoparticles as the carrier for siRNA delivery. However, our data about siRNA-based therapeutics and also nanomedicine are still limited. More clinical data needs to be completely understood in the benefits and drawbacks of siRNA-based therapeutics. Prospective studies must pay attention to the in vivo safety profiles of the different delivery systems, including uninvited immune system stimulation and cytotoxicity. In essence, the development of nontoxic, biocompatible, and biodegradable delivery systems for medical application of RNAi-based therapeutics is needed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Jensen, Ditte Krohn; Jensen, Linda Boye; Koocheki, Saeid; Bengtson, Lasse; Cun, Dongmei; Nielsen, Hanne Mørck; Foged, Camilla
2012-01-10
Matrix systems based on biocompatible and biodegradable polymers like the United States Food and Drug Administration (FDA)-approved polymer poly(DL-lactide-co-glycolide acid) (PLGA) are promising for the delivery of small interfering RNA (siRNA) due to favorable safety profiles, sustained release properties and improved colloidal stability, as compared to polyplexes. The purpose of this study was to design a dry powder formulation based on cationic lipid-modified PLGA nanoparticles intended for treatment of severe lung diseases by pulmonary delivery of siRNA. The cationic lipid dioleoyltrimethylammoniumpropane (DOTAP) was incorporated into the PLGA matrix to potentiate the gene silencing efficiency. The gene knock-down level in vitro was positively correlated to the weight ratio of DOTAP in the particles, and 73% silencing was achieved in the presence of 10% (v/v) serum at 25% (w/w) DOTAP. Optimal properties were found for nanoparticles modified with 15% (w/w) DOTAP, which reduced the gene expression with 54%. This formulation was spray-dried with mannitol into nanocomposite microparticles of an aerodynamic size appropriate for lung deposition. The spray-drying process did not affect the physicochemical properties of the readily re-dispersible nanoparticles, and most importantly, the in vitro gene silencing activity was preserved during spray-drying. The siRNA content in the powder was similar to the theoretical loading and the siRNA was intact, suggesting that the siRNA is preserved during the spray-drying process. Finally, X-ray powder diffraction analysis demonstrated that mannitol remained in a crystalline state upon spray-drying with PLGA nanoparticles suggesting that the sugar excipient might exert its stabilizing effect by sterical inhibition of the interactions between adjacent nanoparticles. This study demonstrates that spray-drying is an excellent technique for engineering dry powder formulations of siRNA nanoparticles, which might enable the local delivery of biologically active siRNA directly to the lung tissue. Copyright © 2011 Elsevier B.V. All rights reserved.
FcepsilonRI-alpha siRNA inhibits the antigen-induced activation of mast cells.
Safaralizadeh, Reza; Soheili, Zahra-Soheila; Deezagi, Abdolkhaleg; Pourpak, Zahra; Samiei, Shahram; Moin, Mostafa
2009-12-01
FcepsilonRI, The high affinity receptor for IgE plays a critical role in triggering the allergic reactions. It is responsible for inducing mast cell degranulation and deliberation of allergy mediators when it is aggregated by allergen and IgE complexes. FcepsilonRI on the mast cells consists of three subunits; alpha chain directly binds IgE, beta chain and dimmer of gamma chains together mediate intracellular signaling. Cross-linking of IgE-bound FcepsilonRI on the surface of mast cells and basophils by the multivalent antigen induces release of chemical mediators. The present in vitro study was designed to investigate the effect of synthetic FcepsilonRI-alpha siRNA on the antigen-induced activation of MC/9 cells. MC/9 cells which are murine mast cells were transfected by FcepsilonRI-alpha siRNA and negative control siRNA. After 6 h, anti-DNP (Dinitrophenyl) IgE was used for the cells sensitization. Then the cells were challenged with Dinitrophenyl-Human Serum Albumin (DNP-HSA) for mast cell degranulation induction before collection of supernatants. The amount of mRNA and protein expression was measured by Real Time PCR and western blot analysis, respectively. Determination of the expression rate of FcepsilonRI-alpha on cell surface was achieved by flow cytometry. ELISA and spectrophotometry methods were used subsequently for measuring the effects of FcepsilonRI-alpha siRNA on antigen-induced histamine and beta-hexosaminidase release. FcepsilonRI-alpha siRNA treated cells showed significant decrease in FcepsilonRI-alpha mRNA and protein expression in comparison to control cells. FcepsilonRI-mediated mast cell release of beta-hexosaminidase and histamine were also inhibited. In this study it was shown that FcepsilonRI-alpha siRNA could suppress FcepsilonRI-alpha expression and inhibited degranulation and histamine release in antigen-stimulated MC/9 cells. In conclusion, knock-down of FcepsilonRI-alpha by siRNA could be a promising method for inhibition of the mast cell-mediated allergic reactions.
Mehta, Gaurav; Scheinman, Robert I.; Holers, V. Michael; Banda, Nirmal K.
2015-01-01
Rheumatoid Arthritis (RA) is an inflammatory autoimmune joint disease in which the complement system plays an important role. Of the several components of complement, current evidence points to C5 as the most important inducer of inflammation. Several groups generated antibodies or siRNAs or small molecule inhibitors against C5 and C5aR1 (CD88) which have showed some efficacy in RA in animal models. However, none of these candidate therapeutics has moved from bench to bedside. Here we test in CAIA a new therapeutic strategy using a novel anti-C5ab-C5 siRNA conjugate. We first demonstrate that while C5aR2 or C5L2 (GPR77) plays no role in collagen antibody induced arthritis (CAIA), C5aR1 contributes to pathogenesis. We demonstrate that injection of siRNAs blocking either C5, C5aR1 or the combination decreased clinical disease activity (CDA) in mice with CAIA by 45%, 51% and 58%, respectively. Anti-C5 antibody (BB5.1) has only limited efficacy nonetheless significantly reduced arthritis up to 66%. We then generated a novel anti-C5aR1ab-protamine-C5siRNA conjugate. Here we show for the first time that while unconjugated antibody plus siRNAs reduce arthritis by 19%, our an anti-C5aR1ab - protamine - C5 siRNA conjugate was effective in reducing arthritis by 83% along with a parallel decrease in histopathology, C3 deposition, neutrophils and macrophages in the joints of mice with CAIA. These data suggest that by targeting anti-C5 siRNAs to the receptor for its C5a activation fragment (C5aR1), a striking clinical effect can be realized. PMID:25917104
Kubota, Kohei; Onishi, Kohei; Sawaki, Kazuaki; Li, Tianshu; Mitsuoka, Kaoru; Sato, Takaaki; Takeoka, Shinji
2017-01-01
Two lipid-based nanoformulations have been used to date in clinical studies: lipoplexes and lipid nanoparticles (LNPs). In this study, we prepared small interfering RNA (siRNA)-loaded carriers using lipid components of the same composition to form molecular assemblies of differing structures, and evaluated the impact of structure on cellular uptake and immune stimulation. Lipoplexes are electrostatic complexes formed by mixing preformed cationic lipid liposomes with anionic siRNA in an aqueous environment, whereas LNPs are nanoparticles embedding siRNA prepared by mixing an alcoholic lipid solution with an aqueous siRNA solution in one step. Although the physicochemical properties of lipoplexes and LNPs were similar except for small increases in apparent size of lipoplexes and zeta potential of LNPs, siRNA uptake efficiency of LNPs was significantly higher than that of lipoplexes. Furthermore, in the case of LNPs, both siRNA and lipid were effectively incorporated into cells in a co-assembled state; however, in the case of lipoplexes, the amount of siRNA internalized into cells was small in comparison with lipid. siRNAs in lipoplexes were thought to be more likely to localize on the particle surface and thereby undergo dissociation into the medium. Inflammatory cytokine responses also appeared to differ between lipoplexes and LNPs. For tumor necrosis factor-α, release was mainly caused by siRNA. On the other hand, the release of interleukin-1β was mainly due to the cationic nature of particles. LNPs released lower amounts of tumor necrosis factor-α and interleukin-1β than lipoplexes and were thus considered to be better tolerated with respect to cytokine release. In conclusion, siRNA-loaded nanoformulations effect their cellular uptake and immune stimulation in a manner that depends on the structure of the molecular assembly; therefore, nanoformulations should be optimized before extending studies into the in vivo environment. PMID:28790820
Bioinformatics Analysis of Small RNAs in Pima (Gossypium barbadense L.)
Hu, Hongtao; Yu, Dazhao; Liu, Hong
2015-01-01
Small RNAs (sRNAs) are ~20 to 24 nucleotide single-stranded RNAs that play crucial roles in regulation of gene expression. In plants, sRNAs are classified into microRNAs (miRNAs), repeat-associated siRNAs (ra-siRNAs), phased siRNAs (pha-siRNAs), cis and trans natural antisense transcript siRNAs (cis- and trans-nat siRNAs). Pima (Gossypium barbadense L.) is one of the most economically important fiber crops, producing the best and longest spinnable fiber. Although some miRNAs are profiled in Pima, little is known about siRNAs, the largest subclass of plant sRNAs. In order to profile these gene regulators in Pima, a comprehensive analysis of sRNAs was conducted by mining publicly available sRNA data, leading to identification of 678 miRNAs, 3,559,126 ra-siRNAs, 627 pha-siRNAs, 136,600 cis-nat siRNAs and 79,994 trans-nat siRNAs. The 678 miRNAs, belonging to 98 conserved and 402 lineage-specific families, were produced from 2,138 precursors, of which 297 arose from introns, exons, or intron/UTR-exon junctions of protein-coding genes. Ra-siRNAs were produced from various repeat loci, while most (97%) were yielded from retrotransposons, especially LTRs (long terminal repeats). The genes encoding auxin-signaling-related proteins, NBS-LRRs and transcription factors were major sources of pha-siRNAs, while two conserved TAS3 homologs were found as well. Most cis-NATs in Pima overlapped in enclosed and convergent orientations, while a few hybridized in divergent and coincided orientations. Most cis- and trans-nat siRNAs were produced from overlapping regions. Additionally, characteristics of length and the 5’-first nucleotide of each sRNA class were analyzed as well. Results in this study created a valuable molecular resource that would facilitate studies on mechanism of controlling gene expression. PMID:25679373
Zhang, Kai; Sun, Bin; Wang, Lu; Meng, Lin; Liu, Qilin; Zheng, Changyu; Yang, Bai; Sun, Hongchen
2018-01-01
Oral cancer is a type of head and neck cancer that is the seventh most frequent cancer and the ninth most frequent cause of death globally. About 90% of oral cancer is of squamous cell carcinoma type. Surgery and radiation with and without chemotherapy are the major treatments for oral cancer. Better advanced treatment is still needed. Multidrug resistance plays an important role in failure of oral cancer chemotherapy. In this study, we tried to fabricate a novel nanoparticle that could carry both MDR1-siRNA to block MDR1 expression and doxorubicin (DOX), a chemotherapy drug, into cancer cells in order to directly kill the cells with little or no effect of multidrug resistance. Results showed that mesoporous silica nanoparticles (MSNP) can be modified by cationic polymerpolyethylenimine (PEI) to obtain positive charges on the surface, which could enable the MSNP to carry MDR1-siRNA and DOX. The transfection efficiency assays demonstrated that the MSNP-PEI-DOX/ MDR1-siRNA was efficiently transfected into KBV cells in vitro. KBV cells transfected with MSNP-PEI-DOX/MDR1-siRNA could effectively decrease gene expression of MDR1 (~70% increase after 72 hours posttreatment) and induce the apoptosis of KBV cells (24.27% after 48 hours posttreatment) in vitro. Importantly, MSNP-PEI-DOX/MDR1-siRNA dramatically reduced the tumor size (81.64% decrease after 28 days posttreatment) and slowed down tumor growth rate compared to the control group in vivo (P<0.05). In the aggregate, newly synthesized MSNP-PEI-DOX/MDR1-siRNA improves cancer chemotherapy effect in terms of treating multidrug-resistant cancer compared to DOX only, clearly demonstrating that MSNP-PEI-DOX/MDR1-siRNA has potential therapeutic application for multidrug-resistant cancer in the future. PMID:29343957
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Y.; Mirmalek-Sani, S.-H.; Yang, X.
2006-06-10
RNA interference (RNAi) has been used in functional genomics and offers innovative approaches in the development of novel therapeutics. Human mesenchymal stem cells offer a unique cell source for tissue engineering/regeneration strategies. The current study examined the potential of small interfering RNAs (siRNA) against human peroxisome proliferator activated receptor gamma (PPAR{gamma}) to suppress adipocyte differentiation (adipogenesis) in human preadipocytes and fetal-femur-derived mesenchymal cells. Adipogenesis was investigated using cellular and biochemical analysis. Transient transfection with PPAR{gamma}-siRNA using a liposomal-based strategy resulted in a significant inhibition of adipogenesis in human preadipocytes and fetal-femur-derived mesenchymal cells, compared to controls (cell, liposomal and negativemore » siRNA). The inhibitory effect of PPAR{gamma}-siRNA was supported by testing human PPAR{gamma} mRNA and adipogenic associated genes using reverse transcription polymerase chain reaction (RT-PCR) to adiponectin receptor 1 and 2 as well as examination of fatty acid binding protein 3 (FABP{sub 3}) expression, an adipocyte-specific marker. The current studies indicate that PPAR{gamma}-siRNA is a useful tool to study adipogenesis in human cells, with potential applications both therapeutic and in the elucidation of mesenchymal cell differentiation in the modulation of cell differentiation in human mesenchymal cells.« less
Garay, Camilo; Judge, Gurjeet; Lucarelli, Stefanie; Bautista, Stephen; Pandey, Rohan; Singh, Tanveer; Antonescu, Costin N.
2015-01-01
Epidermal growth factor (EGF) binding to its receptor (EGFR) activates several signaling intermediates, including Akt, leading to control of cell survival and metabolism. Concomitantly, ligand-bound EGFR is incorporated into clathrin-coated pits—membrane structures containing clathrin and other proteins—eventually leading to receptor internalization. Whether clathrin might regulate EGFR signaling at the plasma membrane before vesicle scission is poorly understood. We compared the effect of clathrin perturbation (preventing formation of, or receptor recruitment to, clathrin structures) to that of dynamin2 (allowing formation of clathrin structures but preventing EGFR internalization) under conditions in which EGFR endocytosis is clathrin dependent. Clathrin perturbation by siRNA gene silencing, with the clathrin inhibitor pitstop2, or knocksideways silencing inhibited EGF-simulated Gab1 and Akt phosphorylation in ARPE-19 cells. In contrast, perturbation of dynamin2 with inhibitors or by siRNA gene silencing did not affect EGF-stimulated Gab1 or Akt phosphorylation. EGF stimulation enriched Gab1 and phospho-Gab1 within clathrin structures. ARPE-19 cells have low ErbB2 expression, and overexpression and knockdown experiments revealed that robust ErbB2 expression bypassed the requirement for clathrin for EGF-stimulated Akt phosphorylation. Thus clathrin scaffolds may represent unique plasma membrane signaling microdomains required for signaling by certain receptors, a function that can be separated from vesicle formation. PMID:26246598
A theory of photometric stereo for a class of diffuse non-Lambertian surfaces
NASA Technical Reports Server (NTRS)
Tagare, Hemant D.; Defigueiredo, Rui J. P.
1991-01-01
A theory of photometric stereo is proposed for a large class of non-Lambertian reflectance maps. The authors review the different reflectance maps proposed in the literature for modeling reflection from real-world surfaces. From this, they obtain a mathematical class of reflectance maps to which the maps belong. They show that three lights can be sufficient for a unique inversion of the photometric stereo equation for the entire class of reflectance maps. They also obtain a constraint on the positions of light sources for obtaining this solution. They investigate the sufficiency of three light sources to estimate the surface normal and the illuminant strength. The issue of completeness of reconstruction is addressed. They shown that if k lights are sufficient for a unique inversion, 2k lights are necessary for a complete inversion.
S14 as a Therapeutic Target in Breast Cancer
2005-08-01
dimethylthiazol-2yl)-5-(3-carboxymethyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay (Promega). Oxidation of MTS by viable mitochondria yields a...potential mediators of the observed superinduction. The amplified signal could not be attributed to progestin induction of PPAR Gamma Coactivator-113 (PGC-lf3...quantitation of siRNA transfection efficiency, verification of localization of the siRNA to the interior of the cells, using more than one siRNA, and the
Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA
Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi
2012-01-01
Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184
Huzil, John Torin; Saliaj, Evi; Ivanova, Marina V; Gharagozloo, Marjan; Loureiro, Maria Jimena; Lamprecht, Constanze; Korinek, Andreas; Chen, Ding Wen; Foldvari, Marianna
2015-01-01
Background: The potential use of carbon nanotubes (CNTs) in gene therapy as delivery systems for nucleic acids has been recently recognized. Here, we describe that metallic versus semiconducting single-wall CNTs can produce significant differences in transfection rate and cellular distribution of siRNA in murine PAM212 keratinocytes. Results/Methodology: The results of cell interaction studies, coupled with supportive computational simulations and ultrastructural studies revealed that the use of metallic single wall CNTs resulted in siRNA delivery into both the cytoplasm and nucleus of keratinocytes, whereas semiconducting CNTs resulted in delivery only to the cytoplasm. Conclusion: Using enriched fractions of metallic or semiconducting CNTs for siRNA complex preparation may provide specific subcellular targeting advantages. PMID:28031892
Toward a national fuels mapping strategy: Lessons from selected mapping programs
Loveland, Thomas R.
2001-01-01
The establishment of a robust national fuels mapping program must be based on pertinent lessons from relevant national mapping programs. Many large-area mapping programs are under way in numerous Federal agencies. Each of these programs follows unique strategies to achieve mapping goals and objectives. Implementation approaches range from highly centralized programs that use tightly integrated standards and dedicated staff, to dispersed programs that permit considerable flexibility. One model facilitates national consistency, while the other allows accommodation of locally relevant conditions and issues. An examination of the programmatic strategies of four national vegetation and land cover mapping initiatives can identify the unique approaches, accomplishments, and lessons of each that should be considered in the design of a national fuel mapping program. The first three programs are the U.S. Geological Survey Gap Analysis Program, the U.S. Geological Survey National Land Cover Characterization Program, and the U.S. Fish and Wildlife Survey National Wetlands Inventory. A fourth program, the interagency Multiresolution Land Characterization Program, offers insights in the use of partnerships to accomplish mapping goals. Collectively, the programs provide lessons, guiding principles, and other basic concepts that can be used to design a successful national fuels mapping initiative.
Watanabe, Toshiaki; Takeda, Atsushi; Tsukiyama, Tomoyuki; Mise, Kazuyuki; Okuno, Tetsuro; Sasaki, Hiroyuki; Minami, Naojiro; Imai, Hiroshi
2006-01-01
Small RNAs ranging in size between 18 and 30 nucleotides (nt) are found in many organisms including yeasts, plants, and animals. Small RNAs are involved in the regulation of gene expression through translational repression, mRNA degradation, and chromatin modification. In mammals, microRNAs (miRNAs) are the only small RNAs that have been well characterized. Here, we have identified two novel classes of small RNAs in the mouse germline. One class consists of ∼20- to 24-nt small interfering RNAs (siRNAs) from mouse oocytes, which are derived from retroelements including LINE, SINE, and LTR retrotransposons. Addition of retrotransposon-derived sequences to the 3′ untranslated region (UTR) of a reporter mRNA destabilizes the mRNA significantly when injected into full-grown oocytes. These results suggest that retrotransposons are suppressed through the RNAi pathway in mouse oocytes. The other novel class of small RNAs is 26- to 30-nt germline small RNAs (gsRNAs) from testes. gsRNAs are expressed during spermatogenesis in a developmentally regulated manner, are mapped to the genome in clusters, and have strong strand bias. These features are reminiscent of Tetrahymena ∼23- to 24-nt small RNAs and Caenorhabditis elegans X-cluster small RNAs. A conserved novel small RNA pathway may be present in diverse animals. PMID:16766679
Mapping Your Way to Geographic Awareness: Part II
ERIC Educational Resources Information Center
Daniel Ness, Daniel; Diercks, Mark J.
2005-01-01
In last month's column, the authors examined the different kinds of maps that exist in everyday life. In this month's column, they experience, through simulation, the skills that are required of a cartographer. A cartographer is a person who practices the art of making maps. Cartographers' maps were often unique, visual representations of data.…
Comes, Nuria; Borrás, Teresa
2007-08-01
To investigate whether naked short-interfering RNA (siRNA) molecules could be directly delivered to perfused intact human trabecular meshwork (TM) tissue, whether this siRNA could silence a trabecular meshwork preferred gene, and whether it could counteract the downstream effect of a deleterious agent (dexamethasone, DEX) by silencing its receptor. Anterior segments from post-mortem normal human donors were perfused at 3.4+/-0.3 microl/min-constant flow or 15 mmHg-constant pressure to stable baseline (outflow facility, C=0.22+/-0.19 microl/min/mmHg; n=14). Commercial siRNAs were diluted in DMEM (Dulbecco's Modified Eagle's Medium) perfusion medium and used without coupling to transfection reagents ("naked"). Perfusion of Cy3-labeled siRNA was performed at 100 nM for 48 h followed by 24 h with DMEM medium (two pairs). Perfusions of Matrix GLA protein (MGP) siRNA (100 nM; right eye [Oculus Dexter]; OD) and scramble-siRNA (control; left eye [Oculus Sinster]; OS) were performed for 48 h (two pairs). Perfusions of glucocorticoid receptor (GR)-siRNA (OD) and scramble-control (OS) were performed for 48 h and continued by adding 100 nM DEX to the perfusion media for an additional 24 h (two pairs). Frozen sections of labeled anterior segments were analyzed by confocal fluorescence microscopy. Differential expression of GR, MGP, myocilin (MYOC), cornea-derived transcript 6 (CDT6), and 18S genes was determined by reverse-transcriptase TaqMan polymerase chain reacion (RT-TaqMan PCR) on RNA extracted from dissected trabecular meshwork. Primary human trabecular meshwork cells were generated from single individuals and transfected using the nucleofector electroporator with program T-23. Levels of secreted MYOC in the effluents were analyzed by western blot. Histological evaluation of anterior segments perfused with Cy3 labeled siRNA followed by unlabeled medium showed intense fluorescence in the trabecular meshwork region. MGP gene expression was silenced in the trabecular meshwork perfused with naked MGP siRNA. MGP transcripts were reduced 94.7% +/- 0.62 (individual 3) and 93.6% +/- 0.13 (individual 4) from those present in the contralateral eye perfused with the scramble control. Pretreatment of GR siRNA followed by DEX treatment caused a reduction of the MYOC and CDT6 gene expressions when compared with eyes pretreated with scramble-control (percent silencing: 99.3% +/- 0.005 and 97.3% +/- 0.25, respectively, for individual 5 and 98.2% +/- 0.06 and 85.6% +/- 0.88, respectively, for individual 6). Western blots revealed the decrease of MYOC secreted by GR siRNA-treated cell and organ cultures. Readily available siRNA can be delivered to the intact human trabecular meshwork by intracameral perfusion. The delivered naked siRNA is functional, inhibiting not only the targeted gene but also their downstream effectors. This functional intracameral delivery might be of use to protect the trabecular meshwork from unwanted insults and could have important therapeutic applications.
No significant impact of Foxf1 siRNA treatment in acute and chronic CCl4 liver injury.
Abshagen, Kerstin; Rotberg, Tobias; Genz, Berit; Vollmar, Brigitte
2017-08-01
Chronic liver injury of any etiology is the main trigger of fibrogenic responses and thought to be mediated by hepatic stellate cells. Herein, activating transcription factors like forkhead box f1 are described to stimulate pro-fibrogenic genes in hepatic stellate cells. By using a liver-specific siRNA delivery system (DBTC), we evaluated whether forkhead box f1 siRNA treatment exhibit beneficial effects in murine models of acute and chronic CCl 4 -induced liver injury. Systemic administration of DBTC-forkhead box f1 siRNA in mice was only sufficient to silence forkhead box f1 in acute CCl 4 model, but was not able to attenuate liver injury as measured by liver enzymes and necrotic liver cell area. Therapeutic treatment of mice with DBTC-forkhead box f1 siRNA upon chronic CCl 4 exposition failed to inhibit forkhead box f1 expression and hence lacked to diminish hepatic stellate cells activation or fibrosis development. As a conclusion, DBTC-forkhead box f1 siRNA reduced forkhead box f1 expression in a model of acute but not chronic toxic liver injury and showed no positive effects in either of these mice models. Impact statement As liver fibrosis is a worldwide health problem, antifibrotic therapeutic strategies are urgently needed. Therefore, further developments of new technologies including validation in different experimental models of liver disease are essential. Since activation of hepatic stellate cells is a key event upon liver injury, the activating transcription factor forkhead box f1 (Foxf1) represents a potential target gene. Previously, we evaluated Foxf1 silencing by a liver-specific siRNA delivery system (DBTC), exerting beneficial effects in cholestasis. The present study was designed to confirm the therapeutic potential of Foxf1 siRNA in models of acute and chronic CCl 4 -induced liver injury. DBTC-Foxf1 siRNA was only sufficient to silence Foxf1 in acute CCl 4 model and did not ameliorate liver injury or fibrogenesis. This underlines the significance of the experimental model used. Each model displays specific characteristics in the pathogenic nature, time course and severity of fibrosis and the optimal time point for starting a therapy.
Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process
Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana
2009-01-01
Purpose There are no selective antagonists for the metabotropic nucleotide P2Y2 receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y2 receptor (P2Y2-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Methods Rabbit P2Y2-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y2-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT–PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y2 agonist, 100 μM Ap4A (diadenosine tetraphosphate). Results The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y2-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y2-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y2-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap4A. In addition, both synthesized siRNAs exert a delay effect on the Ap4A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. Conclusions The application of P2Y2-R siRNA has demonstrated the role of this receptor in the accelerating effect of diadenosine tetraphosphate (Ap4A) on the corneal wound healing process. PMID:19521552
Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process.
Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana; Pintor, Jesús
2009-06-11
There are no selective antagonists for the metabotropic nucleotide P2Y(2) receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y(2) receptor (P2Y(2)-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Rabbit P2Y(2)-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y(2)-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT-PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y(2) agonist, 100 muM Ap(4)A (diadenosine tetraphosphate). The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y(2)-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y(2)-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y(2)-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap(4)A. In addition, both synthesized siRNAs exert a delay effect on the Ap(4)A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. The application of P2Y(2)-R siRNA has demonstrated the role of this receptor in the accelerating effect of diadenosine tetraphosphate (Ap(4)A) on the corneal wound healing process.
Poly (amidoamine) (PAMAM) dendrimer mediated delivery of drug and pDNA/siRNA for cancer therapy.
Li, Jun; Liang, Huamin; Liu, Jing; Wang, Ziyuan
2018-07-30
Poly (amidoamine) (PAMAM) dendrimers are well-defined, highly branched macromolecules with numerous active amine groups on the surface. Because of their unique properties, PAMAM dendrimers have steadily grown in popularity in drug delivery, gene therapy, medical imaging and diagnostic application. This review focuses on the recent developments on the application in PAMAM dendrimers as effective carriers for drug and gene (pDNA, siRNA) delivery in cancer therapy, including: a) PAMAM for anticancer drug delivery; b) PAMAM and gene therapy; c) PAMAM used in overcoming tumor multidrug resistance; d) PAMAM used for hybrid nanoparticles; and e) PAMAM linked or loaded in other nanoparticles. Copyright © 2018 Elsevier B.V. All rights reserved.
Small-Interfering RNA–Eluting Surfaces as a Novel Concept for Intravascular Local Gene Silencing
Nolte, Andrea; Walker, Tobias; Schneider, Martina; Kray, Oya; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans Peter
2011-01-01
New drug-eluting stent (DES) methods have recently been demonstrated to improve outcomes of intravascular interventions. A novel technique is the design of gene-silencing stents that elute specific small-interfering RNAs (siRNAs) for better vascular wall regeneration. Although siRNAs used to alter gene expression have surpassed expectations in in vitro experiments, the functional and local delivery of siRNAs is still the major obstacle for the in vivo application of RNA interference. In this preliminary in vitro study we investigated a surface-immobilized siRNA delivery technique that would be readily adaptable for local intravascular applications in vivo. The transfection potency of gelatin coatings consisting of a specific siRNA complexed with polyethylenimine (PEI) was examined in primary human endothelial cells by flow cytometry and quantitative real-time polymerase chain reaction. Several media conditions, such as the presence or absence of serum during cultivation, were investigated. Furthermore, different siRNA and PEI amounts, as well as nitrogen/phosphate ratios, were tested for their transfection efficiency. Gelatin coatings consisting of PEI and siRNA against an exemplary endothelial adhesion molecule receptor achieved a significant knockdown of around 70%. The transfection efficiency of the coatings was not influenced by the presence of serum. The results of this preliminary study support the expectation that this novel coating may be favorable for local in vivo gene silencing (for example, when immobilized on stents or balloons for percutanous transluminal coronary angioplasty). However, further animal experiments are needed to confirm the translation into clinical practice. This intriguing technology leads the way to more sophisticated and individualized coatings for the post-DES era, toward silencing of genes involved in the pathway of intimal hyperplasia. PMID:21792480
Arnold, Anne-Sophie; Tang, Yao Liang; Qian, Keping; Shen, Leping; Valencia, Valery; Phillips, Michael Ian; Zhang, Yuan Clare
2007-01-01
Beta-blockers are widely used and effective for treating hypertension, acute myocardial infarction (MI) and heart failure, but they present side-effects mainly due to antagonism of beta2-adrenergic receptor (AR). Currently available beta-blockers are at best selective but not specific for beta1 or beta2-AR. To specifically inhibit the expression of the beta1-AR, we developed a small interfering RNA (siRNA) targeted to beta1-AR. Three different sequences of beta1 siRNA were delivered into C6-2B cells with 90% efficiency. One of the three sequences reduced the level of beta1-AR mRNA by 70%. The siRNA was highly specific for beta1-AR inhibition with no overlap with beta2-AR. To test this in vivo, systemic injection of beta1 siRNA complexed with liposomes resulted in efficient delivery into the heart, lung, kidney and liver, and effectively reduced beta1-AR expression in the heart without altering beta2-AR. beta1 siRNA significantly lowered blood pressure of spontaneously hypertensive rats (SHR) for at least 12 days and reduced cardiac hypertrophy following a single injection. Pretreatment with beta1 siRNA 3 days before induction of MI in Wistar rats significantly improved cardiac function, as demonstrated by dP/dt and electrocardiogram following the MI. The protective mechanism involved reduction of cardiomyocyte apoptosis in the beta1 siRNA-treated hearts. The present study demonstrates the possibility of using siRNA for treating cardiovascular diseases and may represent a novel beta-blocker specific for beta1-AR.
Screening Nylon-3 Polymers, a New Class of Cationic Amphiphiles, for siRNA Delivery
2015-01-01
Amphiphilic nucleic acid carriers have attracted strong interest. Three groups of nylon-3 copolymers (poly-β-peptides) possessing different cationic/hydrophobic content were evaluated as siRNA delivery agents in this study. Their ability to condense siRNA was determined in SYBR Gold assays. Their cytotoxicity was tested by MTT assays, their efficiency of delivering Alexa Fluor-488-labeled siRNA intracellularly in the presence and absence of uptake inhibitors was assessed by flow cytometry, and their transfection efficacies were studied by luciferase knockdown in a cell line stably expressing luciferase (H1299/Luc). Endosomal release was determined by confocal laser scanning microscopy and colocalization with lysotracker. All polymers efficiently condensed siRNA at nitrogen-to-phosphate (N/P) ratios of 5 or lower, as reflected in hydrodynamic diameters smaller than that at N/P 1. Although several formulations had negative zeta potentials at N/P 1, G2C and G2D polyplexes yielded >80% uptake in H1299/Luc cells, as determined by flow cytometry. Luciferase knockdown (20–65%) was observed after transfection with polyplexes made of the high molecular weight polymers that were the most hydrophobic. The ability of nylon-3 polymers to deliver siRNA intracellularly even at negative zeta potential implies that they mediate transport across cell membranes based on their amphiphilicity. The cellular uptake route was determined to strongly depend on the presence of cholesterol in the cell membrane. These polymers are, therefore, very promising for siRNA delivery at reduced surface charge and toxicity. Our study identified nylon-3 formulations at low N/P ratios for effective gene knockdown, indicating that nylon-3 polymers are a new, promising type of gene delivery agent. PMID:25437915
Diez, Concepcion M.; Meca, Esteban; Tenaillon, Maud I.; Gaut, Brandon S.
2014-01-01
Most angiosperm nuclear DNA is repetitive and derived from silenced transposable elements (TEs). TE silencing requires substantial resources from the plant host, including the production of small interfering RNAs (siRNAs). Thus, the interaction between TEs and siRNAs is a critical aspect of both the function and the evolution of plant genomes. Yet the co-evolutionary dynamics between these two entities remain poorly characterized. Here we studied the organization of TEs within the maize (Zea mays ssp mays) genome, documenting that TEs fall within three groups based on the class and copy numbers. These groups included DNA elements, low copy RNA elements and higher copy RNA elements. The three groups varied statistically in characteristics that included length, location, age, siRNA expression and 24∶22 nucleotide (nt) siRNA targeting ratios. In addition, the low copy retroelements encompassed a set of TEs that had previously been shown to decrease expression within a 24 nt siRNA biogenesis mutant (mop1). To investigate the evolutionary dynamics of the three groups, we estimated their abundance in two landraces, one with a genome similar in size to that of the maize reference and the other with a 30% larger genome. For all three accessions, we assessed TE abundance as well as 22 nt and 24 nt siRNA content within leaves. The high copy number retroelements are under targeted similarly by siRNAs among accessions, appear to be born of a rapid bust of activity, and may be currently transpositionally dead or limited. In contrast, the lower copy number group of retrolements are targeted more dynamically and have had a long and ongoing history of transposition in the maize genome. PMID:24743518
Screening nylon-3 polymers, a new class of cationic amphiphiles, for siRNA delivery.
Nadithe, Venkatareddy; Liu, Runhui; Killinger, Bryan A; Movassaghian, Sara; Kim, Na Hyung; Moszczynska, Anna B; Masters, Kristyn S; Gellman, Samuel H; Merkel, Olivia M
2015-02-02
Amphiphilic nucleic acid carriers have attracted strong interest. Three groups of nylon-3 copolymers (poly-β-peptides) possessing different cationic/hydrophobic content were evaluated as siRNA delivery agents in this study. Their ability to condense siRNA was determined in SYBR Gold assays. Their cytotoxicity was tested by MTT assays, their efficiency of delivering Alexa Fluor-488-labeled siRNA intracellularly in the presence and absence of uptake inhibitors was assessed by flow cytometry, and their transfection efficacies were studied by luciferase knockdown in a cell line stably expressing luciferase (H1299/Luc). Endosomal release was determined by confocal laser scanning microscopy and colocalization with lysotracker. All polymers efficiently condensed siRNA at nitrogen-to-phosphate (N/P) ratios of 5 or lower, as reflected in hydrodynamic diameters smaller than that at N/P 1. Although several formulations had negative zeta potentials at N/P 1, G2C and G2D polyplexes yielded >80% uptake in H1299/Luc cells, as determined by flow cytometry. Luciferase knockdown (20-65%) was observed after transfection with polyplexes made of the high molecular weight polymers that were the most hydrophobic. The ability of nylon-3 polymers to deliver siRNA intracellularly even at negative zeta potential implies that they mediate transport across cell membranes based on their amphiphilicity. The cellular uptake route was determined to strongly depend on the presence of cholesterol in the cell membrane. These polymers are, therefore, very promising for siRNA delivery at reduced surface charge and toxicity. Our study identified nylon-3 formulations at low N/P ratios for effective gene knockdown, indicating that nylon-3 polymers are a new, promising type of gene delivery agent.
Environmental RNAi in herbivorous insects.
Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R
2015-05-01
Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Abdul Ghafoor Raja, Maria; Katas, Haliza; Jing Wen, Thum
2015-01-01
Chitosan (CS) nanoparticles have been extensively studied for siRNA delivery; however, their stability and efficacy are highly dependent on the types of cross-linker used. To address this issue, three common cross-linkers; tripolyphosphate (TPP), dextran sulphate (DS) and poly-D-glutamic acid (PGA) were used to prepare siRNA loaded CS-TPP/DS/PGA nanoparticles by ionic gelation method. The resulting nanoparticles were compared with regard to their physicochemical properties including particle size, zeta potential, morphology, binding and encapsulation efficiencies. Among all the formulations prepared with different cross linkers, CS-TPP-siRNA had the smallest particle size (ranged from 127 ± 9.7 to 455 ± 12.9 nm) with zeta potential ranged from +25.1 ± 1.5 to +39.4 ± 0.5 mV, and high entrapment (>95%) and binding efficiencies. Similarly, CS-TPP nanoparticles showed better siRNA protection during storage at 4˚C and as determined by serum protection assay. TEM micrographs revealed the assorted morphology of CS-TPP-siRNA nanoparticles in contrast to irregular morphology displayed by CS-DS-siRNA and CS-PGA-siRNA nanoparticles. All siRNA loaded CS-TPP/DS/PGA nanoparticles showed initial burst release followed by sustained release of siRNA. Moreover, all the formulations showed low and concentration-dependent cytotoxicity with human colorectal cancer cells (DLD-1), in vitro. The cellular uptake studies with CS-TPP-siRNA nanoparticles showed successful delivery of siRNA within cytoplasm of DLD-1 cells. The results demonstrate that ionically cross-linked CS-TPP nanoparticles are biocompatible non-viral gene delivery system and generate a solid ground for further optimization studies, for example with regard to steric stabilization and targeting. PMID:26068222
Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk
2012-03-10
p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)-Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh-Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3-p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expressionmore » of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2-p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.« less
Targeted polymeric micelles for siRNA treatment of experimental cancer by intravenous injection.
Christie, R James; Matsumoto, Yu; Miyata, Kanjiro; Nomoto, Takahiro; Fukushima, Shigeto; Osada, Kensuke; Halnaut, Julien; Pittella, Frederico; Kim, Hyun Jin; Nishiyama, Nobuhiro; Kataoka, Kazunori
2012-06-26
Small interfering ribonucleic acid (siRNA) cancer therapies administered by intravenous injection require a delivery system for transport from the bloodstream into the cytoplasm of diseased cells to perform the function of gene silencing. Here we describe nanosized polymeric micelles that deliver siRNA to solid tumors and elicit a therapeutic effect. Stable multifunctional micelle structures on the order of 45 nm in size formed by spontaneous self-assembly of block copolymers with siRNA. Block copolymers used for micelle formation were designed and synthesized to contain three main features: a siRNA binding segment containing thiols, a hydrophilic nonbinding segment, and a cell-surface binding peptide. Specifically, poly(ethylene glycol)-block-poly(L-lysine) (PEG-b-PLL) comprising lysine amines modified with 2-iminothiolane (2IT) and the cyclo-Arg-Gly-Asp (cRGD) peptide on the PEG terminus was used. Modification of PEG-b-PLL with 2IT led to improved control of micelle formation and also increased stability in the blood compartment, while installation of the cRGD peptide improved biological activity. Incorporation of siRNA into stable micelle structures containing the cRGD peptide resulted in increased gene silencing ability, improved cell uptake, and broader subcellular distribution in vitro and also improved accumulation in both the tumor mass and tumor-associated blood vessels following intravenous injection into mice. Furthermore, stable and targeted micelles inhibited the growth of subcutaneous HeLa tumor models and demonstrated gene silencing in the tumor mass following treatment with antiangiogenic siRNAs. This new micellar nanomedicine could potentially expand the utility of siRNA-based therapies for cancer treatments that require intravenous injection.
Dual peptide-mediated targeted delivery of bioactive siRNAs to oral cancer cells in vivo.
Alexander-Bryant, Angela A; Zhang, Haiwen; Attaway, Christopher C; Pugh, William; Eggart, Laurence; Sansevere, Robert M; Andino, Lourdes M; Dinh, Lu; Cantini, Liliana P; Jakymiw, Andrew
2017-09-01
Despite significant advances in cancer treatment, the prognosis for oral cancer remains poor in comparison to other cancer types, including breast, skin, and prostate. As a result, more effective therapeutic modalities are needed for the treatment of oral cancer. Consequently, in the present study, we examined the feasibility of using a dual peptide carrier approach, combining an epidermal growth factor receptor (EGFR)-targeting peptide with an endosome-disruptive peptide, to mediate targeted delivery of small interfering RNAs (siRNAs) into EGFR-overexpressing oral cancer cells and induce silencing of the targeted oncogene, cancerous inhibitor of protein phosphatase 2A (CIP2A). Fluorescence microscopy, real-time PCR, Western blot analysis, and in vivo bioimaging of mice containing orthotopic xenograft tumors were used to examine the ability of the dual peptide carrier to mediate specific delivery of bioactive siRNAs into EGFR-overexpressing oral cancer cells/tissues. Co-complexation of the EGFR-targeting peptide, GE11R9, with the endosome-disruptive 599 peptide facilitated the specific uptake of siRNAs into oral cancer cells overexpressing EGFR in vitro with optimal gene silencing observed at a 60:30:1 (GE11R9:599:siRNA) molar ratio. Furthermore, when administered systemically to mice bearing xenograft oral tumors, this dual peptide complex mediated increased targeted delivery of siRNAs into tumor tissues in comparison to the 599 peptide alone and significantly enhanced CIP2A silencing. Herein we provide the first report demonstrating the clinical potential of a dual peptide strategy for siRNA-based therapeutics by synergistically mediating the effective targeting and delivery of bioactive siRNAs into EGFR-overexpressing oral cancer cells. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cun, Dongmei; Jensen, Ditte Krohn; Maltesen, Morten Jonas; Bunker, Matthew; Whiteside, Paul; Scurr, David; Foged, Camilla; Nielsen, Hanne Mørck
2011-01-01
Poly(DL-lactide-co-glycolide acid) (PLGA) is an attractive polymer for delivery of biopharmaceuticals owing to its biocompatibility, biodegradability and outstanding controlled release characteristics. The purpose of this study was to understand and define optimal parameters for preparation of small interfering RNA (siRNA)-loaded PLGA nanoparticles by the double emulsion solvent evaporation method and characterize their properties. The experiments were performed according to a 2(5-1) fractional factorial design based on five independent variables: The volume ratio between the inner water phase and the oil phase, the PLGA concentration, the sonication time, the siRNA load and the amount of acetylated bovine serum albumin (Ac-BSA) in the inner water phase added to stabilize the primary emulsion. The effects on the siRNA encapsulation efficiency and the particle size were investigated. The most important factors for obtaining an encapsulation efficiency as high as 70% were the PLGA concentration and the volume ratio whereas the size was mainly affected by the PLGA concentration. The viscosity of the oil phase was increased at high PLGA concentration, which explains the improved encapsulation by stabilization of the primary emulsion and reduction of siRNA leakage to the outer water phase. Addition of Ac-BSA increased the encapsulation efficiency at low PLGA concentrations. The PLGA matrix protected siRNA against nuclease degradation, provided a burst release of surface-localized siRNA followed by a triphasic sustained release for two months. These results enable careful understanding and definition of optimal process parameters for preparation of PLGA nanoparticles encapsulating high amounts of siRNA with immediate and long-term sustained release properties. Copyright © 2010 Elsevier B.V. All rights reserved.
Diatomite biosilica nanocarriers for siRNA transport inside cancer cells.
Rea, Ilaria; Martucci, Nicola M; De Stefano, Luca; Ruggiero, Immacolata; Terracciano, Monica; Dardano, Principia; Migliaccio, Nunzia; Arcari, Paolo; Taté, Rosarita; Rendina, Ivo; Lamberti, Annalisa
2014-12-01
Diatomite is a natural porous biomaterial of sedimentary origin, formed by fragments of diatom siliceous skeletons, called "frustules". Due to large availability in many areas of the world, chemical stability, and non-toxicity, these fossil structures have been widespread used in lot of industrial applications, such as food production, water extracting agent, production of cosmetics and pharmaceutics. However, diatomite is surprisingly still rarely used in biomedical applications. In this work, we exploit diatomite nanoparticles for small interfering ribonucleic acid (siRNA) transport inside human epidermoid cancer cells (H1355). Morphology and composition of diatomite microfrustules (average size lower than 40μm) are investigated by scanning electron microscopy equipped by energy dispersive X-ray spectroscopy, Fourier transform infrared analysis, and photoluminescence measurements. Nanometric porous particles (average size lower than 450nm) are obtained by mechanical crushing, sonication, and filtering of micrometric frustules. siRNA bioconjugation is performed on both micrometric and nanometric fragments by silanization. In-vitro experiments show very low toxicity on exposure of the cells to diatomite nanoparticle concentration up to 300μg/ml for 72h. Confocal microscopy imaging performed on cancer cells incubated with siRNA conjugated nanoparticles demonstrates a cytoplasmatic localization of vectors. Gene silencing by delivered siRNA is also demonstrated. Our studies endorse diatomite nanoparticles as non-toxic nanocarriers for siRNA transport in cancer cells. siRNA is a powerful molecular tool for cancer treatment but its delivery is inefficient due to the difficulty to penetrate the cell membrane. siRNA-diatomite nanoconjugate may be well suited for delivery of therapeutic to cancer cells. Copyright © 2014 Elsevier B.V. All rights reserved.
Novel targets for sensitizing breast cancer cells to TRAIL-induced apoptosis with siRNA delivery.
Thapa, Bindu; Bahadur Kc, Remant; Uludağ, Hasan
2018-02-01
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in variety of cancer cells without affecting most normal cells, which makes it a promising agent for cancer therapy. However, TRAIL therapy is clinically not effective due to resistance induction. To identify novel regulators of TRAIL that can aid in therapy, protein targets whose silencing sensitized breast cancer cells against TRAIL were screened with an siRNA library against 446 human apoptosis-related proteins in MDA-231 cells. Using a cationic lipopolymer (PEI-αLA) for delivery of library members, 16 siRNAs were identified that sensitized the TRAIL-induced death in MDA-231 cells. The siRNAs targeting BCL2L12 and SOD1 were further evaluated based on the novelty and their ability to sensitize TRAIL induced cell death. Silencing both targets sensitized TRAIL-mediated cell death in MDA-231 cells as well as TRAIL resistant breast cancer cells, MCF-7. Combination of TRAIL and siRNA silencing BCL2L12 had no effect in normal human umbilical vein cells and human bone marrow stromal cell. The silencing of BCL2L12 and SOD1 enhanced TRAIL-mediated apoptosis in MDA-231 cells via synergistically activating capsase-3 activity. Hence, here we report siRNAs targeting BCL2L12 and SOD1 as a novel regulator of TRAIL-induced cell death in breast cancer cells, providing a new approach for enhancing TRAIL therapy for breast cancer. The combination of siRNA targeting BCL2L12 and TRAIL can be a highly effective synergistic pair in breast cancer cells with minimal effect on the non-transformed cells. © 2017 UICC.
Arami, Sanam; Mahdavi, Majid; Rashidi, Mohammad-Reza; Yekta, Reza; Rahnamay, Mohammad; Molavi, Leila; Hejazi, Mohammad-Saeid; Samadi, Nasser
2017-08-05
Delivery of small interfering RNAs (siRNAs) into cells still remains a challenge in gene delivery studies. Here, we investigated the ability of synthesized Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles for siRNA delivery of survivin as the model gene into cells. The cellular uptake of survivin siRNA carried by synthesized nanoparticles into MCF-7 breast cancer cell line was evaluated by florescent microscopy and flowcytometry, both proving the efficacy of nanoparticles in delivery of up to 64.7% in comparison with lipofectamine 2000. Furthermore, the delivery of survivin siRNA by the nanoparticles (nanoplex) induced apoptosis that was assessed through DAPI staining and Annexin V/PI assays. In addition, we evaluated the efficacy of treatment with nanoplexes in the presence of mitoxantrone, as a chemotherapeutic agent. Our data indicated that inhibition of survivin expression increased the cell sensitivity to mitoxantrone. Real-time PCR and western blotting analysis revealed a significant reduction in mRNA and protein levels of survivin upon delivery of siRNA. Molecular docking studies showed that nanoparticles can bind to centeral BIR domain of survivin, exactly above zinc ion location with high affinity (ΔG: -10.3Kcal/mol). Also, thermodynamic studies proved the experimental results theoretically, revealing that the siRNA-loaded nanoparticles have a suppressing effect on survivin mRNA. Therefore, delivery of survivin siRNA into MCF-7 cells using Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles as a carrier enhances the cell death. Copyright © 2017 Elsevier B.V. All rights reserved.
Wei, Liya; Gu, Lianfeng; Song, Xianwei; Cui, Xiekui; Lu, Zhike; Zhou, Ming; Wang, Lulu; Hu, Fengyi; Zhai, Jixian; Meyers, Blake C.; Cao, Xiaofeng
2014-01-01
Transposable elements (TEs) and repetitive sequences make up over 35% of the rice (Oryza sativa) genome. The host regulates the activity of different TEs by different epigenetic mechanisms, including DNA methylation, histone H3K9 methylation, and histone H3K4 demethylation. TEs can also affect the expression of host genes. For example, miniature inverted repeat TEs (MITEs), dispersed high copy-number DNA TEs, can influence the expression of nearby genes. In plants, 24-nt small interfering RNAs (siRNAs) are mainly derived from repeats and TEs. However, the extent to which TEs, particularly MITEs associated with 24-nt siRNAs, affect gene expression remains elusive. Here, we show that the rice Dicer-like 3 homolog OsDCL3a is primarily responsible for 24-nt siRNA processing. Impairing OsDCL3a expression by RNA interference caused phenotypes affecting important agricultural traits; these phenotypes include dwarfism, larger flag leaf angle, and fewer secondary branches. We used small RNA deep sequencing to identify 535,054 24-nt siRNA clusters. Of these clusters, ∼82% were OsDCL3a-dependent and showed significant enrichment of MITEs. Reduction of OsDCL3a function reduced the 24-nt siRNAs predominantly from MITEs and elevated expression of nearby genes. OsDCL3a directly targets genes involved in gibberellin and brassinosteroid homeostasis; OsDCL3a deficiency may affect these genes, thus causing the phenotypes of dwarfism and enlarged flag leaf angle. Our work identifies OsDCL3a-dependent 24-nt siRNAs derived from MITEs as broadly functioning regulators for fine-tuning gene expression, which may reflect a conserved epigenetic mechanism in higher plants with genomes rich in dispersed repeats or TEs. PMID:24554078
INTRARENAL GHRELIN RECEPTOR INHIBITION AMELIORATES ANGIOTENSIN II-DEPENDENT HYPERTENSION IN RATS.
Kemp, Brandon A; Howell, Nancy L; Padia, Shetal H
2018-06-20
The intrarenal ghrelin receptor (GR) is localized to collecting duct (CD) cells where it increases αENaC-dependent sodium reabsorption in rodents. We hypothesized that chronic GR inhibition with intrarenal GR siRNA lowers blood pressure (BP) in Angiotensin II-dependent hypertension via reductions in αENaC-dependent sodium reabsorption. Uninephrectomized Sprague-Dawley rats (N=121) received subcutaneous osmotic pumps for chronic systemic delivery of Angiotensin II or vehicle (5% dextrose in water). Rats also received intrarenal infusion of vehicle, GR siRNA, or scrambled (SCR) siRNA. In rats receiving intrarenal vehicle or intrarenal SCR siRNA, systemic Angiotensin II infusion increased sodium retention and BP on day 1, and BP remained elevated throughout the 5-day study. These rats also demonstrated increased CD GR expression after 5 days of infusion. However, intrarenal GR siRNA infusion prevented Angiotensin II-mediated sodium retention on day 1, induced a continuously negative cumulative sodium balance compared with Angiotensin II alone, and reduced BP chronically. Glomerular filtration rate and renal blood flow remained unchanged in GR siRNA-infused rats. Systemic Angiotensin II infusion also increased serum aldosterone levels, CD αENaC and pSGK1 expression in rats with intrarenal SCR siRNA; however these effects were not observed in the presence of intrarenal GR siRNA, despite exposure to the same systemic Angiotensin II. These data demonstrate that chronic inhibition of intrarenal GR activity significantly reduces αENaC -dependent sodium retention, resulting in a negative cumulative sodium balance, thereby ameliorating Angiotensin II-induced hypertension in rats. Renal GRs represent a novel therapeutic target for the treatment of hypertension and other sodium-retaining states.
Ely, Abdullah; ul Islam, Rafique; Barichievy, Samantha; Bloom, Kristie; Weinberg, Marc S; van Otterlo, Willem AL; de Koning, Charles B; Salazar, Felix; Marion, Patricia; Roesch, Eric B; LeMaitre, Marc; Herdewijn, Piet
2010-01-01
Chronic infection with the hepatitis B virus (HBV) occurs in approximately 6% of the world's population and carriers of the virus are at risk for complicating hepatocellular carcinoma. Current treatment options have limited efficacy and chronic HBV infection is likely to remain a significant global medical problem for many years to come. Silencing HBV gene expression by harnessing RNA interference (RNAi) presents an attractive option for development of novel and effective anti HBV agents. However, despite significant and rapid progress, further refinement of existing technologies is necessary before clinical application of RNAi-based HBV therapies is realized. Limiting off target effects, improvement of delivery efficiency, dose regulation and preventing reactivation of viral replication are some of the hurdles that need to be overcome. To address this, we assessed the usefulness of the recently described class of altritol-containing synthetic siRNAs (ANA siRNAs), which were administered as lipoplexes and tested in vivo in a stringent HBV transgenic mouse model. Our observations show that ANA siRNAs are capable of silencing of HBV replication in vivo. Importantly, non specific immunostimulation was observed with unmodified siRNAs and this undesirable effect was significantly attenuated by ANA modification. Inhibition of HBV replication of approximately 50% was achieved without evidence for induction of toxicity. These results augur well for future application of ANA siRNA therapeutic lipoplexes. PMID:21687523
Co-delivery of curcumin and STAT3 siRNA using deformable cationic liposomes to treat skin cancer.
Jose, Anup; Labala, Suman; Venuganti, Venkata Vamsi Krishna
2017-04-01
Skin cancer is one of the most widely prevalent cancer types with over expression of multiple oncogenic signaling molecules including STAT3. Curcumin is a natural compound with effective anti-cancer properties. The objective of this work was to investigate the liposomal co-delivery of curcumin and STAT3 siRNA by non-invasive topical iontophoretic application to treat skin cancer. Curcumin was encapsulated in cationic liposomes and then complexed with STAT3 siRNA. The liposomal nanocomplex was characterized for particle size, zeta-potential, drug release and stability. Human epidermoid (A431) cancer cells were used to study the cell uptake, growth inhibition and apoptosis induction of curcumin-loaded liposome-siRNA complex. Topical iontophoresis was applied to study the skin penetration of nanocomplex in excised porcine skin model. Results showed that curcumin-loaded liposome-siRNA complex was rapidly taken up by cells preferentially through clathrin-mediated endocytosis pathway. The co-delivery of curcumin and STAT3 siRNA using liposomes resulted in significantly (p < .05) greater cancer cell growth inhibition and apoptosis events compared with neat curcumin and free STAT3 siRNA treatment. Furthermore, topical iontophoresis application enhanced skin penetration of nanocomplex to penetrate viable epidermis. In conclusion, cationic liposomal system can be developed for non-invasive iontophoretic co-delivery of curcumin and siRNA to treat skin cancer.
Yagi, Nobuhiro; Manabe, Ichiro; Tottori, Tsuneaki; Ishihara, Atsushi; Ogata, Fusa; Kim, Jong Heon; Nishimura, Satoshi; Fujiu, Katsuhito; Oishi, Yumiko; Itaka, Keiji; Kato, Yasuki; Yamauchi, Masahiro; Nagai, Ryozo
2009-08-15
Use of short interfering RNA (siRNA) is a promising new approach thought to have a strong potential to lead to rapid development of gene-oriented therapies. Here, we describe a newly developed, systemically injectable siRNA vehicle, the "wrapsome" (WS), which contains siRNA and a cationic lipofection complex in a core that is fully enveloped by a neutral lipid bilayer and hydrophilic polymers. WS protected siRNA from enzymatic digestion, providing a long half-life in the systemic circulation. Moreover, siRNA/WS leaked from blood vessels within tumors into the tumor tissue, where it accumulated and was subsequently transfected into the tumor cells. Because the transcription factor KLF5 is known to play a role in tumor angiogenesis, we designed KLF5-siRNA to test the antitumor activity of siRNA/WS. KLF5-siRNA/WS exhibited significant antitumor activity, although neither WS containing control scrambled-siRNA nor saline containing KLF5-siRNA affected tumor growth. KLF5-siRNA/WS inhibited Klf5 expression within tumors at both mRNA and protein levels, significantly reducing angiogenesis, and we detected no significant acute or long-term toxicity. Our findings support the idea that siRNA/WS can be used to knock down specific genes within tumors and thereby exert therapeutic effects against cancers.
Gale, Aaron; Wu, Peiwen; Ma, Rong; Davis, Mark E.
2015-01-01
There is an urgent need for new therapies that can halt or reverse the course of chronic kidney disease with minimal side-effect burden on the patient. Small interfering RNA (siRNA) nanoparticles are new therapeutic entities in clinical development that could be useful for chronic kidney disease treatment because they combine the tissue-specific targeting properties of nanoparticles with the gene-specific silencing effects of siRNA. Recent reports have emerged demonstrating that the kidney, specifically the glomerulus, is a readily accessible site for nanoparticle targeting. Here, we explore the hypothesis that intravenously administered polycationic cyclodextrin nanoparticles containing siRNA (siRNA/CDP-NPs) can be used for delivery of siRNA to the glomerular mesangium. We demonstrate that siRNA/CDP-NPs localize to the glomerular mesangium with limited deposition in other areas of the kidney after intravenous injection. Additionally, we report that both mouse and human mesangial cells rapidly internalize siRNA/CDP-NPs in vitro and that nanoparticle uptake can be enhanced by attaching the targeting ligands mannose or transferrin to the nanoparticle surface. Lastly, we show knockdown of mesangial enhanced green fluorescent protein expression in a reporter mouse strain following iv treatment with siRNA/CDP-NPs. Altogether, these data demonstrate the feasibility of mesangial targeting using intravenously administered siRNA/CDP-NPs. PMID:25734248
Kong, Jing; Liu, Xiaoping; Jia, Jianbo; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2015-10-01
Hepatocellular carcinoma (HCC) is a deadly human malignant tumor that is among the most common cancers in the world, especially in Asia. Hepatitis B virus (HBV) infection has been well established as a high risk factor for hepatic malignance. Studies have shown that Pokemon is a master oncogene for HCC growth, suggesting it as an ideal therapeutic target. However, efficient delivery system is still lacking for Pokemon targeting treatment. In this study, we used core proteins of HBV, which is modified with RGD peptides, to construct a biomimetic vector for the delivery of Pokemon siRNAs (namely, RGD-HBc-Pokemon siRNA). Quantitative PCR and Western blot assays revealed that RGD-HBc-Pokemon siRNA possessed the highest efficiency of Pokemon suppression in HCC cells. In vitro experiments further indicated that RGD-HBc-Pokemon-siRNA exerted a higher tumor suppressor activity on HCC cell lines, evidenced by reduced proliferation and attenuated invasiveness, than Pokemon-siRNA or RGD-HBc alone. Finally, animal studies demonstrated that RGD-HBc-Pokemon siRNA suppressed the growth of HCC xenografts in mice by a greater extent than Pokemon-siRNA or RGD-HBc alone. Based on the above results, Pokemon siRNA delivery mediated by RGD-modified HBV core protein was shown to be an effective strategy of HCC gene therapy.
Targeted Delivery of siRNA with pH-Responsive Hybrid Gold Nanostars for Cancer Treatment
Zhu, Hongyan; Liu, Wanwan; Cheng, Ziting; Yao, Ke; Yang, Yu; Xu, Bohui
2017-01-01
In this work, we report the engineering of gold nanostars (GNS) to deliver small interfering RNA (siRNA) into HepG2 cells. The ligand DG-PEG-Lipoic acid (LA)-Lys-9R (hydrazone) was designed to functionalize GNS, and create the nanoparticles named as 9R/DG-GNS (hydrazone). In the ligand, 2-deoxyglucose (DG) is the targeting molecule, polyethylene glycol (PEG) helps to improve the dispersity and biocompatibility, 9-poly-d-arginine (9R) is employed to provide a positive surface charge and adsorb negative siRNA, and hydrazone bonds are pH-responsive and can avoid receptor-mediated endosomal recycling. Compared to GNS alone, 9R/DG-GNS (hydrazone) showed superior transfection efficiency. The expressions of cyclooxygenase-2 (COX-2) in HepG2 and SGC7901 cells were significantly suppressed by siRNA/9R/DG-GNS (hydrazone) complex. Notably, 9R/DG-GNS (hydrazone) possessed low cytotoxicity even at high concentrations in both normal cells and tumor cells. The combination treatment of siRNA/9R/DG-GNS (hydrazone) complex inhibited the cell growth rate by more than 75%. These results verified that the pH-responsive GNS complex is a promising siRNA delivery system for cancer therapy, and it is anticipated that near-infrared absorbing GNS with good photothermal conversion efficiency can be potentially used for photothermal therapy of tumors. PMID:28937584
EL Andaloussi, Samir; Lehto, Taavi; Mäger, Imre; Rosenthal-Aizman, Katri; Oprea, Iulian I.; Simonson, Oscar E.; Sork, Helena; Ezzat, Kariem; Copolovici, Dana M.; Kurrikoff, Kaido; Viola, Joana R.; Zaghloul, Eman M.; Sillard, Rannar; Johansson, Henrik J.; Said Hassane, Fatouma; Guterstam, Peter; Suhorutšenko, Julia; Moreno, Pedro M. D.; Oskolkov, Nikita; Hälldin, Jonas; Tedebark, Ulf; Metspalu, Andres; Lebleu, Bernard; Lehtiö, Janne; Smith, C. I. Edvard; Langel, Ülo
2011-01-01
While small interfering RNAs (siRNAs) have been rapidly appreciated to silence genes, efficient and non-toxic vectors for primary cells and for systemic in vivo delivery are lacking. Several siRNA-delivery vehicles, including cell-penetrating peptides (CPPs), have been developed but their utility is often restricted by entrapment following endocytosis. Hence, developing CPPs that promote endosomal escape is a prerequisite for successful siRNA implementation. We here present a novel CPP, PepFect 6 (PF6), comprising the previously reported stearyl-TP10 peptide, having pH titratable trifluoromethylquinoline moieties covalently incorporated to facilitate endosomal release. Stable PF6/siRNA nanoparticles enter entire cell populations and rapidly promote endosomal escape, resulting in robust RNAi responses in various cell types (including primary cells), with minimal associated transcriptomic or proteomic changes. Furthermore, PF6-mediated delivery is independent of cell confluence and, in most cases, not significantly hampered by serum proteins. Finally, these nanoparticles promote strong RNAi responses in different organs following systemic delivery in mice without any associated toxicity. Strikingly, similar knockdown in liver is achieved by PF6/siRNA nanoparticles and siRNA injected by hydrodynamic infusion, a golden standard technique for liver transfection. These results imply that the peptide, in addition to having utility for RNAi screens in vitro, displays therapeutic potential. PMID:21245043
Grijalvo, Santiago; Alagia, Adele
2018-01-01
Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs) and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs) or restoring the anomalous levels of non-coding RNAs (ncRNAs) that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs), carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs) as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed. PMID:29415514
Yu, Haijun; Zou, Yonglong; Wang, Yiguang; Huang, Xiaonan; Huang, Gang; Sumer, Baran D; Boothman, David A; Gao, Jinming
2011-11-22
The endosomal barrier is a major bottleneck for the effective intracellular delivery of siRNA by nonviral nanocarriers. Here, we report a novel amphotericin B (AmB)-loaded, dual pH-responsive micelleplex platform for siRNA delivery. Micelles were self-assembled from poly(2-(dimethylamino)ethyl methacrylate)-block-poly(2-(diisopropylamino)ethyl methacrylate) (PDMA-b-PDPA) diblock copolymers. At pH 7.4, AmB was loaded into the hydrophobic PDPA core, and siRNA was complexed with a positively charged PDMA shell to form the micelleplexes. After cellular uptake, the PDMA-b-PDPA/siRNA micelleplexes dissociated in early endosomes to release AmB. Live cell imaging studies demonstrated that released AmB significantly increased the ability of siRNA to overcome the endosomal barrier. Transfection studies showed that AmB-loaded micelleplexes resulted in significant increase in luciferase (Luc) knockdown efficiency over the AmB-free control. The enhanced Luc knockdown efficiency was abolished by bafilomycin A1, a vacuolar ATPase inhibitor that inhibits the acidification of the endocytic organelles. These data support the central hypothesis that membrane poration by AmB and increased endosomal swelling and membrane tension by a "proton sponge" polymer provided a synergistic strategy to disrupt endosomes for improved intracellular delivery of siRNA. © 2011 American Chemical Society
Wang, Qing; Zhang, Chunlei; Shen, Guangxia; Liu, Huiyang; Fu, Hualin; Cui, Daxiang
2014-12-30
Fluorescent carbon dots (Cdots) have attracted increasing attention due to their potential applications in sensing, catalysis, and biomedicine. Currently, intensive research has been concentrated on the synthesis and imaging-guided therapy of these benign photoluminescent materials. Meanwhile, Cdots have been explored as nonviral vector for nucleic acid or drug delivery by chemical modification on purpose. We have developed a microwave assisted one-step synthesis of Cdots with citric acid as carbon source and tryptophan (Trp) as both nitrogen source and passivation agent. The Cdots with uniform size show superior water solubility, excellent biocompatibility, and high quantum yield. Afterwards, the PEI (polyethylenimine)-adsorbed Cdots nanoparticles (Cdots@PEI) were applied to deliver Survivin siRNA into human gastric cancer cell line MGC-803. The results have confirmed the nanocarrier exhibited excellent biocompatibility and a significant increase in cellular delivery of siRNA, inducing efficient knockdown for Survivin protein to 6.1%. In addition, PEI@Cdots complexes mediated Survivin silencing, the arrested cell cycle progression in G1 phase as well as cell apoptosis was observed. The Cdots-based and PEI-adsorbed complexes both as imaging agents and siRNA nanocarriers have been developed for Survivin siRNA delivery. And the results indicate that Cdots-based nanocarriers could be utilized in a broad range of siRNA delivery systems for cancer therapy.
Targeting the kinesin Eg5 to monitor siRNA transfection in mammalian cells.
Weil, D; Garçon, L; Harper, M; Duménil, D; Dautry, F; Kress, M
2002-12-01
RNA interference, the inhibition of gene expression by double-stranded RNA, provides a powerful tool for functional studies once the sequence of a gene is known. In most mammalian cells, only short molecules can be used because long ones induce the interferon pathway. With the identification of a proper target sequence, the penetration of the oligonucleotides constitutes the most serious limitation in the application of this technique. Here we show that a small interfering RNA (siRNA) targeting the mRNA of the kinesin Eg5 induces a rapid mitotic arrest and provides a convenient assay for the optimization of siRNA transfection. Thus, dose responses can be established for different transfection techniques, highlighting the great differences in response to transfection techniques of various cell types. We report that the calcium phosphate precipitation technique can be an efficient and cost-effective alternative to Oligofectamine in some adherent cells, while electroporation can be efficient for some cells growing in suspension such as hematopoietic cells and some adherent cells. Significantly, the optimal parameters for the electroporation of siRNA differ from those for plasmids, allowing the use of milder conditions that induce less cell toxicity. In summary, a single siRNA leading to an easily assayed phenotype can be used to monitor the transfection of siRNA into any type of proliferating cells of both human and murine origin.
Improved silencing properties using small internally segmented interfering RNAs
Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen
2007-01-01
RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057
Ramon, A L; Bertrand, J R; de Martimprey, H; Bernard, G; Ponchel, G; Malvy, C; Vauthier, C
2013-07-01
Ewing's sarcoma is a rare, mostly pediatric bone cancer that presents a chromosome abnormality called EWS/Fli-1, responsible for the development of the tumor. In vivo, tumor growth can be inhibited specifically by delivering small interfering RNA (siRNA) associated with nanoparticles. The aim of the work was to design targeted nanoparticles against the cell membrane glycoprotein cd99, which is overexpressed in Ewing's sarcoma cells to improve siRNA delivery to tumor cells. Biotinylated poly(isobutylcyanoacrylate) nanoparticles were conceived as a platform to design targeted nanoparticles with biotinylated ligands and using the biotin-streptavidin coupling method. The targeted nanoparticles were validated in vivo for the targeted delivery of siRNA after systemic administration to mice bearing a tumor model of the Ewing's sarcoma. The expression of the gene responsible of Ewing's sarcoma was inhibited at 78% ± 6% by associating the siRNA with the cd99-targeted nanoparticles compared with an inhibition of only 41% ± 9% achieved with the nontargeted nanoparticles. Copyright © 2013 John Wiley & Sons, Ltd.
Oxime Ether Lipids as Transfection Agents: Assembly and Complexation with siRNA.
Puri, Anu; Zampino, Serena; Viard, Mathias; Shapiro, Bruce A
2017-01-01
RNAi-based therapeutic approaches to combat cancer and other diseases are currently an area of great interest. However, practical applications of this approach rely on optimal tools to carry and deliver siRNA to the desired site. Oxime ether lipids (OELs) are a class of molecules among other various carriers being examined for siRNA delivery. OELs, relatively new candidates, belong to a class of non-glycerol based lipids and have begun to claim their place as an siRNA delivery carrier in the field of RNAi therapy. Chemical synthesis steps of OELs are considered relatively simple with the ability to modify the functionalities as desired. OEL-siRNA complexes can be assembled in the presence of serum-containing buffers (or cell culture media) and recent data from our and other groups have demonstrated that OELs are viable carriers for siRNA delivery in the cell culture systems. In this chapter, we provide the details of experimental protocols routinely used in our laboratory to examine OEL-siRNA complexes including their assembly, stability, and transfection efficiencies.
Egashira, Akiyoshi; Yamauchi, Nobuhiko; Islam, Md Rashedul; Yamagami, Kazuki; Tanaka, Asami; Suyama, Hikaru; El-Sayed, El-Sharawy Mohamed; Tabata, Shoji; Kuramoto, Takashi
2016-08-01
This study investigated the knockdown (KD) of Kid on maturation developmental competence and multinucleation of mouse germinal vesicle (GV) oocytes after parthenogenetic activation. Data revealed that Kid messenger RNA (mRNA) was expressed in GV and MII stage oocyte and 1- and 2-cell embryos. Additionally, Kid mRNA expression in the Kid KD group decreased by nearly 46% compared to the control small interfering RNA (siRNA) groups. The rate of multinucleated embryos in the Kid KD group (52.4%) was significantly higher (P < 0.05) than the control siRNA group (4.7%). Finally, the developmental rates were significantly lower in the Kid siRNA group at > 4-cell stage (28.6% vs. 53.5%) and the blastocyst stage (2.4% vs. 23.3%) compared to the control siRNA groups. Suppression of Kid using siRNA caused multinucleation in early embryos with high frequency and it may increase 2- to 4-cell arrested embryos and reduce the developmental competence to blastocyst. © 2016 Japanese Society of Animal Science.
Lin, Liteng; Cai, Mingyue; Deng, Shaohui; Huang, Wensou; Huang, Jingjun; Huang, Xinghua; Huang, Mingsheng; Wang, Yong; Shuai, Xintao; Zhu, Kangshun
2017-10-01
Portal hypertension (PH), a leading cause of mortality in cirrhosis, lacks effective clinical therapeutic strategies. The increased thromboxane A 2 (TXA 2 ), derived primarily from the upregulation of cyclooxygenase-1 (COX-1) in cirrhotic liver sinusoidal endothelial cells (LSECs), is responsible for hepatic endothelial dysfunction and PH. Thus, blocking the COX-1 pathway in cirrhotic LSECs may benefit the treatment of PH. In this study, hyaluronate-graft-polyethylenimine (HA-PEI) was synthesized for the targeted delivery of COX-1 siRNA to LSECs. Compared to non-targeted PEI, HA-PEI mediated much more efficient siRNA delivery, which resulted in potent targeted gene silencing in LSECs. In vivo, HA-PEI notably increased the accumulation of siRNA along the sinusoidal lining of the liver, inhibited over-activation of the COX-1/TXA 2 pathway in LSECs, and successfully reduced portal pressure in cirrhotic mice. These results highlight the potential of HA-PEI complexed siRNA to serve as a LSECs-specific nanomedical system for effective gene therapy in PH. Copyright © 2017 Elsevier Inc. All rights reserved.
Lu, Ying; Wang, Weiming; Mao, Huiming; Hu, Hai; Wu, Yanling; Chen, Bing-Guan; Liu, Zhongmin
2011-01-01
Immune thrombocytopenia depends upon Fc receptor-mediated phagocytosis that involves signaling through the SH2 tyrosine kinase, Syk. We designed small interfering (siRNA) sequences complementary to Syk coding regions to decrease the expression of Syk in the human macrophage cell line, THP-1. To evaluate the functional effect of siRNA on phagocytosis, we developed a new in vitro assay for antibody-mediated platelet ingestion by THP-1 cells. Incubation of THP-1 cells at 37°C with fluorescence-labeled platelets and anti-platelet antibody promoted ingestion of platelets that could be quantitated by flow cytometry. Transfection of THP-1 cells with Syk-specific siRNA resulted in a reduction in the amount of FcγRII-associated Syk protein. Coincident with decreased Syk expression, we observed inhibition of antibody-mediated platelet ingestion. These results confirm a key role for Syk in antibody-mediated phagocytosis and suggest Syk-specific siRNA as a possible therapeutic candidate for immune thrombocytopenia. Copyright © 2011 Elsevier Inc. All rights reserved.
Niu, Ning-Kui; Yin, Juan-Juan; Yang, Yin-Xue; Wang, Zi-Li; Zhou, Zhi-Wei; He, Zhi-Xu; Chen, Xiao-Wu; Zhang, Xueji; Duan, Wei; Yang, Tianxin; Zhou, Shu-Feng
2015-01-01
Tuberculosis (TB) is still a major public health issue in developing countries, and its chemotherapy is compromised by poor drug compliance and severe side effects. This study aimed to synthesize and characterize new multimodal PEGylated liposomes encapsulated with clinically commonly used anti-TB drugs with linkage to small interfering RNA (siRNA) against transforming growth factor-β1 (TGF-β1). The novel NP-siRNA liposomes could target THP-1-derived human macrophages that were the host cells of mycobacterium infection. The biological effects of the NP-siRNA liposomes were evaluated on cell cycle distribution, apoptosis, autophagy, and the gene silencing efficiency of TGF-β1 siRNA in human macrophages. We also explored the proteomic responses to the newly synthesized NP-siRNA liposomes using the stable isotope labeling with amino acids in cell culture approach. The results showed that the multifunctional PEGylated liposomes were successfully synthesized and chemically characterized with a mean size of 265.1 nm. The novel NP-siRNA liposomes functionalized with the anti-TB drugs and TGF-β1 siRNA were endocytosed efficiently by human macrophages as visualized by transmission electron microscopy and scanning electron microscopy. Furthermore, the liposomes showed a low cytotoxicity toward human macrophages. There was no significant effect on cell cycle distribution and apoptosis in THP-1-derived macrophages after drug exposure at concentrations ranging from 2.5 to 62.5 μg/mL. Notably, there was a 6.4-fold increase in the autophagy of human macrophages when treated with the NP-siRNA liposomes at 62.5 μg/mL. In addition, the TGF-β1 and nuclear factor-κB expression levels were downregulated by the NP-siRNA liposomes in THP-1-derived macrophages. The Ingenuity Pathway Analysis data showed that there were over 40 signaling pathways involved in the proteomic responses to NP-siRNA liposome exposure in human macrophages, with 160 proteins mapped. The top five canonical signaling pathways were eukaryotic initiation factor 2 signaling, actin cytoskeleton signaling, remodeling of epithelial adherens junctions, epithelial adherens junction signaling, and Rho GDP-dissociation inhibitor signaling pathways. Collectively, the novel synthetic targeting liposomes represent a promising delivery system for anti-TB drugs to human macrophages with good selectivity and minimal cytotoxicity. PMID:26300629
In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.
Seema, S; Seenivasagam, R; Hemavathi, K
2013-01-01
Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.
Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi
BRIDI, L. C.; SHARAKHOVA, M. V.; SHARAKHOV, I. V.; CORDEIRO, J.; AZEVEDO, G. M.; TADEI, W. P.; RAFAEL, M. S.
2012-01-01
Physical and genetic maps have been used for chromosomal localization of genes in vectors of infectious diseases. The availability of polytene chromosomes in malaria mosquitoes provides a unique opportunity to precisely map genes of interest. We report physical mapping of two actin genes on polytene chromosomes of the major malaria vector in Amazon Anopheles darlingi. The clones with the actin genes sequences were obtained from a cDNA library constructed from RNA isolated from adult females and males of An. darlingi. Each of the two clones was mapped to a unique site on the chromosomal arm 2L in subdivisions 21A (clone pl05-A04) and 23B (clone pl17-G06). The obtained results together with previous mapping data provide a suitable basis for comparative genomics and for establishing chromosomal homologies among major malaria vectors. PMID:22804344
Comparison and quantitative verification of mapping algorithms for whole genome bisulfite sequencing
USDA-ARS?s Scientific Manuscript database
Coupling bisulfite conversion with next-generation sequencing (Bisulfite-seq) enables genome-wide measurement of DNA methylation, but poses unique challenges for mapping. However, despite a proliferation of Bisulfite-seq mapping tools, no systematic comparison of their genomic coverage and quantitat...
Using Maps in Web Analytics to Evaluate the Impact of Web-Based Extension Programs
ERIC Educational Resources Information Center
Veregin, Howard
2015-01-01
Maps can be a valuable addition to the Web analytics toolbox for Extension programs that use the Web to disseminate information. Extension professionals use Web analytics tools to evaluate program impacts. Maps add a unique perspective through visualization and analysis of geographic patterns and their relationships to other variables. Maps can…
Kowalczewski, Christine J; Saul, Justin M
2015-10-01
Antagonists and inhibitory molecules responsible for maintaining tissue homeostasis can present a significant barrier to healing when tissue engineering/regenerative medicine strategies are employed. One example of this situation is the up-regulation of antagonists such as noggin in response to increasing concentrations of bone morphogenetic protein-2 (BMP-2) present from endogenous bone repair processes or delivered exogenously from biomaterials (synthetic bone grafts). While recombinant human (rh)BMP-2 delivered from synthetic bone grafts has been shown to be an effective alternative to autografts and allografts, the supraphysiological doses of rhBMP-2 have led to clinically-adverse side effects. The high rhBMP-2 dosage may be required, in part, to overcome the presence of antagonists such as noggin. Small interfering RNA (siRNA) is an appealing approach to overcome this problem because it can knock-down antagonists or inhibitory molecules in a temporary manner. Here, we conducted fundamental studies on the delivery of siRNA from material surfaces as a means to knock-down antagonists like noggin. Non-viral cationic lipid (Lipofectamine)-siRNA complexes were delivered from a fibrin hydrogel surface to MC3T3-E1 preosteoblasts that were treated with a supraphysiological dose of rhBMP-2 to achieve noggin mRNA expression levels higher than cells naïve to rhBMP-2. Confocal microscopy and flow cytometry showed intracellular uptake of siRNA in over 98% of MC3T3-E1 cells after 48 h. Doses of 0.5 and 1 μg noggin siRNA were able to significantly reduce noggin mRNA to levels equivalent to those in MC3T3-E1 cells not exposed to rhBMP-2 with no effects on cell viability. Small interfering RNA (siRNA) has been considered for treatment of diseases ranging from Alzheimer's to cancer. However, the ability to use siRNA in conjunction with biomaterials to direct tissue regeneration processes has received relatively little attention. Using the bone morphogenetic protein 2 antagonist, noggin, as a model, this research describes an approach to knock-down molecules that are inhibitory to desired regenerative pathways at the mRNA level via siRNA delivery from a hydrogel surface. Interactions between the material (fibrin) surface and polycation-siRNA complexes, release of the siRNA from the material surface, high levels of cellular uptake/internalization of siRNA, and significant knockdown of the targeting (noggin) mRNA are demonstrated. Broader future applications include those to nerve regeneration, cardiovascular tissue engineering, directing (stem) cell behavior, and mitigating inflammatory responses to materials. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
The Contribution of Prohibitin 1 to Prostate Cancer Chemoresistance
2015-10-01
ceramide-PEG5K in normal BALB/c mice after i.v. injection. The siRNA was labeled with near infrared (NIR) dye DY647. (B) Ex vivo fluorescence image of...ceramide-PEG5K (Right) siRNA NPs at 18 h. The siRNA was labeled with dye DY547. (Scale bar, 10 μm.) Zhu et al. PNAS | June 23, 2015 | vol. 112 | no...Woodrow KA, et al. (2009) Intravaginal gene silencing using biodegradable polymer nanoparticles densely loaded with small-interfering RNA. Nat Mater
Multifunctional Nanotherapeutic System for Advanced Prostate Cancer
2013-10-01
combined delivery of eIF4E siRNA and DTX using dendrimer as a nanocarrier. To this end the objective of this study is to prepare, characterize and...period we prepared and characterized the dendrimer -DTX conjugate and dendrimer -siRNA complex. During this evaluation period our goal was to optimize the...involved in cell growth and survival3. Our goal is to overcome this drug resistance by combined delivery of eIF4E siRNA and DTX using dendrimer as
Characterization and Targeting of the Aldehyde Dehydrogenase Subpopulation in Ovarian Cancer
2013-07-01
from the A2780cp20 cell line . Task 2: Determine if ALDH1-positive cells survive chemotherapy in the tumor microenvironment. We have previously... lines . Anti- endoglin siRNAs were used to downregulate expression in ES2 and HeyA8MDR. In vitro, the effects of endoglin-knockdown individually and...ES2 or HeyA8MDR cell lines were administered chitosan-encapsulated anti- ENG siRNA or control siRNA with and without carboplatin. As described in the
Epanchintseva, Anna; Dolodoev, Anton; Grigor'eva, Alina; Chelobanov, Boris; Pyshnyi, Dmitrii; Ryabchikova, Elena; Pyshnaya, Inna
2018-08-31
The ability of gold nanoparticles to bind different substances has resulted in the high interest of researchers determining their usage as a promising carrier of various biological substances including nucleic acids (NAs) for therapeutic applications. Most publications report covalent binding (conjugation) of an NA to spherical AuNPs via the Au-S bond. In this work, we obtained non-covalent associates of different ssDNA, ssRNA and siRNAs with spherical gold nanoparticles (AuNPs) and examined their physico-chemical properties and stability in media mimicking intracellular space (bacterial 'cytosol') and cell culture media (10% FBS in DMEM). The 'cytosol' was obtained from E. coli and possessed nuclease activity. For the first time, we used the phosphoryl guanidine (dimethylimidazolidin-2-imine, Dmi) group for modification of 3'-ends to enhance the stability of ssRNAs and siRNAs against nuclease destruction. Trying to evaluate the material balance, we analyzed the whole nucleotide species obtained after incubation of NA-AuNPs associates in 'cytosol' and FBS and evaluated the degree of NAs destruction, a share of full-size NAs remained on the surface of the AuNPs and in the solution. Native ss- and siRNAs, both free and in composition of non-covalent associates with AuNPs, were less resistant to degrading factors than ssDNA. The introduction of two Dmi-groups into the ssDNA increased its stability in 'cytosol' three times within 2.5 h. Dmi-modified siRNAs in non-covalent associates with AuNPs were two times more stable than unmodified siRNA within 4 h. We showed that non-covalent siRNA-AuNPs associates serve as a kind of storage for full-size NAs and thereby prolong their presence in nuclease-active media. Our study showed that non-covalent binding of siRNAs with a surface of AuNPs provides desorption of both strands, which is necessary for siRNA functioning in living cells, and could be considered as an important way to construct siRNA and ssDNA delivery systems based on AuNPs.
Efficient Intracellular siRNA Delivery by Ethyleneimine-Modified Amphiphilic Macromolecules
Sparks, Sarah M.; Waite, Carolyn L.; Harmon, Alexander M.; Nusblat, Leora M.; Roth, Charles M.; Uhrich, Kathryn E.
2013-01-01
Summary New materials that can bind and deliver oligonucleotides such as short interfering RNA (siRNA) without toxicity are greatly needed to fulfill the promise of therapeutic gene silencing. Amphiphilic macromolecules (AMs) were functionalized with linear ethyleneimines to create cationic AMs capable of complexing with siRNA. Structurally, the parent AM is formed from a mucic acid backbone whose tetra-hydroxy groups are alkylated with 12-carbon aliphatic chains to form the hydrophobic component of the macromolecule. This alkylated mucic acid is then mono-functionalized with poly(ethylene glycol) (PEG) as a hydrophilic component. The resulting AM contains a free carboxylic acid within the hydrophobic domain. In this work, linear ethyleneimines were conjugated to the free carboxylic acid to produce an AM with one primary amine (1N) or one primary amine and four secondary amines (5N). Further, an AM with amine substitution both to the free carboxylic acid in the hydrophobic domain and also to the adjacent PEG was synthesized to produce a polymer with one primary amine and eight secondary amines (9N), four located on each side of the AM hydrophobic domain. All amine-functionalized AMs formed nanoscale micelles but only the 5N and 9N AMs had cationic zeta potentials, which increased with increasing number of amines. All AMs exhibited less inherent cytotoxicity than linear polyethyleneimine (L-PEI) at concentrations of 10 µM and above. By increasing the length of the cationic ethyleneimine chain and the total number of amines, successful siRNA complexation and cellular siRNA delivery was achieved in a malignant glioma cell line. In addition, siRNA-induced silencing of firefly luciferase was observed using complexes of siRNA with the 9N AM and comparable to L-PEI, yet showed better cell viability at higher concentrations (above 10 µM). This work highlights the promise of cationic AMs as safe and efficient synthetic vectors for siRNA delivery. Specifically, a novel polymer (9N) was identified for efficient siRNA delivery to cancer cells and will be further evaluated. PMID:21793212
deRonde, Brittany M; Posey, Nicholas D; Otter, Ronja; Caffrey, Leah M; Minter, Lisa M; Tew, Gregory N
2016-06-13
Exploring the role of polymer structure for the internalization of biologically relevant cargo, specifically siRNA, is of critical importance to the development of improved delivery reagents. Herein, we report guanidinium-rich protein transduction domain mimics (PTDMs) based on a ring-opening metathesis polymerization scaffold containing tunable hydrophobic moieties that promote siRNA internalization. Structure-activity relationships using Jurkat T cells and HeLa cells were explored to determine how the length of the hydrophobic block and the hydrophobic side chain compositions of these PTDMs impacted siRNA internalization. To explore the hydrophobic block length, two different series of diblock copolymers were synthesized: one series with symmetric block lengths and one with asymmetric block lengths. At similar cationic block lengths, asymmetric and symmetric PTDMs promoted siRNA internalization in the same percentages of the cell population regardless of the hydrophobic block length; however, with 20 repeat units of cationic charge, the asymmetric block length had greater siRNA internalization, highlighting the nontrivial relationships between hydrophobicity and overall cationic charge. To further probe how the hydrophobic side chains impacted siRNA internalization, an additional series of asymmetric PTDMs was synthesized that featured a fixed hydrophobic block length of five repeat units that contained either dimethyl (dMe), methyl phenyl (MePh), or diphenyl (dPh) side chains and varied cationic block lengths. This series was further expanded to incorporate hydrophobic blocks consisting of diethyl (dEt), diisobutyl (diBu), and dicyclohexyl (dCy) based repeat units to better define the hydrophobic window for which our PTDMs had optimal activity. High-performance liquid chromatography retention times quantified the relative hydrophobicities of the noncationic building blocks. PTDMs containing the MePh, diBu, and dPh hydrophobic blocks were shown to have superior siRNA internalization capabilities compared to their more and less hydrophobic counterparts, demonstrating a critical window of relative hydrophobicity for optimal internalization. This better understanding of how hydrophobicity impacts PTDM-induced internalization efficiencies will help guide the development of future delivery reagents.
Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei
2013-01-01
The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited "half-ecdysis". In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control.
Zhang, Zan; Xing, Yanru; Li, Fei
2013-01-01
The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1st to 5th instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4th instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20–94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited “half-ecdysis”. In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control. PMID:23823756
DICER-ARGONAUTE2 Complex in Continuous Fluorogenic Assays of RNA Interference Enzymes
Bernard, Mark A.; Wang, Leyu; Tachado, Souvenir D.
2015-01-01
Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC) have been hindered by lack of methods for continuous monitoring of enzymatic activity. “Quencherless” fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS) and hypoxia-inducible factor 1-α subunit (HIF1A). Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (K m=74 nM) with substrate inhibition kinetics (K i=105 nM), demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER) bound in the active site of DICER may undergo direct transfer (as AGO2 substrate) to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29), suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a strong (~2800-fold) improvement in potency for mRNA knockdown. This study lays the foundation of a systematic biochemical approach to optimize nucleic acid-based therapeutics for Dicing and ARGONAUTE2-loading for improving efficacy. PMID:25793518
d'Angelo, Ivana; Costabile, Gabriella; Durantie, Estelle; Brocca, Paola; Rondelli, Valeria; Russo, Annapina; Russo, Giulia; Miro, Agnese; Quaglia, Fabiana; Petri-Fink, Alke; Rothen-Rutishauser, Barbara; Ungaro, Francesca
2017-10-16
Nowadays, the downregulation of genes involved in the pathogenesis of severe lung diseases through local siRNA delivery appears an interesting therapeutic approach. In this study, we propose novel hybrid lipid-polymer nanoparticles (hNPs) consisting of poly(lactic-co-glycolic) acid (PLGA) and dipalmitoyl phosphatidylcholine (DPPC) as siRNA inhalation system. A panel of DPPC/PLGA hNPs was prepared by emulsion/solvent diffusion and fully characterized. A combination of model siRNAs against the sodium transepithelial channel (ENaC) was entrapped in optimized hNPs comprising or not poly(ethylenimine) (PEI) as third component. siRNA-loaded hNPs were characterized for encapsulation efficiency, release kinetics, aerodynamic properties, and stability in artificial mucus (AM). The fate and cytotoxicity of hNPs upon aerosolization on a triple cell co-culture model (TCCC) mimicking human epithelial airway barrier were assessed. Finally, the effect of siRNA-loaded hNPs on ENaC protein expression at 72 hours was evaluated in A549 cells. Optimized muco-inert hNPs encapsulating model siRNA with high efficiency were produced. The developed hNPs displayed a hydrodynamic diameter of ∼150 nm, a low polydispersity index, a negative ζ potential close to -25 mV, and a peculiar triphasic siRNA release lasting for 5 days, which slowed down in the presence of PEI. siRNA formulations showed optimal in vitro aerosol performance after delivery with a vibrating mesh nebulizer. Furthermore, small-angle X-ray scattering analyses highlighted an excellent stability upon incubation with AM, confirming the potential of hNPs for direct aerosolization on mucus-lined airways. Studies in TCCC confirmed that fluorescent hNPs are internalized inside airway epithelial cells and do not exert any cytotoxic or acute proinflammatory effect. Finally, a prolonged inhibition of ENaC protein expression was observed in A549 cells upon treatment with siRNA-loaded hNPs. Results demonstrate the great potential of hNPs as carriers for pulmonary delivery of siRNA, prompting toward investigation of their therapeutic effectiveness in severe lung diseases.
New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.
Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro
2005-12-01
In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.
Nanotechnology-Based Strategies for siRNA Brain Delivery for Disease Therapy.
Zheng, Meng; Tao, Wei; Zou, Yan; Farokhzad, Omid C; Shi, Bingyang
2018-05-01
Small interfering RNA (siRNA)-based gene silencing technology has demonstrated significant potential for treating brain-associated diseases. However, effective and safe systemic delivery of siRNA into the brain remains challenging because of biological barriers such as enzymatic degradation, short circulation lifetime, the blood-brain barrier (BBB), insufficient tissue penetration, cell endocytosis, and cytosolic transport. Nanotechnology offers intriguing potential for addressing these challenges in siRNA brain delivery in conjunction with chemical and biological modification strategies. In this review, we outline the challenges of systemic delivery of siRNA-based therapy for brain diseases, highlight recent advances in the development and engineering of siRNA nanomedicines for various brain diseases, and discuss our perspectives on this exciting research field for siRNA-based therapy towards more effective brain disease therapy. Copyright © 2018 Elsevier Ltd. All rights reserved.
Current progress on aptamer-targeted oligonucleotide therapeutics
Dassie, Justin P; Giangrande, Paloma H
2014-01-01
Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250
Geisbert, Thomas W; Hensley, Lisa E; Kagan, Elliott; Yu, Erik Zhaoying; Geisbert, Joan B; Daddario-DiCaprio, Kathleen; Fritz, Elizabeth A; Jahrling, Peter B; McClintock, Kevin; Phelps, Janet R; Lee, Amy C H; Judge, Adam; Jeffs, Lloyd B; MacLachlan, Ian
2006-06-15
Ebola virus (EBOV) infection causes a frequently fatal hemorrhagic fever (HF) that is refractory to treatment with currently available antiviral therapeutics. RNA interference represents a powerful, naturally occurring biological strategy for the inhibition of gene expression and has demonstrated utility in the inhibition of viral replication. Here, we describe the development of a potential therapy for EBOV infection that is based on small interfering RNAs (siRNAs). Four siRNAs targeting the polymerase (L) gene of the Zaire species of EBOV (ZEBOV) were either complexed with polyethylenimine (PEI) or formulated in stable nucleic acid-lipid particles (SNALPs). Guinea pigs were treated with these siRNAs either before or after lethal ZEBOV challenge. Treatment of guinea pigs with a pool of the L gene-specific siRNAs delivered by PEI polyplexes reduced plasma viremia levels and partially protected the animals from death when administered shortly before the ZEBOV challenge. Evaluation of the same pool of siRNAs delivered using SNALPs proved that this system was more efficacious, as it completely protected guinea pigs against viremia and death when administered shortly after the ZEBOV challenge. Additional experiments showed that 1 of the 4 siRNAs alone could completely protect guinea pigs from a lethal ZEBOV challenge. Further development of this technology has the potential to yield effective treatments for EBOV HF as well as for diseases caused by other agents that are considered to be biological threats.
Li, H; Chen, J; Chen, S; Zhang, Q; Chen, S
2011-10-01
Muscle injuries are common musculoskeletal problems encountered in sports medicine clinics. In this study, we examined the effect of lentivirus-mediated small interfering RNA (siRNA) targeting Smad4 on the suppression of the fibrosis in injured skeletal muscles. We found that Smad4-siRNA could efficiently knock down the expression of Smad4 in the C2C12 myoblast cells and in the contunded mice gastrocnemius muscle. The expression of mRNA level of Smad4 decreased to 11% and 49% compared to the control group, respectively, and the expression of protein level decreased to 13% and 57% respectively. Moreover, the lentivirus-mediated siRNA was stably transfected only into the skeletal muscle and not into the liver of the animals. In contunded mice gastrocnemius, the collagenous and vimentin-positive area in the Smad4 siRNA group reduced to 36% and 37% compared to the control group, respectively. Furthermore, compared to the scrambled Smad4 siRNA-injected mice and PBS control-injected mice, the muscle function of the mice injected with lentivirus-mediated Smad4 siRNA improved in terms of both fast-twitch and tetanic strength (P<0.05). The results suggest that the gene therapy of inhibiting Smad4 by lentivirus-mediated siRNA could be a useful approach to prevent scar tissue formation and improve the function of injured skeletal muscle. © Georg Thieme Verlag KG Stuttgart · New York.
PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.
Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N
2016-05-01
To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.
Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin
2014-04-01
RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.
Arami, Sanam; Mahdavi, Majid; Rashidi, Mohammad Reza; Fathi, Marziyeh; Hejazi, Mohammad-Saeid; Samadi, Nasser
2016-11-01
As a gene delivery method in breast cancer therapy, knocking down the undesired genes in the cancerous cells would be promising. Inhibitors of Apoptosis Protein (IAP) family genes are some of the genes whose responsibility is inhibition of apoptosis in cells. Silencing these genes seems to be helpful directing the tumor cells to death. siRNA sequence designed against survivin anti-apoptotic gene can play this role if carried to the cytoplasm. Here we prepared a positive charged biocompatible nano-sized particle made up of a Fe 3 O 4 core covered respectively by polyacrylate (PA) and polyethyleneimine (PEI) layer, which could successfully deliver the siRNA into the MCF-7 cells. The particle structure was checked and having less than 50 nm diameter in size, positive charge and, safety towards MCF-7 cells besides being able to form nanoplexes with the siRNA strand helps it entering into the biologic assays part. The siRNA delivery evaluated via flowcytometry. Apoptosis induction was determined by DAPI staining. The efficiency of survivin gene knockdown was evaluated in mRNA and protein levels using Real time PCR and western blotting methods. Overall, the Fe 3 O 4 -PA-PEI nanoparticles can deliver siRNA effectively into the cytoplasm of the MCF-7 breast cancer cells and induce apoptosis. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.
2015-01-01
Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637
Core Knowledge and the Emergence of Symbols: The Case of Maps
ERIC Educational Resources Information Center
Huang, Yi; Spelke, Elizabeth S.
2015-01-01
Map reading is unique to humans but is present in people of diverse cultures, at ages as young as 4 years old. Here, we explore the nature and sources of this ability and ask both what geometric information young children use in maps and what nonsymbolic systems are associated with their map-reading performance. Four-year-old children were given…
Thinking Maps: Research-Based Instructional Strategy in a PDS
ERIC Educational Resources Information Center
Kessler, Cristy; Zuercher, Deborah K.; Wong, Caroline S.
2013-01-01
An exploratory action research case study was conducted at Moanalua Middle School from 2006-2009 to examine the impact of Thinking Maps on student achievement. Thinking Maps are not just another set of graphic organizers but a set of eight of unique visual mind maps with each linked to a specific higher-order thinking pattern. This study tells the…
Preventing intimal thickening of vein grafts in vein artery bypass using STAT-3 siRNA
2012-01-01
Background Proliferation and migration of vascular smooth muscle cells (VSMCs) play a key role in neointimal formation which leads to restenosis of vein graft in venous bypass. STAT-3 is a transcription factor associated with cell proliferation. We hypothesized that silencing of STAT-3 by siRNA will inhibit proliferation of VSMCs and attenuate intimal thickening. Methods Rat VSMCs were isolated and cultured in vitro by applying tissue piece inoculation methods. VSMCs were transfected with STAT 3 siRNA using lipofectamine 2000. In vitro proliferation of VSMC was quantified by the MTT assay, while in vivo assessment was performed in a venous transplantation model. In vivo delivery of STAT-3 siRNA plasmid or scramble plasmid was performed by admixing with liposomes 2000 and transfected into the vein graft by bioprotein gel applied onto the adventitia. Rat jugular vein-carotid artery bypass was performed. On day 3 and7 after grafting, the vein grafts were extracted, and analyzed morphologically by haematoxylin eosin (H&E), and assessed by immunohistochemistry for expression of Ki-67 and proliferating cell nuclear antigen (PCNA). Western-blot and reverse transcriptase polymerase chain reaction (RT-PCR) were used to detect the protein and mRNA expression in vivo and in vitro. Cell apoptosis in vein grafts was detected by TUNEL assay. Results MTT assay shows that the proliferation of VSMCs in the STAT-3 siRNA treated group was inhibited. On day 7 after operation, a reduced number of Ki-67 and PCNA positive cells were observed in the neointima of the vein graft in the STAT-3 siRNA treated group as compared to the scramble control. The PCNA index in the control group (31.3 ± 4.7) was higher than that in the STAT-3 siRNA treated group (23.3 ± 2.8) (P < 0.05) on 7d. The neointima in the experimental group(0.45 ± 0.04 μm) was thinner than that in the control group(0.86 ± 0.05 μm) (P < 0.05).Compared with the control group, the protein and mRNA levels in the experimental group in vivo and in vitro decreased significantly. Down regulation of STAT-3 with siRNA resulted in a reduced expression of Bcl-2 and cyclin D1. However, apoptotic cells were not obviously found in all grafts on day 3 and 7 post surgery. Conclusions The STAT-3 siRNA can inhibit the proliferation of VSMCs in vivo and in vitro and attenuate neointimal formation. PMID:22216901
Nebane, N Miranda; Coric, Tatjana; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E Lucile
2016-02-01
The development of acoustic droplet ejection (ADE) technology has resulted in many positive changes associated with the operations in a high-throughput screening (HTS) laboratory. Originally, this liquid transfer technology was used to simply transfer DMSO solutions of primarily compounds. With the introduction of Labcyte's Echo 555, which has aqueous dispense capability, the application of this technology has been expanded beyond its original use. This includes the transfer of many biological reagents solubilized in aqueous buffers, including siRNAs. The Echo 555 is ideal for siRNA dispensing because it is accurate at low volumes and a step-down dilution is not necessary. The potential for liquid carryover and cross-contamination is eliminated, as no tips are needed. Herein, we describe the siRNA screening platform at Southern Research's HTS Center using the ADE technology. With this technology, an siRNA library can be dispensed weeks or even months in advance of the assay itself. The protocol has been optimized to achieve assay parameters comparable to small-molecule screening parameters, and exceeding the norm reported for genomewide siRNA screens. © 2015 Society for Laboratory Automation and Screening.
Shahzad, Mian MK; Mangala, Lingegowda S; Han, Hee Dong; Lu, Chunhua; Bottsford-Miller, Justin; Nishimura, Masato; Mora, Edna M; Lee, Jeong-Won; Stone, Rebecca L; Pecot, Chad V; Thanapprapasr, Duangmani; Roh, Ju-Won; Gaur, Puja; Nair, Maya P; Park, Yun-Yong; Sabnis, Nirupama; Deavers, Michael T; Lee, Ju-Seog; Ellis, Lee M; Lopez-Berestein, Gabriel; McConathy, Walter J; Prokai, Laszlo; Lacko, Andras G; Sood, Anil K
2011-01-01
RNA interference holds tremendous potential as a therapeutic approach, especially in the treatment of malignant tumors. However, efficient and biocompatible delivery methods are needed for systemic delivery of small interfering RNA (siRNA). To maintain a high level of growth, tumor cells scavenge high-density lipoprotein (HDL) particles by overexpressing its receptor: scavenger receptor type B1 (SR-B1). In this study, we exploited this cellular characteristic to achieve efficient siRNA delivery and established a novel formulation of siRNA by incorporating it into reconstituted HDL (rHDL) nanoparticles. Here, we demonstrate that rHDL nanoparticles facilitate highly efficient systemic delivery of siRNA in vivo, mediated by the SR-B1. Moreover, in therapeutic proof-of-concept studies, these nanoparticles were effective in silencing the expression of two proteins that are key to cancer growth and metastasis (signal transducer and activator of transcription 3 and focal adhesion kinase) in orthotopic mouse models of ovarian and colorectal cancer. These data indicate that an rHDL nanoparticle is a novel and highly efficient siRNA carrier, and therefore, this novel technology could serve as the foundation for new cancer therapeutic approaches. PMID:21472135
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4
Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503
Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.
Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian
2009-03-01
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.
Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice
Judge, Adam D.; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian
2009-01-01
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target’s biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics. PMID:19229107
Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses
Lakatos, Lóránt; Szittya, György; Silhavy, Dániel; Burgyán, József
2004-01-01
RNA silencing is an evolutionarily conserved surveillance system that occurs in a broad range of eukaryotic organisms. In plants, RNA silencing acts as an antiviral system; thus, successful virus infection requires suppression of gene silencing. A number of viral suppressors have been identified so far; however, the molecular bases of silencing suppression are still poorly understood. Here we show that p19 of Cymbidium ringspot virus (CymRSV) inhibits RNA silencing via its small RNA-binding activity in vivo. Small RNAs bound by p19 in planta are bona fide double-stranded siRNAs and they are silencing competent in the in vitro RNA-silencing system. p19 also suppresses RNA silencing in the heterologous Drosophila in vitro system by preventing siRNA incorporation into RISC. During CymRSV infection, p19 markedly diminishes the amount of free siRNA in cells by forming p19–siRNA complexes, thus making siRNAs inaccessible for effector complexes of RNA-silencing machinery. Furthermore, the obtained results also suggest that the p19-mediated sequestration of siRNAs in virus-infected cells blocks the spread of the mobile, systemic signal of RNA silencing. PMID:14976549
Advances in RNAi therapeutic delivery to leukocytes using lipid nanoparticles.
Ramishetti, Srinivas; Landesman-Milo, Dalit; Peer, Dan
2016-11-01
Small interfering RNAs (siRNAs) therapeutics has advanced into clinical trials for liver diseases and solid tumors, but remain a challenge for manipulating leukocytes fate due to lack of specificity and safety issues. Leukocytes ingest pathogens and defend the body through a complex network. They are also involved in the pathogeneses of inflammation, viral infection, autoimmunity and cancers. Modulating gene expression in leukocytes using siRNAs holds great promise to treat leukocyte-mediated diseases. Leukocytes are notoriously hard to transduce with siRNAs and are spread throughout the body often located deep in tissues, therefore developing an efficient systemic delivery strategy is still a challenge. Here, we discuss recent advances in siRNA delivery to leukocyte subsets such as macrophages, monocytes, dendritic cells and lymphocytes. We focus mainly on lipid-based nanoparticles (LNPs) comprised of new generation of ionizable lipids and their ability to deliver siRNA to primary or malignant leukocytes in a targeted manner. Special emphasis is made on LNPs targeted to subsets of leukocytes and we detail a novel microfluidic mixing technology that could aid in changing the landscape of process development of LNPs from a lab tool to a potential novel therapeutic modality.
Magnetic Core-Shell Silica Nanoparticles with Large Radial Mesopores for siRNA Delivery.
Xiong, Lin; Bi, Jingxu; Tang, Youhong; Qiao, Shi-Zhang
2016-09-01
A novel type of magnetic core-shell silica nanoparticles is developed for small interfering RNA (siRNA) delivery. These nanoparticles are fabricated by coating super-paramagnetic magnetite nanocrystal clusters with radial large-pore mesoporous silica. The amine functionalized nanoparticles have small particle sizes around 150 nm, large radial mesopores of 12 nm, large surface area of 411 m(2) g(-1) , high pore volume of 1.13 cm(3) g(-1) and magnetization of 25 emu g(-1) . Thus, these nanoparticles possess both high loading capacity of siRNA (2 wt%) and strong magnetic response under an external magnetic field. An acid-liable coating composed of tannic acid can further protect the siRNA loaded in these nanoparticles. The coating also increases the dispersion stability of the siRNA-loaded carrier and can serve as a pH-responsive releasing switch. Using the magnetic silica nanoparticles with tannic acid coating as carriers, functional siRNA has been successfully delivered into the cytoplasm of human osteosarcoma cancer cells in vitro. The delivery is significantly enhanced with the aid of the external magnetic field. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A
2012-06-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.
Durdevic, Zeljko; Mobin, Mehrpouya Balaghy; Hanna, Katharina; Lyko, Frank; Schaefer, Matthias
2013-09-12
Transfer RNA (tRNA) fragmentation in response to stress conditions has been described in many organisms. tRNA fragments have been found in association with small interfering RNA (siRNA) components, but the biological role of these interactions remains unclear. We report here that the tRNA methyltransferase Dnmt2 is essential for efficient Dicer-2 (Dcr-2) function in Drosophila. Using small RNA (sRNA) sequencing, we confirmed that Dnmt2 limits the extent of tRNA fragmentation during the heat-shock response. tRNAs as well as tRNA fragments serve as Dcr-2 substrates, and Dcr-2 degrades tRNA-derived sequences, especially under heat-shock conditions. tRNA-derived RNAs are able to inhibit Dcr-2 activity on long double-stranded RNAs (dsRNAs). Consequently, heat-shocked Dnmt2 mutant animals accumulate dsRNAs, produce fewer siRNAs, and show misregulation of siRNA pathway-dependent genes. These results reveal the impact of tRNA fragmentation on siRNA pathways and implicate tRNA modifications in the regulation of sRNA homeostasis during the heat-shock response. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Perivascular Delivery of Notch 1 siRNA Inhibits Injury-Induced Arterial Remodeling
Redmond, Eileen M.; Liu, Weimin; Hamm, Katie; Hatch, Ekaterina; Cahill, Paul A.; Morrow, David
2014-01-01
Objectives To determine the efficacy of perivascular delivery of Notch 1 siRNA in preventing injury-induced arterial remodeling. Methods and Results Carotid artery ligation was performed to induce arterial remodeling. After 14 days, morphometric analysis confirmed increased vSMC growth and subsequent media thickening and neointimal formation. Laser capture microdissection, quantitative qRT-PCR and immunoblot analysis of medial tissue revealed a significant increase in Notch1 receptor and notch target gene, Hrt 1 and 2 expression in the injured vessels. Perivascular delivery of Notch 1 siRNA by pluronic gel inhibited the injury-induced increase in Notch 1 receptor and target gene expression when compared to scrambled siRNA controls while concomitantly reducing media thickening and neointimal formation to pre-injury, sham-operated levels. Selective Notch 1 knockdown also reversed the injury-induced inhibition of pro-apoptotic Bax expression while decreasing injury-induced anti-apoptotic Bcl-XL expression to sham-operated control levels. In parallel experiments, proliferative cyclin levels, as measured by PCNA expression, were reversed to sham-operated control levels following selective Notch 1 knockdown. Conclusion These results suggest that injury-induced arterial remodeling can be successfully inhibited by localized perivascular delivery of Notch 1 siRNA. PMID:24416200
Amylose-Based Cationic Star Polymers for siRNA Delivery.
Nishimura, Tomoki; Umezaki, Kaori; Mukai, Sada-atsu; Sawada, Shin-ichi; Akiyoshi, Kazunari
2015-01-01
A new siRNA delivery system using a cationic glyco-star polymer is described. Spermine-modified 8-arm amylose star polymer (with a degree of polymerization of approximately 60 per arm) was synthesized by chemoenzymatic methods. The cationic star polymer effectively bound to siRNA and formed spherical complexes with an average hydrodynamic diameter of 230 nm. The cationic 8-arm star polymer complexes showed superior cellular uptake characteristics and higher gene silencing effects than a cationic 1-arm polymer. These results suggest that amylose-based star polymers are a promising nanoplatform for glycobiomaterials.
The Role of Tumor Metastases Suppressor Gene, Drg-1, in Breast Cancer
2007-03-01
acetyl-CoA carboxylase inhibitor), fumonisin B1 (ceramide synthase inhibitor), etomoxir [carnitine palmitoyltransferase-1 (CPT-1) inhibitor], and C2...synthase inhibitor, fumonisin B1. RNA was extracted from the cells, and the expression of BNIP3 and b-actin genes were examined by real-time RT-PCR. G, MCF...7 cells were treated with 300 nmol/L FAS siRNA or GFP siRNA or a combination of FAS siRNA and 50 Amol/L fumonisin B1, and the level of cellular
NASA Astrophysics Data System (ADS)
Alessandrini, Giovanni; de Hoop, Maarten V.; Gaburro, Romina
2017-12-01
We discuss the inverse problem of determining the, possibly anisotropic, conductivity of a body Ω\\subset{R}n when the so-called Neumann-to-Dirichlet map is locally given on a non-empty curved portion Σ of the boundary \\partialΩ . We prove that anisotropic conductivities that are a priori known to be piecewise constant matrices on a given partition of Ω with curved interfaces can be uniquely determined in the interior from the knowledge of the local Neumann-to-Dirichlet map.
NASA Astrophysics Data System (ADS)
Lakshminarayanan, Abirami; Reddy, B. Uma; Raghav, Nallani; Ravi, Vijay Kumar; Kumar, Anuj; Maiti, Prabal K.; Sood, A. K.; Jayaraman, N.; Das, Saumitra
2015-10-01
A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector.A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector. Electronic supplementary information (ESI) available: Spectral data and experimental details. See DOI: 10.1039/c5nr02898a
Hua, Ping; Liu, Li-Bao; Liu, Jia-Liang; Wang, Meng; Jiang, Hui-Qi; Zeng, Kuan; Yang, Yan-Qi; Yang, Song-Ran
2013-09-01
Transplantation of bone marrow mesenchymal stem cells is a promising new strategy for the repair of infarcted cardiac tissue. However, the majority of transplanted bone marrow mesenchymal stem cells (BMSCs) die soon after transplantation, due in part to oxidative stress in the ischemic region. Oxidative stress is known to induce apoptosis through the activation of caspase-3. The aim of this study is to determine whether small interfering RNA targeting caspase-3 can inhibit the apoptosis of rat BMSCs in vitro. Caspase-3 siRNA expression vectors were prepared and transfected into rat BMSCs in the presence of liposomes. Western blot assay and real-time polymerase chain reaction (RT-PCR) were performed to detect caspase-3 expression. A retrovirus packaging system was employed to package 293FT cells producing caspase-3 siRNA virus, which were transfected into rat BMSCs. Those stably expressing caspase-3 siRNA were screened by Western blot assay and RT-PCR to determine caspase-3 expression levels. Stable transfection of caspase-3 siRNA significantly decreased caspase-3 protein (0.26 ± 0.001 vs. 0.42 ± 0.004, P < 0.05) and mRNA expression (0.19 ± 0.002 vs. 1, P < 0.05) in BMSCs compared to non-transfected BMSCs. Cells were incubated in H2O2 to induce apoptosis, which was detected by TUNEL staining, and BMSC morphology was not altered by either transient or stable transfection of caspase-3 siRNA. H2O2-induced apoptosis of BMSCs stably transfected with caspase-3 siRNA was dramatically reduced compared to that of normal BMSCs (11.0 ± 3.2 vs. 25.8 ± 4.2, P < 0.05). Caspase-3 knockdown BMSCs are thus more resistant to apoptosis than normal BMSCs, potentially increasing their survival rates under conditions that cause oxidative stress.
Peng, Haiying; Zou, Lifang; Xie, Jinyan; Wu, Hong; Wu, Bing; Zhu, Gaochun; Lv, Qiulan; Zhang, Xi; Liu, Shuangmei; Li, Guilin; Xu, Hong; Gao, Yun; Xu, Changshui; Zhang, Chunping; Wang, Shouyu; Xue, Yun; Liang, Shangdong
2017-01-01
Long noncoding RNAs (lncRNAs) participate in physiological and pathophysiological processes. Type 2 diabetes mellitus (T2DM) accounts for more than 90 % of all cases of diabetes mellitus (DM). Diabetic neuropathic pain (DNP) is a common complication of T2DM. The aim of this study was to investigate the effects of lncRNA NONRATT021972 small interference RNA (siRNA) on DNP mediated by the P2X 3 receptor in dorsal root ganglia (DRG). These experiments showed that the expression levels of NONRATT021972 in DRG were increased in the T2DM rat model (intraperitoneal injection of STZ with 30 mg/kg). The concentration of NONRATT021972 in T2DM patient serum was higher compared to control healthy subjects. The mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL) in T2DM rats were lower compared to control rats. MWT and TWL in T2DM rats treated with NONRATT021972 siRNA were higher compared with those in T2DM rats. The expression levels of the P2X 3 protein and messenger RNA (mRNA) of T2DM rat DRG were higher compared to the control, while those in T2DM rats treated with NONRATT021972 siRNA were significantly lower compared to T2DM rats. The level of tumor necrosis factor-α (TNF-α) in the serum of T2DM rats treated with NONRATT021972 siRNA was significantly decreased compared with T2DM rats. NONRATT021972 siRNA inhibited the phosphorylation and activation of ERK1/2 in T2DM DRG. Thus, NONRATT021972 siRNA treatment may suppress the upregulated expression and activation of the P2X 3 receptor and reduce the hyperalgesia potentiated by the pro-inflammatory cytokine TNF-α in T2DM rats.
Javadi, Hamidreza; Lotfi, Abbas Sahebghadam; Hosseinkhani, Saman; Mehrani, Hossein; Amani, Jafar; Soheili, Zahra Soheila; Hojati, Zahra; Kamali, Mehdi
2018-06-06
In the present research, we assumed that reducing the amounts of E6 and E7 oncoproteins by a specific siRNA sequence and recovering p53 and RB proteins, along with the recovery of the FOXO1 protein by applying anti-miR-182, would increase apoptosis and reduce proliferation rate in cancer cells. The HPV16-positive CaSki cervical cancer cell line was used. 48 hours after transfection of siRNA for targeting E6 and E7 oncoproteins and anti-miR-182, expression of its cellular targets p53, p21 and FOXO1 was assessed by real-time PCR, western blot analysis and immunocytofluorescence staining. In all treatments, apoptosis rate and viability were evaluated using Annexin-V-FITC apoptosis detection kits and MTT assays, respectively. Among the designed siRNAs, E6-1 and E7-2 proved the most effective in reducing E6 and E7 expressions by increasing the apoptotic rates to 12.4% and 16%, respectively, after 48 hours. Also, using anti-miR-182 increased apoptotic rate to 12.7% 48 hours after transfection of cervical cancer cells. The combinational use of either E6-1 or E7-2 siRNAs with anti-miR-182 resulted in a rise in apoptosis to 19.3% and 26%, respectively, higher than those obtained from the individual application of either without anti-miR-182. The simultaneous use of siRNA E6-1 and siRNA E7-2 with cisplatin increased sensitivity to cisplatin and reduced the viability of the cancer cells as compared to the use of cisplatin alone. The simultaneous use of cisplatin and anti-miR-182 had no considerable effect on viability or apoptosis rate compared to cisplatin alone.
Surface engineering of gold nanoparticles for in vitro siRNA delivery
NASA Astrophysics Data System (ADS)
Zhao, Enyu; Zhao, Zhixia; Wang, Jiancheng; Yang, Chunhui; Chen, Chengjun; Gao, Lingyan; Feng, Qiang; Hou, Wenjie; Gao, Mingyuan; Zhang, Qiang
2012-07-01
Cellular uptake, endosomal/lysosomal escape, and the effective dissociation from the carrier are a series of hurdles for specific genes to be delivered both in vitro and in vivo. To construct siRNA delivery systems, poly(allylamine hydrochloride) (PAH) and siRNA were alternately assembled on the surface of 11.8 +/- 0.9 nm Au nanoparticles (GNP), stabilized by denatured bovine serum albumin, by the ionic layer-by-layer (LbL) self-assembly method. By manipulating the outmost PAH layer, GNP-PAH vectors with different surface electric potentials were prepared. Then, the surface potential-dependent cytotoxicity of the resultant GNP-PAH particles was evaluated via sulforhodamine B (SRB) assay, while the surface potential-dependent cellular uptake efficiency was quantitatively analyzed by using the flow cytometry method based on carboxyfluorescein (FAM)-labeled siRNA. It was revealed that the GNP-PAH particles with surface potential of +25 mV exhibited the optimal cellular uptake efficiency and cytotoxicity for human breast cancer MCF-7 cells. Following these results, two more positively charged polyelectrolytes with different protonating abilities in comparison with PAH, i.e., polyethylenimine (PEI), and poly(diallyl dimethyl ammonium chloride) (PDDA), were chosen to fabricate similarly structured vectors. Confocal fluorescence microscopy studies indicated that siRNA delivered by GNP-PAH and GNP-PEI systems was better released than that delivered by the GNP-PDDA system. Further flow cytometric assays based on immunofluorescence staining of the epidermal growth factor receptor (EGFR) revealed that EGFR siRNA delivered by GNP-PAH and GNP-PEI exhibited similar down-regulation effects on EGFR expression in MCF-7 cells. The following dual fluorescence flow cytometry assays by co-staining phosphatidylserine and DNA suggested the EGFR siRNA delivered by GNP-PAH exhibited an improved silencing effect in comparison with that delivered by the commercial transfection reagent Lipofectamine 2000.
NASA Astrophysics Data System (ADS)
Lin, Chung-Ming; Kao, Wei-Chien; Yeh, Chun-An; Chen, Hui-Jye; Lin, Shinn-Zong; Hsieh, Hsien-Hsu; Sun, Wei-Shen; Chang, Chih-Hsuan; Hung, Huey-Shan
2015-03-01
Benzo[a]pyrene (BaP), a component of cooking oil fumes (COF), promotes lung cancer cell proliferation and survival via the induction of inhibitor of apoptosis protein-2 (IAP-2) proteins. Thus knockdown of IAP-2 would be a promising way to battle against lung cancer caused by COF. Functionalized gold nanoparticle (AuNP) is an effective delivery system for bio-active materials. Here, biocompatible hyaluronic acid (HA) was fabricated into nanoparticles to increase the target specificity by binding to CD44-over-expressed cancer cells. IAP-2-specific small-interfering RNA (siRNAs) or fluorescein isothiocyanate (FITC) were then incorporated into AuNP-HA. Conjugation of IAP-2 siRNA into AuNPs-HA was verified by the UV-vis spectrometer and Fourier transform infrared spectrometer. Further studies showed that AuNP-HA/FITC were effectively taken up by A549 cells through CD44-mediated endocytosis. Incubation of BaP-challenged cells with AuNP-HA-IAP-2 siRNAs silenced the expression of IAP-2, decreased cell proliferation and triggered pronounced cell apoptosis by the decrease in Bcl-2 protein and the increase in Bax protein as well as the active form of caspases-3. The BaP-elicited cell migration and enzymatic activity of the secreted matrix metalloproteinase-2 were also substantially suppressed by treatment with AuNP-HA-IAP-2 siRNAs. These results indicated that IAP-2 siRNAs can be efficiently delivered into A549 cells by functionalized AuNP-HA to repress the IAP-2 expression and BaP-induced oncogenic events, suggesting the potential therapeutic application of IAP-2 siRNA or other siRNA-conjugated AuNP-HA composites to COF-induced lung cancer and other gene-caused diseases in the future.
[Locally administered lentivirus-mediated siRNA inhibits wear debris-induced inflammation].
Peng, Xiao-chun; Zhang, Xian-long; Tao, Kun; Cheng, Tao; Zhu, Jun-feng; Zeng, Bing-fang
2009-03-01
To determine the safety and efficacy of local administration of lentivirus-mediated small interfering RNA (siRNA) targeting tumor necrosis factor-alpha (TNF-alpha) in murine air pouch model. From May 2007 to April 2008 a siRNA targeting TNF-alpha and a missense siRNA were designed, and recombine lentivirus which coexpressed the green fluorescent protein (GFP) as a marker gene was constructed. Air pouches were established and stimulated by Ti-6Al-4V particles. Pouches were divided into 3 groups randomly. Lentivirus-mediated siRNA targeting TNF-alpha (TNF-alpha group) or lentivirus-mediated missense siRNA (MS group), or virus-free saline (control group) were injected into pouches respectively. Pouch membrane, peripheral blood, heart, liver, spleen, kidney, lung and brain were harvested at 28 d after transfection, and assayed for markers of inflammation using histological, molecular, immunological techniques and Xenogen in vivo imaging system (IVIS) 50 vivo bioluminescent assay system. Xenogen IVIS 50 vivo image revealed strong expression of GFP localized in pouch areas and no expression in other parts of mice both in TNF-alpha group and MS group at 4 weeks after transfection, while no expression of GFP was found in control group. By RT-PCR and ELISA, the mRNA and protein levels of TNF-alpha in TNF-alpha group decreased by 81.6% and 82.6% respectively compared to control group (P < 0.01), and decreased by 78.9% and 84.0% respectively compared to MS group (P < 0.01), whereas TNF-alpha level in peripheral blood, heart, liver, spleen, kidney, lung and brain remained invariant (P > 0.05). Less inflammatory responses (thinner pouch membrane and decreased cellular infiltration) were observed in TNF-alpha group. Efficient local delivery of lentivirus-mediated siRNA targeting TNF-alpha into modified murine air pouch can inhibit debris-induced inflammation effectively, with no systemic adverse effects.
Puri, Jyoti; Vinothini, Priya; Reuben, Jayne; Bellinger, Larry L.; Ailing, Li; Peng, Yuan B.; Kramer, Phillip R.
2012-01-01
Trigeminal ganglia neurons express the GABAA receptor subunit alpha 6 (Gabrα6) but the role of this particular subunit in orofacial hypersensitivity is unknown. In this report the function of Gabrα6 was tested by reducing its expression in the trigeminal ganglia and measuring the effect of this reduction on inflammatory temporomandibular joint (TMJ) hypersensitivity. Gabrα6 expression was reduced by infusing the trigeminal ganglia of male Sprague Dawley rats with small interfering RNA (siRNA) having homology to either the Gabrα6 gene (Gabrα6 siRNA) or no known gene (control siRNA). Sixty hours after siRNA infusion the rats received a bilateral TMJ injection of complete Freund’s adjuvant to induce an inflammatory response. Hypersensitivity was then quantitated by measuring meal duration, which lengthens when hypersensitivity increases. Neuronal activity in the trigeminal ganglia was also measured by quantitating the amount of phosphorylated ERK. Rats in a different group that did not have TMJ inflammation had an electrode placed in the spinal cord at the level of C1 sixty hours after siRNA infusion to record extracellular electrical activity of neurons that responded to TMJ stimulation. Our results show that Gabrα6 was expressed in both neurons and satellite glia of the trigeminal ganglia and that Gabrα6 positive neurons within the trigeminal ganglia have afferents in the TMJ. Gabrα6 siRNA infusion reduced Gabrα6 gene expression by 30% and significantly lengthened meal duration in rats with TMJ inflammation. Gabrα6 siRNA infusion also significantly increased p-ERK expression in the trigeminal ganglia of rats with TMJ inflammation and increased electrical activity in the spinal cord of rats without TMJ inflammation. These results suggest that maintaining Gabrα6 expression was necessary to inhibit primary sensory afferents in the trigeminal pathway and reduce inflammatory orofacial nociception. PMID:22521829
Tabujew, Ilja; Freidel, Christoph; Krieg, Bettina; Helm, Mark; Koynov, Kaloian; Müllen, Klaus; Peneva, Kalina
2014-07-01
Here, the preparation of a novel block copolymer consisting of a statistical copolymer N-(2-hydroxypropyl) methacrylamide-s-N-(3-aminopropyl) methacrylamide and a short terminal 3-guanidinopropyl methacrylamide block is reported. This polymer structure forms neutral but water-soluble nanosized complexes with siRNA. The siRNA block copolymer complexes are first analyzed using agarose gel electrophoresis and their size is determined with fluorescence correlation spectroscopy. The protective properties of the polymer against RNA degradation are investigated by treating the siRNA block copolymer complexes with RNase V1. Heparin competition assays confirm the efficient release of the cargo in vitro. In addition, the utilization of microscale thermophoresis is demonstrated for the determination of the binding strength between a fluorescently labeled polyanion and a polymer molecule. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A review on current status of antiviral siRNA.
Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani
2018-04-15
Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.
ENHANCING ADULT NERVE REGENERATION THROUGH THE KNOCKDOWN OF RETINOBLASTOMA PROTEIN
Christie, Kimberly J.; Krishnan, Anand; Martinez, Jose A.; Purdy, Kaylynn; Singh, Bhagat; Eaton, Shane; Zochodne, Douglas
2016-01-01
Tumour suppressor pathways may offer novel targets capable of altering the plasticity of post-mitotic adult neurons. Here we describe a role for retinoblastoma (Rb) protein, widely expressed in adult sensory neurons and their axons, during regeneration. In adult sensory neurons, Rb siRNA knockdown or Rb1 deletion in vitro enhances neurite outgrowth and branching. Plasticity is achieved in part through upregulation of neuronal PPARγ; its antagonism inhibits Rb siRNA plasticity whereas a PPARγ agonist increases growth. In an in vivo regenerative paradigm following complete peripheral nerve trunk transection, direct delivery of Rb siRNA prompts increased outgrowth of axons from proximal stumps and entrains Schwann cells to accompany them for greater distances. Similarly Rb siRNA delivery following a nerve crush improves behavioural indices of motor and sensory recovery in mice. The overall findings indicate that inhibition of tumour suppressor molecules has a role to play in promoting adult neuron regeneration. PMID:24752312
RNAi-combined nano-chemotherapeutics to tackle resistant tumors.
Tekade, Rakesh Kumar; Tekade, Muktika; Kesharwani, Prashant; D'Emanuele, Antony
2016-11-01
The merger of nanotechnology and combination chemotherapy has shown notable promise in the therapy of resistant tumors. The latest scientific attention encompasses the engagement of anticancer drugs in combination with small interfering (si)RNAs, such as VEGF, XLAP, PGP, MRP-1, BCL-2 and cMyc, to name but a few. siRNAs have shown immense promise to knockout drug resistance genes as well as to recover the sensitivity of resistant tumors to anticancer therapy. The nanotechnology approach could also protect siRNA against RNAse degradation as well as prevent off-target effects. In this article, we discuss the approaches that have been used to deliver of siRNA in combination with chemotherapeutic drugs to treat resistant tumors. We also discuss the stipulations that must be considered in formulating a nanotechnology-assisted siRNA-drug cancer therapy. Copyright © 2016. Published by Elsevier Ltd.
Leung, Ada W. Y.; Hung, Stacy S.; Backstrom, Ian; Ricaurte, Daniel; Kwok, Brian; Poon, Steven; McKinney, Steven; Segovia, Romulo; Rawji, Jenna; Qadir, Mohammed A.; Aparicio, Samuel; Stirling, Peter C.; Steidl, Christian; Bally, Marcel B.
2016-01-01
Platinum-based combination chemotherapy is the standard treatment for advanced non-small cell lung cancer (NSCLC). While cisplatin is effective, its use is not curative and resistance often emerges. As a consequence of microenvironmental heterogeneity, many tumour cells are exposed to sub-lethal doses of cisplatin. Further, genomic heterogeneity and unique tumor cell sub-populations with reduced sensitivities to cisplatin play a role in its effectiveness within a site of tumor growth. Being exposed to sub-lethal doses will induce changes in gene expression that contribute to the tumour cell’s ability to survive and eventually contribute to the selective pressures leading to cisplatin resistance. Such changes in gene expression, therefore, may contribute to cytoprotective mechanisms. Here, we report on studies designed to uncover how tumour cells respond to sub-lethal doses of cisplatin. A microarray study revealed changes in gene expressions that occurred when A549 cells were exposed to a no-observed-effect level (NOEL) of cisplatin (e.g. the IC10). These data were integrated with results from a genome-wide siRNA screen looking for novel therapeutic targets that when inhibited transformed a NOEL of cisplatin into one that induced significant increases in lethality. Pathway analyses were performed to identify pathways that could be targeted to enhance cisplatin activity. We found that over 100 genes were differentially expressed when A549 cells were exposed to a NOEL of cisplatin. Pathways associated with apoptosis and DNA repair were activated. The siRNA screen revealed the importance of the hedgehog, cell cycle regulation, and insulin action pathways in A549 cell survival and response to cisplatin treatment. Results from both datasets suggest that RRM2B, CABYR, ALDH3A1, and FHL2 could be further explored as cisplatin-enhancing gene targets. Finally, pathways involved in repairing double-strand DNA breaks and INO80 chromatin remodeling were enriched in both datasets, warranting further research into combinations of cisplatin and therapeutics targeting these pathways. PMID:26938915
Leung, Ada W Y; Hung, Stacy S; Backstrom, Ian; Ricaurte, Daniel; Kwok, Brian; Poon, Steven; McKinney, Steven; Segovia, Romulo; Rawji, Jenna; Qadir, Mohammed A; Aparicio, Samuel; Stirling, Peter C; Steidl, Christian; Bally, Marcel B
2016-01-01
Platinum-based combination chemotherapy is the standard treatment for advanced non-small cell lung cancer (NSCLC). While cisplatin is effective, its use is not curative and resistance often emerges. As a consequence of microenvironmental heterogeneity, many tumour cells are exposed to sub-lethal doses of cisplatin. Further, genomic heterogeneity and unique tumor cell sub-populations with reduced sensitivities to cisplatin play a role in its effectiveness within a site of tumor growth. Being exposed to sub-lethal doses will induce changes in gene expression that contribute to the tumour cell's ability to survive and eventually contribute to the selective pressures leading to cisplatin resistance. Such changes in gene expression, therefore, may contribute to cytoprotective mechanisms. Here, we report on studies designed to uncover how tumour cells respond to sub-lethal doses of cisplatin. A microarray study revealed changes in gene expressions that occurred when A549 cells were exposed to a no-observed-effect level (NOEL) of cisplatin (e.g. the IC10). These data were integrated with results from a genome-wide siRNA screen looking for novel therapeutic targets that when inhibited transformed a NOEL of cisplatin into one that induced significant increases in lethality. Pathway analyses were performed to identify pathways that could be targeted to enhance cisplatin activity. We found that over 100 genes were differentially expressed when A549 cells were exposed to a NOEL of cisplatin. Pathways associated with apoptosis and DNA repair were activated. The siRNA screen revealed the importance of the hedgehog, cell cycle regulation, and insulin action pathways in A549 cell survival and response to cisplatin treatment. Results from both datasets suggest that RRM2B, CABYR, ALDH3A1, and FHL2 could be further explored as cisplatin-enhancing gene targets. Finally, pathways involved in repairing double-strand DNA breaks and INO80 chromatin remodeling were enriched in both datasets, warranting further research into combinations of cisplatin and therapeutics targeting these pathways.
Application of small RNA technology for improved control of parasitic helminths.
Britton, Collette; Winter, Alan D; Marks, Neil D; Gu, Henry; McNeilly, Tom N; Gillan, Victoria; Devaney, Eileen
2015-08-15
Over the last decade microRNAs (miRNAs) and small interfering RNAs (siRNAs) have emerged as important regulators of post-transcriptional gene expression. miRNAs are short, non-coding RNAs that regulate a variety of processes including cancer, organ development and immune function. This class of small RNAs bind with partial complementarity to their target mRNA sequences, most often in the 3'UTR, to negatively regulate gene expression. In parasitic helminths, miRNAs are being increasingly studied for their potential roles in development and host-parasite interactions. The availability of genome data, combined with small RNA sequencing, has paved the way to profile miRNAs expressed at particular developmental stages for many parasitic helminths. While some miRNAs are conserved across species, others appear to be unique to specific parasites, suggesting important roles in adaptation and survival in the host environment. Some miRNAs are released from parasites, in exosomes or in protein complexes, and the potential effects of these on host immune function are being increasingly studied. In addition, release of miRNAs from schistosome and filarial parasites into host plasma can be exploited for the development of specific and sensitive diagnostic biomarkers of infection. Interfering with miRNA function, as well as silencing key components of the pathways they regulate, will progress our understanding of parasite development and provide a novel approach to therapeutic control. RNA interference (RNAi) by siRNAs has proven to be inconsistent in parasitic nematodes. However, the recent successes reported for schistosome and liver fluke RNAi, encourage further efforts to enhance delivery of RNA and improve in vitro culture systems and assays to monitor phenotypic effects in nematodes. These improvements are important for the establishment of reliable functional genomic platforms for novel drug and vaccine development. In this review we focus on the important roles of miRNAs and siRNAs in post-transcriptional gene regulation in veterinary parasitic helminths and the potential value of these in parasite diagnosis and control. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Differential Effector Engagement by Oncogenic KRAS.
Yuan, Tina L; Amzallag, Arnaud; Bagni, Rachel; Yi, Ming; Afghani, Shervin; Burgan, William; Fer, Nicole; Strathern, Leslie A; Powell, Katie; Smith, Brian; Waters, Andrew M; Drubin, David; Thomson, Ty; Liao, Rosy; Greninger, Patricia; Stein, Giovanna T; Murchie, Ellen; Cortez, Eliane; Egan, Regina K; Procter, Lauren; Bess, Matthew; Cheng, Kwong Tai; Lee, Chih-Shia; Lee, Liam Changwoo; Fellmann, Christof; Stephens, Robert; Luo, Ji; Lowe, Scott W; Benes, Cyril H; McCormick, Frank
2018-02-13
KRAS can bind numerous effector proteins, which activate different downstream signaling events. The best known are RAF, phosphatidylinositide (PI)-3' kinase, and RalGDS families, but many additional direct and indirect effectors have been reported. We have assessed how these effectors contribute to several major phenotypes in a quantitative way, using an arrayed combinatorial siRNA screen in which we knocked down 41 KRAS effectors nodes in 92 cell lines. We show that every cell line has a unique combination of effector dependencies, but in spite of this heterogeneity, we were able to identify two major subtypes of KRAS mutant cancers of the lung, pancreas, and large intestine, which reflect different KRAS effector engagement and opportunities for therapeutic intervention. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
NASA Astrophysics Data System (ADS)
Qiu, Chong; Wei, Wei; Sun, Jing; Zhang, Hai-Tao; Ding, Jing-Song; Wang, Jian-Cheng; Zhang, Qiang
2016-06-01
In this study, hyaluronan (HA)-functionalized calcium phosphate nanoparticles (CaP-AHA/siRNA NPs) were developed for an injectable and targetable delivery of siRNA, which were prepared by coating the alendronate-hyaluronan graft polymer (AHA) around the surface of calcium phosphate-siRNA co-precipitates. The prepared CaP-AHA/siRNA NPs had a uniform spherical core-shell morphology with an approximate size of 170 nm and zeta potential of -12 mV. The coating of hydrophilic HA improved the physical stability of nanoparticles over one month due to the strong interactions between phosphonate and calcium. In vitro experiments demonstrated that the negatively charged CaP-AHA/siRNA NPs could effectively deliver EGFR-targeted siRNA into A549 cells through CD44-mediated endocytosis and significantly down-regulate the level of EGFR expression. Also, the internalized CaP-AHA/siRNA NPs exhibited a pH-responsive release of siRNA, indicating that the acidification of lysosomes probably facilitated the disassembling of nanoparticles and the resultant ions sharply increased the inner osmotic pressure and thus expedited the release of siRNA from late lysosomes into the cytoplasm. Furthermore, in vivo tumor therapy demonstrated that high accumulation of CaP-AHA/siEGFR NPs in tumor led to a significant tumor growth inhibition with a specific EGFR gene silencing effect after intravenous administration in nude mice xenografted with A549 tumor, along with a negligible body weight loss. These results suggested that the CaP-AHA/siRNA NPs could be an effective and safe systemic siRNA delivery system for a RNAi-based tumor targeted therapy strategy.In this study, hyaluronan (HA)-functionalized calcium phosphate nanoparticles (CaP-AHA/siRNA NPs) were developed for an injectable and targetable delivery of siRNA, which were prepared by coating the alendronate-hyaluronan graft polymer (AHA) around the surface of calcium phosphate-siRNA co-precipitates. The prepared CaP-AHA/siRNA NPs had a uniform spherical core-shell morphology with an approximate size of 170 nm and zeta potential of -12 mV. The coating of hydrophilic HA improved the physical stability of nanoparticles over one month due to the strong interactions between phosphonate and calcium. In vitro experiments demonstrated that the negatively charged CaP-AHA/siRNA NPs could effectively deliver EGFR-targeted siRNA into A549 cells through CD44-mediated endocytosis and significantly down-regulate the level of EGFR expression. Also, the internalized CaP-AHA/siRNA NPs exhibited a pH-responsive release of siRNA, indicating that the acidification of lysosomes probably facilitated the disassembling of nanoparticles and the resultant ions sharply increased the inner osmotic pressure and thus expedited the release of siRNA from late lysosomes into the cytoplasm. Furthermore, in vivo tumor therapy demonstrated that high accumulation of CaP-AHA/siEGFR NPs in tumor led to a significant tumor growth inhibition with a specific EGFR gene silencing effect after intravenous administration in nude mice xenografted with A549 tumor, along with a negligible body weight loss. These results suggested that the CaP-AHA/siRNA NPs could be an effective and safe systemic siRNA delivery system for a RNAi-based tumor targeted therapy strategy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr04034a
Using Eco-Mapping to Understand Family Strengths and Resources
ERIC Educational Resources Information Center
McCormick, Katherine M.; Stricklin, Sarintha; Nowak, Theresa M.; Rous, Beth
2008-01-01
As professionals and families work together to identify and celebrate the strengths and resources unique to each family, new and innovative ways to describe and discuss family characteristics are needed. The eco-map, borrowed from social science disciplines, is one method used to describe family strengths and resources. The eco-map was developed…
Dasgupta, Somsankar; Wang, Guanghu; Yu, Robert K.
2011-01-01
Sulfoglucuronosyl paragloboside (SGPG), a minor glycosphingolipid (GSL) of endothelial cells, is a ligand for L-selectin and has been implicated in neuro-inflammatory diseases, such as Guillian-Barré syndrome. Inflammatory cytokines, such as TNFα and IL-1β, up-regulate SGPG expression by stimulating gene expression for glucuronosyltransferases, both P and S forms (GlcATp and GlcATs), and the HNK-1 sulfotransferase (HNK-1 ST). Transfection of a human cerebromicrovascular endothelial cell (SV-HCEC) line with HNK-1 ST siRNA down-regulated SGPG expression, inhibited cytokine-stimulated T cell adhesion, and offered protection against apoptosis. However, the precise mechanisms of SGPG elevation in endothelial cell death (apoptosis) and the maintenance of blood-brain or blood-nerve barrier (BBB or BNB) integrity in inflammation have not been elucidated. Blocking SGPG expression inhibited cytokine-mediated stimulation of NF-κB activity but stimulated MAP kinase (ERK) activity. Furthermore, elevation of SGPG by over-expression of GlcATp and GlcATs triggered endothelial cell apoptosis, with GlcATs being more potent than GlcATp. While SGPG-mediated endothelial cell apoptosis was preceded by inhibiting the intracellular NF-κB activity, interfering with Akt and ERK activation and stimulating caspase 3 in SV-HCECs, HNK-1ST siRNA transfection also interfered with IKB phosphorylation but stimulated ERK activation. Our data indicate that SGPG is a critical regulatory molecule for maintaining endothelial cell survival and BBB/BNB barrier function. PMID:21916893
Zhao, Di; Wang, Wei; Wang, Hao; Peng, Honghai; Liu, Xiangjuan; Guo, Weixing; Su, Guohai; Zhao, Zhuo
2017-01-01
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively regulating autophagy using the technique of PKD knockdown by siRNA. Cardiac hypertrophy was induced in 8-week old male C57BL/6 mice by transverse aortic constriction (TAC). TAC mice were then divided into five groups receiving the treatments of vehicle (DMSO), an autophagy inducer rapamycin (1 mg/kg/day, i.p.), control siRNA, lentiviral PKD siRNA (2×10 8 transducing units/0.1 ml, i.v. injection in one day after surgery, and repeated in 2 weeks after surgery), and PKD siRNA plus 3-methyladenine (3-MA, an autophagy inhibitor, 20 mg/kg/day, i.p.), respectively. Four weeks after TAC surgery, echocardiographic study, hematoxylin and eosin (HE) staining, and Masson's staining showed mice with TAC had significantly hypertrophy and remodeling compared with sham animals. Treatments with PKD siRNA or rapamycin significantly ameliorated the cardiac hypertrophy and dysfunction. Moreover, PKD siRNA increased cardiac autophagic activity determined by electron micrographic study and the biomarkers by Western blot, accompanied with the downregulated AKT/mTOR/S6K signaling pathway. All the cardiac effects of PDK knockdown were inhibited by co-treatment with 3-MA. These results suggest that PKD is involved in the development of cardiac hypertrophy by inhibiting cardiac autophagy via AKT/mTOR pathway.
Xia, He; Jun, Ji; Wen-Ping, Ling; Yi-Feng, Pan; Xiao-Ling, Chen
2013-10-01
The purpose of this study was to elucidate the transfection of chitosan nanoparticle carrying small interfering RNA against platelet-derived growth factor B (PDGF-B) to inhibit the expression of PDGF-B mRNA and proliferation of smooth muscle cells. A rabbit iliac artery injury model was constructed. A small interfering RNA (siRNA) against PDGF-B mRNA expression vector was constructed and packaged by chitosan nanoparticle to transfect into the vascular smooth muscle cells (vSMCs) of balloon catheter-injured rabbit iliac artery wall, using a therapeutic ultrasound for the gene delivery. The experiment was divided into two groups: experimental group, denudation and nano-PDGF-B siRNA treated, and only single denudation as control. Effects of the siRNA on the expressions of proliferating cell nuclear antigen (PCNA) and PDGF-B mRNA by vSMCs and the proliferation of vSMCs were observed with the methods of routine pathological, immunohistochemical staining, in situ hybridization and morphometry. The nano siRNA against PDGF-B was successfully transfected. The nano siRNA significantly inhibited the expressions of PCNA and PDGF-B mRNA in intimal vSMCs. The local intimal thickness and area were also reduced remarkably. In conclusion, transfection of chitosan nanoparticle carrying siRNA against PDGF-B mRNA could inhibit proliferation of vSMCs in the rabbit iliac artery injury model. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.