Sensitive SERS detection of DNA methyltransferase by target triggering primer generation-based multiple signal amplification strategy.

PubMed

Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru

2016-07-15

A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. Copyright © 2016 Elsevier B.V. All rights reserved.

A universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA.

PubMed

Jung, Ulrike; Jiang, Xiaoou; Kaufmann, Stefan H E; Patzel, Volker

2013-12-01

Several methods for the detection of RNA have been developed over time. For small RNA detection, a stem-loop reverse primer-based protocol relying on TaqMan RT-PCR has been described. This protocol requires an individual specific TaqMan probe for each target RNA and, hence, is highly cost-intensive for experiments with small sample sizes or large numbers of different samples. We describe a universal TaqMan-based probe protocol which can be used to detect any target sequence and demonstrate its applicability for the detection of endogenous as well as artificial eukaryotic and bacterial small RNAs. While the specific and the universal probe-based protocol showed the same sensitivity, the absolute sensitivity of detection was found to be more than 100-fold lower for both than previously reported. In subsequent experiments, we found previously unknown limitations intrinsic to the method affecting its feasibility in determination of mature template RISC incorporation as well as in multiplexing. Both protocols were equally specific in discriminating between correct and incorrect small RNA targets or between mature miRNA and its unprocessed RNA precursor, indicating the stem-loop RT-primer, but not the TaqMan probe, triggers target specificity. The presented universal TaqMan-based RT-PCR protocol represents a cost-efficient method for the detection of small RNAs.

Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

PubMed

Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

2017-12-15

This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

PubMed

Ito, Takao; Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

PubMed Central

Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Pathotypic characterization of Newcastle disease virus isolated from vaccinated chicken in West Java, Indonesia.

PubMed

Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia

2017-04-01

This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].

PubMed

Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun

2009-10-01

To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

PubMed

Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

2017-05-15

We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.

PubMed

Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J

2018-01-01

Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.

Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities.

PubMed

Wang, Guoping; Ding, Xiong; Hu, Jiumei; Wu, Wenshuai; Sun, Jingjing; Mu, Ying

2017-10-24

Existing isothermal nucleic acid amplification (INAA) relying on the strand displacement activity of DNA polymerase usually requires at least two primers. However, in this paper, we report an unusual isothermal multimerization and amplification (UIMA) which only needs one primer and is efficiently initiated by the strand-displacing DNA polymerases with reverse transcription activities. On electrophoresis, the products of UIMA present a cascade-shape band and they are confirmed to be multimeric DNAs with repeated target sequences. In contrast to current methods, UIMA is simple to product multimeric DNA, due to the independent of multiple primers and rolling circle structures. Through assaying the synthesized single-stranded DNA targets, UIMA performs high sensitivity and specificity, as well as the universality. In addition, a plausible mechanism of UIMA is proposed, involving short DNA bending, mismatch extension, and template slippage. UIMA is a good explanation for why nonspecific amplification easily happens in existing INAAs. As the simplest INAA till now, UIMA provides a new insight for deeply understanding INAA and opens a new avenue for thoroughly addressing nonspecific amplification.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

NASA Astrophysics Data System (ADS)

Wright, K. E.; Domagal-Goldman, S. D.

2011-12-01

We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and high-schools. We are now producing a second edition, which is an entirely new re-write, and we are making the process of producing the primer a development opportunity in its own right, to strengthen the international community of early-career astrobiologists. We have recruited a large team of writers and editors, 45 people from 11 different countries across North and South America, Europe and Australia. By working together on this joint project we are strengthening links between early-career scientists in these countries. In addition, we have a wider group of early-career astrobiologists who we consulted on the content that the primer should include. We have also recruited early-career scientists from this group, and more widely, to act as 'accessibility reviewers' to check that the primer meets its goal of being clear to people who are not experts in the field. We expect that the primer will be published in 2012, in several different languages. It will be freely available online to all who want it. References 1. Mix LM et al (2006) The Astrobiology Primer : An Outline of General Knowledge - Version 1, 2006 Astrobiology 6(5) : 735-813

Tensile Bond Strength of So-called Universal Primers and Universal Multimode Adhesives to Zirconia and Lithium Disilicate Ceramics.

PubMed

Elsayed, Adham; Younes, Feras; Lehmann, Frank; Kern, Matthias

2017-01-01

To test the bond strength and durability after artificial aging of so-called universal primers and universal multimode adhesives to lithium disilicate or zirconia ceramics. A total of 240 ceramic plates, divided into two groups, were produced and conditioned: 120 acid-etched lithium disilicate plates (IPS e.max CAD) and 120 air-abraded zirconia plates (Zenostar T). Each group was divided into five subgroups (n = 24), and a universal restorative primer or multimode universal adhesive was used for each subgroup to bond plexiglas tubes filled with a composite resin to the ceramic plate. The specimens were stored in water at 37°C for 3 days without thermal cycling, or for 30 or 150 days with 7500 or 37,500 thermal cycles between 5°C and 55°C, respectively. All specimens then underwent tensile bond strength testing. Initially, all bonding systems exhibited high TBS, but some showed a significant reduction after 30 and 150 days of storage. After 3, 30, and 150 days, Monobond Plus, which contains silane and phosphate monomer, showed significantly higher bond strengths than the other universal primer and adhesive systems. The bond strength to lithium disilicate and zirconia ceramic is significantly affected by the bonding system used. Using a separate primer containg silane and phosphate monomer provides more durable bonding than do silanes incorporated in universal multimode adhesives. Only one of five so-called universal primers and adhesives provided durable bonding to lithium disilicate and zirconia ceramic.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

PubMed

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

Undergraduate virology exercises demonstrate conventional and real-time PCR using commercially available HIV primers and noninfectious target.

PubMed

Sulzinski, Michael A; Wasilewski, Melissa A; Farrell, James C; Glick, David L

2009-07-01

It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an undergraduate laboratory course in virology. Here we describe simple procedures for student exercises that demonstrate the PCR detection of an HIV target nucleic acid. Our procedures combine a commercially available kit for conventional PCR with a modification for RT-PCR using the same reagents in the kit, making it possible for an instructor with access to a LightCycler® instrument to implement a relevant student exercise on RT-PCR detection of HIV nucleic acid targets. This combination of techniques is useful for demonstrating and comparing conventional PCR amplification and detection with agarose gel electrophoresis, with real-time PCR over a series of three laboratory periods. The series of laboratory periods also is used to provide the foundation for teaching the concept of PCR primer design, optimization of PCR detection systems, and introduction to nucleic acid queries using NCBI-BLAST to find and identify primers, amplicons, and other potential amplification targets within the HIV viral genome. The techniques were successfully implemented at the Biology 364 undergraduate virology course at the University of Scranton during the Fall 2008 semester. The techniques are particularly targeted to students who intend to pursue either postgraduate technical employment or graduate studies in the molecular life sciences. Copyright © 2009 International Union of Biochemistry and Molecular Biology, Inc.

Instances of erroneous DNA barcoding of metazoan invertebrates: Are universal cox1 gene primers too "universal"?

PubMed

Mioduchowska, Monika; Czyż, Michał Jan; Gołdyn, Bartłomiej; Kur, Jarosław; Sell, Jerzy

2018-01-01

The cytochrome c oxidase subunit I (cox1) gene is the main mitochondrial molecular marker playing a pivotal role in phylogenetic research and is a crucial barcode sequence. Folmer's "universal" primers designed to amplify this gene in metazoan invertebrates allowed quick and easy barcode and phylogenetic analysis. On the other hand, the increase in the number of studies on barcoding leads to more frequent publishing of incorrect sequences, due to amplification of non-target taxa, and insufficient analysis of the obtained sequences. Consequently, some sequences deposited in genetic databases are incorrectly described as obtained from invertebrates, while being in fact bacterial sequences. In our study, in which we used Folmer's primers to amplify COI sequences of the crustacean fairy shrimp Branchipus schaefferi (Fischer 1834), we also obtained COI sequences of microbial contaminants from Aeromonas sp. However, when we searched the GenBank database for sequences closely matching these contaminations we found entries described as representatives of Gastrotricha and Mollusca. When these entries were compared with other sequences bearing the same names in the database, the genetic distance between the incorrect and correct sequences amplified from the same species was c.a. 65%. Although the responsibility for the correct molecular identification of species rests on researchers, the errors found in already published sequences data have not been re-evaluated so far. On the basis of the standard sampling technique we have estimated with 95% probability that the chances of finding incorrectly described metazoan sequences in the GenBank depend on the systematic group, and variety from less than 1% (Mollusca and Arthropoda) up to 6.9% (Gastrotricha). Consequently, the increasing popularity of DNA barcoding and metabarcoding analysis may lead to overestimation of species diversity. Finally, the study also discusses the sources of the problems with amplification of non-target sequences.

A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology1

PubMed Central

Wheeler, Gregory L.; Dorman, Hanna E.; Buchanan, Alenda; Challagundla, Lavanya; Wallace, Lisa E.

2014-01-01

Microsatellites occur in all plant genomes and provide useful markers for studies of genetic diversity and structure. Chloroplast microsatellites (cpSSRs) are frequently targeted because they are more easily isolated than nuclear microsatellites. Here, we quantified the frequency and uses of cpSSRs based on a literature review of over 400 studies published 1995–2013. These markers are an important and economical tool for plant biologists and continue to be used alongside modern genomics approaches to study genetic diversity and structure, evolutionary history, and hybridization in native and agricultural species. Studies using species-specific primers reported a greater number of polymorphic loci than those employing universal primers. A major disadvantage to cpSSRs is fragment size homoplasy; therefore, we documented its occurrence at several cpSSR loci within and between species of Acmispon (Fabaceae). Based on our empirical data set, we recommend targeted sequencing of a subset of samples combined with fragment genotyping as a cost-efficient, data-rich approach to the use of cpSSRs and as a test of homoplasy. The availability of genomic resources for plants aids in the development of primers for new study systems, thereby enhancing the utility of cpSSRs across plant biology. PMID:25506520

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

PubMed

Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

2018-01-01

To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

Method to amplify variable sequences without imposing primer sequences

DOEpatents

Bradbury, Andrew M.; Zeytun, Ahmet

2006-11-14

The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

PubMed Central

Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

2015-01-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

PubMed

Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

2015-07-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

PubMed

Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio; Kano, Shigeyuki

2018-01-01

A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

PubMed Central

Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

2018-01-01

A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Comparison of two suspension arrays for simultaneous detection of five biothreat bacterial in powder samples.

PubMed

Yang, Yu; Wang, Jing; Wen, Haiyan; Liu, Hengchuan

2012-01-01

We have developed novel Bio-Plex assays for simultaneous detection of Bacillus anthracis, Yersinia pestis, Brucella spp., Francisella tularensis, and Burkholderia pseudomallei. Universal primers were used to amplify highly conserved region located within the 16S rRNA amplicon, followed by hybridized to pathogen-specific probes for identification of these five organisms. The other assay is based on multiplex PCR to simultaneously amplify five species-specific pathogen identification-targeted regions unique to individual pathogen. Both of the two arrays are validated to be flexible and sensitive for simultaneous detection of bioterrorism bacteria. However, universal primer PCR-based array could not identify Bacillus anthracis, Yersinia pestis, and Brucella spp. at the species level because of the high conservation of 16S rDNA of the same genus. The two suspension arrays can be utilized to detect Bacillus anthracis sterne spore and Yersinia pestis EV76 from mimic "write powder" samples, they also proved that the suspension array system will be valuable tools for diagnosis of bacterial biothreat agents in environmental samples.

Comparative study of diagnostic accuracy of established PCR assays and in-house developed sdaA PCR method for detection of Mycobacterium tuberculosis in symptomatic patients with pulmonary tuberculosis.

PubMed

Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman

2013-11-01

Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Receptor for Advanced Glycation End Products (RAGE) as a Novel Target for Inhibiting Breast Cancer Bone Metastasis

DTIC Science & Technology

2013-04-01

SUMMARY: We observed high expression of RAGE in ~50-60% of breast invasive ductal carcinomas compared to benign mammary epithelium. RAGE expression was...of the Ohio State University Department of Pathology. Antigen retrieval on TMA slides was performed by Heat-Induced Epitope Retrieval (HIER,) where...TRAP. Furthermore, the osteoclasts were determined by Real time PCR using gene specific primers against cathepsin K (Cstk). It has been shown that

Dual-primer self-generation SERS signal amplification assay for PDGF-BB using label-free aptamer.

PubMed

Ye, SuJuan; Zhai, XiaoMo; Wu, YanYing; Kuang, ShaoPing

2016-05-15

Highly sensitive detection of proteins, especially those associated with cancers, is essential to biomedical research as well as clinical diagnosis. In this work, a simple and novel one-two-three signal amplification surface-enhanced Raman scattering (SERS) method for the detection of protein is fabricated by using label-free aptamer and dual-primer self-generation. Platelet-derived growth factor B-chain (PDGF-BB) is selected as the model protein. The one-two-three cascade DNA amplification means one target-aptamer binding event, two hairpin DNA switches and three DNA amplification reactions. This strategy possesses some remarkable features compared to conventional signal amplification methods: (i) A smart probe including a label-free aptamer is fabricated, for suitable hybridization without hindering the affinity of the aptamer toward its target. (ii) Using the unique structure switch of the aptamer and cooperator, a one-two-three working mode is developed to amplify the SERS signal. The amplification efficiency is enhanced. Given the unique and attractive characteristics, a simple and universal strategy is designed to accomplish ultrasensitive detection of proteins. The detection limit of PDGF-BB via SERS detection is 0.42 pM, with the linear range from 1.0×10(-12)M to 10(-8)M. It is potentially universal because the aptamer can be easily designed for biomolecules whose aptamers undergo similar conformational changes. Copyright © 2015 Elsevier B.V. All rights reserved.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Detection of Bacillus spores using PCR and FTA filters.

PubMed

Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

2004-05-01

Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

PubMed Central

Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A.; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C. M.; Osorio, F.; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed. PMID:26421306

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

PubMed

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

PubMed Central

Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

2014-01-01

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

PRISE2: software for designing sequence-selective PCR primers and probes.

PubMed

Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

2014-09-25

PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

Loop-Mediated Isothermal Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Enterococcus faecalis and Staphylococcus aureus

PubMed Central

Wang, Yi; Li, Hui; Wang, Yan; Zhang, Lu; Xu, Jianguo; Ye, Changyun

2017-01-01

The report describes a simple, rapid and sensitive assay for visual and multiplex detection of Enterococcus faecalis and Staphylococcus aureus based on multiple loop-mediated isothermal amplification (mLAMP) and lateral flow biosensor (LFB). Detection and differentiation of the Ef0027 gene (E. faecalis-specific gene) and nuc gene (S. aureus-specific gene) were determined using fluorescein (FITC)-and digoxin-modified primers in the mLAMP process. In the presence of biotin- and FITC-/digoxin-modified primers, the mLAMP yielded numerous biotin- and FITC-/digoxin-attached duplex products, which were detected by LFB through biotin/streptavidin interaction (biotin on the duplex and streptavidin on the gold nanoparticle) and immunoreactions (FITC/digoxin on the duplex and anti-FITC/digoxin on the LFB test line). The accumulation of gold nanoparticles generated a characteristic red line, enabling visual and multiplex detection of target pathogens without instrumentation. The limit of detection (LoD), analytical specificity and feasibility of LAMP-LFB technique were successfully examined in pure culture and blood samples. The entire procedure, including specimen (blood samples) processing (30 min), isothermal reaction (40 min) and result reporting (within 2 min), could be completed within 75 min. Thus, this assay offers a simple, rapid, sensitive and specific test for multiplex detection of E. faecalis and S. aureus strains. Furthermore, the LAMP-LFB strategy is a universal technique, which can be extended to detect various target sequences by re-designing the specific LAMP primers. PMID:28239371

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.

PubMed

Hallur, V; Sehgal, R; Khurana, S

2015-01-01

The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

PubMed

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive

PubMed Central

2018-01-01

Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

PubMed

Carter-Harris, Lisa

2016-11-01

Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

PubMed

Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

2016-09-01

The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Real-time PCR probe optimization using design of experiments approach.

PubMed

Wadle, S; Lehnert, M; Rubenwolf, S; Zengerle, R; von Stetten, F

2016-03-01

Primer and probe sequence designs are among the most critical input factors in real-time polymerase chain reaction (PCR) assay optimization. In this study, we present the use of statistical design of experiments (DOE) approach as a general guideline for probe optimization and more specifically focus on design optimization of label-free hydrolysis probes that are designated as mediator probes (MPs), which are used in reverse transcription MP PCR (RT-MP PCR). The effect of three input factors on assay performance was investigated: distance between primer and mediator probe cleavage site; dimer stability of MP and target sequence (influenza B virus); and dimer stability of the mediator and universal reporter (UR). The results indicated that the latter dimer stability had the greatest influence on assay performance, with RT-MP PCR efficiency increased by up to 10% with changes to this input factor. With an optimal design configuration, a detection limit of 3-14 target copies/10 μl reaction could be achieved. This improved detection limit was confirmed for another UR design and for a second target sequence, human metapneumovirus, with 7-11 copies/10 μl reaction detected in an optimum case. The DOE approach for improving oligonucleotide designs for real-time PCR not only produces excellent results but may also reduce the number of experiments that need to be performed, thus reducing costs and experimental times.

Helicase Dependent Isothermal Amplification of DNA and RNA using Self-Avoiding Molecular Recognition Systems

PubMed Central

Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.

2015-01-01

Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623

Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities

PubMed Central

Kittelmann, Sandra; Seedorf, Henning; Walters, William A.; Clemente, Jose C.; Knight, Rob; Gordon, Jeffrey I.; Janssen, Peter H.

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats. PMID:23408926

Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

PubMed

Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

PubMed

Koester, Meike; Gergs, René

2017-10-05

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

PubMed

Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

2014-01-01

Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-06-02

States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Nanotechnology: A Policy Primer

DTIC Science & Technology

2008-05-20

of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a

A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

PubMed Central

Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming

2012-01-01

Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780

A blocking primer increases specificity in environmental DNA detection of bull trout (Salvelinus confluentus)

Treesearch

Taylor M. Wilcox; Michael K. Schwartz; Kevin S. McKelvey; Michael K. Young; Winsor H. Lowe

2014-01-01

Environmental DNA (eDNA) is increasingly applied as a highly sensitive way to detect aquatic animals non-invasively. However, distinguishing closely related taxa can be particularly challenging. Previous studies of ancient DNA and genetic diet analysis have used blocking primers to enrich target template in the presence of abundant, non-target DNA. Here we apply a...

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

PubMed

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

PubMed

Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

2009-12-01

To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

PubMed

Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

2009-01-01

* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

PubMed

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

NASA Astrophysics Data System (ADS)

Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

2017-02-01

There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

Molecular diagnostic for boll weevil (Coleoptera: Curculionidae) based on amplification of three species-specific microsatellites.

PubMed

Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W

2009-04-01

The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.

A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids.

PubMed

Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

2008-06-04

Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

PubMed Central

Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

2009-01-01

We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

Properties of targeted preamplification in DNA and cDNA quantification.

PubMed

Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders

2015-01-01

Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.

DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

PubMed

Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

1994-10-01

We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

PubMed Central

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

A graphene-based biosensing platform based on the release of DNA probes and rolling circle amplification.

PubMed

Liu, Meng; Song, Jinping; Shuang, Shaomin; Dong, Chuan; Brennan, John D; Li, Yingfu

2014-06-24

We report a versatile biosensing platform capable of achieving ultrasensitive detection of both small-molecule and macromolecular targets. The system features three components: reduced graphene oxide for its ability to adsorb single-stranded DNA molecules nonspecifically, DNA aptamers for their ability to bind reduced graphene oxide but undergo target-induced conformational changes that facilitate their release from the reduced graphene oxide surface, and rolling circle amplification (RCA) for its ability to amplify a primer-template recognition event into repetitive sequence units that can be easily detected. The key to the design is the tagging of a short primer to an aptamer sequence, which results in a small DNA probe that allows for both effective probe adsorption onto the reduced graphene oxide surface to mask the primer domain in the absence of the target, as well as efficient probe release in the presence of the target to make the primer available for template binding and RCA. We also made an observation that the circular template, which on its own does not cause a detectable level of probe release from the reduced graphene oxide, augments target-induced probe release. The synergistic release of DNA probes is interpreted to be a contributing factor for the high detection sensitivity. The broad utility of the platform is illustrated though engineering three different sensors that are capable of achieving ultrasensitive detection of a protein target, a DNA sequence and a small-molecule analyte. We envision that the approach described herein will find useful applications in the biological, medical, and environmental fields.

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Multi-targeted priming for genome-wide gene expression assays.

PubMed

Adomas, Aleksandra B; Lopez-Giraldez, Francesc; Clark, Travis A; Wang, Zheng; Townsend, Jeffrey P

2010-08-17

Complementary approaches to assaying global gene expression are needed to assess gene expression in regions that are poorly assayed by current methodologies. A key component of nearly all gene expression assays is the reverse transcription of transcribed sequences that has traditionally been performed by priming the poly-A tails on many of the transcribed genes in eukaryotes with oligo-dT, or by priming RNA indiscriminately with random hexamers. We designed an algorithm to find common sequence motifs that were present within most protein-coding genes of Saccharomyces cerevisiae and of Neurospora crassa, but that were not present within their ribosomal RNA or transfer RNA genes. We then experimentally tested whether degenerately priming these motifs with multi-targeted primers improved the accuracy and completeness of transcriptomic assays. We discovered two multi-targeted primers that would prime a preponderance of genes in the genomes of Saccharomyces cerevisiae and Neurospora crassa while avoiding priming ribosomal RNA or transfer RNA. Examining the response of Saccharomyces cerevisiae to nitrogen deficiency and profiling Neurospora crassa early sexual development, we demonstrated that using multi-targeted primers in reverse transcription led to superior performance of microarray profiling and next-generation RNA tag sequencing. Priming with multi-targeted primers in addition to oligo-dT resulted in higher sensitivity, a larger number of well-measured genes and greater power to detect differences in gene expression. Our results provide the most complete and detailed expression profiles of the yeast nitrogen starvation response and N. crassa early sexual development to date. Furthermore, our multi-targeting priming methodology for genome-wide gene expression assays provides selective targeting of multiple sequences and counter-selection against undesirable sequences, facilitating a more complete and precise assay of the transcribed sequences within the genome.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

PubMed

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

A universal procedure for primer labelling of amplicons.

PubMed Central

Neilan, B A; Wilton, A N; Jacobs, D

1997-01-01

Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046

One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

PubMed

Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

2015-03-01

A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

PubMed

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

Molecular diversity of poleroviruses infecting cucurbit crops in four countries reveals the presence of members of six distinct species.

PubMed

Knierim, D; Tsai, W S; Maiss, E; Kenyon, L

2014-06-01

When 66 cucurbit samples with yellowing symptoms from fields in Mali, the Philippines, Thailand and Uzbekistan were screened by RT-PCR using universal polerovirus primers, 21 were identified as harboring polerovirus RNA. When these 21 samples were screened with specific primers for the known cucurbit-infecting poleroviruses, suakwa aphid-borne yellows virus and a recombinant strain of cucurbit aphid-borne yellows virus were detected for the first time in the Philippines and Thailand. However, seven polerovirus-positive samples did not react with any of the known species-specific primers. Sequencing of 1.4-kb universal polerovirus RT-PCR products revealed the presence of two poleroviruses that had not been described previously. These viruses, from Mali and Thailand, were provisionally named pepo aphid-borne yellows virus and luffa aphid-borne yellows virus, respectively.

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

Helicase-Dependent Isothermal Amplification of DNA and RNA by Using Self-Avoiding Molecular Recognition Systems.

PubMed

Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M; Hoshika, Shuichi; Frye, Carole B; Benner, Steven A

2015-06-15

Assays that detect DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low-resource environments, and requires equipment and power that might not be available in these environments. Isothermal procedures, which avoid thermal cycling, are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a "self avoiding molecular recognition system" (SAMRS) eliminates these artifacts and gives clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3'-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, difficult to achieve with HDA using standard primers. Thus, SAMRS-HDA is a more versatile approach than standard HDA, with a broader applicability for xNA-targeted diagnostics and research. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

NASA Astrophysics Data System (ADS)

Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

2008-01-01

Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

PubMed

Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

2013-10-17

Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

Effects of Universal and Conventional MDP Primers on the Shear Bond Strength of Zirconia Ceramic and Nanofilled Composite Resin

PubMed Central

Sharafeddin, Farahnaz; Shoale, Soodabe

2018-01-01

Statement of the Problem: The clinical success of ceramic depends on the quality of the bond between the zirconia and resin cement. Purpose: In the present study, the effects of universal and conventional MDP-containing primers were evaluated on the shear bond strength of zirconia ceramic and nanofilled composite resin. Materials and Method: Thirty blocks of zirconia ceramic (6mm×2mm) were prepared. Then the inner surfaces were air-abraded and divided into three groups (n= 10) as follows: untreated with primer (control group, I); All- Bond Universal (group II) and Z-Prime Plus (group III). The specimens in each group were bonded with Variolink N cement to cylinders of composite resin Z350XT. After 24 hour water storage, the shear bond strength test was performed with a universal testing machine at a crosshead speed of 1mm/ min and bond strength values (MPa) were calculated and analyzed with one-way ANOVA and post hoc Tukey tests (p< 0.05). The failure mode of each specimen was evaluated under a stereomicroscope and representative specimens were analyzed by scanning electron microscopy (SEM). Results: The mean shear bond strength values (MPa) were 7.58±1.62, 17.51±1.34 and 22.45±3.60 in groups I, II and III, respectively. These results indicated that the shear bond strength were significantly higher in groups II and III compared to the control group (p< 0.001). Chemical pre-treatment of zirconia with Z- Prime Plus revealed significantly higher bond strength than the All-Bond Universal adhesive (p< 0.002). All the failure modes were adhesive in the control group (I) and when using primer treatment, mixed failures occurred in 40% and 50% of specimens in groups II and III, respectively. Conclusion: Treatment with both primers resulted in higher bond strength values compared to the control group. The use of Z-Prime Plus treatment in combination with air-abrasion procedure resulted in the highest bond strength. PMID:29492416

Bonding effectiveness to different chemically pre-treated dental zirconia.

PubMed

Inokoshi, Masanao; Poitevin, André; De Munck, Jan; Minakuchi, Shunsuke; Van Meerbeek, Bart

2014-09-01

The objective of this study was to evaluate the effect of different chemical pre-treatments on the bond durability to dental zirconia. Fully sintered IPS e.max ZirCAD (Ivoclar Vivadent) blocks were subjected to tribochemical silica sandblasting (CoJet, 3M ESPE). The zirconia samples were additionally pre-treated using one of four zirconia primers/adhesives (Clearfil Ceramic Primer, Kuraray Noritake; Monobond Plus, Ivoclar Vivadent; Scotchbond Universal, 3M ESPE; Z-PRIME Plus, Bisco). Finally, two identically pre-treated zirconia blocks were bonded together using composite cement (RelyX Ultimate, 3M ESPE). The specimens were trimmed at the interface to a cylindrical hourglass and stored in distilled water (7 days, 37 °C), after which they were randomly tested as is or subjected to mechanical ageing involving cyclic tensile stress (10 N, 10 Hz, 10,000 cycles). Subsequently, the micro-tensile bond strength was determined, and SEM fractographic analysis performed. Weibull analysis revealed the highest Weibull scale and shape parameters for the 'Clearfil Ceramic Primer/mechanical ageing' combination. Chemical pre-treatment of CoJet (3M ESPE) sandblasted zirconia using Clearfil Ceramic Primer (Kuraray Noritake) and Monobond Plus (Ivoclar Vivadent) revealed a significantly higher bond strength than when Scotchbond Universal (3M ESPE) and Z-PRIME Plus (Bisco) were used. After ageing, Clearfil Ceramic Primer (Kuraray Noritake) revealed the most stable bond durability. Combined mechanical/chemical pre-treatment, the latter with either Clearfil Ceramic Primer (Kuraray Noritake) or Monobond Plus (Ivoclar Vivadent), resulted in the most durable bond to zirconia. As a standard procedure to durably bond zirconia to tooth tissue, the application of a combined 10-methacryloyloxydecyl dihydrogen phosphate/silane ceramic primer to zirconia is clinically highly recommended.

Molecular Technique to Understand Deep Microbial Diversity

NASA Technical Reports Server (NTRS)

Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.

2012-01-01

Current sequencing-based and DNA microarray techniques to study microbial diversity are based on an initial PCR (polymerase chain reaction) amplification step. However, a number of factors are known to bias PCR amplification and jeopardize the true representation of bacterial diversity. PCR amplification of the minor template appears to be suppressed by the exponential amplification of the more abundant template. It is widely acknowledged among environmental molecular microbiologists that genetic biosignatures identified from an environment only represent the most dominant populations. The technological bottleneck has overlooked the presence of the less abundant minority population, and underestimated their role in the ecosystem maintenance. To generate PCR amplicons for subsequent diversity analysis, bacterial l6S rRNA genes are amplified by PCR using universal primers. Two distinct PCR regimes are employed in parallel: one using normal and the other using biotinlabeled universal primers. PCR products obtained with biotin-labeled primers are mixed with streptavidin-labeled magnetic beads and selectively captured in the presence of a magnetic field. Less-abundant DNA templates that fail to amplify in this first round of PCR amplification are subjected to a second round of PCR using normal universal primers. These PCR products are then subjected to downstream diversity analyses such as conventional cloning and sequencing. A second round of PCR amplified the minority population and completed the deep diversity picture of the environmental sample.

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Binary electrokinetic separation of target DNA from background DNA primers.

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Conrad D.; Derzon, Mark Steven

2005-10-01

This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting themore » entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.« less

A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

PubMed Central

Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

2008-01-01

Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Planning for climate change on the National Wildlife Refuge System

Treesearch

B. Czech; S. Covington; T. M. Crimmins; J. A. Ericson; C. Flather; M. Gale; K. Gerst; M. Higgins; M. Kaib; E. Marino; T. Moran; J. Morton; N. Niemuth; H. Peckett; D. Savignano; L. Saperstein; S. Skorupa; E. Wagener; B. Wilen; B. Wolfe

2014-01-01

This document originated in 2008 as a collaborative project of the U.S. Fish and Wildlife Service (FWS) and the University of Maryland's Graduate Program in Sustainable Development and Conservation Biology. The original title was A Primer on Climate Change for the National Wildlife Refuge System. The Primer has evolved into Planning for Climate Change on the...

Issues Primer. EEE708 Negotiated Study Program.

ERIC Educational Resources Information Center

Jennings, Leonie

This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

Universal Detection and Identification of Avian Influenza Virus by Use of Resequencing Microarrays

DTIC Science & Technology

2009-04-01

For the RT step, primer LN was replaced by primer NLN (a random 9-mer with a linker se- quence). One picogram each of two internal controls (NAC1...samples (data not shown). These data indicated that most of the avian H5N1 samples identified were presumably sensitive to neuraminidase inhibitors

Accuracy of Conventional PCR Targeting the 16S rRNA Gene with the Ot-16sRF1 and Ot-16sRR1 Primers for Diagnosis of Scrub Typhus: a Case-Control Study

PubMed Central

Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon

2015-01-01

We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Detection of RNA Viruses.

PubMed

Ball, Cameron S; Light, Yooli K; Koh, Chung-Yan; Wheeler, Sarah S; Coffey, Lark L; Meagher, Robert J

2016-04-05

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of the reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read "quasar"), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). Furthermore, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.

Limited efficiency of universal mini-barcode primers for DNA amplification from desert reptiles, birds and mammals.

PubMed

Arif, I A; Khan, H A; Al Sadoon, M; Shobrak, M

2011-10-31

In recent years, DNA barcoding has emerged as a powerful tool for species identification. We report an extended validation of a universal DNA mini-barcode for amplification of 130-bp COI segments from 23 specimens collected from a desert environment, including 11 reptiles, five mammals and seven birds. Besides the standard double-annealing protocol, we also tested a more stringent single-annealing protocol. The PCR success rate for the amplification of the mini-barcode region was: mammals (4/5), reptiles (5/11) and birds (4/7). These findings demonstrate the limited utility of universal primers for mini-barcoding, at least for these vertebrate taxa that we collected from the Saudi Arabian desert.

Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

PubMed

Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

2017-03-01

Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

Exploring target-specific primer extension in combination with a bead-based suspension array for multiplexed detection and typing using Streptococcus suis as a model pathogen

PubMed Central

van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.

2017-01-01

We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

PubMed

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification

USDA-ARS?s Scientific Manuscript database

The technique of loop-mediated isothermal amplification (LAMP) utilizes 4 (or 6) primers targeting 6 (or 8) regions within a fairly small segment of a genome for amplification, with concentration higher than that used in traditional PCR methods. The high concentrations of primers used leads to an in...

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

Evaluation of Primers Targeting the Diazotroph Functional Gene and Development of NifMAP – A Bioinformatics Pipeline for Analyzing nifH Amplicon Data

PubMed Central

Angel, Roey; Nepel, Maximilian; Panhölzl, Christopher; Schmidt, Hannes; Herbold, Craig W.; Eichorst, Stephanie A.; Woebken, Dagmar

2018-01-01

Diazotrophic microorganisms introduce biologically available nitrogen (N) to the global N cycle through the activity of the nitrogenase enzyme. The genetically conserved dinitrogenase reductase (nifH) gene is phylogenetically distributed across four clusters (I–IV) and is widely used as a marker gene for N2 fixation, permitting investigators to study the genetic diversity of diazotrophs in nature and target potential participants in N2 fixation. To date there have been limited, standardized pipelines for analyzing the nifH functional gene, which is in stark contrast to the 16S rRNA gene. Here we present a bioinformatics pipeline for processing nifH amplicon datasets – NifMAP (“NifH MiSeq Illumina Amplicon Analysis Pipeline”), which as a novel aspect uses Hidden-Markov Models to filter out homologous genes to nifH. By using this pipeline, we evaluated the broadly inclusive primer pairs (Ueda19F–R6, IGK3–DVV, and F2–R6) that target the nifH gene. To evaluate any systematic biases, the nifH gene was amplified with the aforementioned primer pairs in a diverse collection of environmental samples (soils, rhizosphere and roots samples, biological soil crusts and estuarine samples), in addition to a nifH mock community consisting of six phylogenetically diverse members. We noted that all primer pairs co-amplified nifH homologs to varying degrees; up to 90% of the amplicons were nifH homologs with IGK3–DVV in some samples (rhizosphere and roots from tall oat-grass). In regards to specificity, we observed some degree of bias across the primer pairs. For example, primer pair F2–R6 discriminated against cyanobacteria (amongst others), yet captured many sequences from subclusters IIIE and IIIL-N. These aforementioned subclusters were largely missing by the primer pair IGK3–DVV, which also tended to discriminate against Alphaproteobacteria, but amplified sequences within clusters IIIC (affiliated with Clostridia) and clusters IVB and IVC. Primer pair Ueda19F–R6 exhibited the least bias and successfully captured diazotrophs in cluster I and subclusters IIIE, IIIL, IIIM, and IIIN, but tended to discriminate against Firmicutes and subcluster IIIC. Taken together, our newly established bioinformatics pipeline, NifMAP, along with our systematic evaluations of nifH primer pairs permit more robust, high-throughput investigations of diazotrophs in diverse environments. PMID:29760683

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

Start codon targeted (SCoT) and target region amplification polymorphism (TRAP) for evaluating the genetic relationship of Dendrobium species.

PubMed

Feng, Shangguo; He, Refeng; Yang, Sai; Chen, Zhe; Jiang, Mengying; Lu, Jiangjie; Wang, Huizhong

2015-08-10

Two molecular marker systems, start codon targeted (SCoT) and target region amplification polymorphism (TRAP), were used for genetic relationship analysis of 36 Dendrobium species collected from China. Twenty-two selected SCoT primers produced 337 loci, of which 324 (96%) were polymorphic, whereas 13 TRAP primer combinations produced a total of 510 loci, with 500 (97.8%) of them being polymorphic. An average polymorphism information content of 0.953 and 0.983 was detected using the SCoT and TRAP primers, respectively, showing that a high degree of genetic diversity exists among Chinese Dendrobium species. The partition of clusters in the unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis plot based on the SCoT and TRAP markers was similar and clustered the 36 Dendrobium species into four main groups. Our results will provide useful information for resource protection and will also be useful to improve the current Dendrobium breeding programs. Our results also demonstrate that SCoT and TRAP markers are informative and can be used to evaluate genetic relationships between Dendrobium species. Copyright © 2015 Elsevier B.V. All rights reserved.

An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

PubMed

Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

2013-04-15

An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

PubMed

Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

2017-01-03

This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Easy detection of multiple Alexandrium species using DNA chromatography chip.

PubMed

Nagai, Satoshi; Miyamoto, Shigehiko; Ino, Keita; Tajimi, Seisuke; Nishi, Hiromi; Tomono, Jun

2016-01-01

In this study, the Kaneka DNA chromatography chip (KDCC) for the Alexandrium species was successfully developed for simultaneous detection of five Alexandrium species. This method utilizes a DNA-DNA hybridization technology. In the PCR process, specifically designed tagged-primers are used, i.e. a forward primer consisting of a tag domain, which can conjugate with gold nanocolloids on the chip, and a primer domain, which can anneal/amplify the target sequence. However, the reverse primer consists of a tag domain, which can hybridize to the solid-phased capture probe on the chip, and a primer domain, which can anneal/amplify the target sequence. As a result, a red line that originates from gold nanocolloids appears as a positive signal on the chip, and the amplicon is detected visually by the naked eye. This technique is simple, because it is possible to visually detect the target species soon after (<5min) the application of 2μL of PCR amplicon and 65μL of development buffer to the sample pad of the chip. Further, this technique is relatively inexpensive and does not require expensive laboratory equipment, such as real-time Q-PCR machines or DNA microarray detectors, but a thermal cycler. Regarding the detection limit of KDCC for the five Alexandrium species, it varied among species and it was <0.1-10pg and equivalent to 5-500 copies of rRNA genes, indicating that the technique is sensitive enough for practical use to detect several cells of the target species from 1L of seawater. The detection sensitivity of KDCC was also evaluated with two different techniques, i.e. a multiplex-PCR and a digital DNA hybridization by digital DNA chip analyzer (DDCA), using natural plankton assemblages. There was no significant difference in the detection sensitivity among the three techniques, suggesting KDCC can be readily used to monitor the HAB species. Copyright © 2015 Elsevier B.V. All rights reserved.

Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

PubMed Central

Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

2011-01-01

Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.

PubMed

Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan

2014-11-01

Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico <75% of insect species with complete mitochondrial genomes available, whereas new primers targeting 16S provided >90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE PAGES

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan; ...

2016-03-16

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

A Primer on Fresh Water: The Environmental Citizenship Series.

ERIC Educational Resources Information Center

Environment Canada, Ottawa (Ontario).

Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

PubMed

Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

2016-09-01

Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

PubMed Central

Tank, David C.

2016-01-01

Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology.

PubMed

Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Boudreau, Dominique K; Bergeron, Michel G

2015-04-01

Recombinase polymerase amplification (RPA) technology relies on three major proteins, recombinase proteins, single-strand binding proteins, and polymerases, to specifically amplify nucleic acid sequences in an isothermal format. The performance of RPA with respect to sequence mismatches of closely-related non-target molecules is not well documented and the influence of the number and distribution of mismatches in DNA sequences on RPA amplification reaction is not well understood. We investigated the specificity of RPA by testing closely-related species bearing naturally occurring mismatches for the tuf gene sequence of Pseudomonas aeruginosa and/or Mycobacterium tuberculosis and for the cfb gene sequence of Streptococcus agalactiae. In addition, the impact of the number and distribution of mismatches on RPA efficiency was assessed by synthetically generating 14 types of mismatched forward primers for detecting five bacterial species of high diagnostic relevance such as Clostridium difficile, Staphylococcus aureus, S. agalactiae, P. aeruginosa, and M. tuberculosis as well as Bacillus atropheus subsp. globigii for which we use the spores as internal control in diagnostic assays. A total of 87 mismatched primers were tested in this study. We observed that target specific RPA primers with mismatches (n > 1) at their 3'extrimity hampered RPA reaction. In addition, 3 mismatches covering both extremities and the center of the primer sequence negatively affected RPA yield. We demonstrated that the specificity of RPA was multifactorial. Therefore its application in clinical settings must be selected and validated a priori. We recommend that the selection of a target gene must consider the presence of closely-related non-target genes. It is advisable to choose target regions with a high number of mismatches (≥36%, relative to the size of amplicon) with respect to closely-related species and the best case scenario would be by choosing a unique target gene. Copyright © 2014 Elsevier Ltd. All rights reserved.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

PubMed Central

Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

PubMed

Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction.

PubMed

Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin

2009-02-01

Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.

The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

PubMed

Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

2018-04-01

Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined mixtures. These data indicate that for authentication purposes, complementary PCR-related methods are highly recommendable for the analysis of herbal mixtures in parallel. Copyright © 2018 Elsevier GmbH. All rights reserved.

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

The Detection of Spotted Fever Group Rickettsia DNA in Tick Samples From Pastoral Communities in Kenya.

PubMed

Koka, Hellen; Sang, Rosemary; Kutima, Helen Lydia; Musila, Lillian

2017-05-01

In this study, ticks from pastoral communities in Kenya were tested for Rickettsia spp. infections in geographical regions where the presence of tick-borne arboviruses had previously been reported. Rickettsial and arbovirus infections have similar clinical features which makes differential diagnosis challenging when both diseases occur. The tick samples were tested for Rickettsia spp. by conventional PCR using three primer sets targeting the gltA, ompA, and ompB genes followed by amplicon sequencing. Of the tick pools screened, 25% (95/380) were positive for Rickettsia spp. DNA using the gltA primer set. Of the tick-positive pools, 60% were ticks collected from camels. Rickettsia aeschlimannii and R. africae were the main Rickettsia spp. detected in the tick pools sequenced. The findings of this study indicate that multiple Rickettsia species are circulating in ticks from pastoral communities in Kenya and could contribute to the etiology of febrile illness in these areas. Diagnosis and treatment of rickettsial infections should be a public health priority in these regions. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Discovery of variant infectious salmon anaemia virus (ISAV) of European genotype in British Columbia, Canada.

PubMed

Kibenge, Molly Jt; Iwamoto, Tokinori; Wang, Yingwei; Morton, Alexandra; Routledge, Richard; Kibenge, Frederick Sb

2016-01-06

Infectious salmon anaemia (ISA) virus (ISAV) belongs to the genus Isavirus, family Orthomyxoviridae. ISAV occurs in two basic genotypes, North American and European. The European genotype is more widespread and shows greater genetic variation and greater virulence variation than the North American genotype. To date, all of the ISAV isolates from the clinical disease, ISA, have had deletions in the highly polymorphic region (HPR) on ISAV segment 6 (ISAV-HPRΔ) relative to ISAV-HPR0, named numerically from ISAV-HPR1 to over ISAV-HPR30. ISA outbreaks have only been reported in farmed Atlantic salmon, although ISAV has been detected by RT-PCR in wild fish. It is recognized that asymptomatically ISAV-infected fish exist. There is no universally accepted ISAV RT-qPCR TaqMan® assay. Most diagnostic laboratories use the primer-probe set targeting a 104 bp-fragment on ISAV segment 8. Some laboratories and researchers have found a primer-probe set targeting ISAV segment 7 to be more sensitive. Other researchers have published different ISAV segment 8 primer-probe sets that are highly sensitive. In this study, we tested 1,106 fish tissue samples collected from (i) market-bought farmed salmonids and (ii) wild salmon from throughout British Columbia (BC), Canada, for ISAV using real time RT-qPCR targeting segment 8 and/or conventional RT-PCR with segment 8 primers and segment 6 HPR primers, and by virus isolation attempts using Salmon head kidney (SHK-1 and ASK-2) cell line monolayers. The sequences from the conventional PCR products were compared by multiple alignment and phylogenetic analyses. Seventy-nine samples were "non-negative" with at least one of these tests in one or more replicates. The ISAV segment 6 HPR sequences from the PCR products matched ISAV variants, HPR5 on 29 samples, one sample had both HPR5 and HPR7b and one matched HPR0. All sequences were of European genotype. In addition, alignment of sequences of the conventional PCR product segment 8 showed they had a single nucleotide mutation in the region of the probe sequence and a 9-nucleotide overlap with the reverse primer sequence of the real time RT-qPCR assay. None of the classical ISAV segment 8 sequences in the GenBank have this mutation in the probe-binding site of the assay, suggesting the presence of a novel ISAV variant in BC. A phylogenetic tree of these sequences showed that some ISAV sequences diverted early from the classical European genotype sequences, while others have evolved separately. All virus isolation attempts on the samples were negative, and thus the samples were considered "negative" in terms of the threshold trigger set for Canadian federal regulatory action; i.e., successful virus isolation in cell culture. This is the first published report of the detection of ISAV sequences in fish from British Columbia, Canada. The sequences detected, both of ISAV-HPRΔ and ISAV-HPR0 are of European genotype. These sequences are different from the classical ISAV segment 8 sequences, and this difference suggests the presence of a new ISAV variant of European genotype in BC. Our results further suggest that ISAV-HPRΔ strains can be present without clinical disease in farmed fish and without being detected by virus isolation using fish cell lines.

Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

PubMed Central

Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

2018-01-01

Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

PubMed

Vatolin, Sergei; Weil, Robert J

2008-01-01

Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

PubMed Central

Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

2001-01-01

We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

Treesearch

M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

2004-01-01

The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

Massive Open Online Courses (MOOCs): A Primer for University and College Board Members. An AGB White Paper

ERIC Educational Resources Information Center

Voss, Brian D.

2013-01-01

The environment in which MOOCs and other forms of online education operate is changing virtually every day. Based upon a presentation given to the board of directors of AGB, this white paper is an effort to give board chairs, presidents, and others some context to help guide discussions on their own campuses. It provides a primer on MOOCs,…

Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

PubMed

Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

2012-04-20

In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

PubMed

Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

2015-07-29

In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

Primer-Free Aptamer Selection Using A Random DNA Library

PubMed Central

Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary

2010-01-01

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences using high efficiency partitioning are met with problems regarding PCR amplification 10. We have developed a primer-free (PF) selection method that significantly simplifies SELEX procedures and effectively eliminates primer-interference problems 11, 12. The protocols work in a straightforward manner. The central random region of the library is purified without extraneous flanking sequences and is bound to a suitable target (for example to a purified protein or complex mixtures such as cell lines). Then the bound sequences are obtained, reunited with flanking sequences, and re-amplified to generate selected sub-libraries. As an example, here we selected aptamers to S100B, a protein marker for melanoma. Binding assays showed Kd s in the 10-7 - 10-8 M range after a few rounds of selection, and we demonstrate that the aptamers function effectively in a sandwich binding format. PMID:20689511

Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

PubMed

Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

2010-08-01

We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

Nucleic acid amplification of HIV-1 integrase sequence subtypes CRF01_AE and B for development of HIV anti-integrase drug resistance genotyping assay

NASA Astrophysics Data System (ADS)

Adlar, F. R.; Bela, B.

2017-08-01

To anticipate the potential use of anti-integrase drugs in Indonesia for treatment of HIV-1 infection, the development of a drug resistance genotyping assay for anti-integrase is crucial in identifying the genetic drug resistance profile of Indonesian HIV-1 strains. This experiment aimed to amplify a target region in the integrase gene of Indonesian HIV-1 subtypes CRF01_AE and B that contain genetic mutations known to confer resistance to anti-integrase drug. Eleven archived plasma samples from individuals living with HIV-1 were obtained from the Virology and Cancer Pathobiology Research Center for Health Service (VCPRC FKUI-RSCM) laboratory. One of the plasma samples contained HIV-1 subtype B, and the remaining plasma samples contained subtype CRF01_AE. The target regions for all samples were amplified through RT-PCR, with an annealing temperature of 55 °C, using the primer pair AE_POL 4086F and AE_POL 5232R that were designed by VCPRC FKUI-RSCM. The results of this experiment show that 18.2% (2/11) of the samples were successfully amplified using the one-step RT-PCR. While the primer pair was effective in amplifying the target region in the integrase gene sequence for subtype B (100%; 1/1), it had a low efficacy (10%, 1/10) for subtype CRF01_AE. In conclusion, the primer pair can be used to amplify the target region in Indonesian HIV-1 strain subtypes CRF01_AE and B. However, optimization of the PCR condition and an increased number of samples would help to determine an accurate representation of the efficacy of the primer pair.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

PubMed

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

Highly Sensitive Detection of Low-Abundance White Spot Syndrome Virus by a Pre-Amplification PCR Method.

PubMed

Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo

2017-03-28

White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.

Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

PubMed Central

Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

2014-01-01

A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

PubMed Central

Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

2013-01-01

In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Genetic structure of soil population of fungus Fusarium oxysporum Schlechtend.: Fr.: Molecular reidentification of the species and genetic differentiation of isolates using polymerase chain reaction technique with universal primers (UP-PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.

1995-07-01

The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlativelymore » occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.« less

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

PubMed

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter (pitA, pstS) were amplified from 13 respectively 9 distinct microbial orders. Accordingly the introduced primers represent a valuable tool for further analysis of the microbial community involved in the turnover of phosphorus in soils but most likely also in other environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

PubMed

Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

2017-08-01

Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

PubMed

Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

2015-03-01

Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Liability Insurance: A Primer for College and University Counsel.

ERIC Educational Resources Information Center

Ende, Howard; Anderson, Eugene R.; Crego, Susannah

1997-01-01

Because of the rise in litigation involving colleges and universities, basic information about liability insurance is provided. Administrators are warned that previously purchased liability insurance may not cover damages and losses incurred today, and that insurance companies often benefit from extended litigation. College counsel must understand…

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Multiplex real-time PCR assay for Legionella species.

PubMed

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

PubMed

O'Halloran, Damien M

2015-06-01

Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

PubMed

Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

2006-05-01

Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

Effect of laser heat treatment on Pull-out bond strength of fiber posts treated with different silanes.

PubMed

Shafiei, Fereshteh; Saadat, Maryam; Jowkar, Zahra

2018-05-01

This study evaluated the effect of three different silanes and post-silanization treatments on the retentive strength of fiber posts luted with an etch-and-rinse resin cement. One hundred intact maxillary central incisors were randomly divided into 10 groups after endodontic treatment and post space preparation (n=10). The fiber posts were etched using 24% hydrogen peroxide. Posts of the control group did not receive silane. In nine experimental groups, each of the three silanes used, Scotchbond Universal adhesive, Bis-Silane and Porcelain Primer, was subjected to three treatments: air-drying at 25°C, warm air-drying and CO2 laser heat treatment. After cementation of the treated posts using One-Step Plus/Duo-Link cement, the specimens were stored for one weak and then subjected to pull-out bond strength (PBS) testing. The data in Newton (N) were analyzed using two-way ANOVA and Tukey tests (α=0.05). PBS was significantly affected by silane type and post-silanization treatment ( p <0.001). The interaction of the two factors was not statistically significant ( p =0.15). The effect of Porcelain Primer on PBS was significantly higher than those of universal adhesive ( p <0.001) and Bis-Silane ( p =0.01), with similar results for the two latter. Warm air-drying and laser treatment significantly increased PBS ( p <0.001). The lowest and highest PBS was obtained in the control (no silane) group (190.9±31) and laser-treated/ Porcelain Primer group (377.1±50), respectively. Warm air-drying and CO2 laser heat treatment had a significantly beneficial effect on retentive strength of fiber posts. Porcelain Primer was significantly more effective than universal adhesive and Bis-Silane. Key words: Laser heat treatment, Pull-out bond strength, fiber post.

Teaching and Technology Transfer as Alternative Revenue Streams: A Primer on the Potential Legal Implications for UK Universities

ERIC Educational Resources Information Center

Van Hoorebeek, Mark; Marson, James

2005-01-01

Purpose: The purpose of this paper is to assess the financial and intellectual issues facing the university sector as many institutions in the UK pursue alternative revenue streams. As a consequence to the increasing financial pressures, university departments are increasingly exposed to new forms of potential litigation and also face the risk to…

Multicentric Comparative Analytical Performance Study for Molecular Detection of Low Amounts of Toxoplasma gondii from Simulated Specimens▿ †

PubMed Central

Sterkers, Yvon; Varlet-Marie, Emmanuelle; Cassaing, Sophie; Brenier-Pinchart, Marie-Pierre; Brun, Sophie; Dalle, Frédéric; Delhaes, Laurence; Filisetti, Denis; Pelloux, Hervé; Yera, Hélène; Bastien, Patrick

2010-01-01

Although screening for maternal toxoplasmic seroconversion during pregnancy is based on immunodiagnostic assays, the diagnosis of clinically relevant toxoplasmosis greatly relies upon molecular methods. A problem is that this molecular diagnosis is subject to variation of performances, mainly due to a large diversity of PCR methods and primers and the lack of standardization. The present multicentric prospective study, involving eight laboratories proficient in the molecular prenatal diagnosis of toxoplasmosis, was a first step toward the harmonization of this diagnosis among university hospitals in France. Its aim was to compare the analytical performances of different PCR protocols used for Toxoplasma detection. Each center extracted the same concentrated Toxoplasma gondii suspension and tested serial dilutions of the DNA using its own assays. Differences in analytical sensitivities were observed between assays, particularly at low parasite concentrations (≤2 T. gondii genomes per reaction tube), with “performance scores” differing by a 20-fold factor among laboratories. Our data stress the fact that differences do exist in the performances of molecular assays in spite of expertise in the matter; we propose that laboratories work toward a detection threshold defined for a best sensitivity of this diagnosis. Moreover, on the one hand, intralaboratory comparisons confirmed previous studies showing that rep529 is a more adequate DNA target for this diagnosis than the widely used B1 gene. But, on the other hand, interlaboratory comparisons showed differences that appear independent of the target, primers, or technology and that hence rely essentially on proficiency and care in the optimization of PCR conditions. PMID:20610670

Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests.

PubMed

Pochon, Xavier; Bott, Nathan J; Smith, Kirsty F; Wood, Susanna A

2013-01-01

Most surveillance programmes for marine invasive species (MIS) require considerable taxonomic expertise, are laborious, and are unable to identify species at larval or juvenile stages. Therefore, marine pests may go undetected at the initial stages of incursions when population densities are low. In this study, we evaluated the ability of the benchtop GS Junior™ 454 pyrosequencing system to detect the presence of MIS in complex sample matrices. An initial in-silico evaluation of the mitochondrial cytochrome c oxidase subunit I (COI) and the nuclear small subunit ribosomal DNA (SSU) genes, found that multiple primer sets (targeting a ca. 400 base pair region) would be required to obtain species level identification within the COI gene. In contrast a single universal primer set was designed to target the V1-V3 region of SSU, allowing simultaneous PCR amplification of a wide taxonomic range of MIS. To evaluate the limits of detection of this method, artificial contrived communities (10 species from 5 taxonomic groups) were created using varying concentrations of known DNA samples and PCR products. Environmental samples (water and sediment) spiked with one or five 160 hr old Asterias amurensis larvae were also examined. Pyrosequencing was able to recover DNA/PCR products of individual species present at greater than 0.64% abundance from all tested contrived communities. Additionally, single A. amurensis larvae were detected from both water and sediment samples despite the co-occurrence of a large array of environmental eukaryotes, indicating an equivalent sensitivity to quantitative PCR. NGS technology has tremendous potential for the early detection of marine invasive species worldwide.

Diagnosis of Carrion’s Disease by Direct Blood PCR in Thin Blood Smear Negative Samples

PubMed Central

Tinco Valdez, Carmen; Pons, Maria J.; del Valle, Luis J.; Oré, Verónica Casabona; Michelena, Denisse Champin; Mayra, Jorge Bazán; Gavidea, Víctor Zavaleta; Vargas, Martha; Ruiz, Joaquim

2014-01-01

Bartonella bacilliformis is the etiologic agent of Carrion's disease. This disease has two well established phases, the most relevant being the so called Oroya Fever, in which B. bacilliformis infect the erythrocytes resulting in severe anemia and transient immunosuppression, with a high lethality in the absence of adequate antibiotic treatment. The presence of B. bacilliformis was studied in 113 blood samples suspected of Carrion’s disease based on clinical criteria, despite the absence of a positive thin blood smear, by two different PCR techniques (using Bartonella-specific and universal 16S rRNA gene primers), and by bacterial culture. The specific 16S rRNA gene primers revealed the presence of 21 B. bacilliformis and 1 Bartonella elizabethae, while universal primers showed both the presence of 3 coinfections in which a concomitant pathogen was detected plus Bartonella, in addition to the presence of infections by other microorganisms such as Agrobacterium or Bacillus firmus. These data support the need to implement molecular tools to diagnose Carrion’s disease. PMID:24651298

Genetic Diversity Analysis of Medicinally Important Horticultural Crop Aegle marmelos by ISSR Markers.

PubMed

Mujeeb, Farina; Bajpai, Preeti; Pathak, Neelam; Verma, Smita Rastogi

2017-01-01

Inter simple sequence repeat (ISSR) markers help in identifying and determining the extent of genetic diversity in cultivars. Here, we describe their application in determining the genetic diversity of bael (Aegle marmelos Corr.). Universal ISSR primers are selected and their marker characteristics such as polymorphism information content, effective multiplex ratio and marker index have been evaluated. ISSR-PCR is then performed using universal ISSR primers to generate polymorphic bands. This information is used to determine the degree of genetic similarity among the bael varieties/accessions by cluster analysis using unweighted pair-group method with arithmetic averages (UPGMA). This technology is valuable for biodiversity conservation and for making an efficient choice of parents in breeding programs.

Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

PubMed

Miller, D M; Dudley, E G; Roberts, R F

2012-09-01

Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

2015-07-08

We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

NASA Astrophysics Data System (ADS)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

Dynamics of Vaginal Bacterial Communities in Women Developing Bacterial Vaginosis, Candidiasis, or No Infection, Analyzed by PCR-Denaturing Gradient Gel Electrophoresis and Real-Time PCR▿

PubMed Central

Vitali, Beatrice; Pugliese, Ciro; Biagi, Elena; Candela, Marco; Turroni, Silvia; Bellen, Gert; Donders, Gilbert G. G.; Brigidi, Patrizia

2007-01-01

The microbial flora of the vagina plays a major role in preventing genital infections, including bacterial vaginosis (BV) and candidiasis (CA). An integrated approach based on PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and real-time PCR was used to study the structure and dynamics of bacterial communities in vaginal fluids of healthy women and patients developing BV and CA. Universal eubacterial primers and Lactobacillus genus-specific primers, both targeted at 16S rRNA genes, were used in DGGE and real-time PCR analysis, respectively. The DGGE profiles revealed that the vaginal flora was dominated by Lactobacillus species under healthy conditions, whereas several potentially pathogenic bacteria were present in the flora of women with BV. Lactobacilli were the predominant bacterial population in the vagina for patients affected by CA, but changes in the composition of Lactobacillus species were observed. Real-time PCR analysis allowed the quantitative estimation of variations in lactobacilli associated with BV and CA diseases. A statistically significant decrease in the relative abundance of lactobacilli was found in vaginal fluids of patients with BV compared to the relative abundance of lactobacilli in the vaginal fluids of healthy women and patients with CA. PMID:17644631

Dynamics of vaginal bacterial communities in women developing bacterial vaginosis, candidiasis, or no infection, analyzed by PCR-denaturing gradient gel electrophoresis and real-time PCR.

PubMed

Vitali, Beatrice; Pugliese, Ciro; Biagi, Elena; Candela, Marco; Turroni, Silvia; Bellen, Gert; Donders, Gilbert G G; Brigidi, Patrizia

2007-09-01

The microbial flora of the vagina plays a major role in preventing genital infections, including bacterial vaginosis (BV) and candidiasis (CA). An integrated approach based on PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and real-time PCR was used to study the structure and dynamics of bacterial communities in vaginal fluids of healthy women and patients developing BV and CA. Universal eubacterial primers and Lactobacillus genus-specific primers, both targeted at 16S rRNA genes, were used in DGGE and real-time PCR analysis, respectively. The DGGE profiles revealed that the vaginal flora was dominated by Lactobacillus species under healthy conditions, whereas several potentially pathogenic bacteria were present in the flora of women with BV. Lactobacilli were the predominant bacterial population in the vagina for patients affected by CA, but changes in the composition of Lactobacillus species were observed. Real-time PCR analysis allowed the quantitative estimation of variations in lactobacilli associated with BV and CA diseases. A statistically significant decrease in the relative abundance of lactobacilli was found in vaginal fluids of patients with BV compared to the relative abundance of lactobacilli in the vaginal fluids of healthy women and patients with CA.

Characterization of Microbial Communities Found in Bioreactor Effluent

NASA Technical Reports Server (NTRS)

Flowe, Candice

2013-01-01

The purpose of this investigation was to examine microbial communities of simulated wastewater effluent from hollow fiber membrane bioreactors collected from the Space Life Science Laboratory and Texas Technical University. Microbes were characterized using quantitative polymerase chain reaction where a total count of bacteria and fungi were determined. The primers that were used to determine the total count of bacteria and fungi were targeted for 16S rDNA genes and the internal transcribed spacer, respectively. PCR products were detected with SYBR Green I fluorescent dye and a melting curve analysis was performed to identify unique melt profiles resulting from DNA sequence variations from each species of the community. Results from both the total bacteria and total fungi count assays showed that distinct populations were present in isolates from these bioreactors. This was exhibited by variation in the number of peaks observed on the melting curve analysis graph. Further analysis of these results using species-specific primers will shed light on exactly which microbes are present in these effluents. Information gained from this study will enable the design of a system that can efficiently monitor microbes that play a role in the biogeochemical cycling of nitrogen in wastewater on the International Space Station to assist in the design of a sustainable system capable of converting this nutrient.

A Quantum Groups Primer

NASA Astrophysics Data System (ADS)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

PubMed Central

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora.

PubMed

Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan

2004-06-01

The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.

Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes

PubMed Central

Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza

2017-01-01

Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826

A tailing genome walking method suitable for genomes with high local GC content.

PubMed

Liu, Taian; Fang, Yongxiang; Yao, Wenjuan; Guan, Qisai; Bai, Gang; Jing, Zhizhong

2013-10-15

The tailing genome walking strategies are simple and efficient. However, they sometimes can be restricted due to the low stringency of homo-oligomeric primers. Here we modified their conventional tailing step by adding polythymidine and polyguanine to the target single-stranded DNA (ssDNA). The tailed ssDNA was then amplified exponentially with a specific primer in the known region and a primer comprising 5' polycytosine and 3' polyadenosine. The successful application of this novel method for identifying integration sites mediated by φC31 integrase in goat genome indicates that the method is more suitable for genomes with high complexity and local GC content. Copyright © 2013 Elsevier Inc. All rights reserved.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

PubMed

Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

2007-01-01

Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

PubMed

Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

2018-04-01

Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

Adhesion of maxillofacial silicone elastomer to a fiber-reinforced composite resin framework.

PubMed

Kantola, Rosita; Lassila, Lippo; Vallittu, Pekka

2011-01-01

Recently, fiber-reinforced composite resin (FRC) has been introduced as a framework material for maxillofacial silicone prostheses. The purpose of this research was to study the tensile bond strength between a room temperature-polymerized maxillofacial silicone elastomer and a unidirectional FRC. Three different bonding agents were compared. Specimens were loaded in tension mode according to ISO 22401 in a universal testing device with a crosshead speed of 10 mm/min until bonding failure occurred. The influence of the surface characteristics (ground vs intact) was also studied. The highest tensile bond strength was seen with Gold Platinum Primer A-330-G, followed by Sofreliner primer. One-way analysis of variance revealed that the surface treatment of the FRC and the adhesive used had a significant effect on tensile bond strength between silicone and FRC (P < .05). Grinding enhanced adhesion, especially with Gold Platinum Primer A-330-G and Sofreliner primer. The fracture type also changed to more cohesive in nature. The FRC substructure can successfully be bonded to maxillofacial silicone elastomer by using primer containing methyl ethyl ketone and dichloromethane solvent. Bonding can be improved by roughening the FRC substrate via grinding.

Massively Parallel Sequencing Detected a Mutation in the MFN2 Gene Missed by Sanger Sequencing Due to a Primer Mismatch on an SNP Site.

PubMed

Neupauerová, Jana; Grečmalová, Dagmar; Seeman, Pavel; Laššuthová, Petra

2016-05-01

We describe a patient with early onset severe axonal Charcot-Marie-Tooth disease (CMT2) with dominant inheritance, in whom Sanger sequencing failed to detect a mutation in the mitofusin 2 (MFN2) gene because of a single nucleotide polymorphism (rs2236057) under the PCR primer sequence. The severe early onset phenotype and the family history with severely affected mother (died after delivery) was very suggestive of CMT2A and this suspicion was finally confirmed by a MFN2 mutation. The mutation p.His361Tyr was later detected in the patient by massively parallel sequencing with a gene panel for hereditary neuropathies. According to this information, new primers for amplification and sequencing were designed which bind away from the polymorphic sites of the patient's DNA. Sanger sequencing with these new primers then confirmed the heterozygous mutation in the MFN2 gene in this patient. This case report shows that massively parallel sequencing may in some rare cases be more sensitive than Sanger sequencing and highlights the importance of accurate primer design which requires special attention. © 2016 John Wiley & Sons Ltd/University College London.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.

In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

Surveillance for Western Equine Encephalitis, St. Louis Encephalitis, and West Nile Viruses Using Reverse Transcription Loop-Mediated Isothermal Amplification

PubMed Central

Wheeler, Sarah S.; Ball, Cameron S.; Langevin, Stanley A.; Fang, Ying; Coffey, Lark L.; Meagher, Robert J.

2016-01-01

Collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized public health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance. PMID:26807734

Bacterial community dynamics in a cooling tower with emphasis on pathogenic bacteria and Legionella species using universal and genus-specific deep sequencing.

PubMed

Pereira, Rui P A; Peplies, Jörg; Höfle, Manfred G; Brettar, Ingrid

2017-10-01

Cooling towers are the major source of outbreaks of legionellosis in Europe and worldwide. These outbreaks are mostly associated with Legionella species, primarily L. pneumophila, and its surveillance in cooling tower environments is of high relevance to public health. In this study, a combined NGS-based approach was used to study the whole bacterial community, specific waterborne and water-based bacterial pathogens, especially Legionella species, targeting the 16S rRNA gene. This approach was applied to water from a cooling tower obtained by monthly sampling during two years. The studied cooling tower was an open circuit cooling tower with lamellar cooling situated in Braunschweig, Germany. A highly diverse bacterial community was observed with 808 genera including 25 potentially pathogenic taxa using universal 16S rRNA primers. Sphingomonas and Legionella were the most abundant pathogenic genera. By applying genus-specific primers for Legionella, a diverse community with 85 phylotypes, and a representative core community with substantial temporal heterogeneity was observed. A high percentage of sequences (65%) could not be affiliated to an acknowledged species. L. pneumophila was part of the core community and the most abundant Legionella species reinforcing the importance of cooling towers as its environmental reservoir. Major temperature shifts (>10 °C) were the key environmental factor triggering the reduction or dominance of the Legionella species in the Legionella community dynamics. In addition, interventions by chlorine dioxide had a strong impact on the Legionella community composition but not on the whole bacterial community. Overall, the presented results demonstrated the value of a combined NGS approach for the molecular monitoring and surveillance of health related pathogens in man-made freshwater systems. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

PubMed Central

Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

2001-01-01

Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer

PubMed Central

Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.

2016-01-01

We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

NASA Astrophysics Data System (ADS)

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-03-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning.

PubMed

Wan, Haisu; Li, Yongwen; Fan, Yu; Meng, Fanrong; Chen, Chen; Zhou, Qinghua

2012-01-15

Site-directed mutagenesis has become routine in molecular biology. However, many mutants can still be very difficult to create. Complicated chimerical mutations, tandem repeats, inverted sequences, GC-rich regions, and/or heavy secondary structures can cause inefficient or incorrect binding of the mutagenic primer to the target sequence and affect the subsequent amplification. In theory, these problems can be avoided by introducing the mutations into the target sequence using mutagenic fragments and so removing the need for primer-template annealing. The cassette mutagenesis uses the mutagenic fragment in its protocol; however, in most cases it needs to perform two rounds of mutagenic primer-based mutagenesis to introduce suitable restriction enzyme sites into templates and is not suitable for routine mutagenesis. Here we describe a highly efficient method in which the template except the region to be mutated is amplified by polymerase chain reaction (PCR) and the type IIs restriction enzyme-digested PCR product is directly ligated with the mutagenic fragment. Our method requires no assistance of mutagenic primers. We have used this method to create various types of difficult-to-make mutants with mutagenic frequencies of nearly 100%. Our protocol has many advantages over the prevalent QuikChange method and is a valuable tool for studies on gene structure and function. Copyright © 2011 Elsevier Inc. All rights reserved.

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

PubMed Central

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-01-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Setting up Targeted Research Interviews: A Primer for Students and New Interviewers

ERIC Educational Resources Information Center

Noy, Darren

2009-01-01

This article analyzes key strategic considerations for setting up targeted research interviews, including human subjects and Institutional Review Board requirements, approaching respondents, the medium of contact, using technology, cultural conceptions of time and commitment, using networks, wading through bureaucracies, and watching for warning…

SciDAC-3: Searching for Physics Beyond the Standard Model, University of Arizona component, Year 2 progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toussaint, Doug

2014-03-21

The Arizona component of the SciDAC-3 Lattice Gauge Theory program consisted of partial support for a postdoctoral position. In the original budget this covered three fourths of a postdoc, but the University of Arizona changed its ERE rate for postdoctoral positions from 4.3% to 21%, so the support level was closer to two-thirds of a postdoc. The grant covered the work of postdoc Thomas Primer. Dr. Primer's first task was an urgent one, although it was not forseen in our proposed work. It turned out that on the large lattices used in some of our current computations the gauge fixingmore » code was not working as expected, and this revealed itself in inconsistent results in the correlators needed to compute the semileptonic form factors for K and D decays. Dr. Primer participated in the effort to understand this problem and to modify our codes to deal with the large lattices we are now generating (as large as 144 3 x 288). Corrected code was incorporated in our standard codes, and workarounds that allow us to use the correlators already computed with the unexpected gauge fixing were been implemented.« less

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

PubMed

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

PubMed

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

PubMed

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Evaluating Detection Limits of Next-Generation Sequencing for the Surveillance and Monitoring of International Marine Pests

PubMed Central

Pochon, Xavier; Bott, Nathan J.; Smith, Kirsty F.; Wood, Susanna A.

2013-01-01

Most surveillance programmes for marine invasive species (MIS) require considerable taxonomic expertise, are laborious, and are unable to identify species at larval or juvenile stages. Therefore, marine pests may go undetected at the initial stages of incursions when population densities are low. In this study, we evaluated the ability of the benchtop GS Junior™ 454 pyrosequencing system to detect the presence of MIS in complex sample matrices. An initial in-silico evaluation of the mitochondrial cytochrome c oxidase subunit I (COI) and the nuclear small subunit ribosomal DNA (SSU) genes, found that multiple primer sets (targeting a ca. 400 base pair region) would be required to obtain species level identification within the COI gene. In contrast a single universal primer set was designed to target the V1–V3 region of SSU, allowing simultaneous PCR amplification of a wide taxonomic range of MIS. To evaluate the limits of detection of this method, artificial contrived communities (10 species from 5 taxonomic groups) were created using varying concentrations of known DNA samples and PCR products. Environmental samples (water and sediment) spiked with one or five 160 hr old Asterias amurensis larvae were also examined. Pyrosequencing was able to recover DNA/PCR products of individual species present at greater than 0.64% abundance from all tested contrived communities. Additionally, single A. amurensis larvae were detected from both water and sediment samples despite the co-occurrence of a large array of environmental eukaryotes, indicating an equivalent sensitivity to quantitative PCR. NGS technology has tremendous potential for the early detection of marine invasive species worldwide. PMID:24023913

Targeted gene enrichment and high-throughput sequencing for environmental biomonitoring: a case study using freshwater macroinvertebrates.

PubMed

Dowle, Eddy J; Pochon, Xavier; C Banks, Jonathan; Shearer, Karen; Wood, Susanna A

2016-09-01

Recent studies have advocated biomonitoring using DNA techniques. In this study, two high-throughput sequencing (HTS)-based methods were evaluated: amplicon metabarcoding of the cytochrome C oxidase subunit I (COI) mitochondrial gene and gene enrichment using MYbaits (targeting nine different genes including COI). The gene-enrichment method does not require PCR amplification and thus avoids biases associated with universal primers. Macroinvertebrate samples were collected from 12 New Zealand rivers. Macroinvertebrates were morphologically identified and enumerated, and their biomass determined. DNA was extracted from all macroinvertebrate samples and HTS undertaken using the illumina miseq platform. Macroinvertebrate communities were characterized from sequence data using either six genes (three of the original nine were not used) or just the COI gene in isolation. The gene-enrichment method (all genes) detected the highest number of taxa and obtained the strongest Spearman rank correlations between the number of sequence reads, abundance and biomass in 67% of the samples. Median detection rates across rare (<1% of the total abundance or biomass), moderately abundant (1-5%) and highly abundant (>5%) taxa were highest using the gene-enrichment method (all genes). Our data indicated primer biases occurred during amplicon metabarcoding with greater than 80% of sequence reads originating from one taxon in several samples. The accuracy and sensitivity of both HTS methods would be improved with more comprehensive reference sequence databases. The data from this study illustrate the challenges of using PCR amplification-based methods for biomonitoring and highlight the potential benefits of using approaches, such as gene enrichment, which circumvent the need for an initial PCR step. © 2015 John Wiley & Sons Ltd.

Advances in plant gene-targeted and functional markers: a review

PubMed Central

2013-01-01

Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the potential to generate phenotypically linked functional markers, especially when fingerprints are generated from the transcribed or expressed region of the genome. It is to be expected that these recently developed techniques will generate larger datasets, but their shortcomings should also be acknowledged and carefully investigated. PMID:23406322

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

Particle Physics Primer: Explaining the Standard Model of Matter.

ERIC Educational Resources Information Center

Vondracek, Mark

2002-01-01

Describes the Standard Model, a basic model of the universe that describes electromagnetic force, weak nuclear force radioactivity, and the strong nuclear force responsible for holding particles within the nucleus together. (YDS)

Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics

PubMed Central

Radonić, Aleksandar; Kocak Tufan, Zeliha; Domingo, Cristina

2017-01-01

Background We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS)-based identification of viral hemorrhagic fever (VHF) agents and assess the feasibility of this approach in diagnostics. Methodology An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF) virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients. Principal findings The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1–10 genome equivalents) and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours. Conclusions Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring. PMID:29155823

Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics.

PubMed

Brinkmann, Annika; Ergünay, Koray; Radonić, Aleksandar; Kocak Tufan, Zeliha; Domingo, Cristina; Nitsche, Andreas

2017-11-01

We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS)-based identification of viral hemorrhagic fever (VHF) agents and assess the feasibility of this approach in diagnostics. An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF) virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients. The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1-10 genome equivalents) and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours. Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring.

Evaluation of Targeted Next-Generation Sequencing for Detection of Bovine Pathogens in Clinical Samples.

PubMed

Anis, Eman; Hawkins, Ian K; Ilha, Marcia R S; Woldemeskel, Moges W; Saliki, Jeremiah T; Wilkes, Rebecca P

2018-07-01

The laboratory diagnosis of infectious diseases, especially those caused by mixed infections, is challenging. Routinely, it requires submission of multiple samples to separate laboratories. Advances in next-generation sequencing (NGS) have provided the opportunity for development of a comprehensive method to identify infectious agents. This study describes the use of target-specific primers for PCR-mediated amplification with the NGS technology in which pathogen genomic regions of interest are enriched and selectively sequenced from clinical samples. In the study, 198 primers were designed to target 43 common bovine and small-ruminant bacterial, fungal, viral, and parasitic pathogens, and a bioinformatics tool was specifically constructed for the detection of targeted pathogens. The primers were confirmed to detect the intended pathogens by testing reference strains and isolates. The method was then validated using 60 clinical samples (including tissues, feces, and milk) that were also tested with other routine diagnostic techniques. The detection limits of the targeted NGS method were evaluated using 10 representative pathogens that were also tested by quantitative PCR (qPCR), and the NGS method was able to detect the organisms from samples with qPCR threshold cycle ( C T ) values in the 30s. The method was successful for the detection of multiple pathogens in the clinical samples, including some additional pathogens missed by the routine techniques because the specific tests needed for the particular organisms were not performed. The results demonstrate the feasibility of the approach and indicate that it is possible to incorporate NGS as a diagnostic tool in a cost-effective manner into a veterinary diagnostic laboratory. Copyright © 2018 Anis et al.

The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

PubMed

Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

2015-12-03

Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

PubMed

Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

2015-08-14

In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines

PubMed Central

Queza, Macario Ireneo P; Rivera, Windell L

2013-01-01

Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368

Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip

PubMed Central

Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.

2015-01-01

Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

PubMed Central

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones.

PubMed

Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C

2018-06-04

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

PubMed

Huang, Chia-Chia; Pan, Tzu-Ming

2005-05-18

The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

Diversity of Ktedonobacteria with Actinomycetes-Like Morphology in Terrestrial Environments

PubMed Central

Yabe, Shuhei; Sakai, Yasuteru; Abe, Keietsu; Yokota, Akira

2017-01-01

Bacteria with an actinomycetes-like morphology have recently been discovered, and the class Ktedonobacteria was created for these bacteria in the phylum Chloroflexi. They may prove to be a valuable resource with the potential to produce unprecedented secondary metabolites. However, our understanding of their diversity, richness, habitat, and ecological significance is very limited. We herein developed a 16S rRNA gene-targeted, Ktedonobacteria-specific primer and analyzed ktedonobacterial amplicons. We investigated abundance, diversity, and community structure in forest and garden soils, sand, bark, geothermal sediment, and compost. Forest soils had the highest diversity among the samples tested (1181–2934 operational taxonomic units [OTUs]; Chao 1 estimate, 2503–5613; Shannon index, 4.21–6.42). A phylogenetic analysis of representative OTUs revealed at least eight groups within unclassified Ktedonobacterales, expanding the known diversity of this order. Ktedonobacterial communities markedly varied among our samples. The common mesic environments (soil, sand, and bark) were dominated by diverse phylotypes within the eight groups. In contrast, compost and geothermal sediment samples were dominated by known ktedonobacterial families (Thermosporotrichaceae and Thermogemmatisporaceae, respectively). The relative abundance of Ktedonobacteria in the communities, based on universal primers, was ≤0.8%, but was 12.9% in the geothermal sediment. These results suggest that unknown diverse Ktedonobacteria inhabit common environments including forests, gardens, and sand at low abundances, as well as extreme environments such as geothermal areas. PMID:28321007

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

PubMed

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

First Year University Students' Use of Formulaic Sequences in Oral and Written Descriptions (El uso de secuencias formulaicas de estudiantes de primer año en descripciones orales y escritas)

ERIC Educational Resources Information Center

Gómez Burgos, Eric

2015-01-01

The present article investigates the use of first year university students' formulaic sequences in written and oral texts in an English as a foreign language context. The corpus of the study consists of eight descriptive texts--four written and four oral--which were composed of four students of English Pedagogy at a university in Santiago, Chile.…

Population diversity of ammonium oxidizers investigated by specific PCR amplification

USGS Publications Warehouse

Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

1997-01-01

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

Methods, compounds and systems for detecting a microorganism in a sample

DOEpatents

Colston, Jr, Bill W.; Fitch, J. Patrick; Gardner, Shea N.; Williams, Peter L.; Wagner, Mark C.

2016-09-06

Methods to identify a set of probe polynucleotides suitable for detecting a set of targets and in particular methods for identification of primers suitable for detection of target microorganisms related polynucleotides, set of polynucleotides and compositions, and related methods and systems for detection and/or identification of microorganisms in a sample.

Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

PubMed Central

Barnes, W M; Bevan, M

1983-01-01

A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

PubMed

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

PubMed Central

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-01-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

Development of a genus-specific next generation sequencing approach for sensitive and quantitative determination of the Legionella microbiome in freshwater systems.

PubMed

Pereira, Rui P A; Peplies, Jörg; Brettar, Ingrid; Höfle, Manfred G

2017-03-31

Next Generation Sequencing (NGS) has revolutionized the analysis of natural and man-made microbial communities by using universal primers for bacteria in a PCR based approach targeting the 16S rRNA gene. In our study we narrowed primer specificity to a single, monophyletic genus because for many questions in microbiology only a specific part of the whole microbiome is of interest. We have chosen the genus Legionella, comprising more than 20 pathogenic species, due to its high relevance for water-based respiratory infections. A new NGS-based approach was designed by sequencing 16S rRNA gene amplicons specific for the genus Legionella using the Illumina MiSeq technology. This approach was validated and applied to a set of representative freshwater samples. Our results revealed that the generated libraries presented a low average raw error rate per base (<0.5%); and substantiated the use of high-fidelity enzymes, such as KAPA HiFi, for increased sequence accuracy and quality. The approach also showed high in situ specificity (>95%) and very good repeatability. Only in samples in which the gammabacterial clade SAR86 was present more than 1% non-Legionella sequences were observed. Next-generation sequencing read counts did not reveal considerable amplification/sequencing biases and showed a sensitive as well as precise quantification of L. pneumophila along a dilution range using a spiked-in, certified genome standard. The genome standard and a mock community consisting of six different Legionella species demonstrated that the developed NGS approach was quantitative and specific at the level of individual species, including L. pneumophila. The sensitivity of our genus-specific approach was at least one order of magnitude higher compared to the universal NGS approach. Comparison of quantification by real-time PCR showed consistency with the NGS data. Overall, our NGS approach can determine the quantitative abundances of Legionella species, i. e. the complete Legionella microbiome, without the need for species-specific primers. The developed NGS approach provides a new molecular surveillance tool to monitor all Legionella species in qualitative and quantitative terms if a spiked-in genome standard is used to calibrate the method. Overall, the genus-specific NGS approach opens up a new avenue to massive parallel diagnostics in a quantitative, specific and sensitive way.

Composite-composite repair bond strength: effect of different adhesion primers.

PubMed

Tezvergil, A; Lassila, L V J; Vallittu, P K

2003-11-01

Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.

Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

PubMed Central

Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

1996-01-01

The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

The effect of five kinds of surface treatment agents on the bond strength to various ceramics with thermocycle aging.

PubMed

Noda, Yukari; Nakajima, Masatoshi; Takahashi, Masahiro; Mamanee, Teerapong; Hosaka, Keiichi; Takagaki, Tomohiro; Ikeda, Masaomi; Foxton, Richard M; Tagami, Junji

2017-11-29

This study evaluated the effects of ceramic surface treatment agents on shear bond strengths to ceramic materials with and without thermocycling. Ceramic plates were prepared from feldspathic ceramic; AAA, lithium disilicate ceramic material; IPS e.max Press, zirconia ceramic; Lava. Ceramic surfaces were pretreated with one of five surface treatment agents (Clearfil PhotoBond mixed with Porcelainbond activator (PB), Clearfil SE One mixed with Porcelainbond activator (SO), Ceramic Primer (CP), Universal Primer (UP), Scotchbond Universal (SU)), and then a resin cement (Clapearl DC) was filled. After 0, 5,000, and 10,000 thermocycles, micro-shear bond strengths between ceramic-cement interfaces were determined. SU exhibited significantly lower initial bond strength to AAA and e.max than PB, SO, CP, and UP. For Lava, PB, SO, CP and SU exhibited higher initial bond strengths than UP. Thermocycles reduced bond strengths to all the ceramic materials with any surface treatment.

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

Bonding to new CAD/CAM resin composites: influence of air abrasion and conditioning agents as pretreatment strategy.

PubMed

Reymus, Marcel; Roos, Malgorzata; Eichberger, Marlis; Edelhoff, Daniel; Hickel, Reinhard; Stawarczyk, Bogna

2018-04-27

Because of their industrially standardized process of manufacturing, CAD/CAM resin composites show a high degree of conversion, making a reliable bond difficult to achieve. The purpose of this experiment was to investigate the tensile bond strength (TBS) of luting composite to CAD/CAM resin composite materials as influenced by air abrasion and pretreatment strategies. The treatment factors of the present study were (1) brand of the CAD/CAM resin composite (Brilliant Crios [Coltene/Whaledent], Cerasmart [GC Europe], Shofu Block HC [Shofu], and Lava Ultimate [3M]); (2) air abrasion vs. no air abrasion; and (3) pretreatment using a silane primer (Clearfil Ceramic Primer, Kuraray) vs. a resin primer (One Coat 7 Universal, Coltene/Whaledent). Subsequently, luting composite (DuoCem, Coltene/Whaledent) was polymerized onto the substrate surface using a mold. For each combination of the levels of the three treatment factors (4 (materials) × 2 (air abrasion vs. no air abrasion; resin) × 2 (primer vs. silane primer)), n = 15, specimens were prepared. After 24 h of water storage at 37 °C and 5000 thermo-cycles (5/55 °C), TBS was measured and failure types were examined. The resulting data was analyzed using Kaplan-Meier estimates of the cumulative failure distribution function with Breslow-Gehan tests and non-parametric ANOVA (Kruskal-Wallis test) followed by the multiple pairwise Mann-Whitney U test with α-error adjustment using the Benjamini-Hochberg procedure and chi-square test (p < 0.05). The additional air abrasion step increased TBS values and lowered failure rates. Specimens pretreated using a resin primer showed significantly higher TBS and lower failure rates than those pretreated using a silane primer. The highest failure rates were observed for groups pretreated with a silane primer. Within the Shofu Block HC group, all specimens without air abrasion and pretreatment with a silane primer debonded during the aging procedure. Before fixation of CAD/CAM resin composites, the restorations should be air abraded and pretreated using a resin primer containing methyl-methacrylate to successfully bond to the luting composite. The pretreatment of the CAD/CAM resin composite using merely a silane primer results in deficient adhesion. For a reliable bond of CAD/CAM resin composites to the luting composite, air abrasion and a special pretreatment strategy are necessary in order to achieve promising long-term results.

Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

PubMed

Glais, Laurent; Jacquot, Emmanuel

2015-01-01

Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

Culture Wars: Air Force Culture and Civil-Military Relations

DTIC Science & Technology

2010-06-01

Builder, The Masks of War: American Military Styles in Strategy and Analysis (Baltimore: Johns Hopkins University Press, 1989 ). 9 Adam Stulberg and...University Press, 1989 ), 3. 49 Charles Dunlap, Understanding Airmen: A Primer for Soldiers, Military Review (2007), 128. 21 heuristic of organizational...James Q. Wilson, Bureaucracy: What Government Agencies Do and Why They Do it (New York: Basic Books, 1989 ), 91. The idea of organizational

Detection of unculturable bacteria in periodontal health and disease by PCR.

PubMed

Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G

1999-05-01

Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.

Surveillance for Western equine encephalitis St. Louis encephalitis and West Nile viruses using reverse transcription loop-mediated isothermal amplification

DOE PAGES

Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.; ...

2016-01-25

In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

Development and Comparison of Two Assay Formats for Parallel Detection of Four Biothreat Pathogens by Using Suspension Microarrays

PubMed Central

Janse, Ingmar; Bok, Jasper M.; Hamidjaja, Raditijo A.; Hodemaekers, Hennie M.; van Rotterdam, Bart J.

2012-01-01

Microarrays provide a powerful analytical tool for the simultaneous detection of multiple pathogens. We developed diagnostic suspension microarrays for sensitive and specific detection of the biothreat pathogens Bacillus anthracis, Yersinia pestis, Francisella tularensis and Coxiella burnetii. Two assay chemistries for amplification and labeling were developed, one method using direct hybridization and the other using target-specific primer extension, combined with hybridization to universal arrays. Asymmetric PCR products for both assay chemistries were produced by using a multiplex asymmetric PCR amplifying 16 DNA signatures (16-plex). The performances of both assay chemistries were compared and their advantages and disadvantages are discussed. The developed microarrays detected multiple signature sequences and an internal control which made it possible to confidently identify the targeted pathogens and assess their virulence potential. The microarrays were highly specific and detected various strains of the targeted pathogens. Detection limits for the different pathogen signatures were similar or slightly higher compared to real-time PCR. Probit analysis showed that even a few genomic copies could be detected with 95% confidence. The microarrays detected DNA from different pathogens mixed in different ratios and from spiked or naturally contaminated samples. The assays that were developed have a potential for application in surveillance and diagnostics. PMID:22355407

Development and comparison of two assay formats for parallel detection of four biothreat pathogens by using suspension microarrays.

PubMed

Janse, Ingmar; Bok, Jasper M; Hamidjaja, Raditijo A; Hodemaekers, Hennie M; van Rotterdam, Bart J

2012-01-01

Microarrays provide a powerful analytical tool for the simultaneous detection of multiple pathogens. We developed diagnostic suspension microarrays for sensitive and specific detection of the biothreat pathogens Bacillus anthracis, Yersinia pestis, Francisella tularensis and Coxiella burnetii. Two assay chemistries for amplification and labeling were developed, one method using direct hybridization and the other using target-specific primer extension, combined with hybridization to universal arrays. Asymmetric PCR products for both assay chemistries were produced by using a multiplex asymmetric PCR amplifying 16 DNA signatures (16-plex). The performances of both assay chemistries were compared and their advantages and disadvantages are discussed. The developed microarrays detected multiple signature sequences and an internal control which made it possible to confidently identify the targeted pathogens and assess their virulence potential. The microarrays were highly specific and detected various strains of the targeted pathogens. Detection limits for the different pathogen signatures were similar or slightly higher compared to real-time PCR. Probit analysis showed that even a few genomic copies could be detected with 95% confidence. The microarrays detected DNA from different pathogens mixed in different ratios and from spiked or naturally contaminated samples. The assays that were developed have a potential for application in surveillance and diagnostics.

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

PubMed

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Yellow Fever Outbreak, Imatong, Southern Sudan

PubMed Central

Ofula, Victor O.; Sang, Rosemary C.; Konongoi, Samson L.; Sow, Abdourahmane; De Cock, Kevin M.; Tukei, Peter M.; Okoth, Fredrick A.; Swanepoel, Robert; Burt, Felicity J.; Waters, Norman C.; Coldren, Rodney L.

2004-01-01

In May 2003, the World Health Organization received reports about a possible outbreak of a hemorrhagic disease of unknown cause in the Imatong Mountains of southern Sudan. Laboratory investigations were conducted on 28 serum samples collected from patients in the Imatong region. Serum samples from 13 patients were positive for immunoglobulin M antibody to flavivirus, and serum samples from 5 patients were positive by reverse transcription–polymerase chain reaction with both the genus Flavivirus–reactive primers and yellow fever virus–specific primers. Nucleotide sequencing of the amplicons obtained with the genus Flavivirus oligonucleotide primers confirmed yellow fever virus as the etiologic agent. Isolation attempts in newborn mice and Vero cells from the samples yielded virus isolates from five patients. Rapid and accurate laboratory diagnosis enabled an interagency emergency task force to initiate a targeted vaccination campaign to control the outbreak. PMID:15207058

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

PubMed

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils

PubMed Central

Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.

2006-01-01

Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

[The forensic medical significance of the igniting primer for the 18×45T cartridges of the 'Osa' pistol].

PubMed

Leonov, S V; Pinchuk, P V; Rasnyuk, S V

The objective of the present study was to obtain the ballistic characteristics of the igniting primer (electrical ignitor) for the 18×45T cartridges of the 'Osa' pistol produced by different manufacturers. The experiments included a series of shots fired from the 'Osa' pistol with the use of cartridges having an energy of 85 Joules ('Novye oruzheinye tekhnologii', Ltd., Sergiev Posad) and 88 Joules ('A+A', Ltd, Tula). The shooting distance varied from the point blank range to 5, 10, 20, 30, 40, and 50 cm. The targets were either the femoral soft tissue of the cut-off human lower extremity, white cotton fabric, and the 1-5 cm high gelatin cylinder 25 cm in diameter. The experiments have demonstrated that the igniting primer (electrical ignitor) for the cartridges manufactured by the 'Novye oruzheinye tekhnologii', Ltd., Sergiev Posad, served as an additional factor of the shot responsible for the penetrating power of the ammunition at a distance of 50 cm. The data on the composition of metals used for the manufacturing of the igniting primers under consideration are presented.

ITS1: a DNA barcode better than ITS2 in eukaryotes?

PubMed

Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

2015-05-01

A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

Molecular Monitoring of the Fecal Microbiota of Healthy Human Subjects during Administration of Lactulose and Saccharomyces boulardii

PubMed Central

Vanhoutte, Tom; De Preter, Vicky; De Brandt, Evie; Verbeke, Kristin; Swings, Jean; Huys, Geert

2006-01-01

Diet is a major factor in maintaining a healthy human gastrointestinal tract, and this has triggered the development of functional foods containing a probiotic and/or prebiotic component intended to improve the host's health via modulation of the intestinal microbiota. In this study, a long-term placebo-controlled crossover feeding study in which each subject received several treatments was performed to monitor the effect of a prebiotic substrate (i.e., lactulose), a probiotic organism (i.e., Saccharomyces boulardii), and their synbiotic combination on the fecal microbiota of three groups of 10 healthy human subjects differing in prebiotic dose and/or intake of placebo versus synbiotic. For this purpose, denaturing gradient gel electrophoresis (DGGE) analysis of 16S rRNA gene amplicons was used to detect possible changes in the overall bacterial composition using the universal V3 primer and to detect possible changes at the subpopulation level using group-specific primers targeting the Bacteroides fragilis subgroup, the genus Bifidobacterium, the Clostridium lituseburense group (cluster XI), and the Clostridium coccoides-Eubacterium rectale group (cluster XIVa). Although these populations remained fairly stable based on DGGE profiling, one pronounced change was observed in the universal fingerprint profiles after lactulose ingestion. Band position analysis and band sequencing revealed that a band appearing or intensifying following lactulose administration could be assigned to the species Bifidobacterium adolescentis. Subsequent analysis with real-time PCR (RT-PCR) indicated a statistically significant increase (P < 0.05) in total bifidobacteria in one of the three subject groups after lactulose administration, whereas a similar but nonsignificant trend was observed in the other two groups. Combined RT-PCR results from two subject groups indicated a borderline significant increase (P = 0.074) of B. adolescentis following lactulose intake. The probiotic yeast S. boulardii did not display any detectable universal changes in the DGGE profiles, nor did it influence the bifidobacterial levels. This study highlighted the capacity of an integrated approach consisting of DGGE analysis and RT-PCR to monitor and quantify pronounced changes in the fecal microbiota of healthy subjects upon functional food administration. PMID:16957220

Biogeochemical and Molecular Signatures of Anaerobic Methane Oxidation in a Marine Sediment

PubMed Central

Thomsen, Trine R.; Finster, Kai; Ramsing, Niels B.

2001-01-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802–805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin. PMID:11282617

Biogeochemical and molecular signatures of anaerobic methane oxidation in a marine sediment.

PubMed

Thomsen, T R; Finster, K; Ramsing, N B

2001-04-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802-805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin.

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Development of Species-Specific SCAR Markers, Based on a SCoT Analysis, to Authenticate Physalis (Solanaceae) Species

PubMed Central

Feng, Shangguo; Zhu, Yujia; Yu, Chenliang; Jiao, Kaili; Jiang, Mengying; Lu, Jiangjie; Shen, Chenjia; Ying, Qicai; Wang, Huizhong

2018-01-01

Physalis is an important genus in the Solanaceae family. It includes many species of significant medicinal value, edible value, and ornamental value. However, many Physalis species are easily confused because of their similar morphological traits, which hinder the utilization and protection of Physalis resources. Therefore, it is necessary to create fast, sensitive, and reliable methods for the Physalis species authentication. Intended for that, in this study, species-specific sequence-characterized amplified region (SCAR) markers were developed for accurate identification of the closely related Physalis species P. angulata, P. minima, P. pubescens, and P. alkekengi var. franchetii, based on a simple and novel marker system, start codon targeted (SCoT) marker. A total of 34 selected SCoT primers yielded 289 reliable SCoT loci, of which 265 were polymorphic. Four species-specific SCoT fragments (SCoT3-1404, SCoT3-1589, SCoT5-550, and SCoT36-520) from Physalis species were successfully identified, cloned, and sequenced. Based on these selected specific DNA fragments, four SCAR primers pairs were developed and named ST3KZ, ST3MSJ, ST5SJ, and ST36XSJ. PCR analysis of each of these primer pairs clearly demonstrated a specific amplified band in all samples of the target Physalis species, but no amplification was observed in other Physalis species. Therefore, the species-specific SCAR primer pairs developed in this study could be used as powerful tools that can rapidly, effectively, and reliably identify and differentiate Physalis species.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

PubMed Central

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

PubMed Central

Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

2012-01-01

Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

Do we need primer for orthodontic bonding? A randomized controlled trial.

PubMed

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Plastid markers in Carya

USDA-ARS?s Scientific Manuscript database

We evaluated 8 "universal" plastid primers and qualified 3 as polymorphic and informative within Carya. Pecans of known lineage and geographic origin, representatives of other Carya species and interspecific hybrids were profiled. In an analysis of 169 Carya accessions, 21 alleles were observed am...

Detecting in situ copepod diet diversity using molecular technique: development of a copepod/symbiotic ciliate-excluding eukaryote-inclusive PCR protocol.

PubMed

Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie

2014-01-01

Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

PubMed

Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

2003-03-01

SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

Sensitive immobilization-free electrochemical DNA sensor based on isothermal circular strand displacement polymerization reaction.

PubMed

Xuan, Feng; Luo, Xiaoteng; Hsing, I-Ming

2012-05-15

A highly sensitive electrochemical DNA sensor that requires no probe immobilization has been developed based on a target recycling mechanism utilizing a DNA polymerase with a strand displacement activity. The electrochemical detection is realized by taking advantage of the difference in diffusivity between a free ferrocene-labeled peptide nucleic acid (Fc-PNA) and a Fc-PNA hybridized with a complementary DNA, while the DNA polymerase-assisted target recycling leads to signal generation and amplification. The hybridization of the target DNA opens up a stem-loop template DNA with the Fc-PNA hybridized to its extruded 5' end and allows a DNA primer to anneal and be extended by the DNA polymerase, which results in sequential displacement of the target DNA and the Fc-PNA from the template DNA. The displaced target DNA will hybridize with another template DNA, triggering another round of primer extension and strand displacement. The released Fc-PNA, due to its neutral backbone, has much higher diffusivity towards a negatively charged electrode, compared to that when it is hybridized with a negatively charged DNA. Therefore, a significantly enhanced signal of Fc can be observed. The outstanding sensitivity and simplicity make this approach a promising candidate for next-generation electrochemical DNA sensing technologies. Copyright © 2012 Elsevier B.V. All rights reserved.

Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen.

PubMed

Denman, Stuart E; McSweeney, Christopher S

2006-12-01

Traditional methods for enumerating and identifying microbial populations within the rumen can be time consuming and cumbersome. Methods that involve culturing and microscopy can also be inconclusive, particularly when studying anaerobic rumen fungi. A real-time PCR SYBR Green assay, using PCR primers to target total rumen fungi and the cellulolytic bacteria Ruminococcus flavefaciens and Fibrobacter succinogenes, is described, including design and validation. The DNA and crude protein contents with respect to the fungal biomass of both polycentric and monocentric fungal isolates were investigated across the fungal growth stages to aid in standard curve generation. The primer sets used were found to be target specific with no detectable cross-reactivity. Subsequently, the real-time PCR assay was employed in a study to detect these populations within cattle rumen. The anaerobic fungal target was observed to increase 3.6-fold from 0 to 12 h after feeding. The results also indicated a 5.4-fold increase in F. succinogenes target between 0 and 12 h after feeding, whereas R. flavefaciens was observed to maintain more or less consistent levels. This is the first report of a real-time PCR assay to estimate the rumen anaerobic fungal population.

Identification of Erwinia species isolated from apples and pears by differential PCR.

PubMed

Gehring, I; Geider, K

2012-04-01

Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

PubMed

Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

2013-08-01

[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

PubMed

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-06-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

PubMed

Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

2018-02-01

Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

PubMed

del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

2014-04-15

Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.

Cultivation-Independent Screening Revealed Hot Spots of IncP-1, IncP-7 and IncP-9 Plasmid Occurrence in Different Environmental Habitats

PubMed Central

Dealtry, Simone; Ding, Guo-Chun; Weichelt, Viola; Dunon, Vincent; Schlüter, Andreas; Martini, María Carla; Papa, María Florencia Del; Lagares, Antonio; Amos, Gregory Charles Auton; Wellington, Elizabeth Margaret Helen; Gaze, William Hugo; Sipkema, Detmer; Sjöling, Sara; Springael, Dirk; Heuer, Holger; van Elsas, Jan Dirk; Thomas, Christopher; Smalla, Kornelia

2014-01-01

IncP-1, IncP-7 and IncP-9 plasmids often carry genes encoding enzymes involved in the degradation of man-made and natural contaminants, thus contributing to bacterial survival in polluted environments. However, the lack of suitable molecular tools often limits the detection of these plasmids in the environment. In this study, PCR followed by Southern blot hybridization detected the presence of plasmid-specific sequences in total community (TC-) DNA or fosmid DNA from samples originating from different environments and geographic regions. A novel primer system targeting IncP-9 plasmids was developed and applied along with established primers for IncP-1 and IncP-7. Screening TC-DNA from biopurification systems (BPS) which are used on farms for the purification of pesticide-contaminated water revealed high abundances of IncP-1 plasmids belonging to different subgroups as well as IncP-7 and IncP-9. The novel IncP-9 primer-system targeting the rep gene of nine IncP-9 subgroups allowed the detection of a high diversity of IncP-9 plasmid specific sequences in environments with different sources of pollution. Thus polluted sites are “hot spots” of plasmids potentially carrying catabolic genes. PMID:24587126

Seven Novel Probe Systems for Real-Time PCR Provide Absolute Single-Base Discrimination, Higher Signaling, and Generic Components

PubMed Central

Murray, James L.; Hu, Peixu; Shafer, David A.

2015-01-01

We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. PMID:25307756

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

PubMed Central

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

PubMed

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

PubMed

Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

2016-06-17

Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

PubMed Central

Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho

2013-01-01

Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428

Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river

PubMed Central

Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

2013-01-01

Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47–48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

Paucity of Nanolayering in Resin-Dentin Interfaces of MDP-based Adhesives

PubMed Central

Tian, F.; Zhou, L.; Zhang, Z.; Niu, L.; Zhang, L.; Chen, C.; Zhou, J.; Yang, H.; Wang, X.; Fu, B.; Huang, C.; Pashley, D.H.; Tay, F.R.

2015-01-01

Self-assembled nanolayering structures have been reported in resin-dentin interfaces created by adhesives that contain 10-methacryloyloxydecyl dihydrogen phosphate (10-MDP). These structures have been hypothesized to contribute to bond durability. The objective of the present study was to determine the extent of nanolayering in resin-dentin interfaces after application of commercialized 10-MDP-containing self-etch and universal adhesives to human dentin. Seven commercialized adhesives were examined: Adhese Universal (Ivoclar-Vivadent), All-Bond Universal (Bisco, Inc.), Clearfil SE Bond 2, Clearfil S3 Bond Plus, Clearfil Universal Bond (all from Kuraray Noritake Dental Inc.), G-Premio Bond (GC Corp.), and Scotchbond Universal (3M ESPE). Each adhesive was applied in the self-etch mode on midcoronal dentin according to the respective manufacturer’s instructions. Bonded specimens (n = 6) were covered with flowable resin composite, processed for transmission electron microscopy, and examined at 30 random sites without staining. Thin-film glancing angle X-ray diffraction (XRD) was used to detect the characteristic peaks exhibited by nanolayering (n = 4). The control consisted of 15%wt, 10%wt, and 5%wt 10-MDP (DM Healthcare Products, Inc.) dissolved in a mixed solvent (ethanol and water weight ratio 9:8, with photoinitiators). Experimental primers were applied to dentin for 20 s, covered with hydrophobic resin layer, and examined in the same manner. Profuse nanolayering with highly ordered periodicity (~3.7 nm wide) was observed adjacent to partially dissolved apatite crystallites in dentin treated with the 15% 10-MDP primer. Three peaks in the 2θ range of 2.40° (3.68 nm), 4.78° (1.85 nm), and 7.18° (1.23 nm) were identified from thin-film XRD. Reduction in the extent of nanolayering was observed in the 10% and 5% 10-MDP experimental primer-dentin interface along with lower intensity XRD peaks. Nanolayering and characteristic XRD peaks were rarely observed in specimens prepared from the commercialized adhesives. The sparsity of nanolayering in resin-dentin interfaces created by commercialized adhesives challenges its clinical effectiveness as a mechanism for improving bond longevity in dentin bonding. PMID:26701351

Paucity of Nanolayering in Resin-Dentin Interfaces of MDP-based Adhesives.

PubMed

Tian, F; Zhou, L; Zhang, Z; Niu, L; Zhang, L; Chen, C; Zhou, J; Yang, H; Wang, X; Fu, B; Huang, C; Pashley, D H; Tay, F R

2016-04-01

Self-assembled nanolayering structures have been reported in resin-dentin interfaces created by adhesives that contain 10-methacryloyloxydecyl dihydrogen phosphate (10-MDP). These structures have been hypothesized to contribute to bond durability. The objective of the present study was to determine the extent of nanolayering in resin-dentin interfaces after application of commercialized 10-MDP-containing self-etch and universal adhesives to human dentin. Seven commercialized adhesives were examined: Adhese Universal (Ivoclar-Vivadent), All-Bond Universal (Bisco, Inc.), Clearfil SE Bond 2, Clearfil S3 Bond Plus, Clearfil Universal Bond (all from Kuraray Noritake Dental Inc.), G-Premio Bond (GC Corp.), and Scotchbond Universal (3M ESPE). Each adhesive was applied in the self-etch mode on midcoronal dentin according to the respective manufacturer's instructions. Bonded specimens (n = 6) were covered with flowable resin composite, processed for transmission electron microscopy, and examined at 30 random sites without staining. Thin-film glancing angle X-ray diffraction (XRD) was used to detect the characteristic peaks exhibited by nanolayering (n = 4). The control consisted of 15%wt, 10%wt, and 5%wt 10-MDP (DM Healthcare Products, Inc.) dissolved in a mixed solvent (ethanol and water weight ratio 9:8, with photoinitiators). Experimental primers were applied to dentin for 20 s, covered with hydrophobic resin layer, and examined in the same manner. Profuse nanolayering with highly ordered periodicity (~3.7 nm wide) was observed adjacent to partially dissolved apatite crystallites in dentin treated with the 15% 10-MDP primer. Three peaks in the 2θ range of 2.40° (3.68 nm), 4.78° (1.85 nm), and 7.18° (1.23 nm) were identified from thin-film XRD. Reduction in the extent of nanolayering was observed in the 10% and 5% 10-MDP experimental primer-dentin interface along with lower intensity XRD peaks. Nanolayering and characteristic XRD peaks were rarely observed in specimens prepared from the commercialized adhesives. The sparsity of nanolayering in resin-dentin interfaces created by commercialized adhesives challenges its clinical effectiveness as a mechanism for improving bond longevity in dentin bonding. © International & American Associations for Dental Research 2015.

Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

PubMed

Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

2016-04-01

Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. Copyright © 2016 Elsevier B.V. All rights reserved.

Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

NASA Astrophysics Data System (ADS)

Tanumihardja, J.; Bela, B.

2017-08-01

Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

Multi-User Facilities for Molecular Marine Biology and Biotechnology

DTIC Science & Technology

1990-04-06

relatedness (or non-relatedness) of symbiotic zooxanthellae in corals. The DNA synthesizer is used to prepare universal primers for 18s r RNA. A...tunicates (Weissman lab) Robert Rowan - Zooxanthellae (Powers lab) Lani West - sponges/barnacles (Powers lab) Jeff Mitton - Mytilus (Powers lab) Kristi

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

PubMed

Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

2012-11-01

Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

PubMed

Winn-Deen

1998-12-01

Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

Phylogenetic analysis of bacterial and archaeal species in symptomatic and asymptomatic endodontic infections.

PubMed

Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R

2007-01-01

Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

PubMed

Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

2013-05-01

This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

Detection of Unculturable Bacteria in Periodontal Health and Disease by PCR

PubMed Central

Harper-Owen, R.; Dymock, D.; Booth, V.; Weightman, A. J.; Wade, W. G.

1999-01-01

Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease. PMID:10203507

DNA authentication of animal-derived concentrated Chinese medicine granules.

PubMed

Jiang, Li-Li; Lo, Yat-Tung; Chen, Wei-Ting; Shaw, Pang-Chui

2016-09-10

Concentrated Chinese medicine granules (CCMG) offer patients a convenient option for traditional therapy. However with morphological and microscopic characteristics lost, it is difficult to authenticate and control the quality of these medicinal products. This study is the first to examine the feasibility of using DNA techniques to authenticate animal-derived CCMG, which has so far lacking of effective means for authentication. Primers targeting amplicons of different sizes were designed to determine the presence of PCR-amplifiable DNA fragments in two types of CCMG, namely Zaocys and Scorpio. Species-specific primers were designed to differentiate the genuine drugs from their adulterants. The specificity of the designed primers was evaluated in crude drugs (including genuine and adulterant) and CCMG. Results showed that by using species-specific primers, DNA fragments of less than 200bp could be isolated from the CCMG and the concerned source materials. This study demonstrated the presence of small size DNA in animal-derived CCMG and the DNA is effective in species identification. The work has extended the application of DNA techniques in herbal medicine and this approach may be further developed for quality control and regulatory compliance in the CCMG industry. Copyright © 2016 Elsevier B.V. All rights reserved.

In-planta detection and monitorization of endophytic colonization by a Beauveria bassiana strain using a new-developed nested and quantitative PCR-based assay and confocal laser scanning microscopy.

PubMed

Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E

2013-10-01

Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.

Red to Black: A Primer for Continuing Education Managers.

ERIC Educational Resources Information Center

Desmarais, Armand; White, Sandra

1990-01-01

Traces the efforts of the Division of Continuing Studies at a large northeastern state university to regain fiscal solvency through business and leadership techniques including management by objectives, section management, and a course confirmation formula. Warns program administrators about potential problems with break-even registration…

Modulation of Molecular Markers by CLA.

DTIC Science & Technology

1998-10-01

sequence information obtained for each gene fragment, a gene-specific primer was synthesized (Integrated DNA Technology, Inc, Coralville , IA) as the down...G.W. and Cochran, W.G. (1967) Statistical Methods, Ed. 6 Iowa University Press. 81. JK Beckman, T Yoshioka, SM Knobel, HL Green. Biphasic changes in

Wavelet Decomposition for Discrete Probability Maps

DTIC Science & Technology

2007-08-01

using other wavelet basis functions, such as those mentioned in Section 7 15 DSTO–TN–0760 References 1. P. M. Bentley and J . T . E. McDonnell. Wavelet...84, 1995. 0272-1716. 18. E. J . Stollnitz, T . D. DeRose, and D. H. Salesin. Wavelets for computer graphics: a primer. 2. Computer Graphics and...and Computer Modelling in 2006 from the University of South Australia, Mawson Lakes. Part of this de- gree was undertaken at the University of Twente

Applications of three DNA barcodes in assorting intertidal red macroalgal flora in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhao, Xiaobo; Pang, Shaojun; Shan, Tifeng; Liu, Feng

2013-03-01

This study is part of the endeavor to construct a comprehensive DNA barcoding database for common seaweeds in China. Identifications of red seaweeds, which have simple morphology and anatomy, are sometimes difficult solely depending on morphological characteristics. In recent years, DNA barcode technique has become a more and more effective tool to help solve some of the taxonomic difficulties. Some DNA markers such as COI (cytochrome oxidase subunit I) are proposed as standardized DNA barcodes for all seaweed species. In this study, COI, UPA (universal plastid amplicon, domain V of 23S rRNA), and ITS (nuclear internal transcribed spacer) were employed to analyze common species of intertidal red seaweeds in Qingdao (119.3°-121°E, 35.35°-37.09°N). The applicability of using one or a few combined barcodes to identify red seaweed species was tested. The results indicated that COI is a sensitive marker at species level. However, not all the tested species gave PCR amplification products due to lack of the universal primers. The second barcode UPA had effective universal primers but needed to be tested for the effectiveness of resolving closely related species. More than one ITS sequence types were found in some species in this investigation, which might lead to confusion in further analysis. Therefore ITS sequence is not recommended as a universal barcode for seaweeds identification.

Detection of West Nile virus and tick-borne encephalitis virus in birds in Slovakia, using a universal primer set.

PubMed

Csank, Tomáš; Bhide, Katarína; Bencúrová, Elena; Dolinská, Saskia; Drzewnioková, Petra; Major, Peter; Korytár, Ľuboš; Bocková, Eva; Bhide, Mangesh; Pistl, Juraj

2016-06-01

West Nile virus (WNV) is a mosquito-borne neurotropic pathogen that presents a major public health concern. Information on WNV prevalence and circulation in Slovakia is insufficient. Oral and cloacal swabs and bird brain samples were tested for flavivirus RNA by RT-PCR using newly designed generic primers. The species designation was confirmed by sequencing. WNV was detected in swab and brain samples, whereas one brain sample was positive for tick-borne encephalitis virus (TBEV). The WNV sequences clustered with lineages 1 and 2. These results confirm the circulation of WNV in birds in Slovakia and emphasize the risk of infection of humans and horses.

Use of species-specific PCR for the identification of 10 sea cucumber species

NASA Astrophysics Data System (ADS)

Wen, Jing; Zeng, Ling

2014-11-01

We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

Long-stem shaped multifunctional molecular beacon for highly sensitive nucleic acids determination via intramolecular and intermolecular interactions based strand displacement amplification.

PubMed

Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee

2017-11-20

Occurrence and application of oligonucleotide probes have promoted great progress in the biochemical analysis field due to their unique biological and chemical properties. In this work, a long-stem shaped multifunctional molecular beacon (LS-MMB) that is responsive to a cancer-related gene, p53, is well-prepared. By designing the probe with long-paired bases at its two ends and short-paired bases between the middle region and the 3' end, the LS-MMB is intelligently endowed with the ability to recognize the target analyte, serve as the polymerization primer/template, and signal the hybridization event synchronously, which is distinctly advantageous over the traditional molecular beacons (MBs). Moreover, it is excitingly found that the LS-MMB can be employed to exert intramolecular and intermolecular interactions for strand displacement amplification (SDA) without the involvement of any assistant probes; this therapy results in a really easy and rapid sensing system that provides an extremely low background noise and high target output signal. In this case, an excellent sensitivity and specificity to detect target gene down to picomolar level and resolution to even one nucleotide variation are achieved, respectively. In addition, the application potential for real genomic DNA analysis is realized. We envision that the probe of LS-MMB can act as a universal platform for biosensing and biomedical research.

Effects of bond primers on bending strength and bonding of glass fibers in fiber-embedded maxillofacial silicone prostheses.

PubMed

Hatamleh, Muhanad M; Watts, David C

2011-02-01

To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p < 0.05). Mean (SD) values of maximum pull-out forces (N) before aging for groups: no primer, G611, A-304, A-330-G were: 13.63 (7.45), 20.44 (2.99), 22.06 (6.69), and 57.91 (10.15), respectively. All primers increased bond strength in comparison to control specimens (p < 0.05). Primer A-330-G showed the greatest increase among all primers (p < 0.05); however, bonding degraded after aging (p < 0.05), and pull-out forces were 13.58 (2.61), 6.17 (2.89), 6.95 (2.61), and 11.72 (3.03). Maximum bending strengths of fiber bundles at baseline increased after treatment with primers and light aging in comparison with control specimens (p < 0.05), and were in the range of 917.72 to 1095.25 and 1124.06 to 1596.68 MPa at both baseline and after 360 hours aging (p < 0.05). The use of A-330-G primer in conjunction with silicone Cosmesil M511 produced the greatest bond strength for silicone-glass fiber surfaces at baseline; however, bond strength was significantly degraded after accelerated daylight aging. Treatment with primer and accelerated daylight aging increased bending strength of glass fibers. © 2011 by The American College of Prosthodontists.

Artifacts in Radar Imaging of Moving Targets

DTIC Science & Technology

2012-09-01

CA, USA, 2007. [11] B. Borden, Radar imaging of airborne targets: A primer for Applied mathematicians and Physicists . New York, NY: Taylor and... Project (0704–0188) Washington DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 21 September 2012 3. REPORT TYPE AND DATES COVERED...CW Continuous Wave DAC Digital to Analog Convertor DFT Discrete Fourier Transform FBP Filtered Back Projection FFT Fast Fourier Transform GPS

A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

PubMed

Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

2000-12-01

Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers

PubMed Central

Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

2017-01-01

The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

PubMed Central

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-01-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

PubMed

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-08-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

Barcode haplotype variation in North American agroecosystem ladybird beetles (Coleoptera: Coccinellidae

USDA-ARS?s Scientific Manuscript database

DNA barcodes have proven invaluable in identifying and distinguishing insect pests, for example for determining the provenance of exotic invasives, but relatively few insect natural enemies have been barcoded. We used Folmer et al.’s universal invertebrate primers (1994), and those designed by Heber...

Designing specific chloroplast markers for black walnut from a set of universal primers

Treesearch

Erin Victory; Rodney L. Robichaud; Keith Woeste

2003-01-01

Chloroplasts are a valuable source of genetic information because their sequence is highly conserved, they undergo little or no recombination, and they are uniparentally inherited. Chloroplast polymorphisms are powerful genetic tools for identifying matrilineal family groups, studying gene flow from seed versus pollen movement, reconstructing phylogeographic...

The Symptomatic Persian Gulf Veterans Protocol: An Analysis of Risk Factors with an Immunologic and Neuropsychiatric Assessment.

DTIC Science & Technology

1999-01-01

Evaluation of peripheral blood mononuclear cells, urine and throat cultures samples for the presence of mycoplasma or ureaplasma organisms by...c) by PCR with a universal mycoplasma primer. Mycoplasma or ureaplasma were detected frequently in urine and throat swabs, however no significant

Investment Primer for Green Revolving Funds

ERIC Educational Resources Information Center

Weisbord, Dano

2012-01-01

Developing return-oriented green revolving funds (GRFs) is a rapidly growing trend at colleges and universities. A green revolving fund (GRF) is a special account designated for investment in on-campus projects that improve energy efficiency or decrease material use. GRFs invest in a variety of cost-saving initiatives, resulting in significant…

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

PubMed

Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

2015-04-01

Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

Improved PCR assay for the species-specific identification and quantitation of Legionella pneumophila in water.

PubMed

Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk

2015-11-01

Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.

Cytochrome cd1-containing nitrite reductase encoding gene nirS as a new functional biomarker for detection of anaerobic ammonium oxidizing (Anammox) bacteria.

PubMed

Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong

2011-04-15

A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gacura, Matthew D.; Sprockett, Daniel D.; Heidenreich, Bess

Here, fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this studywe developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from40 fungal genomes. The primerswere used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senescedmore » tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communitieswere up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystemtype were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes.« less

Developing Educational Resources to Advance Umbilical Cord Blood Banking and Research: A Canadian Perspective.

PubMed

Beak, Carla Pereira; Chargé, Sophie B; Isasi, Rosario; Knoppers, Bartha M

2015-05-01

In 2013 Canadian Blood Services (CBS) launched the National Public Cord Blood Bank (NPCBB), a program to collect, process, test, and store cord blood units donated for use in transplantation. A key component of the creation of the NPCBB is the establishment of a program that enables cord blood not suitable for banking or transplantation to be used for biomedical research purposes. Along with the development of processes and policies to manage the NPCBB and the cord blood research program, CBS-in collaboration with researchers from the Stem Cell Network-have also developed educational tools to provide relevant information for target audiences to aid implementation and operation. We describe here one of these tools, the REB Primer on Research and Cord Blood Donation (the Primer), which highlights key ethical and legal considerations and identifies Canadian documents that are relevant to the use of cord blood in biomedical research. The Primer also introduces the NPCBB and describes the systems CBS is implementing to address ethical issues. The Primer is intended to assist research ethics boards in evaluating the ethical acceptability of research protocols, to facilitate harmonized decision-making by providing a common reference, and to highlight the role of research ethics boards in governance frameworks. With the Primer we hope to illustrate how the development of such educational tools can facilitate the ethical implementation and governance of programs related to stem cell research in Canada and abroad.

Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi

DOE PAGES

Gacura, Matthew D.; Sprockett, Daniel D.; Heidenreich, Bess; ...

2016-02-17

Here, fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this studywe developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from40 fungal genomes. The primerswere used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senescedmore » tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communitieswere up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystemtype were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes.« less

A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

PubMed

Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

PubMed Central

Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

Implementation of Novel Design Features for qPCR-Based eDNA Assessment

PubMed Central

Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

2016-01-01

Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

One-step multiplex RT-qPCR detects three citrus viroids from different genera in a wide range of hosts.

PubMed

Osman, Fatima; Dang, Tyler; Bodaghi, Sohrab; Vidalakis, Georgios

2017-07-01

A one-step multiplex reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) based on species-specific minor groove binding (MGB) probes, was developed for the simultaneous detection, identification, and quantification of three citrus viroids belonging to different genera. Citrus exocortis viroid (Pospiviroid), Hop stunt viroid (Hostuviroid), and Citrus bark cracking viroid (Cocadviroid) cause a variety of maladies in agriculturally significant crops. Therefore, reliable assays for their detection are essential tools for various government and industry organizations implementing disease management programs. Singleplex qPCR primers and MGB probes were designed individually for the detection of the three targeted viroids, and subsequently combined in a one-step multiplex RT-qPCR reaction. A wide host range of woody plants, including citrus, grapevines, apricots, plums and herbaceous plants such as tomato, cucumber, eggplant and chrysanthemum different world regions were used to validate the assay. Single, double and triple viroid infections were identified in the tested samples. The developed multiplex RT-qPCR assay was compared with a previously reported SYBR Green I RT-qPCR for the universal detection of citrus viroids. Both assays accurately identified all citrus viroid infected samples. The multiplex assay complemented the SYBR Green I universal detection assay by differentiating among citrus viroid species in the positive samples. The developed multiplex RT-qPCR assay has the potential to simultaneously detect each targeted viroid and could be used in high throughput screenings for citrus viroids in field surveys, germplasm banks, nurseries and other viroid disease management programs. Copyright © 2017. Published by Elsevier B.V.

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Minimal Disease Assessment in the Treatment of Children and Adolescents with Intermediate-Risk (Stage III/IV) B-Cell Non-Hodgkin Lymphoma: A Children’s Oncology Group Report

PubMed Central

Shiramizu, Bruce; Goldman, Stanton; Kusao, Ian; Agsalda, Melissa; Lynch, James; Smith, Lynette; Harrison, Lauren; Morris, Erin; Gross, Thomas G.; Sanger, Warren; Perkins, Sherrie; Cairo, Mitchell S.

2011-01-01

Summary Children/adolescents with mature B-cell non-Hodgkin lymphoma (B-NHL) have an excellent prognosis but relapses still occur. While chromosomal aberrations and/or clonal immunoglobulin (Ig) gene rearrangements may indicate risk of failure, a more universal approach was developed to detect minimal disease (MD). Children/adolescents with intermediate-risk B-NHL were treated with French-British-American/Lymphome Malins de Burkitt 96 (FAB/LMB96) B4 modified chemotherapy and rituximab. Specimens from diagnosis, end of induction (EOI), and end of therapy (EOT) were assayed for MD. Initial specimens were screened for IGHV family usage with primer pools followed by individual primers to identify MD. Thirty-two diagnostic/staging specimens screened positive with primer pools and unique IGHV family primers were identified. Two patients relapsed; first relapse (4 months from diagnosis) was MD-positive at EOI, the second (36 months from diagnosis) was MD-positive at EOT. At EOI, recurrent rates were similar between the MRD-positive and MRD-negative patients (p=0.40). At EOT, only 13/32 patients had MRD data available with 1 relapse in the MRD-positive group and no recurrences in the MRD-negative group (p=0.077). The study demonstrated molecular-disseminated disease in which IgIGHV primer pools could be used to assess MD. This feasibility study supports future investigations to assess the validity and significance of MD screening in a larger cohort of patients with intermediate-risk mature B-NHL. PMID:21496005

Minimal disease assessment in the treatment of children and adolescents with intermediate-risk (Stage III/IV) B-cell non-Hodgkin lymphoma: a children's oncology group report.

PubMed

Shiramizu, Bruce; Goldman, Stanton; Kusao, Ian; Agsalda, Melissa; Lynch, James; Smith, Lynette; Harrison, Lauren; Morris, Erin; Gross, Thomas G; Sanger, Warren; Perkins, Sherrie; Cairo, Mitchell S

2011-06-01

Children/adolescents with mature B-cell non-Hodgkin lymphoma (B-NHL) have an excellent prognosis but relapses still occur. While chromosomal aberrations and/or clonal immunoglobulin (Ig) gene rearrangements may indicate risk of failure, a more universal approach was developed to detect minimal disease (MD). Children/adolescents with intermediate-risk B-NHL were treated with French-British-American/Lymphome Malins de Burkitt 96 (FAB/LMB96) B4 modified chemotherapy and rituximab. Specimens from diagnosis, end of induction (EOI), and end of therapy (EOT) were assayed for MD. Initial specimens were screened for IGHV family usage with primer pools followed by individual primers to identify MD. Thirty-two diagnostic/staging specimens screened positive with primer pools and unique IGHV family primers were identified. Two patients relapsed; first relapse (4 months from diagnosis) was MD-positive at EOI, the second (36 months from diagnosis) was MD-positive at EOT. At EOI, recurrent rates were similar between the MRD-positive and MRD-negative patients (P = 0·40). At EOT, only 13/32 patients had MRD data available with one relapse in the MRD-positive group and no recurrences in the MRD-negative group (P = 0·077). The study demonstrated molecular-disseminated disease in which IgIGHV primer pools could be used to assess MD. This feasibility study supports future investigations to assess the validity and significance of MD screening in a larger cohort of patients with intermediate-risk mature B-NHL. © 2011 Blackwell Publishing Ltd.

Enamel Deproteinization using Papacarie and 10% Papain Gel on Shear Bond Strength of Orthodontic Brackets Before and After Acid Etching.

PubMed

Agarwal, R M; Yeluri, R; Singh, C; Munshi, A K

2015-01-01

To suggest Papacarie(®) as a new deproteinizing agent in comparison with indigenously prepared 10% papain gel before and after acid etching that may enhance the quality of the bond between enamel surface and composite resin complex. One hundred and twenty five extracted human premolars were utilized and divided into five groups: In the group 1, enamel surface was etched and primer was applied. In group 2, treatment with papacarie(®) for 60 seconds followed by etching and primer application. In group 3, etching followed by treatment with papacarie(®) for 60 seconds and primer application. In group 4, treatment with 10% papain gel for 60 seconds followed by etching and primer application. In group 5, etching followed by treatment with 10% papain gel for 60 seconds and primer application . After bonding the brackets, the mechanical testing was performed using a Universal testing machine. The failure mode was analyzed using an adhesive remnant index. The etching patterns before and after application of papacarie(®) and 10% papain gel was also evaluated using SEM. The values obtained for shear bond strength were submitted to analysis of variance and Tukey test (p < 0.05). It was observed that group 2 and group 4 had the highest shear bond strength and was statistically significant from other groups (p=0.001). Regarding Adhesive remnant index no statistical difference was seen between the groups (p=0.538). Papacarie(®) or 10% papain gel can be used to deproteinize the enamel surface before acid etching to enhance the bond strength of orthodontic brackets.

Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

PubMed

Pitta, João; Branco, Teresa C; Portugal, Jaime

2018-05-01

Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (P<.001) by all the factors studied (cement system, saliva contamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (P<.05) and were the only groups not affected by saliva contamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by saliva contamination. Copyright © 2017 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Gene Polymorphism Studies in a Teaching Laboratory

NASA Astrophysics Data System (ADS)

Shultz, Jeffry

2009-02-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

Detection of HbsAg and hATIII genetically modified goats (Caprahircus) by loop-mediated isothermal amplification.

PubMed

Tao, Chenyu; Zhang, Qingde; Zhai, Shanli; Liu, Bang

2013-11-01

In this study, sensitive and rapid detection systems were designed using a loop-mediated isothermal amplification (LAMP) method to detect the genetically modified goats. A set of 4 primers were designed for each exogenous nucleic acids HBsAg and hATIII. The DNA samples were first amplified with the outer and inner primers and released a single-stranded DNA,of which both ends were stem-loop structure. Then one inner primer hybridized with the loop, and initiated displacement synthesis in less than 1 h. The result could be visualized by both agarose gel electrophoresis and unaided eyes directly after adding SYBR GREEN 1. The detection limit of LAMP was ten copies of target molecules, indicating that LAMP was tenfold more sensitive than the classical PCR. Furthermore, all the samples of genetically modified goats were tested positively by LAMP, and the results demonstrated that the LAMP was a rapid and sensitive method for detecting the genetically modified organism.

Fluorescent Random Amplified Microsatellites (F-RAMS) analysis of mushrooms as a forensic investigative tool.

PubMed

Kallifatidis, Beatrice; Borovička, Jan; Stránská, Jana; Drábek, Jiří; Mills, Deetta K

2014-03-01

The capability of Fluorescent Random Amplified Microsatellites (F-RAMS) to profile hallucinogenic mushrooms to species and sub-species level was assessed. Fifteen samples of Amanita rubescens and 22 samples of other hallucinogenic and non-hallucinogenic mushrooms of the genera Amanita and Psilocybe were profiled using two fluorescently-labeled, 5'degenerate primers, 5'-6FAM-SpC3-DD (CCA)5 and 5'-6FAM-SpC3-DHB (CGA)5, which target different microsatellite repeat regions. Among the two primers, 5'-6FAM-SpC3-DHB (CGA)5 provided more reliable data for identification purposes, by grouping samples of the same species and clustering closely related species together in a dendrogram based on amplicon similarities. A high degree of intra-specific variation between the 15 A. rubescens samples was shown with both primers and the amplicons generated for all A. rubescens samples were organized into three classes of amplicons (discriminant, private, and marker) based on their individualizing potential. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Pentaplex PCR as screening assay for jellyfish species identification in food products.

PubMed

Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

2014-12-17

Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

An innovative and integrated approach based on DNA walking to identify unauthorised GMOs.

PubMed

Fraiture, Marie-Alice; Herman, Philippe; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H

2014-03-15

In the coming years, the frequency of unauthorised genetically modified organisms (GMOs) being present in the European food and feed chain will increase significantly. Therefore, we have developed a strategy to identify unauthorised GMOs containing a pCAMBIA family vector, frequently present in transgenic plants. This integrated approach is performed in two successive steps on Bt rice grains. First, the potential presence of unauthorised GMOs is assessed by the qPCR SYBR®Green technology targeting the terminator 35S pCAMBIA element. Second, its presence is confirmed via the characterisation of the junction between the transgenic cassette and the rice genome. To this end, a DNA walking strategy is applied using a first reverse primer followed by two semi-nested PCR rounds using primers that are each time nested to the previous reverse primer. This approach allows to rapidly identify the transgene flanking region and can easily be implemented by the enforcement laboratories. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Gene Polymorphism Studies in a Teaching Laboratory

ERIC Educational Resources Information Center

Shultz, Jeffry

2009-01-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

Ecological succession of the microbial communities of an air-conditioning cooling coil in the tropics.

PubMed

Acerbi, E; Chénard, C; Miller, D; Gaultier, N E; Heinle, C E; Chang, V W-C; Uchida, A; Drautz-Moses, D I; Schuster, S C; Lauro, F M

2017-03-01

Air-conditioning systems harbor microorganisms, potentially spreading them to indoor environments. While air and surfaces in air-conditioning systems are periodically sampled as potential sources of indoor microbes, little is known about the dynamics of cooling coil-associated communities and their effect on the downstream airflow. Here, we conducted a 4-week time series sampling to characterize the succession of an air-conditioning duct and cooling coil after cleaning. Using an universal primer pair targeting hypervariable regions of the 16S/18S ribosomal RNA, we observed a community succession for the condensed water, with the most abundant airborne taxon Agaricomycetes fungi dominating the initial phase and Sphingomonas bacteria becoming the most prevalent taxa toward the end of the experiment. Duplicate air samples collected upstream and downstream of the coil suggest that the system does not act as ecological filter or source/sink for specific microbial taxa during the duration of the experiment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)

NASA Astrophysics Data System (ADS)

Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina

2014-09-01

Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.

A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

PubMed

Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

2014-11-01

The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

DNA Persistence in a Sink Drain Environment

DOE PAGES

Winder, Eric M.; Bonheyo, George T.

2015-07-31

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 10 7 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition ofmore » the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.« less

DNA Persistence in a Sink Drain Environment

PubMed Central

Winder, Eric M.; Bonheyo, George T.

2015-01-01

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively. PMID:26230525

DNA Persistence in a Sink Drain Environment.

PubMed

Winder, Eric M; Bonheyo, George T

2015-01-01

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.

Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

PubMed

Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

2013-04-02

Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.

Overcoming Endocrine Resistance by Targeting ER/FoxA1/IL-8 Axis

DTIC Science & Technology

2015-10-01

residual disease after 6-month neoadjuvant endocrine therapy 45 . Recent studies unveiled gain-of- function mutations in ESR1 , the gene encoding ER...described previously 61 . SYBR dye (Life Technologies) was used in real- time PCR and the target primer sequences are as follows: ESR1 forward...Breast Cancer Symposium (ed^(eds). Cancer Res (2013). 46. Li S, et al. Endocrine-therapy-resistant ESR1 variants revealed by genomic characterization of

Making a Difference: A Primer for Women in Public Life. Report on a Leadership Seminar Sponsored by the Alaska Women's Commission (Fairbanks, Alaska, April 12, 1988).

ERIC Educational Resources Information Center

Callahan, Christine

This workshop summary offers a guide for women who are considering seeking public office. It covers pre-campaign concerns, development of a campaign plan, and keeping the campaign on target. While a campaign plan should be an anchor, it also should be a flexible tool that can be revised, if necessary. The document discusses "targeting,"…

Bacterial colonisation of suture material after routine neurosurgical procedures: relevance for wound infection.

PubMed

Hong, Bujung; Winkel, Andreas; Ertl, Philipp; Stumpp, Sascha Nico; Schwabe, Kerstin; Stiesch, Meike; Krauss, Joachim K

2018-03-01

Wound healing impairment is a serious problem in surgical disciplines which may be associated with chronic morbidity, increased cost and patient discomfort. Here we aimed to investigate the relevance of bacterial colonisation on suture material using polymerase chain reaction (PCR) to detect and taxonomically classify bacterial DNA in patients with and without wound healing problems after routine neurosurgical procedures. Repeat surgery was performed in 25 patients with wound healing impairment and in 38 patients with well-healed wounds. To determine the presence of bacteria, a 16S rDNA-based PCR detection method was applied. Fragments of 500 bp were amplified using universal primers which target hypervariable regions within the bacterial 16S rRNA gene. Amplicons were separated from each other by single-strand conformation polymorphism (SSCP) analysis, and finally classified using Sanger sequencing. PCR/SSCP detected DNA of various bacteria species on suture material in 10/38 patients with well-healed wounds and in 12/25 patients with wound healing impairment including Staphylococcus aureus, Staphylococcus epidermidis, Propionibacterium acnes and Escherichia coli. Microbiological cultures showed bacterial growth in almost all patients with wound healing impairment and positive results in PCR/SSCP (10/12), while this was the case in only one patient with a well-healed wound (1/10). Colonisation of suture material with bacteria occurs in a relevant portion of patients with and without wound healing impairment after routine neurosurgical procedures. Suture material may provide a nidus for bacteria and subsequent biofilm formation. Most likely, however, such colonisation of sutures is not a general primer for subsequent wound infection.

Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river.

PubMed

Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

2013-06-01

Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47-48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex.

PubMed

Elfekih, Samia; Tay, Wee Tek; Gordon, Karl; Court, Leon N; De Barro, Paul J

2018-01-01

The whitefly Bemisia tabaci complex harbours over 40 cryptic species that have been placed in 11 phylogenetically distinct clades based on the molecular characterization of partial mitochondrial DNA COI (mtCOI) gene region. Four cryptic species are currently within the invasive clade, i.e. MED, MEAM1, MEAM2 and IO. Correct identification of these species is a critical step towards implementing reliable measures for plant biosecurity and border protection; however, no standardized B. tabaci-specific primers are currently available which has caused inconsistencies in the species identification processes. We report three sets of polymerase chain reaction (PCR) primers developed to amplify the mtCOI region which can be used for genotyping MED, MEAM1 and IO species, and tested these primers on 91 MED, 35 MEAM1 and five IO individuals. PCR and sequencing of amplicons identified a total of 21, six and one haplotypes in MED, MEAM1 and IO respectively, of which six haplotypes were new to the B. tabaci database. These primer pairs enabled standardization and robust molecular species identification via mtCOI screening of the targeted invasive cryptic species and will improve quarantine decisions. Use of this diagnostic tool could be extended to other species within the complex. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

PubMed Central

Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

2014-01-01

• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

PubMed

Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

2018-06-01

Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

PubMed

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

Seven novel probe systems for real-time PCR provide absolute single-base discrimination, higher signaling, and generic components.

PubMed

Murray, James L; Hu, Peixu; Shafer, David A

2014-11-01

We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Massively parallel digital high resolution melt for rapid and absolutely quantitative sequence profiling

NASA Astrophysics Data System (ADS)

Velez, Daniel Ortiz; Mack, Hannah; Jupe, Julietta; Hawker, Sinead; Kulkarni, Ninad; Hedayatnia, Behnam; Zhang, Yang; Lawrence, Shelley; Fraley, Stephanie I.

2017-02-01

In clinical diagnostics and pathogen detection, profiling of complex samples for low-level genotypes represents a significant challenge. Advances in speed, sensitivity, and extent of multiplexing of molecular pathogen detection assays are needed to improve patient care. We report the development of an integrated platform enabling the identification of bacterial pathogen DNA sequences in complex samples in less than four hours. The system incorporates a microfluidic chip and instrumentation to accomplish universal PCR amplification, High Resolution Melting (HRM), and machine learning within 20,000 picoliter scale reactions, simultaneously. Clinically relevant concentrations of bacterial DNA molecules are separated by digitization across 20,000 reactions and amplified with universal primers targeting the bacterial 16S gene. Amplification is followed by HRM sequence fingerprinting in all reactions, simultaneously. The resulting bacteria-specific melt curves are identified by Support Vector Machine learning, and individual pathogen loads are quantified. The platform reduces reaction volumes by 99.995% and achieves a greater than 200-fold increase in dynamic range of detection compared to traditional PCR HRM approaches. Type I and II error rates are reduced by 99% and 100% respectively, compared to intercalating dye-based digital PCR (dPCR) methods. This technology could impact a number of quantitative profiling applications, especially infectious disease diagnostics.

Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study.

PubMed

Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay

2013-09-01

The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

A Primer on Alternative Investments: Free Lunches, Magic, and the Four Ps.

ERIC Educational Resources Information Center

Yoder, Jay A.

1998-01-01

A discussion of alternative investments for colleges and universities looks at the kinds of investments that comprise this group, rationales for making such investments, the advantages of diversification, risk issues, and ways to reduce risk, including careful selection of managers. Several strategies for getting started in alternative investments…

Detection of Food Allergens by Taqman Real-Time PCR Methodology.

PubMed

García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

2017-01-01

Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

PCR detection of uncultured rumen bacteria.

PubMed

Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

2012-07-01

16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

A robust and cost-effective approach to sequence and analyze complete genomes of small RNA viruses

USDA-ARS?s Scientific Manuscript database

Background: Next-generation sequencing (NGS) allows ultra-deep sequencing of nucleic acids. The use of sequence-independent amplification of viral nucleic acids without utilization of target-specific primers provides advantages over traditional sequencing methods and allows detection of unsuspected ...

Endophyte Microbiome Diversity in Micropropagated Atriplex canescens and Atriplex torreyi var griffithsii

PubMed Central

Lucero, Mary E.; Unc, Adrian; Cooke, Peter; Dowd, Scot; Sun, Shulei

2011-01-01

Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequencing (TEFAP) analysis amplified sequences from callus homologous to diverse fungal and bacterial taxa. Culturing isolated some seed borne endophyte taxa which could be readily propagated apart from the host. Microbial cells were observed within biofilm-like residues associated with plant cell surfaces and intercellular spaces. Various universal primers amplified both plant and microbial sequences, with different primers revealing different patterns of fungal diversity. Bacterial and fungal TEFAP followed by alignment with sequences from curated databases revealed 7 bacterial and 17 ascomycete taxa in A. canescens, and 5 bacterial taxa in A. torreyi. Additional diversity was observed among isolates and clone libraries. Micropropagated Atriplex retains a complex, intimately associated microbiome which includes diverse strains well poised to interact in manners that influence host physiology. Microbiome analysis was facilitated by high throughput sequencing methods, but primer biases continue to limit recovery of diverse sequences from even moderately complex communities. PMID:21437280

Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

PubMed

Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

2018-01-01

"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

A practical workshop for generating simple DNA fingerprints of plants.

PubMed

Rouzière, A-S; Redman, J E

2011-01-01

Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of plants thereby illustrating concepts and techniques in genetics and molecular biology. Three combinations of primers/restriction enzyme targeting chloroplast DNA were sufficient to generate patterns that enabled visual discrimination of plant species. The protocol was tested with a range of common fruit, vegetable, and herb plants that could be easily cultivated and handled in the laboratory. Toxic or hazardous materials such as ethidium bromide and liquid nitrogen were avoided. The protocol was validated as a university outreach workshop targeted at a group of up to 10 high-school students. In a teaching laboratory, students sampled plants, setup the PCR reaction and restriction digest using microliter pipettes, and loaded the digested samples on an agarose gel. The workshop was structured as 2 × 2.5-hour sessions on separate days. The main challenges stemmed from the speed and accuracy of pipetting, especially at the gel loading stage. Feedback from students was largely positive, with the majority reporting that they had both enjoyed and learnt from the experience. Copyright © 2010 Wiley Periodicals, Inc.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

PubMed

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Genetic homogeneity among Leishmania (Leishmania) infantum isolates from dog and human samples in Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil.

PubMed

da Silva, Thais Almeida Marques; Gomes, Luciana Inácia; Oliveira, Edward; Coura-Vital, Wendel; Silva, Letícia de Azevedo; Pais, Fabiano Sviatopolk-Mirsky; Ker, Henrique Gama; Reis, Alexandre Barbosa; Rabello, Ana; Carneiro, Mariangela

2015-04-15

Certain municipalities in the Belo Horizonte Metropolitan Area (BHMA), Minas Gerais, Brazil, have the highest human visceral leishmaniasis (VL) mortality rates in the country and also demonstrate high canine seropositivity. In Brazil, the etiologic agent of VL is Leishmania (Leishmania) infantum. The aim of this study was to evaluate the intraspecific genetic variability of parasites from humans and from dogs with different clinical forms of VL in five municipalities of BHMA using PCR-RFLP and two target genes: kinetoplast DNA (kDNA) and gp63. In total, 45 samples of DNA extracted from clinical samples (n = 35) or L. infantum culture (n = 10) were evaluated. These samples originated from three groups: adults (with or without Leishmania/HIV co-infection; n = 14), children (n = 18) and dogs (n = 13). The samples were amplified for the kDNA target using the MC1 and MC2 primers (447 bp), while the Sg1 and Sg2 (1330 bp) primers were used for the gp63 glycoprotein target gene. The restriction enzyme patterns of all the samples tested were monomorphic. These findings reveal a high degree of genetic homogeneity for the evaluated gene targets among L. infantum samples isolated from different hosts and representing different clinical forms of VL in the municipalities of BHMA studied.

A PCR-based tool for the cultivation-independent monitoring of Pandora neoaphidis.

PubMed

Fournier, A; Enkerli, J; Keller, S; Widmer, F

2008-09-01

Pandora neoaphidis is one of the most important fungal pathogens of aphids and has a great potential for use in biocontrol. Little is known on how this fungus persists in an area and in particular on its overwintering strategies. It is hypothesized that natural areas play an important role for survival and that soil may serve as a source of inoculum for new aphid populations in spring. To test these hypotheses, a cultivation-independent PCR-based diagnostic tool was developed, that allows the detection of P. neoaphidis in the environment. Two P. neoaphidis specific PCR primer pairs were designed, targeting sequences in the ribosomal RNA gene cluster. Specificity of both primer pairs was demonstrated with P. neoaphidis and non-target close entomophthoralean relatives. Moreover, single amplicons of expected sizes were obtained with both primer pairs from various environmental sample types, including aphid cadavers, plant material, and soil. The PCR-based diagnostic tool was applied to investigate the persistence of P. neoaphidis in soil samples obtained in 2004/2005 from a nettle field harboring infected aphids in fall 2004. P. neoaphidis was detected in every sample collected in November 2004 and March 2005, suggesting an overwintering stage of P. neoaphidis in top soil layers. The developed cultivation-independent PCR-based tool will be valuable for further investigation of the ecology of P. neoaphidis and for the development and future implementation of management strategies against aphids involving conservation biocontrol.

Environmental distribution of two widespread uncultured freshwater Euryarchaeota clades unveiled by specific primers and quantitative PCR.

PubMed

Restrepo-Ortiz, Claudia X; Casamayor, Emilio O

2013-12-01

Quantitative environmental distribution of two widely distributed uncultured freshwater Euryarchaeota with unknown functional role was explored by newly designed quantitative PCR primers targeting the 16S rRNA gene of clades Miscellaneous Euryarchaeota Group (MEG, containing the groups pMC2A384 and VALII/Eury4) and Deep-Sea Euryarchaeotal Groups (DSEG, targeting the cluster named VALIII containing the DHVE-3/DSEG, BC07-2A-27/DSEG-3 and DSEG-2 groups), respectively. The summer surface plankton of 28 lakes was analysed, and one additional dimictic deep alpine lake, Lake Redon, was temporally and vertically surveyed covering seasonal limnological variability. A trophic range between 0.2 and 5.2 μg l(-1) Chl a, and pH span from 3.8 to 9.5 was explored at altitudes between 632 and 2590 m above sea level. The primers showed to be highly selective with c. 85% coverage and 100% specificity. Only pH significantly explained the changes observed in gene abundances and environment. In Lake Redon, DSEG bloomed in deep stratified waters both in summer and early spring, and MEG at intermediate depths during the ice-cover period. Overall, MEG and DSEG showed a differential ecological distribution although correlational analyses indicated lack of coupling of both Euryarchaeota with phytoplankton (chlorophyll a). However, an intriguing positive and significant relationship was found between DSEG and putative ammonia oxidizing thaumarchaeota. © 2013 John Wiley & Sons Ltd and Society for Applied Microbiology.

Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...

Single Laboratory Comparison of Quantitative Real-time PCR Assays for the Detection of Fecal Pollution

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...

Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

PubMed

Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2016-09-01

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

Hybrid calcium phosphate coatings for implants

NASA Astrophysics Data System (ADS)

Malchikhina, Alena I.; Shesterikov, Evgeny V.; Bolbasov, Evgeny N.; Ignatov, Viktor P.; Tverdokhlebov, Sergei I.

2016-08-01

Monophasic biomaterials cannot provide all the necessary functions of bones or other calcined tissues. It is necessary to create for cancer patients the multiphase materials with the structure and composition simulating the natural bone. Such materials are classified as hybrid, obtained by a combination of chemically different components. The paper presents the physical, chemical and biological studies of coatings produced by hybrid technologies (HT), which combine primer layer and calcium phosphate (CaP) coating. The first HT type combines the method of vacuum arc titanium primer layer deposition on a stainless steel substrate with the following micro-arc oxidation (MAO) in phosphoric acid solution with addition of calcium compounds to achieve high supersaturated state. MAO CaP coatings feature high porosity (2-8%, pore size 5-7 µm) and surface morphology with the thickness greater than 5 µm. The thickness of Ti primer layer is 5-40 µm. Amorphous MAO CaP coating micro-hardness was measured at maximum normal load Fmax = 300 mN. It was 3.1 ± 0.8 GPa, surface layer elasticity modulus E = 110 ± 20 GPa, roughness Ra = 0.9 ± 0.1 µm, Rz = 7.5 ± 0.2 µm, which is less than the titanium primer layer roughness. Hybrid MAO CaP coating is biocompatible, able to form calcium phosphates from supersaturated body fluid (SBF) solution and also stimulates osteoinduction processes. The second HT type includes the oxide layer formation by thermal oxidation and then CaP target radio frequency magnetron sputtering (RFMS). Oxide-RFMS CaP coating is a thin dense coating with good adhesion to the substrate material, which can be used for metal implants. The RFMS CaP coating has thickness 1.6 ± 0.1 µm and consists of main target elements calcium and phosphorus and Ca/P ratio 2.4. The second HT type can form calcium phosphates from SBF solution. In vivo study shows that hybrid RFMS CaP coating is biocompatible and produces fibrointegration processes.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Rapid Molecular Diagnostics, Antibiotic Treatment Decisions, and Developing Approaches to Inform Empiric Therapy: PRIMERS I and II.

PubMed

Evans, Scott R; Hujer, Andrea M; Jiang, Hongyu; Hujer, Kristine M; Hall, Thomas; Marzan, Christine; Jacobs, Michael R; Sampath, Rangarajan; Ecker, David J; Manca, Claudia; Chavda, Kalyan; Zhang, Pan; Fernandez, Helen; Chen, Liang; Mediavilla, Jose R; Hill, Carol B; Perez, Federico; Caliendo, Angela M; Fowler, Vance G; Chambers, Henry F; Kreiswirth, Barry N; Bonomo, Robert A

2016-01-15

Rapid molecular diagnostic (RMD) platforms may lead to better antibiotic use. Our objective was to develop analytical strategies to enhance the interpretation of RMDs for clinicians. We compared the performance characteristics of 4 RMD platforms for detecting resistance against β-lactams in 72 highly resistant isolates of Escherichia coli and Klebsiella pneumoniae (PRIMERS I). Subsequently, 2 platforms were used in a blinded study in which a heterogeneous collection of 196 isolates of E. coli and K. pneumoniae (PRIMERS II) were examined. We evaluated the genotypic results as predictors of resistance or susceptibility against β-lactam antibiotics. We designed analytical strategies and graphical representations of platform performance, including discrimination summary plots and susceptibility and resistance predictive values, that are readily interpretable by practitioners to inform decision-making. In PRIMERS I, the 4 RMD platforms detected β-lactamase (bla) genes and identified susceptibility or resistance in >95% of cases. In PRIMERS II, the 2 platforms identified susceptibility against extended-spectrum cephalosporins and carbapenems in >90% of cases; however, against piperacillin/tazobactam, susceptibility was identified in <80% of cases. Applying the analytical strategies to a population with 15% prevalence of ceftazidime-resistance and 5% imipenem-resistance, RMD platforms predicted susceptibility in >95% of cases, while prediction of resistance was 69%-73% for ceftazidime and 41%-50% for imipenem. RMD platforms can help inform empiric β-lactam therapy in cases where bla genes are not detected and the prevalence of resistance is known. Our analysis is a first step in bridging the gap between RMDs and empiric treatment decisions. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Shear bond strength of composite bonded with three adhesives to Er,Cr:YSGG laser-prepared enamel.

PubMed

Türkmen, Cafer; Sazak-Oveçoğlu, Hesna; Günday, Mahir; Güngör, Gülşad; Durkan, Meral; Oksüz, Mustafa

2010-06-01

To assess in vitro the shear bond strength of a nanohybrid composite resin bonded with three adhesive systems to enamel surfaces prepared with acid and Er,Cr:YSGG laser etching. Sixty extracted caries- and restoration-free human maxillary central incisors were used. The teeth were sectioned 2 mm below the cementoenamel junction. The crowns were embedded in autopolymerizing acrylic resin with the labial surfaces facing up. The labial surfaces were prepared with 0.5-mm reduction to receive composite veneers. Thirty specimens were etched with Er,Cr:YSGG laser. This group was also divided into three subgroups, and the following three bonding systems were then applied on the laser groups and the other three unlased groups: (1) 37% phosphoric acid etch + Bond 1 primer/adhesive (Pentron); (2) Nano-bond self-etch primer (Pentron) + Nano-bond adhesive (Pentron); and (3) all-in-one adhesive-single dose (Futurabond NR, Voco). All of the groups were restored with a nanohybrid composite resin (Smile, Pentron). Shear bond strength was measured with a Zwick universal test device with a knife-edge loading head. The data were analyzed with two-factor ANOVA. There were no significant differences in shear bond strength between self-etch primer + adhesive and all-in-one adhesive systems for nonetched and laser-etched enamel groups (P > .05). However, bond strength values for the laser-etched + Bond 1 primer/adhesive group (48.00 +/- 13.86 MPa) were significantly higher than the 37% phosphoric acid + Bond 1 primer/adhesive group (38.95 +/- 20.07 MPa) (P < .05). The Er,Cr:YSGG laser-powered hydrokinetic system etched the enamel surface more effectively than 37% phosphoric acid for subsequent attachment of composite material.

Citrus huanglongbing in São Paulo State, Brazil: PCR detection of the 'Candidatus' Liberibacter species associated with the disease.

PubMed

do Carmo Teixeira, Diva; Luc Danet, Jean; Eveillard, Sandrine; Cristina Martins, Elaine; de Jesus Junior, Waldir Cintra; Takao Yamamoto, Pedro; Aparecido Lopes, Silvio; Beozzo Bassanezi, Renato; Juliano Ayres, Antonio; Saillard, Colette; Bové, Joseph Marie

2005-06-01

Symptoms of huanglongbing (HLB), one of the most serious diseases of citrus in Asia and Africa, have been noticed in March 2004 in the Araraquara region of São Paulo State, Brazil. HLB has not been reported previously from America. The causal HLB bacteria, Candidatus Liberibacter africanus in Africa and Candidatus Liberibacter asiaticus in Asia, can be detected in symptomatic citrus leaves by PCR amplification of their 16S rDNA with previously described primers. When this technique was applied to 43 symptomatic leaf samples from the Araraquara region, all PCR reactions were negative. This suggested that a new pathogen, not detected by the above primers, could be involved in HLB in the State of São Paulo. Indeed, by using universal primers for amplification of bacterial 16S rDNA, a new liberibacter species, Candidatus Liberibacter americanus, has recently been identified. Specific primers for PCR amplification of the 16S rDNA of Ca. L. americanus have been selected. Using these primers, the new liberibacter could be detected in 214 symptomatic leaf samples tested. The leaves of two additional samples were infected with Candidatus Liberibacter asiaticus, and two further samples contained both Ca. L. americanus and Ca. L. asiaticus. The samples came from 47 farms in 35 municipalities. The psyllid vector of Ca. L. asiaticus, Diaphorina citri, is established in South, Central, and North America (Florida and Texas). Ca. L. americanus could be detected by PCR in several batches of D. citri psyllids collected on symptomatic sweet orange trees infected with Ca. L. americanus, strongly suggesting that D. citri is the vector of Ca. L. americanus. The results reported here confirm the presence of HLB in the State of São Paulo. Ca. L. americanus is the most widely distributed pathogen.

Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

PubMed

Asvapathanagul, P; Olson, B H

2017-01-01

To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

Detection and Diversity of Fungal Nitric Oxide Reductase Genes (p450nor) in Agricultural Soils

PubMed Central

Welsh, Allana; Orellana, Luis H.; Konstantinidis, Konstantinos T.; Chee-Sanford, Joanne C.; Sanford, Robert A.; Schadt, Christopher W.

2016-01-01

ABSTRACT Members of the Fungi convert nitrate (NO3−) and nitrite (NO2−) to gaseous nitrous oxide (N2O) (denitrification), but the fungal contributions to N loss from soil remain uncertain. Cultivation-based methodologies that include antibiotics to selectively assess fungal activities have limitations, and complementary molecular approaches to assign denitrification potential to fungi are desirable. Microcosms established with soils from two representative U.S. Midwest agricultural regions produced N2O from added NO3− or NO2− in the presence of antibiotics to inhibit bacteria. Cultivation efforts yielded 214 fungal isolates belonging to at least 15 distinct morphological groups, 151 of which produced N2O from NO2−. Novel PCR primers targeting the p450nor gene, which encodes the nitric oxide (NO) reductase responsible for N2O production in fungi, yielded 26 novel p450nor amplicons from DNA of 37 isolates and 23 amplicons from environmental DNA obtained from two agricultural soils. The sequences shared 54 to 98% amino acid identity with reference P450nor sequences within the phylum Ascomycota and expand the known fungal P450nor sequence diversity. p450nor was detected in all fungal isolates that produced N2O from NO2−, whereas nirK (encoding the NO-forming NO2− reductase) was amplified in only 13 to 74% of the N2O-forming isolates using two separate nirK primer sets. Collectively, our findings demonstrate the value of p450nor-targeted PCR to complement existing approaches to assess the fungal contributions to denitrification and N2O formation. IMPORTANCE A comprehensive understanding of the microbiota controlling soil N loss and greenhouse gas (N2O) emissions is crucial for sustainable agricultural practices and addressing climate change concerns. We report the design and application of a novel PCR primer set targeting fungal p450nor, a biomarker for fungal N2O production, and demonstrate the utility of the new approach to assess fungal denitrification potential in fungal isolates and agricultural soils. These new PCR primers may find application in a variety of biomes to assess the fungal contributions to N loss and N2O emissions. PMID:26969694

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

PubMed

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Case Study of the Distribution of Mucosa-Associated Bifidobacterium Species, Lactobacillus Species, and Other Lactic Acid Bacteria in the Human Colon

PubMed Central

Nielsen, D. S.; Møller, P. L.; Rosenfeldt, V.; Pærregaard, A.; Michaelsen, K. F.; Jakobsen, M.

2003-01-01

The distribution of mucosa-associated bacteria, bifidobacteria and lactobacilli and closely related lactic acid bacteria, in biopsy samples from the ascending, transverse, and descending parts of the colon from four individuals was investigated by denaturing gradient gel electrophoresis (DGGE). Bifidobacterial genus-specific, Lactobacillus group-specific, and universal bacterial primers were used in a nested PCR approach to amplify a fragment of the 16S rRNA gene. DGGE profiles of the bifidobacterial community were relatively simple, with one or two amplicons detected at most sampling sites in the colon. DGGE profiles obtained with Lactobacillus group-specific primers were complex and varied with host and sampling site in the colon. The overall bacterial community varied with host but not sampling site. PMID:14660412

Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

PubMed

Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

2017-09-15

At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

PubMed

Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

2017-02-01

PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox bacteria within wider coverage of genera in Mai Po wetland indicates this unique niche is very complex, and species of anammox bacteria are niche-specific with different physiological properties towards substrates competing and chemical tolerance capability.

Ballistics: a primer for the surgeon.

PubMed

Volgas, David A; Stannard, James P; Alonso, Jorge E

2005-03-01

The purpose of this paper is to review the literature on ballistics and to sort through the plethora of myth and popular opinion. The trauma surgeon is increasingly faced with gunshot wounds. Knowledge of ballistics is important to help in assessing the patterns of wounds that are seen. There are many factors that affect the flight of a bullet to its target. Many of these factors also affect the behaviour of the bullet after it strikes the target. It is primarily these factors that interest the surgeon.

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

Determining miRNA Expression Levels in Degraded RNA Samples Using Real-Time RT-qPCR and Microarray Technologies

PubMed Central

Tighe, S.; Holbrook, J.; Nadella, V.; Carmical, R.; Sol-Church, K.; Yueng, A.T.; Chittur, S.

2011-01-01

The Nucleic Acid Research Group (NARG) has previously conducted studies evaluating the impact of RNA integrity and priming strategies on cDNA synthesis and real-time RT-qPCR. The results of last year's field study as it relates to degraded RNA will be presented. In continuation of the RNA integrity theme, this year's study was designed to evaluate the impact of RNA integrity on the analysis of miRNA expression using real-time RT-qPCR. Target section was based on data obtained by the Microarray Research Group (MARG) and other published data from next gen sequencing. These 9 miRNAs represent three groups of miRNA that are expressed at low, medium or high levels in the First Choice human brain reference RNA sample. Two popular RT priming strategies tested in this study include the Megaplex miRNA TaqMan assay (ABI) and the RT2 miRNA qPCR assay (Qiagen/SA Biosciences). The basis for the ABI assay design is a target-specific stem-loop structure and reverse-transcription primer, while the Qiagen design combines poly(A) tailing and a universal reverse transcription in one cDNA synthesis reaction. For this study, the human brain reference RNA was subject to controlled degradation using RNase A to RIN (RNA Integrity Number) values of 7 (good), 4 (moderately degraded), and 2 (severely degraded).These templates were then used to assess both RT methods. In addition to this real-time RT-qPCR data, the same RNA templates were further analyzed using universal poly(A) tailing and hybridization to Affymetrix miRNA GeneChips. This talk will provide insights into RT priming strategies for miRNA and contrast the qPCR results obtained using different technologies.

A novel non-sequencing approach for rapid authentication of Testudinis Carapax et Plastrum and Trionycis Carapax by species-specific primers

PubMed Central

Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin

2018-01-01

A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667

Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

2013-02-01

Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

PubMed

Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

2016-07-01

Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

Loop-Mediated Isothermal Amplification Test for Trypanosoma gambiense Group 1 with Stem Primers: A Molecular Xenomonitoring Test for Sleeping Sickness.

PubMed

Njiru, Zablon K; Mbae, Cecilia K; Mburugu, Gitonga N

2017-01-01

The World Health Organization has targeted Human African Trypanosomiasis (HAT) for elimination by 2020 with zero incidence by 2030. To achieve and sustain this goal, accurate and easy-to-deploy diagnostic tests for Gambian trypanosomiasis which accounts for over 98% of reported cases will play a crucial role. Most needed will be tools for surveillance of pathogen in vectors (xenomonitoring) since population screening tests are readily available. The development of new tests is expensive and takes a long time while incremental improvement of existing technologies that have potential for xenomonitoring may offer a shorter pathway to tools for HAT surveillance. We have investigated the effect of including a second set of reaction accelerating primers (stem primers) to the standard T. brucei gambiense LAMP test format. The new test format was analyzed with and without outer primers. Amplification was carried out using Rotorgene 6000 and the portable ESE Quant amplification unit capable of real-time data output. The stem LAMP formats indicated shorter time to results (~8 min), were 10-100-fold more sensitive, and indicated higher diagnostic sensitivity and accuracy compared to the standard LAMP test. It was possible to confirm the predicted product using ESE melt curves demonstrating the potential of combining LAMP and real-time technologies as possible tool for HAT molecular xenomonitoring.

Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria.

PubMed

Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; Silva, Marcus Adonai Castro da; Andreote, Fernando Dini; Lima, André Oliveira de Souza

2017-05-25

The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase ( phaC ) gene, which is involved in the production of polyhydroxyalkanoate (PHA)-a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms ( n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced ( n = 4), allowing for the confirmation of the pha C gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity.

Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria

PubMed Central

Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; da Silva, Marcus Adonai Castro; Andreote, Fernando Dini; Lima, André Oliveira de Souza

2017-01-01

The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase (phaC) gene, which is involved in the production of polyhydroxyalkanoate (PHA)—a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms (n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced (n = 4), allowing for the confirmation of the phaC gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity. PMID:28952531

The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

PubMed Central

Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

2016-01-01

Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

Development and application of a rapid and visual loop-mediated isothermal amplification for the detection of Sporisorium scitamineum in sugarcane

PubMed Central

Su, Yachun; Yang, Yuting; Peng, Qiong; Zhou, Dinggang; Chen, Yun; Wang, Zhuqing; Xu, Liping; Que, Youxiong

2016-01-01

Smut is a fungal disease with widespread prevalence in sugarcane planting areas. Early detection and proper identification of Sporisorium scitamineum are essential in smut management practices. In the present study, four specific primers targeting the core effector Pep1 gene of S. scitamineum were designed. Optimal concentrations of Mg2+, primer and Bst DNA polymerase, the three important components of the loop-mediated isothermal amplification (LAMP) reaction system, were screened using a single factor experiment method and the L16(45) orthogonal experimental design. Hence, a LAMP system suitable for detection of S. scitamineum was established. High specificity of the LAMP method was confirmed by the assay of S. scitamineum, Fusarium moniliforme, Pestalotia ginkgo, Helminthospcrium sacchari, Fusarium oxysporum and endophytes of Yacheng05-179 and ROC22. The sensitivity of the LAMP method was equal to that of the conventional PCR targeting Pep1 gene and was 100 times higher than that of the conventional PCR assay targeting bE gene in S. scitamineum. The results suggest that this novel LAMP system has strong specificity and high sensitivity. This method not only provides technological support for the epidemic monitoring of sugarcane smut, but also provides a good case for development of similar detection technology for other plant pathogens. PMID:27035751

Specific Identification and Targeted Characterization of Bifidobacterium lactis from Different Environmental Isolates by a Combined Multiplex-PCR Approach

PubMed Central

Ventura, Marco; Reniero, Roberto; Zink, Ralf

2001-01-01

The species Bifidobacterium lactis, with its main representative strain Bb12 (DSM 10140), is a yoghurt isolate used as a probiotic strain and is commercially applied in different types of yoghurts and infant formulas. In order to ensure the genetic identity and safety of this bacterial isolate, species- and strain-specific molecular tools for genetic fingerprinting must be available to identify isolated bifidobacteria or lactic acid bacteria from, e.g., various clinical environments of relevance in medical microbiology. Two opposing rRNA gene-targeted primers have been developed for specific detection of this microorganism by PCR. The specificity of this approach was evaluated and verified with DNA samples isolated from single and mixed cultures of bifidobacteria and lactobacilli (48 isolates, including the type strains of 29 Bifidobacterium and 9 Lactobacillus species). Furthermore, we performed a Multiplex-PCR using oligonucleotide primers targeting a specific region of the 16S rRNA gene for the genus Bifidobacterium and a conserved eubacterial 16S rDNA sequence. The specificity and sensitivity of this detection with a pure culture of B. lactis were, respectively, 100 bacteria/ml after 25 cycles of PCR and 1 to 10 bacteria/ml after a 50-cycle nested-PCR approach. PMID:11375192

Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 Triggered Isothermal Amplification for Site-Specific Nucleic Acid Detection.

PubMed

Huang, Mengqi; Zhou, Xiaoming; Wang, Huiying; Xing, Da

2018-02-06

A novel CRISPR/Cas9 triggered isothermal exponential amplification reaction (CAS-EXPAR) strategy based on CRISPR/Cas9 cleavage and nicking endonuclease (NEase) mediated nucleic acids amplification was developed for rapid and site-specific nucleic acid detection. CAS-EXPAR was primed by the target DNA fragment produced by cleavage of CRISPR/Cas9, and the amplification reaction performed cyclically to generate a large number of DNA replicates which were detected using a real-time fluorescence monitoring method. This strategy that combines the advantages of CRISPR/Cas9 and exponential amplification showed high specificity as well as rapid amplification kinetics. Unlike conventional nucleic acids amplification reactions, CAS-EXPAR does not require exogenous primers, which often cause target-independent amplification. Instead, primers are first generated by Cas9/sgRNA directed site-specific cleavage of target and accumulated during the reaction. It was demonstrated this strategy gave a detection limit of 0.82 amol and showed excellent specificity in discriminating single-base mismatch. Moreover, the applicability of this method to detect DNA methylation and L. monocytogenes total RNA was also verified. Therefore, CAS-EXPAR may provide a new paradigm for efficient nucleic acid amplification and hold the potential for molecular diagnostic applications.

Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products.

PubMed

Botti, Sara; Giuffra, Elisabetta

2010-08-23

DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce) and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. The described method is largely independent of the degree of degradation of DNA source and can thus be applied to processed seafood. Moreover, the method is highly flexible: publicly available sequence information on mitochondrial genomes are rapidly increasing for most species, facilitating the choice of target sequences and the improvement of resolution of the test. This is particularly important for discrimination of marine and aquaculture species for which genome information is still limited.

Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution - Poster

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method p...

Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

ERIC Educational Resources Information Center

Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

2018-01-01

Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

Improved HF183 reverse primer and probe for greater analytical sensitivity of human Bacteroides in the environment

EPA Science Inventory

Background: Numerous indicators have been used to assess the presence of fecal pollution, many relying on molecular methods such as qPCR. One of the targets frequently used, the human-associated Bacteroides 16s rRNA region, has several assays in current usage. These assays vary...

Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

USDA-ARS?s Scientific Manuscript database

Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...