Construction and Screening of a Lentiviral Secretome Library.
Liu, Tao; Jia, Panpan; Ma, Huailei; Reed, Sean A; Luo, Xiaozhou; Larman, H Benjamin; Schultz, Peter G
2017-06-22
Over 2,000 human proteins are predicted to be secreted, but the biological function of the many of these proteins is still unknown. Moreover, a number of these proteins may act as new therapeutic agents or be targets for the development of therapeutic antibodies. To further explore the extracellular proteome, we have developed a secretome-enriched open reading frame (ORF) library that can be readily screened for autocrine activity in cell-based phenotypic or reporter assays. Next-generation sequencing (NGS) and database analysis predict that the library contains approximately 900 ORFs encoding known secreted proteins (accounting for 77.8% of the library), as well as genes encoding potentially unknown secreted proteins. In a proof-of-principle study, human TF-1 cells were screened for proliferative factors, and the known cytokine GMCSF was identified as a dominant hit. This library offers a relatively low-cost and straightforward approach for functional autocrine screens of secreted proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.
Agouti signaling protein stimulates cell division in "viable yellow" (A vy/a) mouse liver
USDA-ARS?s Scientific Manuscript database
Enhanced linear growth, hyperplasia, and tumorigenesis are well-known characteristics of "viable yellow" agouti Avy/- mice (1); however, the functional basis for this aspect of the phenotype is unknown. In the present study, we ascertained whether agouti signaling protein (ASIP) levels in Avy/a or a...
Progress towards mapping the universe of protein folds
Grant, Alastair; Lee, David; Orengo, Christine
2004-01-01
Although the precise aims differ between the various international structural genomics initiatives currently aiming to illuminate the universe of protein folds, many selectively target protein families for which the fold is unknown. How well can the current set of known protein families and folds be used to estimate the total number of folds in nature, and will structural genomics initiatives yield representatives for all the major protein families within a reasonable time scale? PMID:15128436
A glimpse into the proteome of phototrophic bacterium Rhodobacter capsulatus.
Onder, Ozlem; Aygun-Sunar, Semra; Selamoglu, Nur; Daldal, Fevzi
2010-01-01
A first glimpse into the proteome of Rhodobacter capsulatus revealed more than 450 (with over 210 cytoplasmic and 185 extracytoplasmic known as well as 55 unknown) proteins that are identified with high degree of confidence using nLC-MS/MS analyses. The accumulated data provide a solid platform for ongoing efforts to establish the proteome of this species and the cellular locations of its constituents. They also indicate that at least 40 of the identified proteins, which were annotated in genome databases as unknown hypothetical proteins, correspond to predicted translation products that are indeed present in cells under the growth conditions used in this work. In addition, matching the identification labels of the proteins reported between the two available R. capsulatus genome databases (ERGO-light with RRCxxxxx and NT05 with NT05RCxxxx numbers) indicated that 11 such proteins are listed only in the latter database.
Genome-wide protein-protein interactions and protein function exploration in cyanobacteria
Lv, Qi; Ma, Weimin; Liu, Hui; Li, Jiang; Wang, Huan; Lu, Fang; Zhao, Chen; Shi, Tieliu
2015-01-01
Genome-wide network analysis is well implemented to study proteins of unknown function. Here, we effectively explored protein functions and the biological mechanism based on inferred high confident protein-protein interaction (PPI) network in cyanobacteria. We integrated data from seven different sources and predicted 1,997 PPIs, which were evaluated by experiments in molecular mechanism, text mining of literatures in proved direct/indirect evidences, and “interologs” in conservation. Combined the predicted PPIs with known PPIs, we obtained 4,715 no-redundant PPIs (involving 3,231 proteins covering over 90% of genome) to generate the PPI network. Based on the PPI network, terms in Gene ontology (GO) were assigned to function-unknown proteins. Functional modules were identified by dissecting the PPI network into sub-networks and analyzing pathway enrichment, with which we investigated novel function of underlying proteins in protein complexes and pathways. Examples of photosynthesis and DNA repair indicate that the network approach is a powerful tool in protein function analysis. Overall, this systems biology approach provides a new insight into posterior functional analysis of PPIs in cyanobacteria. PMID:26490033
The influence of iron on the proteomic profile of Chromobacterium violaceum.
Lima, Daniel C; Duarte, Fábio T; Medeiros, Viviane K S; Lima, Diogo B; Carvalho, Paulo C; Bonatto, Diego; Batistuzzo de Medeiros, Silvia R
2014-10-20
Chromobacterium violaceum is a bacterium commonly found in tropical and subtropical regions and is associated with important pharmacological and industrial attributes such as producing substances with therapeutic properties and synthesizing biodegradable polymers. Its genome was sequenced, however, approximately 40% of its genes still remain with unknown functions. Although C. violaceum is known by its versatile capacity of living in a wide range of environments, little is known on how it achieves such success. Here, we investigated the proteomic profile of C. violaceum cultivated in the absence and presence of high iron concentration, describing some proteins of unknown function that might play an important role in iron homeostasis, amongst others. Briefly, C. violaceum was cultivated in the absence and in the presence of 9 mM of iron during four hours. Total proteins were identified by LC-MS and through the PatternLab pipeline. Our proteomic analysis indicates major changes in the energetic metabolism, and alterations in the synthesis of key transport and stress proteins. In addition, it may suggest the presence of a yet unidentified operon that could be related to oxidative stress, together with a set of other proteins with unknown function. The protein-protein interaction network also pinpointed the importance of energetic metabolism proteins to the acclimatation of C. violaceum in high concentration of iron. This is the first proteomic analysis of the opportunistic pathogen C. violaceum in the presence of high iron concentration. Our data allowed us to identify a yet undescribed operon that might have a role in oxidative stress defense. Our work provides new data that will contribute to understand how this bacterium achieve its capacity of surviving in harsh conditions as well as to open a way to explore the yet little availed biotechnological characteristics of this bacterium with the further exploring of the proteins of unknown function that we showed to be up-regulated in high iron concentration.
MoCha: Molecular Characterization of Unknown Pathways.
Lobo, Daniel; Hammelman, Jennifer; Levin, Michael
2016-04-01
Automated methods for the reverse-engineering of complex regulatory networks are paving the way for the inference of mechanistic comprehensive models directly from experimental data. These novel methods can infer not only the relations and parameters of the known molecules defined in their input datasets, but also unknown components and pathways identified as necessary by the automated algorithms. Identifying the molecular nature of these unknown components is a crucial step for making testable predictions and experimentally validating the models, yet no specific and efficient tools exist to aid in this process. To this end, we present here MoCha (Molecular Characterization), a tool optimized for the search of unknown proteins and their pathways from a given set of known interacting proteins. MoCha uses the comprehensive dataset of protein-protein interactions provided by the STRING database, which currently includes more than a billion interactions from over 2,000 organisms. MoCha is highly optimized, performing typical searches within seconds. We demonstrate the use of MoCha with the characterization of unknown components from reverse-engineered models from the literature. MoCha is useful for working on network models by hand or as a downstream step of a model inference engine workflow and represents a valuable and efficient tool for the characterization of unknown pathways using known data from thousands of organisms. MoCha and its source code are freely available online under the GPLv3 license.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, B.; Sugiman-Marangos, S; Junop, M
2009-01-01
The Actinobacteria phylum represents one of the largest and most diverse groups of bacteria, encompassing many important and well-characterized organisms including Streptomyces, Bifidobacterium, Corynebacterium and Mycobacterium. Members of this phylum are remarkably diverse in terms of life cycle, morphology, physiology and ecology. Recent comparative genomic analysis of 19 actinobacterial species determined that only 5 genes of unknown function uniquely define this large phylum [1]. The cellular functions of these actinobacteria-specific proteins (ASP) are not known.
Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2018-03-06
Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.
Exploration of Uncharted Regions of the Protein Universe
Jaroszewski, Lukasz; Li, Zhanwen; Krishna, S. Sri; Bakolitsa, Constantina; Wooley, John; Deacon, Ashley M.; Wilson, Ian A.; Godzik, Adam
2009-01-01
The genome projects have unearthed an enormous diversity of genes of unknown function that are still awaiting biological and biochemical characterization. These genes, as most others, can be grouped into families based on sequence similarity. The PFAM database currently contains over 2,200 such families, referred to as domains of unknown function (DUF). In a coordinated effort, the four large-scale centers of the NIH Protein Structure Initiative have determined the first three-dimensional structures for more than 250 of these DUF families. Analysis of the first 248 reveals that about two thirds of the DUF families likely represent very divergent branches of already known and well-characterized families, which allows hypotheses to be formulated about their biological function. The remainder can be formally categorized as new folds, although about one third of these show significant substructure similarity to previously characterized folds. These results infer that, despite the enormous increase in the number and the diversity of new genes being uncovered, the fold space of the proteins they encode is gradually becoming saturated. The previously unexplored sectors of the protein universe appear to be primarily shaped by extreme diversification of known protein families, which then enables organisms to evolve new functions and adapt to particular niches and habitats. Notwithstanding, these DUF families still constitute the richest source for discovery of the remaining protein folds and topologies. PMID:19787035
Wong, Mabel T.; Wang, Weijun; Couturier, Marie; Razeq, Fakhria M.; Lombard, Vincent; Lapebie, Pascal; Edwards, Elizabeth A.; Terrapon, Nicolas; Henrissat, Bernard; Master, Emma R.
2017-01-01
To identify carbohydrate-active enzymes (CAZymes) that might be particularly relevant for wood fiber processing, we performed a comparative metagenomic analysis of digestive systems from Canadian beaver (Castor canadensis) and North American moose (Alces americanus) following 3 years of enrichment on either microcrystalline cellulose or poplar hydrolysate. In total, 9,386 genes encoding CAZymes and carbohydrate-binding modules (CBMs) were identified, with up to half predicted to originate from Firmicutes, Bacteroidetes, Chloroflexi, and Proteobacteria phyla, and up to 17% from unknown phyla. Both PCA and hierarchical cluster analysis distinguished the annotated glycoside hydrolase (GH) distributions identified herein, from those previously reported for grass-feeding mammals and herbivorous foragers. The CAZyme profile of moose rumen enrichments also differed from a recently reported moose rumen metagenome, most notably by the absence of GH13-appended dockerins. Consistent with substrate-driven convergence, CAZyme profiles from both poplar hydrolysate-fed cultures differed from cellulose-fed cultures, most notably by increased numbers of unique sequences belonging to families GH3, GH5, GH43, GH53, and CE1. Moreover, pairwise comparisons of moose rumen enrichments further revealed higher counts of GH127 and CE15 families in cultures fed with poplar hydrolysate. To expand our scope to lesser known carbohydrate-active proteins, we identified and compared multi-domain proteins comprising both a CBM and domain of unknown function (DUF) as well as proteins with unknown function within the 416 predicted polysaccharide utilization loci (PULs). Interestingly, DUF362, identified in iron–sulfur proteins, was consistently appended to CBM9; on the other hand, proteins with unknown function from PULs shared little identity unless from identical PULs. Overall, this study sheds new light on the lignocellulose degrading capabilities of microbes originating from digestive systems of mammals known for fiber-rich diets, and highlights the value of enrichment to select new CAZymes from metagenome sequences for future biochemical characterization. PMID:29326667
Development of a dedicated peptide tandem mass spectral library for conservation science.
Fremout, Wim; Dhaenens, Maarten; Saverwyns, Steven; Sanyova, Jana; Vandenabeele, Peter; Deforce, Dieter; Moens, Luc
2012-05-30
In recent years, the use of liquid chromatography tandem mass spectrometry (LC-MS/MS) on tryptic digests of cultural heritage objects has attracted much attention. It allows for unambiguous identification of peptides and proteins, and even in complex mixtures species-specific identification becomes feasible with minimal sample consumption. Determination of the peptides is commonly based on theoretical cleavage of known protein sequences and on comparison of the expected peptide fragments with those found in the MS/MS spectra. In this approach, complex computer programs, such as Mascot, perform well identifying known proteins, but fail when protein sequences are unknown or incomplete. Often, when trying to distinguish evolutionarily well preserved collagens of different species, Mascot lacks the required specificity. Complementary and often more accurate information on the proteins can be obtained using a reference library of MS/MS spectra of species-specific peptides. Therefore, a library dedicated to various sources of proteins in works of art was set up, with an initial focus on collagen rich materials. This paper discusses the construction and the advantages of this spectral library for conservation science, and its application on a number of samples from historical works of art. Copyright © 2012 Elsevier B.V. All rights reserved.
A structural-alphabet-based strategy for finding structural motifs across protein families
Wu, Chih Yuan; Chen, Yao Chi; Lim, Carmay
2010-01-01
Proteins with insignificant sequence and overall structure similarity may still share locally conserved contiguous structural segments; i.e. structural/3D motifs. Most methods for finding 3D motifs require a known motif to search for other similar structures or functionally/structurally crucial residues. Here, without requiring a query motif or essential residues, a fully automated method for discovering 3D motifs of various sizes across protein families with different folds based on a 16-letter structural alphabet is presented. It was applied to structurally non-redundant proteins bound to DNA, RNA, obligate/non-obligate proteins as well as free DNA-binding proteins (DBPs) and proteins with known structures but unknown function. Its usefulness was illustrated by analyzing the 3D motifs found in DBPs. A non-specific motif was found with a ‘corner’ architecture that confers a stable scaffold and enables diverse interactions, making it suitable for binding not only DNA but also RNA and proteins. Furthermore, DNA-specific motifs present ‘only’ in DBPs were discovered. The motifs found can provide useful guidelines in detecting binding sites and computational protein redesign. PMID:20525797
Protein-protein interactions: an application of Tus-Ter mediated protein microarray system.
Sitaraman, Kalavathy; Chatterjee, Deb K
2011-01-01
In this chapter, we present a novel, cost-effective microarray strategy that utilizes expression-ready plasmid DNAs to generate protein arrays on-demand and its use to validate protein-protein interactions. These expression plasmids were constructed in such a way so as to serve a dual purpose of synthesizing the protein of interest as well as capturing the synthesized protein. The microarray system is based on the high affinity binding of Escherichia coli "Tus" protein to "Ter," a 20 bp DNA sequence involved in the regulation of DNA replication. The protein expression is carried out in a cell-free protein synthesis system, with rabbit reticulocyte lysates, and the target proteins are detected either by labeled incorporated tag specific or by gene-specific antibodies. This microarray system has been successfully used for the detection of protein-protein interaction because both the target protein and the query protein can be transcribed and translated simultaneously in the microarray slides. The utility of this system for detecting protein-protein interaction is demonstrated by a few well-known examples: Jun/Fos, FRB/FKBP12, p53/MDM2, and CDK4/p16. In all these cases, the presence of protein complexes resulted in the localization of fluorophores at the specific sites of the immobilized target plasmids. Interestingly, during our interactions studies we also detected a previously unknown interaction between CDK2 and p16. Thus, this Tus-Ter based system of protein microarray can be used for the validation of known protein interactions as well as for identifying new protein-protein interactions. In addition, it can be used to examine and identify targets of nucleic acid-protein, ligand-receptor, enzyme-substrate, and drug-protein interactions.
The Protein Interactome of Mycobacteriophage Giles Predicts Functions for Unknown Proteins.
Mehla, Jitender; Dedrick, Rebekah M; Caufield, J Harry; Siefring, Rachel; Mair, Megan; Johnson, Allison; Hatfull, Graham F; Uetz, Peter
2015-08-01
Mycobacteriophages are viruses that infect mycobacterial hosts and are prevalent in the environment. Nearly 700 mycobacteriophage genomes have been completely sequenced, revealing considerable diversity and genetic novelty. Here, we have determined the protein complement of mycobacteriophage Giles by mass spectrometry and mapped its genome-wide protein interactome to help elucidate the roles of its 77 predicted proteins, 50% of which have no known function. About 22,000 individual yeast two-hybrid (Y2H) tests with four different Y2H vectors, followed by filtering and retest screens, resulted in 324 reproducible protein-protein interactions, including 171 (136 nonredundant) high-confidence interactions. The complete set of high-confidence interactions among Giles proteins reveals new mechanistic details and predicts functions for unknown proteins. The Giles interactome is the first for any mycobacteriophage and one of just five known phage interactomes so far. Our results will help in understanding mycobacteriophage biology and aid in development of new genetic and therapeutic tools to understand Mycobacterium tuberculosis. Mycobacterium tuberculosis causes over 9 million new cases of tuberculosis each year. Mycobacteriophages, viruses of mycobacterial hosts, hold considerable potential to understand phage diversity, evolution, and mycobacterial biology, aiding in the development of therapeutic tools to control mycobacterial infections. The mycobacteriophage Giles protein-protein interaction network allows us to predict functions for unknown proteins and shed light on major biological processes in phage biology. For example, Giles gp76, a protein of unknown function, is found to associate with phage packaging and maturation. The functions of mycobacteriophage-derived proteins may suggest novel therapeutic approaches for tuberculosis. Our ORFeome clone set of Giles proteins and the interactome data will be useful resources for phage interactomics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giulliani, S. E.; Frank, A. E.; Collart, F. R.
2008-12-08
We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mudenda, Lwiindi; Aguilar Pierle, Sebastian; Turse, Joshua E.
2014-08-07
Dermacentor andersoni, known as the Rocky Mountain wood tick, is found in the western United States and transmits pathogens that cause diseases of veterinary and public health importance including Rocky Mountain spotted fever, tularemia, Colorado tick fever and bovine anaplasmosis. Tick saliva is known to modulate both innate and acquired immune responses, enabling ticks to feed for several days without detection. During feeding ticks subvert host defences such as hemostasis and inflammation, which would otherwise result in coagulation, wound repair and rejection of the tick. Molecular characterization of the proteins and pharmacological molecules secreted in tick saliva offers an opportunitymore » to develop tick vaccines as an alternative to the use of acaricides, as well as new anti-inflammatory drugs. We performed proteomics informed by transcriptomics to identify D. andersoni saliva proteins that are secreted during feeding. The transcript data generated a database of 21,797 consensus sequences, which we used to identify 677 proteins secreted in the saliva of D. andersoni ticks fed for 2 and 5 days, following proteomic investigations of whole saliva using mass spectrometry. Salivary gland transcript levels of unfed ticks were compared with 2 and 5 day fed ticks to identify genes upregulated early during tick feeding. We cross-referenced the proteomic data with the transcriptomic data to identify 157 proteins of interest for immunomodulation and blood feeding. Proteins of unknown function as well as known immunomodulators were identified.« less
Bandeira, Nuno; Clauser, Karl R; Pevzner, Pavel A
2007-07-01
Despite significant advances in the identification of known proteins, the analysis of unknown proteins by MS/MS still remains a challenging open problem. Although Klaus Biemann recognized the potential of MS/MS for sequencing of unknown proteins in the 1980s, low throughput Edman degradation followed by cloning still remains the main method to sequence unknown proteins. The automated interpretation of MS/MS spectra has been limited by a focus on individual spectra and has not capitalized on the information contained in spectra of overlapping peptides. Indeed the powerful shotgun DNA sequencing strategies have not been extended to automated protein sequencing. We demonstrate, for the first time, the feasibility of automated shotgun protein sequencing of protein mixtures by utilizing MS/MS spectra of overlapping and possibly modified peptides generated via multiple proteases of different specificities. We validate this approach by generating highly accurate de novo reconstructions of multiple regions of various proteins in western diamondback rattlesnake venom. We further argue that shotgun protein sequencing has the potential to overcome the limitations of current protein sequencing approaches and thus catalyze the otherwise impractical applications of proteomics methodologies in studies of unknown proteins.
Lei, R; Zhang, K; Liu, K; Shao, X; Ding, Z; Wang, F; Hong, Y; Zhu, M; Li, H; Li, H
2016-01-01
The Pierre Robin Sequence (PRS), consisting of cleft palate, glossoptosis and micrognathia, is a common human birth defect. However, how this abnormality occurs remains largely unknown. Here we report that neural crest cell (NCC)-specific knockout of transferrin receptor (Tfrc), a well known transferrin transporter protein, caused micrognathia, cleft palate, severe respiratory distress and inability to suckle in mice, which highly resemble human PRS. Histological and anatomical analysis revealed that the cleft palate is due to the failure of palatal shelves elevation that resulted from a retarded extension of Meckel's cartilage. Interestingly, Tfrc deletion dramatically suppressed both transforming growth factor-β (TGF-β) and bone morphogenetic protein (BMP) signaling in cranial NCCs-derived mandibular tissues, suggesting that Tfrc may act as a facilitator of these two signaling pathways during craniofacial morphogenesis. Together, our study uncovers an unknown function of Tfrc in craniofacial development and provides novel insight into the etiology of PRS. PMID:27362800
Bacillus thuringiensis Toxins: An Overview of Their Biocidal Activity
Palma, Leopoldo; Muñoz, Delia; Berry, Colin; Murillo, Jesús; Caballero, Primitivo
2014-01-01
Bacillus thuringiensis (Bt) is a Gram positive, spore-forming bacterium that synthesizes parasporal crystalline inclusions containing Cry and Cyt proteins, some of which are toxic against a wide range of insect orders, nematodes and human-cancer cells. These toxins have been successfully used as bioinsecticides against caterpillars, beetles, and flies, including mosquitoes and blackflies. Bt also synthesizes insecticidal proteins during the vegetative growth phase, which are subsequently secreted into the growth medium. These proteins are commonly known as vegetative insecticidal proteins (Vips) and hold insecticidal activity against lepidopteran, coleopteran and some homopteran pests. A less well characterized secretory protein with no amino acid similarity to Vip proteins has shown insecticidal activity against coleopteran pests and is termed Sip (secreted insecticidal protein). Bin-like and ETX_MTX2-family proteins (Pfam PF03318), which share amino acid similarities with mosquitocidal binary (Bin) and Mtx2 toxins, respectively, from Lysinibacillus sphaericus, are also produced by some Bt strains. In addition, vast numbers of Bt isolates naturally present in the soil and the phylloplane also synthesize crystal proteins whose biological activity is still unknown. In this review, we provide an updated overview of the known active Bt toxins to date and discuss their activities. PMID:25514092
Functional annotation from the genome sequence of the giant panda.
Huo, Tong; Zhang, Yinjie; Lin, Jianping
2012-08-01
The giant panda is one of the most critically endangered species due to the fragmentation and loss of its habitat. Studying the functions of proteins in this animal, especially specific trait-related proteins, is therefore necessary to protect the species. In this work, the functions of these proteins were investigated using the genome sequence of the giant panda. Data on 21,001 proteins and their functions were stored in the Giant Panda Protein Database, in which the proteins were divided into two groups: 20,179 proteins whose functions can be predicted by GeneScan formed the known-function group, whereas 822 proteins whose functions cannot be predicted by GeneScan comprised the unknown-function group. For the known-function group, we further classified the proteins by molecular function, biological process, cellular component, and tissue specificity. For the unknown-function group, we developed a strategy in which the proteins were filtered by cross-Blast to identify panda-specific proteins under the assumption that proteins related to the panda-specific traits in the unknown-function group exist. After this filtering procedure, we identified 32 proteins (2 of which are membrane proteins) specific to the giant panda genome as compared against the dog and horse genomes. Based on their amino acid sequences, these 32 proteins were further analyzed by functional classification using SVM-Prot, motif prediction using MyHits, and interacting protein prediction using the Database of Interacting Proteins. Nineteen proteins were predicted to be zinc-binding proteins, thus affecting the activities of nucleic acids. The 32 panda-specific proteins will be further investigated by structural and functional analysis.
Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering.
Boari de Lima, Elisa; Meira, Wagner; Melo-Minardi, Raquel Cardoso de
2016-06-01
As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem's complexity. Hence, this work's purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting subfamilies in a family with different specificities, thus reducing the complexity of the experimental function characterization problem; and the identification of residues responsible for specificity.
Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering
Boari de Lima, Elisa; Meira, Wagner; de Melo-Minardi, Raquel Cardoso
2016-01-01
As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem’s complexity. Hence, this work’s purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting subfamilies in a family with different specificities, thus reducing the complexity of the experimental function characterization problem; and the identification of residues responsible for specificity. PMID:27348631
Pan, Joshua; Meyers, Robin M; Michel, Brittany C; Mashtalir, Nazar; Sizemore, Ann E; Wells, Jonathan N; Cassel, Seth H; Vazquez, Francisca; Weir, Barbara A; Hahn, William C; Marsh, Joseph A; Tsherniak, Aviad; Kadoch, Cigall
2018-05-23
Protein complexes are assemblies of subunits that have co-evolved to execute one or many coordinated functions in the cellular environment. Functional annotation of mammalian protein complexes is critical to understanding biological processes, as well as disease mechanisms. Here, we used genetic co-essentiality derived from genome-scale RNAi- and CRISPR-Cas9-based fitness screens performed across hundreds of human cancer cell lines to assign measures of functional similarity. From these measures, we systematically built and characterized functional similarity networks that recapitulate known structural and functional features of well-studied protein complexes and resolve novel functional modules within complexes lacking structural resolution, such as the mammalian SWI/SNF complex. Finally, by integrating functional networks with large protein-protein interaction networks, we discovered novel protein complexes involving recently evolved genes of unknown function. Taken together, these findings demonstrate the utility of genetic perturbation screens alone, and in combination with large-scale biophysical data, to enhance our understanding of mammalian protein complexes in normal and disease states. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Use of designed sequences in protein structure recognition.
Kumar, Gayatri; Mudgal, Richa; Srinivasan, Narayanaswamy; Sandhya, Sankaran
2018-05-09
Knowledge of the protein structure is a pre-requisite for improved understanding of molecular function. The gap in the sequence-structure space has increased in the post-genomic era. Grouping related protein sequences into families can aid in narrowing the gap. In the Pfam database, structure description is provided for part or full-length proteins of 7726 families. For the remaining 52% of the families, information on 3-D structure is not yet available. We use the computationally designed sequences that are intermediately related to two protein domain families, which are already known to share the same fold. These strategically designed sequences enable detection of distant relationships and here, we have employed them for the purpose of structure recognition of protein families of yet unknown structure. We first measured the success rate of our approach using a dataset of protein families of known fold and achieved a success rate of 88%. Next, for 1392 families of yet unknown structure, we made structural assignments for part/full length of the proteins. Fold association for 423 domains of unknown function (DUFs) are provided as a step towards functional annotation. The results indicate that knowledge-based filling of gaps in protein sequence space is a lucrative approach for structure recognition. Such sequences assist in traversal through protein sequence space and effectively function as 'linkers', where natural linkers between distant proteins are unavailable. This article was reviewed by Oliviero Carugo, Christine Orengo and Srikrishna Subramanian.
Pan-Cancer Analysis of Mutation Hotspots in Protein Domains.
Miller, Martin L; Reznik, Ed; Gauthier, Nicholas P; Aksoy, Bülent Arman; Korkut, Anil; Gao, Jianjiong; Ciriello, Giovanni; Schultz, Nikolaus; Sander, Chris
2015-09-23
In cancer genomics, recurrence of mutations in independent tumor samples is a strong indicator of functional impact. However, rare functional mutations can escape detection by recurrence analysis owing to lack of statistical power. We enhance statistical power by extending the notion of recurrence of mutations from single genes to gene families that share homologous protein domains. Domain mutation analysis also sharpens the functional interpretation of the impact of mutations, as domains more succinctly embody function than entire genes. By mapping mutations in 22 different tumor types to equivalent positions in multiple sequence alignments of domains, we confirm well-known functional mutation hotspots, identify uncharacterized rare variants in one gene that are equivalent to well-characterized mutations in another gene, detect previously unknown mutation hotspots, and provide hypotheses about molecular mechanisms and downstream effects of domain mutations. With the rapid expansion of cancer genomics projects, protein domain hotspot analysis will likely provide many more leads linking mutations in proteins to the cancer phenotype. Copyright © 2015 Elsevier Inc. All rights reserved.
Greene, Dina N; Schmidt, Robert L; Wilson, Andrew R; Freedman, Mark S; Grenache, David G
2012-08-01
Diagnosis of multiple sclerosis (MS) is facilitated by analyzing biochemical properties of cerebrospinal fluid (CSF). Oligoclonal bands (OCBs) and immunoglobulin G (IgG) index are well-established markers for evaluating patients suspected of having MS. Myelin basic protein (MBP) is also ordered frequently, but its usefulness remains questionable. OCB, IgG index, and MBP were measured in 16,690 consecutive CSF samples. Samples were divided into 2 groups based on MS status known (n = 71) or unknown (n = 16,118). Medical charts of the MS status known group were reviewed to determine their MS status. OCBs have a stronger association to IgG index results than does MBP. Importantly, MBP does not add a statistically significant increase in diagnostic sensitivity or specificity when used in combination with OCB and/or IgG index. The data indicate that MBP is an unnecessary and overused test.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela
To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less
VisANT 3.0: new modules for pathway visualization, editing, prediction and construction.
Hu, Zhenjun; Ng, David M; Yamada, Takuji; Chen, Chunnuan; Kawashima, Shuichi; Mellor, Joe; Linghu, Bolan; Kanehisa, Minoru; Stuart, Joshua M; DeLisi, Charles
2007-07-01
With the integration of the KEGG and Predictome databases as well as two search engines for coexpressed genes/proteins using data sets obtained from the Stanford Microarray Database (SMD) and Gene Expression Omnibus (GEO) database, VisANT 3.0 supports exploratory pathway analysis, which includes multi-scale visualization of multiple pathways, editing and annotating pathways using a KEGG compatible visual notation and visualization of expression data in the context of pathways. Expression levels are represented either by color intensity or by nodes with an embedded expression profile. Multiple experiments can be navigated or animated. Known KEGG pathways can be enriched by querying either coexpressed components of known pathway members or proteins with known physical interactions. Predicted pathways for genes/proteins with unknown functions can be inferred from coexpression or physical interaction data. Pathways produced in VisANT can be saved as computer-readable XML format (VisML), graphic images or high-resolution Scalable Vector Graphics (SVG). Pathways in the format of VisML can be securely shared within an interested group or published online using a simple Web link. VisANT is freely available at http://visant.bu.edu.
BENZENE OXIDE PROTEIN ADDUCTS AS BIOMARKERS OF BENZENE EXPOSURE
Benzene is known to be hematotoxic and carcinogenic in animals and humans. While metabolism is required for toxicity, the identity of the ultimate carcinogen(s) remains unknown. Benzene oxide (BO) is the first and most abundant of the metabolites, but very little is known about...
Albornos, Lucía; Martín, Ignacio; Iglesias, Rebeca; Jiménez, Teresa; Labrador, Emilia; Dopico, Berta
2012-11-07
Many proteins with tandem repeats in their sequence have been described and classified according to the length of the repeats: I) Repeats of short oligopeptides (from 2 to 20 amino acids), including structural cell wall proteins and arabinogalactan proteins. II) Repeats that range in length from 20 to 40 residues, including proteins with a well-established three-dimensional structure often involved in mediating protein-protein interactions. (III) Longer repeats in the order of 100 amino acids that constitute structurally and functionally independent units. Here we analyse ShooT specific (ST) proteins, a family of proteins with tandem repeats of unknown function that were first found in Leguminosae, and their possible similarities to other proteins with tandem repeats. ST protein sequences were only found in dicotyledonous plants, limited to several plant families, mainly the Fabaceae and the Asteraceae. ST mRNAs accumulate mainly in the roots and under biotic interactions. Most ST proteins have one or several Domain(s) of Unknown Function 2775 (DUF2775). All deduced ST proteins have a signal peptide, indicating that these proteins enter the secretory pathway, and the mature proteins have tandem repeat oligopeptides that share a hexapeptide (E/D)FEPRP followed by 4 partially conserved amino acids, which could determine a putative N-glycosylation signal, and a fully conserved tyrosine. In a phylogenetic tree, the sequences clade according to taxonomic group. A possible involvement in symbiosis and abiotic stress as well as in plant cell elongation is suggested, although different STs could play different roles in plant development. We describe a new family of proteins called ST whose presence is limited to the plant kingdom, specifically to a few families of dicotyledonous plants. They present 20 to 40 amino acid tandem repeat sequences with different characteristics (signal peptide, DUF2775 domain, conservative repeat regions) from the described group of 20 to 40 amino acid tandem repeat proteins and also from known cell wall proteins with repeat sequences. Several putative roles in plant physiology can be inferred from the characteristics found.
2012-01-01
Background Many proteins with tandem repeats in their sequence have been described and classified according to the length of the repeats: I) Repeats of short oligopeptides (from 2 to 20 amino acids), including structural cell wall proteins and arabinogalactan proteins. II) Repeats that range in length from 20 to 40 residues, including proteins with a well-established three-dimensional structure often involved in mediating protein-protein interactions. (III) Longer repeats in the order of 100 amino acids that constitute structurally and functionally independent units. Here we analyse ShooT specific (ST) proteins, a family of proteins with tandem repeats of unknown function that were first found in Leguminosae, and their possible similarities to other proteins with tandem repeats. Results ST protein sequences were only found in dicotyledonous plants, limited to several plant families, mainly the Fabaceae and the Asteraceae. ST mRNAs accumulate mainly in the roots and under biotic interactions. Most ST proteins have one or several Domain(s) of Unknown Function 2775 (DUF2775). All deduced ST proteins have a signal peptide, indicating that these proteins enter the secretory pathway, and the mature proteins have tandem repeat oligopeptides that share a hexapeptide (E/D)FEPRP followed by 4 partially conserved amino acids, which could determine a putative N-glycosylation signal, and a fully conserved tyrosine. In a phylogenetic tree, the sequences clade according to taxonomic group. A possible involvement in symbiosis and abiotic stress as well as in plant cell elongation is suggested, although different STs could play different roles in plant development. Conclusions We describe a new family of proteins called ST whose presence is limited to the plant kingdom, specifically to a few families of dicotyledonous plants. They present 20 to 40 amino acid tandem repeat sequences with different characteristics (signal peptide, DUF2775 domain, conservative repeat regions) from the described group of 20 to 40 amino acid tandem repeat proteins and also from known cell wall proteins with repeat sequences. Several putative roles in plant physiology can be inferred from the characteristics found. PMID:23134664
LIU, YU; PATEL, SANJAY; NIBBE, ROD; MAXWELL, SEAN; CHOWDHURY, SALIM A.; KOYUTURK, MEHMET; ZHU, XIAOFENG; LARKIN, EMMA K.; BUXBAUM, SARAH G; PUNJABI, NARESH M.; GHARIB, SINA A.; REDLINE, SUSAN; CHANCE, MARK R.
2015-01-01
The precise molecular etiology of obstructive sleep apnea (OSA) is unknown; however recent research indicates that several interconnected aberrant pathways and molecular abnormalities are contributors to OSA. Identifying the genes and pathways associated with OSA can help to expand our understanding of the risk factors for the disease as well as provide new avenues for potential treatment. Towards these goals, we have integrated relevant high dimensional data from various sources, such as genome-wide expression data (microarray), protein-protein interaction (PPI) data and results from genome-wide association studies (GWAS) in order to define sub-network elements that connect some of the known pathways related to the disease as well as define novel regulatory modules related to OSA. Two distinct approaches are applied to identify sub-networks significantly associated with OSA. In the first case we used a biased approach based on sixty genes/proteins with known associations with sleep disorders and/or metabolic disease to seed a search using commercial software to discover networks associated with disease followed by information theoretic (mutual information) scoring of the sub-networks. In the second case we used an unbiased approach and generated an interactome constructed from publicly available gene expression profiles and PPI databases, followed by scoring of the network with p-values from GWAS data derived from OSA patients to uncover sub-networks significant for the disease phenotype. A comparison of the approaches reveals a number of proteins that have been previously known to be associated with OSA or sleep. In addition, our results indicate a novel association of Phosphoinositide 3-kinase, the STAT family of proteins and its related pathways with OSA. PMID:21121029
Predictive hypotheses are ineffectual in resolving complex biochemical systems.
Fry, Michael
2018-03-20
Scientific hypotheses may either predict particular unknown facts or accommodate previously-known data. Although affirmed predictions are intuitively more rewarding than accommodations of established facts, opinions divide whether predictive hypotheses are also epistemically superior to accommodation hypotheses. This paper examines the contribution of predictive hypotheses to discoveries of several bio-molecular systems. Having all the necessary elements of the system known beforehand, an abstract predictive hypothesis of semiconservative mode of DNA replication was successfully affirmed. However, in defining the genetic code whose biochemical basis was unclear, hypotheses were only partially effective and supplementary experimentation was required for its conclusive definition. Markedly, hypotheses were entirely inept in predicting workings of complex systems that included unknown elements. Thus, hypotheses did not predict the existence and function of mRNA, the multiple unidentified components of the protein biosynthesis machinery, or the manifold unknown constituents of the ubiquitin-proteasome system of protein breakdown. Consequently, because of their inability to envision unknown entities, predictive hypotheses did not contribute to the elucidation of cation theories remained the sole instrument to explain complex bio-molecular systems, the philosophical question of alleged advantage of predictive over accommodative hypotheses became inconsequential.
Identification of DNA-Binding Proteins Using Structural, Electrostatic and Evolutionary Features
Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2009-01-01
Summary DNA binding proteins (DBPs) often take part in various crucial processes of the cell's life cycle. Therefore, the identification and characterization of these proteins are of great importance. We present here a random forests classifier for identifying DBPs among proteins with known three-dimensional structures. First, clusters of evolutionarily conserved regions (patches) on the protein's surface are detected using the PatchFinder algorithm; previous studies showed that these regions are typically the proteins' functionally important regions. Next, we train a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein including its dipole moment. Using 10-fold cross validation on a dataset of 138 DNA-binding proteins and 110 proteins which do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of previously published methods. Furthermore, when we tested 5 different methods on 11 new DBPs which did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA. PMID:19233205
Confronting the catalytic dark matter encoded by sequenced genomes
Ellens, Kenneth W.; Christian, Nils; Singh, Charandeep; Satagopam, Venkata P.
2017-01-01
Abstract The post-genomic era has provided researchers with a deluge of protein sequences. However, a significant fraction of the proteins encoded by sequenced genomes remains without an identified function. Here, we aim at determining how many enzymes of uncertain or unknown function are still present in the Saccharomyces cerevisiae and human proteomes. Using information available in the Swiss-Prot, BRENDA and KEGG databases in combination with a Hidden Markov Model-based method, we estimate that >600 yeast and 2000 human proteins (>30% of their proteins of unknown function) are enzymes whose precise function(s) remain(s) to be determined. This illustrates the impressive scale of the ‘unknown enzyme problem’. We extensively review classical biochemical as well as more recent systematic experimental and computational approaches that can be used to support enzyme function discovery research. Finally, we discuss the possible roles of the elusive catalysts in light of recent developments in the fields of enzymology and metabolism as well as the significance of the unknown enzyme problem in the context of metabolic modeling, metabolic engineering and rare disease research. PMID:29059321
Identification of DNA-binding proteins using structural, electrostatic and evolutionary features.
Nimrod, Guy; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir
2009-04-10
DNA-binding proteins (DBPs) participate in various crucial processes in the life-cycle of the cells, and the identification and characterization of these proteins is of great importance. We present here a random forests classifier for identifying DBPs among proteins with known 3D structures. First, clusters of evolutionarily conserved regions (patches) on the surface of proteins were detected using the PatchFinder algorithm; earlier studies showed that these regions are typically the functionally important regions of proteins. Next, we trained a classifier using features like the electrostatic potential, cluster-based amino acid conservation patterns and the secondary structure content of the patches, as well as features of the whole protein, including its dipole moment. Using 10-fold cross-validation on a dataset of 138 DBPs and 110 proteins that do not bind DNA, the classifier achieved a sensitivity and a specificity of 0.90, which is overall better than the performance of published methods. Furthermore, when we tested five different methods on 11 new DBPs that did not appear in the original dataset, only our method annotated all correctly. The resulting classifier was applied to a collection of 757 proteins of known structure and unknown function. Of these proteins, 218 were predicted to bind DNA, and we anticipate that some of them interact with DNA using new structural motifs. The use of complementary computational tools supports the notion that at least some of them do bind DNA.
The Biochemistry of O-GlcNAc Transferase: Which Functions Make It Essential in Mammalian Cells?
Levine, Zebulon G; Walker, Suzanne
2016-06-02
O-linked N-acetylglucosamine transferase (OGT) is found in all metazoans and plays an important role in development but at the single-cell level is only essential in dividing mammalian cells. Postmitotic mammalian cells and cells of invertebrates such as Caenorhabditis elegans and Drosophila can survive without copies of OGT. Why OGT is required in dividing mammalian cells but not in other cells remains unknown. OGT has multiple biochemical activities. Beyond its well-known role in adding β-O-GlcNAc to serine and threonine residues of nuclear and cytoplasmic proteins, OGT also acts as a protease in the maturation of the cell cycle regulator host cell factor 1 (HCF-1) and serves as an integral member of several protein complexes, many of them linked to gene expression. In this review, we summarize current understanding of the mechanisms underlying OGT's biochemical activities and address whether known functions of OGT could be related to its essential role in dividing mammalian cells.
Apel, William A.; Thompson, Vicki S; Lacey, Jeffrey A.; Gentillon, Cynthia A.
2016-08-09
A method for determining a plurality of proteins for discriminating and positively identifying an individual based from a biological sample. The method may include profiling a biological sample from a plurality of individuals against a protein array including a plurality of proteins. The protein array may include proteins attached to a support in a preselected pattern such that locations of the proteins are known. The biological sample may be contacted with the protein array such that a portion of antibodies in the biological sample reacts with and binds to the proteins forming immune complexes. A statistical analysis method, such as discriminant analysis, may be performed to determine discriminating proteins for distinguishing individuals. Proteins of interest may be used to form a protein array. Such a protein array may be used, for example, to compare a forensic sample from an unknown source with a sample from a known source.
Thompson, Vicki S; Lacey, Jeffrey A; Gentillon, Cynthia A; Apel, William A
2015-03-03
A method for determining a plurality of proteins for discriminating and positively identifying an individual based from a biological sample. The method may include profiling a biological sample from a plurality of individuals against a protein array including a plurality of proteins. The protein array may include proteins attached to a support in a preselected pattern such that locations of the proteins are known. The biological sample may be contacted with the protein array such that a portion of antibodies in the biological sample reacts with and binds to the proteins forming immune complexes. A statistical analysis method, such as discriminant analysis, may be performed to determine discriminating proteins for distinguishing individuals. Proteins of interest may be used to form a protein array. Such a protein array may be used, for example, to compare a forensic sample from an unknown source with a sample from a known source.
Rafii, Mohd Yusop; Maziah, Mahmood
2014-01-01
Separation of proteins based on the physicochemical properties with different molecular weight and isoelectric points would be more accurate. In the current research, the 45-day-old seedlings were treated with 0 (control) and 12 dS m−1 of sodium chloride in the hydroponic system. After 15 days of salt exposure, the total protein of the fresh leaves and roots was extracted and analyzed using two-dimensional electrophoresis system (2-DE). The analysis led to the detection of 32 induced proteins (19 proteins in leaf and 13 proteins in the root) as well as 12 upregulated proteins (four proteins in leaf and eight proteins in the root) in the salt-treated plants. Of the 44 detected proteins, 12 were sequenced, and three of them matched with superoxide dismutase, ascorbate peroxidase and ribulose-1, 5-bisphosphate oxygenase whereas the rest remained unknown. The three known proteins associate with plants response to environmental stresses and could represent the general stress proteins in the present study too. In addition, the proteomic feedback of different accessions of A. paniculata to salt stress can potentially be used to breed salt-tolerant varieties of the herb. PMID:25423252
Gupta, Sayan; Feng, Jun; Chance, Mark; Ralston, Corie
2016-01-01
Synchrotron X-ray Footprinting is a powerful in situ hydroxyl radical labeling method for analysis of protein structure, interactions, folding and conformation change in solution. In this method, water is ionized by high flux density broad band synchrotron X-rays to produce a steady-state concentration of hydroxyl radicals, which then react with solvent accessible side-chains. The resulting stable modification products are analyzed by liquid chromatography coupled to mass spectrometry. A comparative reactivity rate between known and unknown states of a protein provides local as well as global information on structural changes, which is then used to develop structural models for protein function and dynamics. In this review we describe the XF-MS method, its unique capabilities and its recent technical advances at the Advanced Light Source. We provide a comparison of other hydroxyl radical and mass spectrometry based methods with XFMS. We also discuss some of the latest developments in its usage for studying bound water, transmembrane proteins and photosynthetic protein components, and the synergy of the method with other synchrotron based structural biology methods.
Fast vesicle transport is required for the slow axonal transport of synapsin.
Tang, Yong; Scott, David; Das, Utpal; Gitler, Daniel; Ganguly, Archan; Roy, Subhojit
2013-09-25
Although it is known that cytosolic/soluble proteins synthesized in cell bodies are transported at much lower overall velocities than vesicles in fast axonal transport, the fundamental basis for this slow movement is unknown. Recently, we found that cytosolic proteins in axons of mouse cultured neurons are conveyed in a manner that superficially resembles diffusion, but with a slow anterograde bias that is energy- and motor-dependent (Scott et al., 2011). Here we show that slow axonal transport of synapsin, a prototypical member of this rate class, is dependent upon fast vesicle transport. Despite the distinct overall dynamics of slow and fast transport, experimentally induced and intrinsic variations in vesicle transport have analogous effects on slow transport of synapsin as well. Dynamic cotransport of vesicles and synapsin particles is also seen in axons, consistent with a model where higher-order assemblies of synapsin are conveyed by transient and probabilistic associations with vesicles moving in fast axonal transport. We posit that such dynamic associations generate the slow overall anterogradely biased flow of the population ("dynamic-recruitment model"). Our studies uncover the underlying kinetic basis for a classic cytosolic/soluble protein moving in slow axonal transport and reveal previously unknown links between slow and fast transport, offering a clearer conceptual picture of this curious phenomenon.
Large-scale structure prediction by improved contact predictions and model quality assessment.
Michel, Mirco; Menéndez Hurtado, David; Uziela, Karolis; Elofsson, Arne
2017-07-15
Accurate contact predictions can be used for predicting the structure of proteins. Until recently these methods were limited to very big protein families, decreasing their utility. However, recent progress by combining direct coupling analysis with machine learning methods has made it possible to predict accurate contact maps for smaller families. To what extent these predictions can be used to produce accurate models of the families is not known. We present the PconsFold2 pipeline that uses contact predictions from PconsC3, the CONFOLD folding algorithm and model quality estimations to predict the structure of a protein. We show that the model quality estimation significantly increases the number of models that reliably can be identified. Finally, we apply PconsFold2 to 6379 Pfam families of unknown structure and find that PconsFold2 can, with an estimated 90% specificity, predict the structure of up to 558 Pfam families of unknown structure. Out of these, 415 have not been reported before. Datasets as well as models of all the 558 Pfam families are available at http://c3.pcons.net/ . All programs used here are freely available. arne@bioinfo.se. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Novel duck parvovirus identified in Cherry Valley ducks (Anas platyrhynchos domesticus), China.
Li, Chuanfeng; Li, Qi; Chen, Zongyan; Liu, Guangqing
2016-10-01
An unknown infectious disease in Cherry Valley ducks (Anas platyrhynchos domesticus) characterized by short beak and strong growth retardation occurred in China during 2015. The causative agent of this disease, tentatively named duck short beak and dwarfism syndrome (DSBDS), as well as the evolutionary relationships between this causative agent and all currently known avian-origin parvoviruses were clarified by virus isolation, transmission electron microscope (TEM) observation, analysis of nuclear acid type, (RT-)PCR identification, whole genome sequencing, and NS1 protein sequences-based phylogenetic analyses. The results indicated that the causative agent of DSBDS is closely related with the goose parvovirus-like virus, which is divergent from all currently known avian-origin parvoviruses and should be a novel duck parvovirus (NDPV). Copyright © 2016 Elsevier B.V. All rights reserved.
Identification of giant Mimivirus protein functions using RNA interference
Sobhy, Haitham; Scola, Bernard La; Pagnier, Isabelle; Raoult, Didier; Colson, Philippe
2015-01-01
Genomic analysis of giant viruses, such as Mimivirus, has revealed that more than half of the putative genes have no known functions (ORFans). We knocked down Mimivirus genes using short interfering RNA as a proof of concept to determine the functions of giant virus ORFans. As fibers are easy to observe, we targeted a gene encoding a protein absent in a Mimivirus mutant devoid of fibers as well as three genes encoding products identified in a protein concentrate of fibers, including one ORFan and one gene of unknown function. We found that knocking down these four genes was associated with depletion or modification of the fibers. Our strategy of silencing ORFan genes in giant viruses opens a way to identify its complete gene repertoire and may clarify the role of these genes, differentiating between junk DNA and truly used genes. Using this strategy, we were able to annotate four proteins in Mimivirus and 30 homologous proteins in other giant viruses. In addition, we were able to annotate >500 proteins from cellular organisms and 100 from metagenomic databases. PMID:25972846
Known knowns, known unknowns and unknown unknowns in prokaryotic transposition.
Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael
2017-08-01
Although the phenomenon of transposition has been known for over 60 years, its overarching importance in modifying and streamlining genomes took some time to recognize. In spite of a robust understanding of transposition of some TE, there remain a number of important TE groups with potential high genome impact and unknown transposition mechanisms and yet others, only recently identified by bioinformatics, yet to be formally confirmed as mobile. Here, we point to some areas of limited understanding concerning well established important TE groups with DDE Tpases, to address central gaps in our knowledge of characterised Tn with other types of Tpases and finally, to highlight new potentially mobile DNA species. It is not exhaustive. Examples have been chosen to provide encouragement in the continued exploration of the considerable prokaryotic mobilome especially in light of the current threat to public health posed by the spread of multiple Ab R . Copyright © 2017 Elsevier Ltd. All rights reserved.
Ben Daniel, Bat-Hen; Cattan, Esther; Wachtel, Chaim; Avrahami, Dorit; Glick, Yair; Malichy, Asaf; Gerber, Doron; Miller, Gad
2016-08-01
To appropriately acclimate to environmental stresses, plants have to rapidly activate a specific transcriptional program. Yet, the identity and function of many of the transcriptional regulators that mediate early responses to abiotic stress stimuli is still unknown. In this work we employed the promoter of the multi-stress-responsive zinc-finger protein Zat12 in yeast one-hybrid (Y1H) screens to identify early abiotic stress-responsive transcriptional regulators. Analysis of Zat12 promoter fragments fused to luciferase underlined an approximately 200 bp fragment responsive to NaCl and to reactive oxygen species (ROS). Using these segments and others as baits against Y1H control or stress Arabidopsis prey libraries, we identified 15 potential Zat12 transcriptional regulators. Among the prominent proteins identified were known transcription factors including bZIP29 and ANAC91 as well as unknown function proteins such as a homolog of the human USB1, a U6 small nuclear RNA (snRNA) processing protein, and dormancy/auxin-associated family protein 2 (DRM2). Altered expression of Zat12 during high light stress in the knockout mutants further indicated the involvement of these proteins in the regulation of Zat12. Using a state of the art microfluidic approach we showed that AtUSB1 and DRM2 can specifically bind dsDNA and were able to identify the preferred DNA-binding motif of all four proteins. Overall, the proteins identified in this work provide an important start point for charting the earliest signaling network of Zat12 and of other genes required for acclimation to abiotic stresses. © 2016 Scandinavian Plant Physiology Society.
Berjón-Otero, Mónica; Lechuga, Ana; Mehla, Jitender; Uetz, Peter; Salas, Margarita; Redrejo-Rodríguez, Modesto
2017-07-26
Tectiviridae comprises a group of tail-less, icosahedral, membrane-containing bacteriophages that can be divided into two groups by their hosts, either Gram-negative or Gram-positive bacteria. While the first group is composed of PRD1 and nearly identical well characterized lytic viruses, the second one includes more variable temperate phages, like GIL16 or Bam35, whose hosts are Bacillus cereus and related Gram-positive bacteria.In the genome of Bam35, nearly half of the 32 annotated open reading frames (ORFs) have no homologs in databases (ORFans), being putative proteins of unknown function, which hinders the understanding of their biology. With the aim of increasing the knowledge of the viral proteome, we carried out a comprehensive yeast two-hybrid analysis among all the putative proteins encoded by the Bam35 genome. The resulting protein interactome comprises 76 unique interactions among 24 proteins, of which 12 have an unknown function. These results suggested that the P17 protein is the minor capsid protein of Bam35 and P24 is the penton protein, being the latter also supported by iterative threading protein modeling. Moreover, the inner membrane transglycosylase protein P26 could have an additional structural role. We also detected interactions involving non-structural proteins, such as the DNA binding protein P1 and the genome terminal protein (P4), which was confirmed by co-immunoprecipitation of recombinant proteins. Altogether, our results provide a functional view of the Bam35 viral proteome, with a focus on the composition and organization of the viral particle. IMPORTANCE Tail-less viruses of the family Tectiviridae can infect commensal and pathogenic Gram-positive and Gram-negative bacteria. Moreover, they have been proposed to be at the evolutionary origin of several groups of large eukaryotic DNA viruses and self-replicating plasmids. However, due to their ancient origin and complex diversity, many tectiviral proteins are ORFans of unknown function.Comprehensive protein-protein interaction (PPI) analysis among viral proteins can eventually disclose biological mechanisms and thus provide new insights into protein function unattainable by studying proteins one by one. Here we comprehensively describe intraviral PPIs among tectivirus Bam35 proteins using multi-vector yeast two-hybrid screening that was further supported by co-immunoprecipitation assays and protein structural models. This approach allowed us to propose new functions for known proteins and hypothesize on the biological role localization within the viral particle of some viral ORFan proteins that will be helpful for understanding the biology of Gram-positive tectivirus. Copyright © 2017 American Society for Microbiology.
Berjón-Otero, Mónica; Lechuga, Ana; Mehla, Jitender; Uetz, Peter
2017-01-01
ABSTRACT The family Tectiviridae comprises a group of tailless, icosahedral, membrane-containing bacteriophages that can be divided into two groups by their hosts, either Gram-negative or Gram-positive bacteria. While the first group is composed of PRD1 and nearly identical well-characterized lytic viruses, the second one includes more variable temperate phages, like GIL16 or Bam35, whose hosts are Bacillus cereus and related Gram-positive bacteria. In the genome of Bam35, nearly half of the 32 annotated open reading frames (ORFs) have no homologs in databases (ORFans), being putative proteins of unknown function, which hinders the understanding of their biology. With the aim of increasing knowledge about the viral proteome, we carried out a comprehensive yeast two-hybrid analysis of all the putative proteins encoded by the Bam35 genome. The resulting protein interactome comprised 76 unique interactions among 24 proteins, of which 12 have an unknown function. These results suggest that the P17 protein is the minor capsid protein of Bam35 and P24 is the penton protein, with the latter finding also being supported by iterative threading protein modeling. Moreover, the inner membrane transglycosylase protein P26 could have an additional structural role. We also detected interactions involving nonstructural proteins, such as the DNA-binding protein P1 and the genome terminal protein (P4), which was confirmed by coimmunoprecipitation of recombinant proteins. Altogether, our results provide a functional view of the Bam35 viral proteome, with a focus on the composition and organization of the viral particle. IMPORTANCE Tailless viruses of the family Tectiviridae can infect commensal and pathogenic Gram-positive and Gram-negative bacteria. Moreover, they have been proposed to be at the evolutionary origin of several groups of large eukaryotic DNA viruses and self-replicating plasmids. However, due to their ancient origin and complex diversity, many tectiviral proteins are ORFans of unknown function. Comprehensive protein-protein interaction (PPI) analysis of viral proteins can eventually disclose biological mechanisms and thus provide new insights into protein function unattainable by studying proteins one by one. Here we comprehensively describe intraviral PPIs among tectivirus Bam35 proteins determined using multivector yeast two-hybrid screening, and these PPIs were further supported by the results of coimmunoprecipitation assays and protein structural models. This approach allowed us to propose new functions for known proteins and hypothesize about the biological role of the localization of some viral ORFan proteins within the viral particle that will be helpful for understanding the biology of tectiviruses infecting Gram-positive bacteria. PMID:28747494
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
A new family of β-helix proteins with similarities to the polysaccharide lyases
Close, Devin W.; D'Angelo, Sara; Bradbury, Andrew R. M.
2014-09-27
Microorganisms that degrade biomass produce diverse assortments of carbohydrate-active enzymes and binding modules. Despite tremendous advances in the genomic sequencing of these organisms, many genes do not have an ascribed function owing to low sequence identity to genes that have been annotated. Consequently, biochemical and structural characterization of genes with unknown function is required to complement the rapidly growing pool of genomic sequencing data. A protein with previously unknown function (Cthe_2159) was recently isolated in a genome-wide screen using phage display to identify cellulose-binding protein domains from the biomass-degrading bacterium Clostridium thermocellum. Here, the crystal structure of Cthe_2159 is presentedmore » and it is shown that it is a unique right-handed parallel β-helix protein. Despite very low sequence identity to known β-helix or carbohydrate-active proteins, Cthe_2159 displays structural features that are very similar to those of polysaccharide lyase (PL) families 1, 3, 6 and 9. Cthe_2159 is conserved across bacteria and some archaea and is a member of the domain of unknown function family DUF4353. This suggests that Cthe_2159 is the first representative of a previously unknown family of cellulose and/or acid-sugar binding β-helix proteins that share structural similarities with PLs. More importantly, these results demonstrate how functional annotation by biochemical and structural analysis remains a critical tool in the characterization of new gene products.« less
A new family of β-helix proteins with similarities to the polysaccharide lyases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Close, Devin W.; D'Angelo, Sara; Bradbury, Andrew R. M.
Microorganisms that degrade biomass produce diverse assortments of carbohydrate-active enzymes and binding modules. Despite tremendous advances in the genomic sequencing of these organisms, many genes do not have an ascribed function owing to low sequence identity to genes that have been annotated. Consequently, biochemical and structural characterization of genes with unknown function is required to complement the rapidly growing pool of genomic sequencing data. A protein with previously unknown function (Cthe_2159) was recently isolated in a genome-wide screen using phage display to identify cellulose-binding protein domains from the biomass-degrading bacterium Clostridium thermocellum. Here, the crystal structure of Cthe_2159 is presentedmore » and it is shown that it is a unique right-handed parallel β-helix protein. Despite very low sequence identity to known β-helix or carbohydrate-active proteins, Cthe_2159 displays structural features that are very similar to those of polysaccharide lyase (PL) families 1, 3, 6 and 9. Cthe_2159 is conserved across bacteria and some archaea and is a member of the domain of unknown function family DUF4353. This suggests that Cthe_2159 is the first representative of a previously unknown family of cellulose and/or acid-sugar binding β-helix proteins that share structural similarities with PLs. More importantly, these results demonstrate how functional annotation by biochemical and structural analysis remains a critical tool in the characterization of new gene products.« less
Aihara, Masamune; Yamamoto, Shigeru; Nishioka, Hiroko; Inoue, Yutaro; Hamano, Kimikazu; Oka, Masaaki; Mizukami, Yoichi
2012-06-15
G protein-coupled receptor 30/G protein estrogen receptor-1 (GPR30/GPER-1) is a novel membrane receptor for estrogen whose mRNA is expressed at high levels in estrogen-dependent cells such as breast cancer cell lines. However, mutations in GRP30 related to diseases remain unreported. To detect unknown mutations in the GPR30 open reading frame (ORF) quickly, the experimental conditions for high-resolution melting (HRM) analysis were examined for PCR primers, Taq polymerases, saturation DNA binding dyes, Mg(2+) concentration, and normalized temperatures. Nine known SNPs and 13 artificial point mutations within the GPR30 ORF, as well as single nucleotide variants in DNA extracted from subjects with breast cancers were tested under the optimal experimental conditions. The combination of Expand High Fidelity(PLUS) and SYTO9 in the presence of 2.0 mM MgCl(2) produced the best separation in melting curves of mutations in all regions of the GPR30 ORF. Under these experimental conditions, the mutations were clearly detected in both heterozygotes and homozygotes. HRM analysis of GPR30 using genomic DNA from subjects with breast cancers showed a novel single nucleotide variant, 111C>T in GPR30 and 4 known SNPs. The experimental conditions determined in this study for HRM analysis are useful for high throughput assays to detect unknown mutations within the GPR30 ORF. Copyright © 2012 Elsevier B.V. All rights reserved.
Life without double-headed non-muscle myosin II motor proteins
Betapudi, Venkaiah
2014-01-01
Non-muscle myosin II motor proteins (myosin IIA, myosin IIB, and myosin IIC) belong to a class of molecular motor proteins that are known to transduce cellular free-energy into biological work more efficiently than man-made combustion engines. Nature has given a single myosin II motor protein for lower eukaryotes and multiple for mammals but none for plants in order to provide impetus for their life. These specialized nanomachines drive cellular activities necessary for embryogenesis, organogenesis, and immunity. However, these multifunctional myosin II motor proteins are believed to go awry due to unknown reasons and contribute for the onset and progression of many autosomal-dominant disorders, cataract, deafness, infertility, cancer, kidney, neuronal, and inflammatory diseases. Many pathogens like HIV, Dengue, hepatitis C, and Lymphoma viruses as well as Salmonella and Mycobacteria are now known to take hostage of these dedicated myosin II motor proteins for their efficient pathogenesis. Even after four decades since their discovery, we still have a limited knowledge of how these motor proteins drive cell migration and cytokinesis. We need to enrich our current knowledge on these fundamental cellular processes and develop novel therapeutic strategies to fix mutated myosin II motor proteins in pathological conditions. This is the time to think how to relieve the hijacked myosins from pathogens in order to provide a renewed impetus for patients' life. Understanding how to steer these molecular motors in proliferating and differentiating stem cells will improve stem cell based-therapeutics development. Given the plethora of cellular activities non-muscle myosin motor proteins are involved in, their importance is apparent for human life. PMID:25072053
Life without double-headed non-muscle myosin II motor proteins
NASA Astrophysics Data System (ADS)
Betapudi, Venkaiah
2014-07-01
Non-muscle myosin II motor proteins (myosin IIA, myosin IIB, and myosin IIC) belong to a class of molecular motor proteins that are known to transduce cellular free-energy into biological work more efficiently than man-made combustion engines. Nature has given a single myosin II motor protein for lower eukaryotes and multiple for mammals but none for plants in order to provide impetus for their life. These specialized nanomachines drive cellular activities necessary for embryogenesis, organogenesis, and immunity. However, these multifunctional myosin II motor proteins are believed to go awry due to unknown reasons and contribute for the onset and progression of many autosomal-dominant disorders, cataract, deafness, infertility, cancer, kidney, neuronal, and inflammatory diseases. Many pathogens like HIV, Dengue, hepatitis C, and Lymphoma viruses as well as Salmonella and Mycobacteria are now known to take hostage of these dedicated myosin II motor proteins for their efficient pathogenesis. Even after four decades since their discovery, we still have a limited knowledge of how these motor proteins drive cell migration and cytokinesis. We need to enrich our current knowledge on these fundamental cellular processes and develop novel therapeutic strategies to fix mutated myosin II motor proteins in pathological conditions. This is the time to think how to relieve the hijacked myosins from pathogens in order to provide a renewed impetus for patients’ life. Understanding how to steer these molecular motors in proliferating and differentiating stem cells will improve stem cell based-therapeutics development. Given the plethora of cellular activities non-muscle myosin motor proteins are involved in, their importance is apparent for human life.
A chemical proteomics approach for global analysis of lysine monomethylome profiling.
Wu, Zhixiang; Cheng, Zhongyi; Sun, Mingwei; Wan, Xuelian; Liu, Ping; He, Tieming; Tan, Minjia; Zhao, Yingming
2015-02-01
Methylation of lysine residues on histone proteins is known to play an important role in chromatin structure and function. However, non-histone protein substrates of this modification remain largely unknown. An effective approach for system-wide analysis of protein lysine methylation, particularly lysine monomethylation, is lacking. Here we describe a chemical proteomics approach for global screening for monomethyllysine substrates, involving chemical propionylation of monomethylated lysine, affinity enrichment of the modified monomethylated peptides, and HPLC/MS/MS analysis. Using this approach, we identified with high confidence 446 lysine monomethylation sites in 398 proteins, including three previously unknown histone monomethylation marks, representing the largest data set of protein lysine monomethylation described to date. Our data not only confirms previously discovered lysine methylation substrates in the nucleus and spliceosome, but also reveals new substrates associated with diverse biological processes. This method hence offers a powerful approach for dynamic study of protein lysine monomethylation under diverse cellular conditions and in human diseases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Li de La Sierra-Gallay, Ines; Collinet, Bruno; Graille, Marc; Quevillon-Cheruel, Sophie; Liger, Dominique; Minard, Philippe; Blondeau, Karine; Henckes, Gilles; Aufrère, Robert; Leulliot, Nicolas; Zhou, Cong-Zhao; Sorel, Isabelle; Ferrer, Jean-Luc; Poupon, Anne; Janin, Joël; van Tilbeurgh, Herman
2004-03-01
The protein product of the YGR205w gene of Saccharomyces cerevisiae was targeted as part of our yeast structural genomics project. YGR205w codes for a small (290 amino acids) protein with unknown structure and function. The only recognizable sequence feature is the presence of a Walker A motif (P loop) indicating a possible nucleotide binding/converting function. We determined the three-dimensional crystal structure of Se-methionine substituted protein using multiple anomalous diffraction. The structure revealed a well known mononucleotide fold and strong resemblance to the structure of small metabolite phosphorylating enzymes such as pantothenate and phosphoribulo kinase. Biochemical experiments show that YGR205w binds specifically ATP and, less tightly, ADP. The structure also revealed the presence of two bound sulphate ions, occupying opposite niches in a canyon that corresponds to the active site of the protein. One sulphate is bound to the P-loop in a position that corresponds to the position of beta-phosphate in mononucleotide protein ATP complex, suggesting the protein is indeed a kinase. The nature of the phosphate accepting substrate remains to be determined. Copyright 2004 Wiley-Liss, Inc.
Characterization of known protein complexes using k-connectivity and other topological measures
Gallagher, Suzanne R; Goldberg, Debra S
2015-01-01
Many protein complexes are densely packed, so proteins within complexes often interact with several other proteins in the complex. Steric constraints prevent most proteins from simultaneously binding more than a handful of other proteins, regardless of the number of proteins in the complex. Because of this, as complex size increases, several measures of the complex decrease within protein-protein interaction networks. However, k-connectivity, the number of vertices or edges that need to be removed in order to disconnect a graph, may be consistently high for protein complexes. The property of k-connectivity has been little used previously in the investigation of protein-protein interactions. To understand the discriminative power of k-connectivity and other topological measures for identifying unknown protein complexes, we characterized these properties in known Saccharomyces cerevisiae protein complexes in networks generated both from highly accurate X-ray crystallography experiments which give an accurate model of each complex, and also as the complexes appear in high-throughput yeast 2-hybrid studies in which new complexes may be discovered. We also computed these properties for appropriate random subgraphs.We found that clustering coefficient, mutual clustering coefficient, and k-connectivity are better indicators of known protein complexes than edge density, degree, or betweenness. This suggests new directions for future protein complex-finding algorithms. PMID:26913183
2004-01-01
Manganese is an essential, but potentially toxic, trace metal in biological systems. Overexposure to manganese is known to cause neurological deficits in humans, but the pathways that lead to manganese toxicity are largely unknown. We have employed the bakers' yeast Saccharomyces cerevisiae as a model system to identify genes that contribute to manganese-related damage. In a genetic screen for yeast manganese-resistance mutants, we identified S. cerevisiae MAM3 as a gene which, when deleted, would increase cellular tolerance to toxic levels of manganese and also increased the cell's resistance towards cobalt and zinc. By sequence analysis, Mam3p shares strong similarity with the mammalian ACDP (ancient conserved domain protein) family of polypeptides. Mutations in human ACDP1 have been associated with urofacial (Ochoa) syndrome. However, the functions of eukaryotic ACDPs remain unknown. We show here that S. cerevisiae MAM3 encodes an integral membrane protein of the yeast vacuole whose expression levels directly correlate with the degree of manganese toxicity. Surprisingly, Mam3p contributes to manganese toxicity without any obvious changes in vacuolar accumulation of metals. Furthermore, through genetic epistasis studies, we demonstrate that MAM3 operates independently of the well-established manganese-trafficking pathways in yeast, involving the manganese transporters Pmr1p, Smf2p and Pho84p. This is the first report of a eukaryotic ACDP family protein involved in metal homoeostasis. PMID:15498024
New TFII-I family target genes involved in embryonic development.
Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg
2009-09-04
Two members of the TFII-I family transcription factor genes, GTF2I and GTF2IRD1, are the prime candidates responsible for the craniofacial and cognitive abnormalities of Williams syndrome patients. We have previously generated mouse lines with targeted disruption of Gtf2i and Gtf2ird1. Microarray analysis revealed significant changes in the expression profile of mutant embryos. Here we described three unknown genes that were dramatically down-regulated in mutants. The 2410018M08Rik/Scand3 gene encodes a protein of unknown function with CHCH and hATC domains. Scand3 is down-regulated during mouse embryonic stem cell (ES) differentiation. 4933436H12Rik is a testis-specific gene, which encodes a protein with no known domains. It is expressed in mouse ES cells. 1110008P08Rik/Kbtbd7 encodes an adapter protein with BTB/POZ, BACK, and Kelch motifs, previously shown to recruit substrates to the enzymatic complexes of the histone modifying or E3 ubiquitin ligase activities. Based on its expression pattern Kbtbd7 may have a specific role in brain development and function. All three genes possess well-conserved TFII-I-binding consensus sites within proximal promoters. Therefore our analysis suggests that these genes can be direct targets of TFII-I proteins and their impaired expression, as a result of the GTF2I and GTF2IRD1 haploinsufficiency, could contribute to the etiology of Williams syndrome.
Ginseng saponins and the treatment of osteoporosis: mini literature review
Siddiqi, Muhammad Hanif; Siddiqi, Muhammad Zubair; Ahn, Sungeun; Kang, Sera; Kim, Yeon-Ju; Sathishkumar, Natarajan; Yang, Dong-Uk; Yang, Deok-Chun
2013-01-01
The ginseng plant (Panax ginseng Meyer) has a large number of active ingredients including steroidal saponins with a dammarane skeleton as well as protopanaxadiol and protopanaxatriol, commonly known as ginsenosides, which have antioxidant, anticancer, antidiabetic, anti-adipocyte, and sexual enhancing effects. Though several discoveries have demonstrated that ginseng saponins (ginsenosides) as the most important therapeutic agent for the treatment of osteoporosis, yet the molecular mechanism of its active metabolites is unknown. In this review, we summarize the evidence supporting the therapeutic properties of ginsenosides both in vivo and in vitro, with an emphasis on the different molecular agents comprising receptor activator of nuclear factor kappa-B ligand, receptor activator of nuclear factor kappa-B, and matrix metallopeptidase-9, as well as the bone morphogenetic protein-2 and Smad signaling pathways. PMID:24198650
Requirement of GM2 ganglioside activator for phospholipase D activation
Nakamura, Shun-ichi; Akisue, Toshihiro; Jinnai, Hitoshi; Hitomi, Tomohiro; Sarkar, Sukumar; Miwa, Noriko; Okada, Taro; Yoshida, Kimihisa; Kuroda, Shun’ichi; Kikkawa, Ushio; Nishizuka, Yasutomi
1998-01-01
Sequence analysis of a heat-stable protein necessary for the activation of ADP ribosylation factor-dependent phospholipase D (PLD) reveals that this protein has a structure highly homologous to the previously known GM2 ganglioside activator whose deficiency results in the AB-variant of GM2 gangliosidosis. The heat-stable activator protein indeed has the capacity to enhance enzymatic conversion of GM2 to GM3 ganglioside that is catalyzed by β-hexosaminidase A. Inversely, GM2 ganglioside activator purified separately from tissues as described earlier [Conzelmann, E. & Sandhoff, K. (1987) Methods Enzymol. 138, 792–815] stimulates ADP ribosylation factor-dependent PLD in a dose-dependent manner. At higher concentrations of ammonium sulfate, the PLD activator protein apparently substitutes for protein kinase C and phosphatidylinositol 4,5-bisphosphate, both of which are known as effective stimulators of the PLD reaction. The mechanism of action of the heat-stable PLD activator protein remains unknown. PMID:9770472
NASA Astrophysics Data System (ADS)
Kitova, Elena N.; El-Hawiet, Amr; Klassen, John S.
2014-08-01
A semiquantitative electrospray ionization mass spectrometry (ESI-MS) binding assay suitable for analyzing mixtures of oligosaccharides, at unknown concentrations, for interactions with target proteins is described. The assay relies on the differences in the ratio of the relative abundances of the ligand-bound and free protein ions measured by ESI-MS at two or more initial protein concentrations to distinguish low affinity (≤103 M-1) ligands from moderate and high affinity (>105 M-1) ligands present in the library and to rank their affinities. Control experiments were performed on solutions of a single chain antibody and a mixture of synthetic oligosaccharides, with known affinities, in the absence and presence of a 40-component carbohydrate library to demonstrate the implementation and reliability of the assay. The application of the assay for screening natural libraries of carbohydrates against proteins is also demonstrated using mixtures of human milk oligosaccharides, isolated from breast milk, and fragments of a bacterial toxin and human galectin 3.
2014-01-01
Background Bacteroides spp. form a significant part of our gut microbiome and are well known for optimized metabolism of diverse polysaccharides. Initial analysis of the archetypal Bacteroides thetaiotaomicron genome identified 172 glycosyl hydrolases and a large number of uncharacterized proteins associated with polysaccharide metabolism. Results BT_1012 from Bacteroides thetaiotaomicron VPI-5482 is a protein of unknown function and a member of a large protein family consisting entirely of uncharacterized proteins. Initial sequence analysis predicted that this protein has two domains, one on the N- and one on the C-terminal. A PSI-BLAST search found over 150 full length and over 90 half size homologs consisting only of the N-terminal domain. The experimentally determined three-dimensional structure of the BT_1012 protein confirms its two-domain architecture and structural analysis of both domains suggests their specific functions. The N-terminal domain is a putative catalytic domain with significant similarity to known glycoside hydrolases, the C-terminal domain has a beta-sandwich fold typically found in C-terminal domains of other glycosyl hydrolases, however these domains are typically involved in substrate binding. We describe the structure of the BT_1012 protein and discuss its sequence-structure relationship and their possible functional implications. Conclusions Structural and sequence analyses of the BT_1012 protein identifies it as a glycosyl hydrolase, expanding an already impressive catalog of enzymes involved in polysaccharide metabolism in Bacteroides spp. Based on this we have renamed the Pfam families representing the two domains found in the BT_1012 protein, PF13204 and PF12904, as putative glycoside hydrolase and glycoside hydrolase-associated C-terminal domain respectively. PMID:24742328
Kuriakose, Teneema; Man, Si Ming; Malireddi, R.K. Subbarao; Karki, Rajendra; Kesavardhana, Sannula; Place, David E.; Neale, Geoffrey; Vogel, Peter; Kanneganti, Thirumala-Devi
2016-01-01
The interferon-inducible protein Z-DNA binding protein 1 (ZBP1, also known as DNA-dependent activator of IFN-regulatory factors (DAI) and DLM-1) was identified as a dsDNA sensor, which instigates innate immune responses. However, this classification has been disputed and whether ZBP1 functions as a pathogen sensor during an infection has remained unknown. Herein, we demonstrated ZBP1-mediated sensing of the influenza A virus (IAV) proteins NP and PB1, triggering cell death and inflammatory responses via the RIPK1–RIPK3–Caspase-8 axis. ZBP1 regulates NLRP3 inflammasome activation as well as induction of apoptosis, necroptosis and pyroptosis in IAV-infected cells. Importantly, ZBP1 deficiency protected mice from mortality during IAV infection owing to reduced inflammatory responses and epithelial damage. Overall, these findings indicate that ZBP1 is an innate immune sensor of IAV and highlight its importance in the pathogenesis of IAV infection. PMID:27917412
Combined copper/zinc attachment to prion protein
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Bernholc, Jerry
2013-03-01
Misfolding of prion protein (PrP) is responsible for diseases such as ``mad-cow disease'' in cattle and Creutzfeldt-Jacob in humans. Extensive experimental investigation has established that this protein strongly interacts with copper ions, and this ability has been linked to its still unknown function. Attachment of other metal ions (zinc, iron, manganese) have been demonstrated as well, but none of them could outcompete copper. Recent finding, however, indicates that at intermediate concentrations both copper and zinc ions can attach to the PrP at the octarepeat region, which contains high affinity metal binding sites. Based on this evidence, we have performed density functional theory simulations to investigate the combined Cu/Zn attachment. We consider all previously reported binding modes of copper at the octarepeat region and examine a possibility simultaneous Cu/Zn attachment. We find that this can indeed occur for only one of the known binding sites, when copper changes its coordination mode to allow for attachment of zinc ion. The implications of the simultaneous attachment on neural function remain to be explored.
Shedding new light on opsin evolution
Porter, Megan L.; Blasic, Joseph R.; Bok, Michael J.; Cameron, Evan G.; Pringle, Thomas; Cronin, Thomas W.; Robinson, Phyllis R.
2012-01-01
Opsin proteins are essential molecules in mediating the ability of animals to detect and use light for diverse biological functions. Therefore, understanding the evolutionary history of opsins is key to understanding the evolution of light detection and photoreception in animals. As genomic data have appeared and rapidly expanded in quantity, it has become possible to analyse opsins that functionally and histologically are less well characterized, and thus to examine opsin evolution strictly from a genetic perspective. We have incorporated these new data into a large-scale, genome-based analysis of opsin evolution. We use an extensive phylogeny of currently known opsin sequence diversity as a foundation for examining the evolutionary distributions of key functional features within the opsin clade. This new analysis illustrates the lability of opsin protein-expression patterns, site-specific functionality (i.e. counterion position) and G-protein binding interactions. Further, it demonstrates the limitations of current model organisms, and highlights the need for further characterization of many of the opsin sequence groups with unknown function. PMID:22012981
CD34 Antigen: Determination of Specific Sites of Phosphorylation In Vitro and In Vivo¶
Deterding, Leesa J.; Williams, Jason G.; Humble, Margaret M.; Petrovich, Robert M.; Wei, Sung-Jen; Trempus, Carol S.; Gates, Matthew B.; Zhu, Feng; Smart, Robert C.; Tennant, Raymond W.; Tomer, Kenneth B.
2010-01-01
CD34, a type I transmembrane glycoprotein, is a surface antigen which is expressed on several cell types, including hematopoietic progenitors, endothelial cells, as well as mast cells. Recently, CD34 has been described as a marker for epidermal stem cells in mouse hair follicles, and is expressed in outer root sheath cells of the human hair follicle. Although the biological function and regulation of CD34 is not well understood, it is thought to be involved in cell adhesion as well as possibly having a role in signal transduction. In addition, CD34 was shown to be critical for skin tumor development in mice, although the exact mechanism remains unknown. Many proteins' functions and biological activities are regulated through post-translational modifications. The extracellular domain of CD34 is heavily glycosylated but the role of these glycans in CD34 function is unknown. Additionally, two sites of tyrosine phosphorylation have been reported on human CD34 and it is known that CD34 is phosphorylated, at least in part, by protein kinase C; however, the precise location of the sites of phosphorylation has not been reported. In an effort to identify specific phosphorylation sites in CD34 and delineate the possible role of protein kinase C, we undertook the identification of the in vitro sites of phosphorylation on the intracellular domain of mouse CD34 (aa 309–382) following PKC treatment. For this work, we are using a combination of enzymatic proteolysis and peptide sequencing by mass spectrometry. After which the in vivo sites of phosphorylation of full-length mouse CD34 expressed from HEK293F cells were determined. The observed in vivo sites of phosphorylation, however, are not consensus PKC sites, but our data indicate that one of these sites may possibly be phosphorylated by AKT2. These results suggest that other kinases, as well as PKC, may have important signaling functions in CD34. PMID:21499536
Hanson, Andrew D; Pribat, Anne; Waller, Jeffrey C; de Crécy-Lagard, Valérie
2009-12-14
Like other forms of engineering, metabolic engineering requires knowledge of the components (the 'parts list') of the target system. Lack of such knowledge impairs both rational engineering design and diagnosis of the reasons for failures; it also poses problems for the related field of metabolic reconstruction, which uses a cell's parts list to recreate its metabolic activities in silico. Despite spectacular progress in genome sequencing, the parts lists for most organisms that we seek to manipulate remain highly incomplete, due to the dual problem of 'unknown' proteins and 'orphan' enzymes. The former are all the proteins deduced from genome sequence that have no known function, and the latter are all the enzymes described in the literature (and often catalogued in the EC database) for which no corresponding gene has been reported. Unknown proteins constitute up to about half of the proteins in prokaryotic genomes, and much more than this in higher plants and animals. Orphan enzymes make up more than a third of the EC database. Attacking the 'missing parts list' problem is accordingly one of the great challenges for post-genomic biology, and a tremendous opportunity to discover new facets of life's machinery. Success will require a co-ordinated community-wide attack, sustained over years. In this attack, comparative genomics is probably the single most effective strategy, for it can reliably predict functions for unknown proteins and genes for orphan enzymes. Furthermore, it is cost-efficient and increasingly straightforward to deploy owing to a proliferation of databases and associated tools.
Computational intelligence techniques for biological data mining: An overview
NASA Astrophysics Data System (ADS)
Faye, Ibrahima; Iqbal, Muhammad Javed; Said, Abas Md; Samir, Brahim Belhaouari
2014-10-01
Computational techniques have been successfully utilized for a highly accurate analysis and modeling of multifaceted and raw biological data gathered from various genome sequencing projects. These techniques are proving much more effective to overcome the limitations of the traditional in-vitro experiments on the constantly increasing sequence data. However, most critical problems that caught the attention of the researchers may include, but not limited to these: accurate structure and function prediction of unknown proteins, protein subcellular localization prediction, finding protein-protein interactions, protein fold recognition, analysis of microarray gene expression data, etc. To solve these problems, various classification and clustering techniques using machine learning have been extensively used in the published literature. These techniques include neural network algorithms, genetic algorithms, fuzzy ARTMAP, K-Means, K-NN, SVM, Rough set classifiers, decision tree and HMM based algorithms. Major difficulties in applying the above algorithms include the limitations found in the previous feature encoding and selection methods while extracting the best features, increasing classification accuracy and decreasing the running time overheads of the learning algorithms. The application of this research would be potentially useful in the drug design and in the diagnosis of some diseases. This paper presents a concise overview of the well-known protein classification techniques.
Hunting for low abundant redox proteins in plant plasma membranes.
Lüthje, Sabine; Hopff, David; Schmitt, Anna; Meisrimler, Claudia-Nicole; Menckhoff, Ljiljana
2009-04-13
Nowadays electron transport (redox) systems in plasma membranes appear well established. Members of the flavocytochrome b family have been identified by their nucleotide acid sequences and characterized on the transcriptional level. For their gene products functions have been demonstrated in iron uptake and oxidative stress including biotic interactions, abiotic stress factors and plant development. In addition, NAD(P)H-dependent oxidoreductases and b-type cytochromes have been purified and characterized from plasma membranes. Several of these proteins seem to belong to the group of hypothetical or unknown proteins. Low abundance and the lack of amino acid sequence data for these proteins still hamper their functional analysis. Consequently, little is known about the physiological function and regulation of these enzymes. In recent years evidence has been presented for the existence of microdomains (so-called lipid rafts) in plasma membranes and their interaction with specific membrane proteins. The identification of redox systems in detergent insoluble membranes supports the idea that redox systems may have important functions in signal transduction, stress responses, cell wall metabolism, and transport processes. This review summarizes our present knowledge on plasma membrane redox proteins and discusses alternative strategies to investigate the function and regulation of these enzymes.
Schmidt, Ulrike G.; Endler, Anne; Schelbert, Silvia; Brunner, Arco; Schnell, Magali; Neuhaus, H. Ekkehard; Marty-Mazars, Daniéle; Marty, Francis; Baginsky, Sacha; Martinoia, Enrico
2007-01-01
Young meristematic plant cells contain a large number of small vacuoles, while the largest part of the vacuome in mature cells is composed by a large central vacuole, occupying 80% to 90% of the cell volume. Thus far, only a limited number of vacuolar membrane proteins have been identified and characterized. The proteomic approach is a powerful tool to identify new vacuolar membrane proteins. To analyze vacuoles from growing tissues we isolated vacuoles from cauliflower (Brassica oleracea) buds, which are constituted by a large amount of small cells but also contain cells in expansion as well as fully expanded cells. Here we show that using purified cauliflower vacuoles and different extraction procedures such as saline, NaOH, acetone, and chloroform/methanol and analyzing the data against the Arabidopsis (Arabidopsis thaliana) database 102 cauliflower integral proteins and 214 peripheral proteins could be identified. The vacuolar pyrophosphatase was the most prominent protein. From the 102 identified proteins 45 proteins were already described. Nine of these, corresponding to 46% of peptides detected, are known vacuolar proteins. We identified 57 proteins (55.9%) containing at least one membrane spanning domain with unknown subcellular localization. A comparison of the newly identified proteins with expression profiles from in silico data revealed that most of them are highly expressed in young, developing tissues. To verify whether the newly identified proteins were indeed localized in the vacuole we constructed and expressed green fluorescence protein fusion proteins for five putative vacuolar membrane proteins exhibiting three to 11 transmembrane domains. Four of them, a putative organic cation transporter, a nodulin N21 family protein, a membrane protein of unknown function, and a senescence related membrane protein were localized in the vacuolar membrane, while a white-brown ATP-binding cassette transporter homolog was shown to reside in the plasma membrane. These results demonstrate that proteomic analysis of highly purified vacuoles from specific tissues allows the identification of new vacuolar proteins and provides an additional view of tonoplastic proteins. PMID:17660356
Lemonnier, Loic; Shapovalov, George; Gordienko, Dmitri; Poux, Céline; Bernardini, Michela; Bokhobza, Alexandre; Bidaux, Gabriel; Degerny, Cindy; Verreman, Kathye; Guarmit, Basma; Benahmed, Mohamed; de Launoit, Yvan; Bindels, Rene J.M.; Pla, Alessandra Fiorio; Prevarskaya, Natalia
2015-01-01
TRPM8 is a cold sensor that is highly expressed in the prostate as well as in other non-temperature-sensing organs, and is regulated by downstream receptor–activated signaling pathways. However, little is known about the intracellular proteins necessary for channel function. Here, we identify two previously unknown proteins, which we have named “TRP channel–associated factors” (TCAFs), as new TRPM8 partner proteins, and we demonstrate that they are necessary for channel function. TCAF1 and TCAF2 both bind to the TRPM8 channel and promote its trafficking to the cell surface. However, they exert opposing effects on TRPM8 gating properties. Functional interaction of TCAF1/TRPM8 also leads to a reduction in both the speed and directionality of migration of prostate cancer cells, which is consistent with an observed loss of expression of TCAF1 in metastatic human specimens, whereas TCAF2 promotes migration. The identification of TCAFs introduces a novel mechanism for modulation of TRPM8 channel activity. PMID:25559186
VapD in Xylella fastidiosa Is a Thermostable Protein with Ribonuclease Activity.
Mendes, Juliano S; Santiago, André da S; Toledo, Marcelo A S; Rosselli-Murai, Luciana K; Favaro, Marianna T P; Santos, Clelton A; Horta, Maria Augusta C; Crucello, Aline; Beloti, Lilian L; Romero, Fabian; Tasic, Ljubica; de Souza, Alessandra A; de Souza, Anete P
2015-01-01
Xylella fastidiosa strain 9a5c is a gram-negative phytopathogen that is the causal agent of citrus variegated chlorosis (CVC), a disease that is responsible for economic losses in Brazilian agriculture. The most well-known mechanism of pathogenicity for this bacterial pathogen is xylem vessel occlusion, which results from bacterial movement and the formation of biofilms. The molecular mechanisms underlying the virulence caused by biofilm formation are unknown. Here, we provide evidence showing that virulence-associated protein D in X. fastidiosa (Xf-VapD) is a thermostable protein with ribonuclease activity. Moreover, protein expression analyses in two X. fastidiosa strains, including virulent (Xf9a5c) and nonpathogenic (XfJ1a12) strains, showed that Xf-VapD was expressed during all phases of development in both strains and that increased expression was observed in Xf9a5c during biofilm growth. This study is an important step toward characterizing and improving our understanding of the biological significance of Xf-VapD and its potential functions in the CVC pathosystem.
Ramani, Subha; Könings, Karen; Mann, Karen V; van der Vleuten, Cees
2017-10-01
Self-assessment and reflection are essential for meaningful feedback. We aimed to explore whether the well-known Johari window model of self-awareness could guide feedback conversations between faculty and residents and enhance the institutional feedback culture. We had previously explored perceptions of residents and faculty regarding sociocultural factors impacting feedback. We re-analyzed data targeting themes related to self-assessment, reflection, feedback seeking and acceptance, aiming to generate individual and institutional feedback strategies applicable to each quadrant of the window. We identified the following themes for each quadrant: (1) Behaviors known to self and others - Validating the known; (2) Behaviors unknown to self but known to others - Accepting the blind; (3) Behaviors known to self and unknown to others - Disclosure of hidden; and (4) Behaviors unknown to self and others - Uncovering the unknown. Normalizing self-disclosure of limitations, encouraging feedback seeking, training in nonjudgmental feedback and providing opportunities for longitudinal relationships could promote self-awareness, ultimately expanding the "open" quadrant of the Johari window. The Johari window, a model of self-awareness in interpersonal communications, could provide a robust framework for individuals to improve their feedback conversations and institutions to design feedback initiatives that enhance its quality and impact.
Dong, Zhaoming; Zhao, Ping; Wang, Chen; Zhang, Yan; Chen, Jianping; Wang, Xin; Lin, Ying; Xia, Qingyou
2013-11-01
Silkworms (Bombyx mori) produce massive amounts of silk proteins to make cocoons during the final stages of larval development. Although the major components, fibroin and sericin, have been the focus for a long time, few researchers have realized the complexity of the silk proteome. We collected seven kinds of silk fibers spun by silkworm larvae at different developmental stages: the silks spun by new hatched larvae, second instar day 0 larvae, third instar day 0 larvae, fourth instar day 0 larvae, and fourth instar molting larvae, the scaffold silk used to attach the cocoon to the substrate and the cocoon silk. Analysis by liquid chromatography-tandem mass spectrometry identified 500 proteins from the seven silks. In addition to the expected fibroins, sericins, and some known protease inhibitors, we also identified further protease inhibitors, enzymes, proteins of unknown function, and other proteins. Unsurprisingly, our quantitative results showed fibroins and sericins were the most abundant proteins in all seven silks. Except for fibroins and sericins, protease inhibitors, enzymes, and proteins of unknown function were more abundant than other proteins. We found significant change in silk protein compositions through development, being consistent with their different biological functions and complicated formation.
Li, H; Ji, H; Wu, S S; Hou, B X
2016-12-09
Objective: To analyze the protein expression profile and the potential virulence factors of Porphyromonas endodontalis (Pe) via comparison with that of two strains of Porphyromonas gingivalis (Pg) with high and low virulences, respectively. Methods: Whole cell comparative proteomics of Pe ATCC35406 was examined and compared with that of high virulent strain Pg W83 andlow virulent strain Pg ATCC33277, respectively. Isobaric tags for relative and absolute quantitation (iTRAQ) combined with nano liquid chromatography-tandem mass spectrometry (Nano-LC-MS/MS) were adopted to identify and quantitate the proteins of Pe and two strains of Pg with various virulences by using the methods of isotopically labeled peptides, mass spectrometric detection and bioinformatics analysis. The biological functions of similar proteins expressed by Pe ATCC35406 and two strains of Pg were quantified and analyzed. Results: Totally 1 210 proteins were identified while Pe compared with Pg W83. There were 130 proteins (10.74% of the total proteins) expressed similarly, including 89 known functional proteins and 41 proteins of unknown functions. Totally 1 223 proteins were identified when Pe compared with Pg ATCC33277. There were 110 proteins (8.99% of the total proteins) expressed similarly, including 72 known functional proteins and 38 proteins of unknown functions. The similarly expressed proteins in Pe and Pg strains with various virulences mainly focused on catalytic activity and binding function, including recombination activation gene (RagA), lipoprotein, chaperonin Dnak, Clp family proteins (ClpC and ClpX) and various iron-binding proteins. They were involved in metabolism and cellular processes. In addition, the type and number of similar virulence proteins between Pe and high virulence Pg were higher than those between Pe and low virulence Pg. Conclusions: Lipoprotein, oxygen resistance protein, iron binding protein were probably the potential virulence factors of Pe ATCC35406. It was speculated that pathogenicity of Pe was more similar to high virulence Pg than that to low virulence strain.
Protein domains of unknown function are essential in bacteria.
Goodacre, Norman F; Gerloff, Dietlind L; Uetz, Peter
2013-12-31
More than 20% of all protein domains are currently annotated as "domains of unknown function" (DUFs). About 2,700 DUFs are found in bacteria compared with just over 1,500 in eukaryotes. Over 800 DUFs are shared between bacteria and eukaryotes, and about 300 of these are also present in archaea. A total of 2,786 bacterial Pfam domains even occur in animals, including 320 DUFs. Evolutionary conservation suggests that many of these DUFs are important. Here we show that 355 essential proteins in 16 model bacterial species contain 238 DUFs, most of which represent single-domain proteins, clearly establishing the biological essentiality of DUFs. We suggest that experimental research should focus on conserved and essential DUFs (eDUFs) for functional analysis given their important function and wide taxonomic distribution, including bacterial pathogens. The functional units of proteins are domains. Typically, each domain has a distinct structure and function. Genomes encode thousands of domains, and many of the domains have no known function (domains of unknown function [DUFs]). They are often ignored as of little relevance, given that many of them are found in only a few genomes. Here we show that many DUFs are essential DUFs (eDUFs) based on their presence in essential proteins. We also show that eDUFs are often essential even if they are found in relatively few genomes. However, in general, more common DUFs are more often essential than rare DUFs.
Sarma, Rahul; Paul, Sandip
2013-05-09
Protein denaturation in highly concentrated urea solution is a well-known phenomenon. The counteracting effect of a naturally occurring osmolyte, trimethylamine-N-oxide (TMAO), against urea-conferred protein denaturation is also well-established. However, what is largely unknown is the mechanism by which TMAO counteracts this denaturation. To provide a molecular level understanding of how TMAO protects proteins in highly concentrated urea solution, we report here the structural, energetic, and dynamical properties of N-methylacetamide (NMA) solutions that also contain urea and/or TMAO. The solute NMA is of interest mainly because it contains the peptide linkage in addition to hydrophobic sites and represents the typical solvent-exposed state of proteins. Molecular dynamics computer simulation technique is employed in this study. Analysis of solvation characteristics reveals dehydration of NMA and reduction in hydrogen bond number between NMA oxygen and water upon addition of TMAO. The effect of TMAO on NMA-urea interaction is found to be insignificant. Because TMAO cannot donate its hydrogen to NMA oxygen, the total number of hydrogen bonds formed by NMA oxygen with solution species decreases in the presence of TMAO. In solution, TMAO is found to interact strongly with water and urea. Solvation of TMAO makes the water hydrogen bonding network relatively stronger and reduces relaxation of urea-water hydrogen bonds. Implications of these results for counteracting mechanism of TMAO are discussed.
Grasso, Ernesto J.; Sottile, Adolfo E.; Coronel, Carlos E.
2016-01-01
It is known that caltrin (calcium transport inhibitor) protein binds to sperm cells during ejaculation and inhibits extracellular Ca2+ uptake. Although the sequence and some biological features of mouse caltrin I and bovine caltrin are known, their physicochemical properties and tertiary structure are mainly unknown. We predicted the 3D structures of mouse caltrin I and bovine caltrin by molecular homology modeling and threading. Surface electrostatic potentials and electric fields were calculated using the Poisson–Boltzmann equation. Several different bioinformatics tools and available web servers were used to thoroughly analyze the physicochemical characteristics of both proteins, such as their Kyte and Doolittle hydropathy scores and helical wheel projections. The results presented in this work significantly aid further understanding of the molecular mechanisms of caltrin proteins modulating physiological processes associated with fertilization. PMID:27812283
Goonesekere, Nalin C W; Shipely, Krysten; O'Connor, Kevin
2010-06-01
The Pfam database is an important tool in genome annotation, since it provides a collection of curated protein families. However, a subset of these families, known as domains of unknown function (DUFs), remains poorly characterized. We have related sequences from DUF404, DUF407, DUF482, DUF608, DUF810, DUF853, DUF976 and DUF1111 to homologs in PDB, within the midnight zone (9-20%) of sequence identity. These relationships were extended to provide functional annotation by sequence analysis and model building. Also described are examples of residue plasticity within enzyme active sites, and change of function within homologous sequences of a DUF. Copyright 2010 Elsevier Ltd. All rights reserved.
Dokmanić, Ivan; Sikić, Mile; Tomić, Sanja
2008-03-01
Metal ions are constituents of many metalloproteins, in which they have either catalytic (metalloenzymes) or structural functions. In this work, the characteristics of various metals were studied (Cu, Zn, Mg, Mn, Fe, Co, Ni, Cd and Ca in proteins with known crystal structure) as well as the specificity of their environments. The analysis was performed on two data sets: the set of protein structures in the Protein Data Bank (PDB) determined with resolution <1.5 A and the set of nonredundant protein structures from the PDB. The former was used to determine the distances between each metal ion and its electron donors and the latter was used to assess the preferred coordination numbers and common combinations of amino-acid residues in the neighbourhood of each metal. Although the metal ions considered predominantly had a valence of two, their preferred coordination number and the type of amino-acid residues that participate in the coordination differed significantly from one metal ion to the next. This study concentrates on finding the specificities of a metal-ion environment, namely the distribution of coordination numbers and the amino-acid residue types that frequently take part in coordination. Furthermore, the correlation between the coordination number and the occurrence of certain amino-acid residues (quartets and triplets) in a metal-ion coordination sphere was analysed. The results obtained are of particular value for the identification and modelling of metal-binding sites in protein structures derived by homology modelling. Knowledge of the geometry and characteristics of the metal-binding sites in metalloproteins of known function can help to more closely determine the biological activity of proteins of unknown function and to aid in design of proteins with specific affinity for certain metals.
Efficient identification of tubby-binding proteins by an improved system of T7 phage display.
Caberoy, Nora B; Zhou, Yixiong; Jiang, Xiaoyu; Alvarado, Gabriela; Li, Wei
2010-01-01
Mutation in the tubby gene causes adult-onset obesity, progressive retinal, and cochlear degeneration with unknown mechanism. In contrast, mutations in tubby-like protein 1 (Tulp1), whose C-terminus is highly homologous to tubby, only lead to retinal degeneration. We speculate that their diverse N-terminus may define their distinct disease profile. To elucidate the binding partners of tubby, we used tubby N-terminus (tubby-N) as bait to identify unknown binding proteins with open-reading-frame (ORF) phage display. T7 phage display was engineered with three improvements: high-quality ORF phage display cDNA library, specific phage elution by protease cleavage, and dual phage display for sensitive high throughput screening. The new system is capable of identifying unknown bait-binding proteins in as fast as approximately 4-7 days. While phage display with conventional cDNA libraries identifies high percentage of out-of-frame unnatural short peptides, all 28 tubby-N-binding clones identified by ORF phage display were ORFs. They encode 16 proteins, including 8 nuclear proteins. Fourteen proteins were analyzed by yeast two-hybrid assay and protein pull-down assay with ten of them independently verified. Comparative binding analyses revealed several proteins binding to both tubby and Tulp1 as well as one tubby-specific binding protein. These data suggest that tubby-N is capable of interacting with multiple nuclear and cytoplasmic protein binding partners. These results demonstrated that the newly-engineered ORF phage display is a powerful technology to identify unknown protein-protein interactions. (c) 2009 John Wiley & Sons, Ltd.
Oxidative stress is known to play important roles in nanomaterial-induced toxicities. However, the proteins and signaling pathways associated with nanomaterial-mediated oxidative stress and toxicity are largely unknown. To identify oxidative stress-responding toxicity pathways an...
Oxidative stress is known to play important roles in engineered nanomaterial induced cellular toxicity. However, the proteins and signaling pathways associated with the engineered nanomaterial mediated oxidative stress and toxicity are largely unknown. To identify these toxicity ...
Valizade Hasanloei, Mohammad Amin; Sheikhpour, Razieh; Sarram, Mehdi Agha; Sheikhpour, Elnaz; Sharifi, Hamdollah
2018-02-01
Quantitative structure-activity relationship (QSAR) is an effective computational technique for drug design that relates the chemical structures of compounds to their biological activities. Feature selection is an important step in QSAR based drug design to select the most relevant descriptors. One of the most popular feature selection methods for classification problems is Fisher score which aim is to minimize the within-class distance and maximize the between-class distance. In this study, the properties of Fisher criterion were extended for QSAR models to define the new distance metrics based on the continuous activity values of compounds with known activities. Then, a semi-supervised feature selection method was proposed based on the combination of Fisher and Laplacian criteria which exploits both compounds with known and unknown activities to select the relevant descriptors. To demonstrate the efficiency of the proposed semi-supervised feature selection method in selecting the relevant descriptors, we applied the method and other feature selection methods on three QSAR data sets such as serine/threonine-protein kinase PLK3 inhibitors, ROCK inhibitors and phenol compounds. The results demonstrated that the QSAR models built on the selected descriptors by the proposed semi-supervised method have better performance than other models. This indicates the efficiency of the proposed method in selecting the relevant descriptors using the compounds with known and unknown activities. The results of this study showed that the compounds with known and unknown activities can be helpful to improve the performance of the combined Fisher and Laplacian based feature selection methods.
NASA Astrophysics Data System (ADS)
Valizade Hasanloei, Mohammad Amin; Sheikhpour, Razieh; Sarram, Mehdi Agha; Sheikhpour, Elnaz; Sharifi, Hamdollah
2018-02-01
Quantitative structure-activity relationship (QSAR) is an effective computational technique for drug design that relates the chemical structures of compounds to their biological activities. Feature selection is an important step in QSAR based drug design to select the most relevant descriptors. One of the most popular feature selection methods for classification problems is Fisher score which aim is to minimize the within-class distance and maximize the between-class distance. In this study, the properties of Fisher criterion were extended for QSAR models to define the new distance metrics based on the continuous activity values of compounds with known activities. Then, a semi-supervised feature selection method was proposed based on the combination of Fisher and Laplacian criteria which exploits both compounds with known and unknown activities to select the relevant descriptors. To demonstrate the efficiency of the proposed semi-supervised feature selection method in selecting the relevant descriptors, we applied the method and other feature selection methods on three QSAR data sets such as serine/threonine-protein kinase PLK3 inhibitors, ROCK inhibitors and phenol compounds. The results demonstrated that the QSAR models built on the selected descriptors by the proposed semi-supervised method have better performance than other models. This indicates the efficiency of the proposed method in selecting the relevant descriptors using the compounds with known and unknown activities. The results of this study showed that the compounds with known and unknown activities can be helpful to improve the performance of the combined Fisher and Laplacian based feature selection methods.
Retzlaff, Nancy; Stadler, Peter F
2018-06-21
Evolutionary processes have been described not only in biology but also for a wide range of human cultural activities including languages and law. In contrast to the evolution of DNA or protein sequences, the detailed mechanisms giving rise to the observed evolution-like processes are not or only partially known. The absence of a mechanistic model of evolution implies that it remains unknown how the distances between different taxa have to be quantified. Considering distortions of metric distances, we first show that poor choices of the distance measure can lead to incorrect phylogenetic trees. Based on the well-known fact that phylogenetic inference requires additive metrics, we then show that the correct phylogeny can be computed from a distance matrix [Formula: see text] if there is a monotonic, subadditive function [Formula: see text] such that [Formula: see text] is additive. The required metric-preserving transformation [Formula: see text] can be computed as the solution of an optimization problem. This result shows that the problem of phylogeny reconstruction is well defined even if a detailed mechanistic model of the evolutionary process remains elusive.
The protein interaction map of bacteriophage lambda
2011-01-01
Background Bacteriophage lambda is a model phage for most other dsDNA phages and has been studied for over 60 years. Although it is probably the best-characterized phage there are still about 20 poorly understood open reading frames in its 48-kb genome. For a complete understanding we need to know all interactions among its proteins. We have manually curated the lambda literature and compiled a total of 33 interactions that have been found among lambda proteins. We set out to find out how many protein-protein interactions remain to be found in this phage. Results In order to map lambda's interactions, we have cloned 68 out of 73 lambda open reading frames (the "ORFeome") into Gateway vectors and systematically tested all proteins for interactions using exhaustive array-based yeast two-hybrid screens. These screens identified 97 interactions. We found 16 out of 30 previously published interactions (53%). We have also found at least 18 new plausible interactions among functionally related proteins. All previously found and new interactions are combined into structural and network models of phage lambda. Conclusions Phage lambda serves as a benchmark for future studies of protein interactions among phage, viruses in general, or large protein assemblies. We conclude that we could not find all the known interactions because they require chaperones, post-translational modifications, or multiple proteins for their interactions. The lambda protein network connects 12 proteins of unknown function with well characterized proteins, which should shed light on the functional associations of these uncharacterized proteins. PMID:21943085
Botulinum neurotoxin type A: Actions beyond SNAP-25?
Matak, Ivica; Lacković, Zdravko
2015-09-01
Botulinum neurotoxin type A (BoNT/A), the most potent toxin known in nature which causes botulism, is a commonly used therapeutic protein. It prevents synaptic vesicle neuroexocytosis by proteolytic cleavage of synaptosomal-associated protein of 25 kDa (SNAP-25). It is widely believed that BoNT/A therapeutic or toxic actions are exclusively mediated by SNAP-25 cleavage. On the other hand, in vitro and in vivo findings suggest that several BoNT/A actions related to neuroexocytosis, cell cycle and apoptosis, neuritogenesis and gene expression are not necessarily mediated by this widely accepted mechanism of action. In present review we summarize the literature evidence which point to the existence of unknown BoNT/A molecular target(s) and modulation of unknown signaling pathways. The effects of BoNT/A apparently independent of SNAP-25 occur at similar doses/concentrations known to induce SNAP-25 cleavage and prevention of neurotransmitter release. Accordingly, these effects might be pharmacologically significant. Potentially the most interesting are observations of antimitotic and antitumor activity of BoNT/A. However, the exact mechanisms require further studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Ytterberg, A Jimmy; Peltier, Jean-Benoit; van Wijk, Klaas J
2006-03-01
Plastoglobules (PGs) are oval or tubular lipid-rich structures present in all plastid types, but their specific functions are unclear. PGs contain quinones, alpha-tocopherol, and lipids and, in chromoplasts, carotenoids as well. It is not known whether PGs contain any enzymes or regulatory proteins. Here, we determined the proteome of PGs from chloroplasts of stressed and unstressed leaves of Arabidopsis (Arabidopsis thaliana) as well as from pepper (Capsicum annuum) fruit chromoplasts using mass spectrometry. Together, this showed that the proteome of chloroplast PGs consists of seven fibrillins, providing a protein coat and preventing coalescence of the PGs, and an additional 25 proteins likely involved in metabolism of isoprenoid-derived molecules (quinines and tocochromanols), lipids, and carotenoid cleavage. Four unknown ABC1 kinases were identified, possibly involved in regulation of quinone monooxygenases. Most proteins have not been observed earlier but have predicted N-terminal chloroplast transit peptides and lack transmembrane domains, consistent with localization in the PG lipid monolayer particles. Quantitative differences in PG composition in response to high light stress and degreening were determined by differential stable-isotope labeling using formaldehyde. More than 20 proteins were identified in the PG proteome of pepper chromoplasts, including four enzymes of carotenoid biosynthesis and several homologs of proteins observed in the chloroplast PGs. Our data strongly suggest that PGs in chloroplasts form a functional metabolic link between the inner envelope and thylakoid membranes and play a role in breakdown of carotenoids and oxidative stress defense, whereas PGs in chromoplasts are also an active site for carotenoid conversions.
Ytterberg, A. Jimmy; Peltier, Jean-Benoit; van Wijk, Klaas J.
2006-01-01
Plastoglobules (PGs) are oval or tubular lipid-rich structures present in all plastid types, but their specific functions are unclear. PGs contain quinones, α-tocopherol, and lipids and, in chromoplasts, carotenoids as well. It is not known whether PGs contain any enzymes or regulatory proteins. Here, we determined the proteome of PGs from chloroplasts of stressed and unstressed leaves of Arabidopsis (Arabidopsis thaliana) as well as from pepper (Capsicum annuum) fruit chromoplasts using mass spectrometry. Together, this showed that the proteome of chloroplast PGs consists of seven fibrillins, providing a protein coat and preventing coalescence of the PGs, and an additional 25 proteins likely involved in metabolism of isoprenoid-derived molecules (quinines and tocochromanols), lipids, and carotenoid cleavage. Four unknown ABC1 kinases were identified, possibly involved in regulation of quinone monooxygenases. Most proteins have not been observed earlier but have predicted N-terminal chloroplast transit peptides and lack transmembrane domains, consistent with localization in the PG lipid monolayer particles. Quantitative differences in PG composition in response to high light stress and degreening were determined by differential stable-isotope labeling using formaldehyde. More than 20 proteins were identified in the PG proteome of pepper chromoplasts, including four enzymes of carotenoid biosynthesis and several homologs of proteins observed in the chloroplast PGs. Our data strongly suggest that PGs in chloroplasts form a functional metabolic link between the inner envelope and thylakoid membranes and play a role in breakdown of carotenoids and oxidative stress defense, whereas PGs in chromoplasts are also an active site for carotenoid conversions. PMID:16461379
Superoxide dismutase activity of Cu-bound prion protein
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry
2009-03-01
Misfolding of the prion protein, PrP, has been linked to a group of neurodegenerative diseases, including the mad cow disease in cattle and the Creutzfeldt-Jakob disease in humans. The normal function of PrP is still unknown, but it was found that the PrP can efficiently bind Cu(II) ions. Early experiments suggested that Cu-PrP complex possesses significant superoxide dismutase (SOD) activity, but later experiments failed to confirm it and at present this issue remains unresolved. Using a recently developed hybrid DFT/DFT method, which combines Kohn-Sham DFT for the solute and its first solvation shells with orbital-free DFT for the remainder of the solvent, we have investigated SOD activity of PrP. The PrP is capable of incorporating Cu(II) ions in several binding modes and our calculations find that each mode has a different SOD activity. The highest activity found is comparable to those of well-known SOD proteins, suggesting that the conflicting experimental results may be due to different bindings of Cu(II) in those experiments.
Plasmodesmata: channels for intercellular signaling during plant growth and development.
Sevilem, Iris; Yadav, Shri Ram; Helariutta, Ykä
2015-01-01
Plants have evolved strategies for short- and long-distance communication to coordinate plant development and to adapt to changing environmental conditions. Plasmodesmata (PD) are intercellular nanochannels that provide an effective pathway for both selective and nonselective movement of various molecules that function in diverse biological processes. Numerous non-cell-autonomous proteins (NCAP) and small RNAs have been identified that have crucial roles in cell fate determination and organ patterning during development. Both the density and aperture size of PD are developmentally regulated, allowing formation of spatial symplastic domains for establishment of tissue-specific developmental programs. The PD size exclusion limit (SEL) is controlled by reversible deposition of callose, as well as by some PD-associated proteins. Although a large number of PD-associated proteins have been identified, many of their functions remain unknown. Despite the fact that PD are primarily membranous structures, surprisingly very little is known about their lipid composition. Thus, future studies in PD biology will provide deeper insights into the high-resolution structure and tightly regulated functions of PD and the evolution of PD-mediated cell-to-cell communication in plants.
Taylor, Kathryne E.
2015-01-01
ABSTRACT It has recently been proposed that the herpes simplex virus (HSV) protein ICP0 has cytoplasmic roles in blocking antiviral signaling and in promoting viral replication in addition to its well-known proteasome-dependent functions in the nucleus. However, the mechanisms through which it produces these effects remain unclear. While investigating this further, we identified a novel cytoplasmic interaction between ICP0 and the poorly characterized cellular protein WDR11. During an HSV infection, WDR11 undergoes a dramatic change in localization at late times in the viral replication cycle, moving from defined perinuclear structures to a dispersed cytoplasmic distribution. While this relocation was not observed during infection with viruses other than HSV-1 and correlated with efficient HSV-1 replication, the redistribution was found to occur independently of ICP0 expression, instead requiring viral late gene expression. We demonstrate for the first time that WDR11 is localized to the trans-Golgi network (TGN), where it interacts specifically with some, but not all, HSV virion components, in addition to ICP0. Knockdown of WDR11 in cultured human cells resulted in a modest but consistent decrease in yields of both wild-type and ICP0-null viruses, in the supernatant and cell-associated fractions, without affecting viral gene expression. Although further study is required, we propose that WDR11 participates in viral assembly and/or secondary envelopment. IMPORTANCE While the TGN has been proposed to be the major site of HSV-1 secondary envelopment, this process is incompletely understood, and in particular, the role of cellular TGN components in this pathway is unknown. Additionally, little is known about the cellular functions of WDR11, although the disruption of this protein has been implicated in multiple human diseases. Therefore, our finding that WDR11 is a TGN-resident protein that interacts with specific viral proteins to enhance viral yields improves both our understanding of basic cellular biology as well as how this protein is co-opted by HSV. PMID:26178983
Guanidine hydrochloride-induced alkali molten globule model of horse ferrocytochrome c.
Jain, Rishu; Kaur, Sandeep; Kumar, Rajesh
2013-02-01
This article compares structural, kinetic and thermodynamic properties of previously unknown guanidine hydrochloride (GdnHCl)-induced alkali molten globule (MG) state of horse 'ferrocytochrome c' (ferrocyt c) with the known NaCl-induced alkali-MG state of ferrocyt c. It is well known that Cl(-) arising from GdnHCl refolds and stabilizes the acid-denatured protein to MG state. We demonstrate that the GdnH(+) arising from GdnHCl (≤0.2 M) also transforms the base-denatured CO-liganded ferrocyt c (carbonmonoxycyt c) to MG state by making the electrostatic interactions to the negative charges of the protein. Structural and molecular properties extracted from the basic spectroscopic (circular dichroism (CD), fluorescence, FTIR and NMR) experiments suggest that the GdnH(+)- and Na(+)-induced MG states of base-denatured carbonmonoxycyt c are molecular compact states containing native-like secondary structures and disordered tertiary structures. Kinetic experiments involving the measurement of the CO association to the alkaline ferrocyt c in the presence of different GdnHCl and NaCl concentrations indicate that the Na(+)-induced MG state is more constrained relative to that of GdnH(+)-induced MG state. Analyses of thermal (near UV-CD) denaturation curves of the base-denatured protein in the presence of different GdnHCl and NaCl concentration also indicate that the Na(+)-induced MG state is thermally more stable than the GdnH(+)-induced MG state.
Ma, Yan-Min; Wu, Kai-Jie; Dang, Qiang; Shi, Qi; Gao, Yang; Guo, Peng; Xu, Shan; Wang, Xin-Yang; He, Da-Lin; Gong, Yong-Guang
2014-01-01
Androgen therapy is the mainstay of treatment for the hypogonadotropic hypogonadal micropenis because it obviously enhances penis growth in prepubescent microphallic patients. However, the molecular mechanisms of androgen treatment leading to penis growth are still largely unknown. To clarify this well-known phenomenon, we successfully generated a castrated male Sprague Dawley rat model at puberty followed by testosterone administration. Interestingly, compared with the control group, testosterone treatment stimulated a dose-dependent increase of penis weight, length, and width in castrated rats accompanied with a dramatic recovery of the pathological changes of the penis. Mechanistically, testosterone administration substantially increased the expression of androgen receptor (AR) protein. Increased AR protein in the penis could subsequently initiate transcription of its target genes, including keratin 33B (Krt33b). Importantly, we demonstrated that KRT33B is generally expressed in the rat penis and that most KRT33B expression is cytoplasmic. Furthermore, AR could directly modulate its expression by binding to a putative androgen response element sequence of the Krt33b promoter. Overall, this study reveals a novel mechanism facilitating penis growth after testosterone treatment in precastrated prepubescent animals, in which androgen enhances the expression of AR protein as well as its target genes, such as Krt33b. PMID:24994782
Ma, Yan-Min; Wu, Kai-Jie; Dang, Qiang; Shi, Qi; Gao, Yang; Guo, Peng; Xu, Shan; Wang, Xin-Yang; He, Da-Lin; Gong, Yong-Guang
2014-01-01
Androgen therapy is the mainstay of treatment for the hypogonadotropic hypogonadal micropenis because it obviously enhances penis growth in prepubescent microphallic patients. However, the molecular mechanisms of androgen treatment leading to penis growth are still largely unknown. To clarify this well-known phenomenon, we successfully generated a castrated male Sprague Dawley rat model at puberty followed by testosterone administration. Interestingly, compared with the control group, testosterone treatment stimulated a dose-dependent increase of penis weight, length, and width in castrated rats accompanied with a dramatic recovery of the pathological changes of the penis. Mechanistically, testosterone administration substantially increased the expression of androgen receptor (AR) protein. Increased AR protein in the penis could subsequently initiate transcription of its target genes, including keratin 33B (Krt33b). Importantly, we demonstrated that KRT33B is generally expressed in the rat penis and that most KRT33B expression is cytoplasmic. Furthermore, AR could directly modulate its expression by binding to a putative androgen response element sequence of the Krt33b promoter. Overall, this study reveals a novel mechanism facilitating penis growth after testosterone treatment in precastrated prepubescent animals, in which androgen enhances the expression of AR protein as well as its target genes, such as Krt33b.
Proteomic investigation of the secretome of Cellvibrio japonicus during growth on chitin.
Tuveng, Tina Rise; Arntzen, Magnus Øverlie; Bengtsson, Oskar; Gardner, Jeffrey G; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H
2016-07-01
Studies of the secretomes of microbes grown on insoluble substrates are important for the discovery of novel proteins involved in biomass conversion. However, data in literature and this study indicate that secretome samples tend to be contaminated with cytoplasmic proteins. We have examined the secretome of the Gram-negative soil bacterium Cellvibrio japonicus using a simple plate-based culturing technique that yields samples with high fractions (60-75%) of proteins that are predicted to be secreted. By combining this approach with label-free quantification using the MaxLFQ algorithm, we have mapped and quantified proteins secreted by C. japonicus during growth on α- and β-chitin. Hierarchical clustering of the detected protein quantities revealed groups of up-regulated proteins that include all five putative C. japonicus chitinases as well as a chitin-specific lytic polysaccharide monooxygenase (CjLPMO10A). A small set of secreted proteins were co-regulated with known chitin-specific enzymes, including several with unknown catalytic functions. These proteins provide interesting targets for further studies aimed at unraveling the enzymatic machineries used by C. japonicus for recalcitrant polysaccharide degradation. Studies of chitin degradation indicated that C. japonicus indeed produces an efficient chitinolytic enzyme cocktail. All MS data have been deposited in the ProteomeXchange with the dataset identifier PXD002843 (http://proteomecentral.proteomexchange.org/dataset/PXD002843). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An enzyme-mediated protein-fragment complementation assay for substrate screening of sortase A.
Li, Ning; Yu, Zheng; Ji, Qun; Sun, Jingying; Liu, Xiao; Du, Mingjuan; Zhang, Wei
2017-04-29
Enzyme-mediated protein conjugation has gained great attention recently due to the remarkable site-selectivity and mild reaction condition affected by the nature of enzyme. Among all sorts of enzymes reported, sortase A from Staphylococcus aureus (SaSrtA) is the most popular enzyme due to its selectivity and well-demonstrated applications. Position scanning has been widely applied to understand enzyme substrate specificity, but the low throughput of chemical synthesis of peptide substrates and analytical methods (HPLC, LC-ESI-MS) have been the major hurdle to fully decode enzyme substrate profile. We have developed a simple high-throughput substrate profiling method to reveal novel substrates of SaSrtA 7M, a widely used hyperactive peptide ligase, by modified protein-fragment complementation assay (PCA). A small library targeting the LPATG motif recognized by SaSrtA 7M was generated and screened against proteins carrying N-terminal glycine. Using this method, we have confirmed all currently known substrates of the enzyme, and moreover identified some previously unknown substrates with varying activities. The method provides an easy, fast and highly-sensitive way to determine substrate profile of a peptide ligase in a high-throughput manner. Copyright © 2017 Elsevier Inc. All rights reserved.
von Grotthuss, Marcin; Plewczynski, Dariusz; Ginalski, Krzysztof; Rychlewski, Leszek; Shakhnovich, Eugene I
2006-02-06
The number of protein structures from structural genomics centers dramatically increases in the Protein Data Bank (PDB). Many of these structures are functionally unannotated because they have no sequence similarity to proteins of known function. However, it is possible to successfully infer function using only structural similarity. Here we present the PDB-UF database, a web-accessible collection of predictions of enzymatic properties using structure-function relationship. The assignments were conducted for three-dimensional protein structures of unknown function that come from structural genomics initiatives. We show that 4 hypothetical proteins (with PDB accession codes: 1VH0, 1NS5, 1O6D, and 1TO0), for which standard BLAST tools such as PSI-BLAST or RPS-BLAST failed to assign any function, are probably methyltransferase enzymes. We suggest that the structure-based prediction of an EC number should be conducted having the different similarity score cutoff for different protein folds. Moreover, performing the annotation using two different algorithms can reduce the rate of false positive assignments. We believe, that the presented web-based repository will help to decrease the number of protein structures that have functions marked as "unknown" in the PDB file. http://paradox.harvard.edu/PDB-UF and http://bioinfo.pl/PDB-UF.
Predicting Structure and Function for Novel Proteins of an Extremophilic Iron Oxidizing Bacterium
NASA Astrophysics Data System (ADS)
Wheeler, K.; Zemla, A.; Banfield, J.; Thelen, M.
2007-12-01
Proteins isolated from uncultivated microbial populations represent the functional components of microbial processes and contribute directly to community fitness under natural conditions. Investigations into proteins in the environment are hindered by the lack of genome data, or where available, the high proportion of proteins of unknown function. We have identified thousands of proteins from biofilms in the extremely acidic drainage outflow of an iron mine ecosystem (1). With an extensive genomic and proteomic foundation, we have focused directly on the problem of several hundred proteins of unknown function within this well-defined model system. Here we describe the geobiological insights gained by using a high throughput computational approach for predicting structure and function of 421 novel proteins from the biofilm community. We used a homology based modeling system to compare these proteins to those of known structure (AS2TS) (2). This approach has resulted in the assignment of structures to 360 proteins (85%) and provided functional information for up to 75% of the modeled proteins. Detailed examination of the modeling results enables confident, high-throughput prediction of the roles of many of the novel proteins within the microbial community. For instance, one prediction places a protein in the phosphoenolpyruvate/pyruvate domain superfamily as a carboxylase that fills in a gap in an otherwise complete carbon cycle. Particularly important for a community in such a metal rich environment is the evolution of over 25% of the novel proteins that contain a metal cofactor; of these, one third are likely Fe containing proteins. Two of the most abundant proteins in biofilm samples are unusual c-type cytochromes. Both of these proteins catalyze iron- oxidation, a key metabolic reaction supporting the energy requirements of this community. Structural models of these cytochromes verify our experimental results on heme binding and electron transfer reactivity, and provide details for a working hypothesis of electron flow within the biofilm's major bacterium. Nearly 7% of the novel proteins contain tetratrico peptide repeat (TPR) modules, a protein-protein interaction domain that participates in signal transduction and a wide variety of other cellular functions. Like many biofilms, the various organisms in this community use unknown mechanisms to communicate, relying upon each other for survival. Especially interesting is evidence that most of these novel TPR proteins are located in the extracellular or membrane fractions, suggesting their role in intracellular communication. (1) Ram et al, 2005, Science 308:1915-20, "Community Proteomics of a Natural Microbial Biofilm" (2) Zemla et al, 2005, Nucleic Acids Res 33 (Web Server issue):W111-5, "AS2TS system for protein structure modeling and analysis" This work was funded by the DOE Genomics: GTL Program and was performed under the auspices of the DOE by the University of California, Lawrence Livermore National Laboratory under contract W-7405-Eng-48.
Radar observation of known and unknown clear echoes
NASA Technical Reports Server (NTRS)
Glover, K. M.; Konrad, T. G.
1979-01-01
Target cross-section as a function of wavelength for known insects, known bird, and dot targets is presented. Tracking data using the time series analysis was tabulated for known birds. Examples were selected from these early works to give entomologists some indication of the types of information that are available by radar as well as examples of the different sources of clear-air radar backscatter.
Experimental Determination of Unknown Masses and Their Positions in a Mechanical Black Box
ERIC Educational Resources Information Center
Chakrabarti, Bhupati; Pathare, Shirish; Huli, Saurabhee; Nachane, Madhura
2013-01-01
An experiment with a mechanical black box containing unknown masses is presented. The experiment involves the determination of these masses and their locations by performing some nondestructive tests. The set-ups are inexpensive and easy to fabricate. They are very useful to gain an understanding of some well-known principles of mechanics.
Genome walk of an unknown upstream region of myostatin gene in Spanish goats
USDA-ARS?s Scientific Manuscript database
Myostatin (MSTN) gene product also known as growth differentiation factor (GDF8) is a member of the TGF-ß family of secreted proteins. It is shown to be a negative regulator of muscle mass development. Mutations in the MSTN gene have been reported in mice, cattle and humans that lead to muscular hyp...
Prediction of type III secretion signals in genomes of gram-negative bacteria.
Löwer, Martin; Schneider, Gisbert
2009-06-15
Pathogenic bacteria infecting both animals as well as plants use various mechanisms to transport virulence factors across their cell membranes and channel these proteins into the infected host cell. The type III secretion system represents such a mechanism. Proteins transported via this pathway ("effector proteins") have to be distinguished from all other proteins that are not exported from the bacterial cell. Although a special targeting signal at the N-terminal end of effector proteins has been proposed in literature its exact characteristics remain unknown. In this study, we demonstrate that the signals encoded in the sequences of type III secretion system effectors can be consistently recognized and predicted by machine learning techniques. Known protein effectors were compiled from the literature and sequence databases, and served as training data for artificial neural networks and support vector machine classifiers. Common sequence features were most pronounced in the first 30 amino acids of the effector sequences. Classification accuracy yielded a cross-validated Matthews correlation of 0.63 and allowed for genome-wide prediction of potential type III secretion system effectors in 705 proteobacterial genomes (12% predicted candidates protein), their chromosomes (11%) and plasmids (13%), as well as 213 Firmicute genomes (7%). We present a signal prediction method together with comprehensive survey of potential type III secretion system effectors extracted from 918 published bacterial genomes. Our study demonstrates that the analyzed signal features are common across a wide range of species, and provides a substantial basis for the identification of exported pathogenic proteins as targets for future therapeutic intervention. The prediction software is publicly accessible from our web server (www.modlab.org).
Jang, Seogjoo; Rivera, Eva; Montemayor, Daniel
2015-03-19
The light harvesting 2 (LH2) antenna complex from purple photosynthetic bacteria is an efficient natural excitation energy carrier with well-known symmetric structure, but the molecular level design principle governing its structure-function relationship is unknown. Our all-atomistic simulations of nonnatural analogues of LH2 as well as those of a natural LH2 suggest that nonnatural sizes of LH2-like complexes could be built. However, stable and consistent hydrogen bonding (HB) between bacteriochlorophyll and the protein is shown to be possible only near naturally occurring sizes, leading to significantly smaller disorder than for nonnatural ones. Extensive quantum calculations of intercomplex exciton transfer dynamics, sampled for a large set of disorder, reveal that taming the negative effect of disorder through a reliable HB as well as quantum delocalization of the exciton is a critical mechanism that makes LH2 highly functional, which also explains why the natural sizes of LH2 are indeed optimal.
Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M
2016-03-01
Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajaj, R. Alexandra; Arbing, Mark A.; Shin, Annie
The structure of Msmeg_6760, a protein of unknown function, has been determined. Biochemical and bioinformatics analyses determined that Msmeg_6760 interacts with a protein encoded in the same operon, Msmeg_6762, and predicted that the operon is a toxin–antitoxin (TA) system. Structural comparison of Msmeg_6760 with proteins of known function suggests that Msmeg_6760 binds a hydrophobic ligand in a buried cavity lined by large hydrophobic residues. Access to this cavity could be controlled by a gate–latch mechanism. The function of the Msmeg_6760 toxin is unknown, but structure-based predictions revealed that Msmeg_6760 and Msmeg_6762 are homologous to Rv2034 and Rv2035, a predicted novelmore » TA system involved inMycobacterium tuberculosislatency during macrophage infection. The Msmeg_6760 toxin fold has not been previously described for bacterial toxins and its unique structural features suggest that toxin activation is likely to be mediated by a novel mechanism.« less
Finding Relational Associations in HIV Resistance Mutation Data
NASA Astrophysics Data System (ADS)
Richter, Lothar; Augustin, Regina; Kramer, Stefan
HIV therapy optimization is a hard task due to rapidly evolving mutations leading to drug resistance. Over the past five years, several machine learning approaches have been developed for decision support, mostly to predict therapy failure from the genotypic sequence of viral proteins and additional factors. In this paper, we define a relational representation for an important part of the data, namely the sequences of a viral protein (reverse transcriptase), their mutations, and the drug resistance(s) associated with those mutations. The data were retrieved from the Los Alamos National Laboratories' (LANL) HIV databases. In contrast to existing work in this area, we do not aim directly for predictive modeling, but take one step back and apply descriptive mining methods to develop a better understanding of the correlations and associations between mutations and resistances. In our particular application, we use the Warmr algorithm to detect non-trivial patterns connecting mutations and resistances. Our findings suggest that well-known facts can be rediscovered, but also hint at the potential of discovering yet unknown associations.
Spermidine: a novel autophagy inducer and longevity elixir.
Madeo, Frank; Eisenberg, Tobias; Büttner, Sabrina; Ruckenstuhl, Christoph; Kroemer, Guido
2010-01-01
Spermidine is a ubiquitous polycation that is synthesized from putrescine and serves as a precursor of spermine. Putrescine, spermidine and spermine all are polyamines that participate in multiple known and unknown biological processes. Exogenous supply of spermidine prolongs the life span of several model organisms including yeast (Saccharomyces cerevisiae), nematodes (Caenorhabditis elegans) and flies (Drosophila melanogaster) and significantly reduces age-related oxidative protein damage in mice, indicating that this agent may act as a universal anti-aging drug. Spermidine induces autophagy in cultured yeast and mammalian cells, as well as in nematodes and flies. Genetic inactivation of genes essential for autophagy abolishes the life span-prolonging effect of spermidine in yeast, nematodes and flies. These findings complement expanding evidence that autophagy mediates cytoprotection against a variety of noxious agents and can confer longevity when induced at the whole-organism level. We hypothesize that increased autophagic turnover of cytoplasmic organelles or long-lived proteins is involved in most if not all life span-prolonging therapies.
Naqvi, Ahmad Abu Turab; Ahmad, Faizan; Hassan, Md Imtaiyaz
2015-01-01
Mycobacterium leprae is an intracellular obligate parasite that causes leprosy in humans, and it leads to the destruction of peripheral nerves and skin deformation. Here, we report an extensive analysis of the hypothetical proteins (HPs) from M. leprae strain Br4923, assigning their functions to better understand the mechanism of pathogenesis and to search for potential therapeutic interventions. The genome of M. leprae encodes 1604 proteins, of which the functions of 632 are not known (HPs). In this paper, we predicted the probable functions of 312 HPs. First, we classified all HPs into families and subfamilies on the basis of sequence similarity, followed by domain assignment, which provides many clues for their possible function. However, the functions of 320 proteins were not predicted because of low sequence similarity with proteins of known function. Annotated HPs were categorized into enzymes, binding proteins, transporters, and proteins involved in cellular processes. We found several novel proteins whose functions were unknown for M. leprae. These proteins have a requisite association with bacterial virulence and pathogenicity. Finally, our sequence-based analysis will be helpful for further validation and the search for potential drug targets while developing effective drugs to cure leprosy.
Wlodarski, Tomasz; Kutner, Jan; Towpik, Joanna; Knizewski, Lukasz; Rychlewski, Leszek; Kudlicki, Andrzej; Rowicka, Maga; Dziembowski, Andrzej; Ginalski, Krzysztof
2011-01-01
Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity). Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.
Gudhka, Reema K; Neilan, Brett A; Burns, Brendan P
2015-01-01
Halococcus hamelinensis was the first archaeon isolated from stromatolites. These geomicrobial ecosystems are thought to be some of the earliest known on Earth, yet, despite their evolutionary significance, the role of Archaea in these systems is still not well understood. Detailed here is the genome sequencing and analysis of an archaeon isolated from stromatolites. The genome of H. hamelinensis consisted of 3,133,046 base pairs with an average G+C content of 60.08% and contained 3,150 predicted coding sequences or ORFs, 2,196 (68.67%) of which were protein-coding genes with functional assignments and 954 (29.83%) of which were of unknown function. Codon usage of the H. hamelinensis genome was consistent with a highly acidic proteome, a major adaptive mechanism towards high salinity. Amino acid transport and metabolism, inorganic ion transport and metabolism, energy production and conversion, ribosomal structure, and unknown function COG genes were overrepresented. The genome of H. hamelinensis also revealed characteristics reflecting its survival in its extreme environment, including putative genes/pathways involved in osmoprotection, oxidative stress response, and UV damage repair. Finally, genome analyses indicated the presence of putative transposases as well as positive matches of genes of H. hamelinensis against various genomes of Bacteria, Archaea, and viruses, suggesting the potential for horizontal gene transfer.
Villagomez, Fabian R; Medina-Contreras, Oscar; Cerna-Cortes, Jorge Francisco; Patino-Lopez, Genaro
2018-05-28
The study of cancer has allowed researchers to describe some biological characteristics that tumor cells acquire during their development, known as the "hallmarks of cancer" but more research is needed to expand our knowledge about cancer biology and to generate new strategies of treatment. The role that RabGTPases might play in some hallmarks of cancer represents interesting areas of study since these proteins are frequently altered in cancer. However, their participation is not well known. Recently, Rab35was recognized as an oncogenic RabGTPase and and because of its association with different cellular functions, distinctly important in immune cells, a possible role of Rab35 in leukemia can be suggested. Nevertheless, the involvement of Rab35 in cancer remains poorly understood and its possible specific role in leukemia remains unknown. In this review, we analyze general aspects of the participation of RabGTPases in cancer, and especially, the plausible role of Rab35 in leukemia.
Chemical Component and Proteomic Study of the Amphibalanus (= Balanus) amphitrite Shell
Zhang, Gen; He, Li-sheng; Wong, Yue-Him; Xu, Ying; Zhang, Yu; Qian, Pei-yuan
2015-01-01
As typical biofoulers, barnacles possess hard shells and cause serious biofouling problems. In this study, we analyzed the protein component of the barnacle Amphibalanus (= Balanus) amphitrite shell using gel-based proteomics. The results revealed 52 proteins in the A. Amphitrite shell. Among them, 40 proteins were categorized into 11 functional groups based on KOG database, and the remaining 12 proteins were unknown. Besides the known proteins in barnacle shell (SIPC, carbonic anhydrase and acidic acid matrix protein), we also identified chorion peroxidase, C-type lectin-like domains, serine proteases and proteinase inhibitor proteins in the A. Amphitrite shell. The sequences of these proteins were characterized and their potential functions were discussed. Histology and DAPI staining revealed living cells in the shell, which might secrete the shell proteins identified in this study. PMID:26222041
Nonfood Applications of Proteinaceous Renewable Materials
ERIC Educational Resources Information Center
Barone, Justin R.; Schmidt, Walter F.
2006-01-01
It is well known that proteins are abundant in food and are vital to nutrition and biochemical function. What is not well known is that proteins derived from agricultural sources are used in everyday products such as glue and textiles. Research continues to find new uses for proteins in a wide variety of applications, most of which would be…
Schokraie, Elham; Hotz-Wagenblatt, Agnes; Warnken, Uwe; Mali, Brahim; Frohme, Marcus; Förster, Frank; Dandekar, Thomas; Hengherr, Steffen; Schill, Ralph O; Schnölzer, Martina
2010-03-03
Tardigrades are small, multicellular invertebrates which are able to survive times of unfavourable environmental conditions using their well-known capability to undergo cryptobiosis at any stage of their life cycle. Milnesium tardigradum has become a powerful model system for the analysis of cryptobiosis. While some genetic information is already available for Milnesium tardigradum the proteome is still to be discovered. Here we present to the best of our knowledge the first comprehensive study of Milnesium tardigradum on the protein level. To establish a proteome reference map we developed optimized protocols for protein extraction from tardigrades in the active state and for separation of proteins by high resolution two-dimensional gel electrophoresis. Since only limited sequence information of M. tardigradum on the genome and gene expression level is available to date in public databases we initiated in parallel a tardigrade EST sequencing project to allow for protein identification by electrospray ionization tandem mass spectrometry. 271 out of 606 analyzed protein spots could be identified by searching against the publicly available NCBInr database as well as our newly established tardigrade protein database corresponding to 144 unique proteins. Another 150 spots could be identified in the tardigrade clustered EST database corresponding to 36 unique contigs and ESTs. Proteins with annotated function were further categorized in more detail by their molecular function, biological process and cellular component. For the proteins of unknown function more information could be obtained by performing a protein domain annotation analysis. Our results include proteins like protein member of different heat shock protein families and LEA group 3, which might play important roles in surviving extreme conditions. The proteome reference map of Milnesium tardigradum provides the basis for further studies in order to identify and characterize the biochemical mechanisms of tolerance to extreme desiccation. The optimized proteomics workflow will enable application of sensitive quantification techniques to detect differences in protein expression, which are characteristic of the active and anhydrobiotic states of tardigrades.
Schokraie, Elham; Hotz-Wagenblatt, Agnes; Warnken, Uwe; Mali, Brahim; Frohme, Marcus; Förster, Frank; Dandekar, Thomas; Hengherr, Steffen; Schill, Ralph O.; Schnölzer, Martina
2010-01-01
Background Tardigrades are small, multicellular invertebrates which are able to survive times of unfavourable environmental conditions using their well-known capability to undergo cryptobiosis at any stage of their life cycle. Milnesium tardigradum has become a powerful model system for the analysis of cryptobiosis. While some genetic information is already available for Milnesium tardigradum the proteome is still to be discovered. Principal Findings Here we present to the best of our knowledge the first comprehensive study of Milnesium tardigradum on the protein level. To establish a proteome reference map we developed optimized protocols for protein extraction from tardigrades in the active state and for separation of proteins by high resolution two-dimensional gel electrophoresis. Since only limited sequence information of M. tardigradum on the genome and gene expression level is available to date in public databases we initiated in parallel a tardigrade EST sequencing project to allow for protein identification by electrospray ionization tandem mass spectrometry. 271 out of 606 analyzed protein spots could be identified by searching against the publicly available NCBInr database as well as our newly established tardigrade protein database corresponding to 144 unique proteins. Another 150 spots could be identified in the tardigrade clustered EST database corresponding to 36 unique contigs and ESTs. Proteins with annotated function were further categorized in more detail by their molecular function, biological process and cellular component. For the proteins of unknown function more information could be obtained by performing a protein domain annotation analysis. Our results include proteins like protein member of different heat shock protein families and LEA group 3, which might play important roles in surviving extreme conditions. Conclusions The proteome reference map of Milnesium tardigradum provides the basis for further studies in order to identify and characterize the biochemical mechanisms of tolerance to extreme desiccation. The optimized proteomics workflow will enable application of sensitive quantification techniques to detect differences in protein expression, which are characteristic of the active and anhydrobiotic states of tardigrades. PMID:20224743
The role of saliva in tick feeding.
Francischetti, Ivo M B; Sa-Nunes, Anderson; Mans, Ben J; Santos, Isabel M; Ribeiro, Jose M C
2009-01-01
When attempting to feed on their hosts, ticks face the problem of host hemostasis (the vertebrate mechanisms that prevent blood loss), inflammation (that can produce itching or pain and thus initiate defensive behavior on their hosts) and adaptive immunity (by way of both cellular and humoral responses). Against these barriers, ticks evolved a complex and sophisticated pharmacological armamentarium, consisting of bioactive lipids and proteins, to assist blood feeding. Recent progress in transcriptome research has uncovered that hard ticks have hundreds of different proteins expressed in their salivary glands, the majority of which have no known function, and include many novel protein families (e.g., their primary structure is unique to ticks). This review will address the vertebrate mechanisms of these barriers as a guide to identify the possible targets of these large numbers of known salivary proteins with unknown function. We additionally provide a supplemental Table that catalogues over 3,500 putative salivary proteins from various tick species, which might assist the scientific community in the process of functional identification of these unique proteins. This supplemental file is accessble fromhttp://exon.niaid.nih.gov/transcriptome/tick_review/Sup-Table-1.xls.gz.
Bukiya, Anna N.; Noskov, Sergei; Rosenhouse-Dantsker, Avia
2017-01-01
Hypercholesterolemia is a well known risk factor for the development of neurodegenerative disease. However, the underlying mechanisms are mostly unknown. In recent years, it has become increasingly evident that cholesterol-driven effects on physiology and pathophysiology derive from its ability to alter the function of a variety of membrane proteins including ion channels. Yet, the effect of cholesterol on G protein-gated inwardly rectifying potassium (GIRK) channels expressed in the brain is unknown. GIRK channels mediate the actions of inhibitory brain neurotransmitters. As a result, loss of GIRK function can enhance neuron excitability, whereas gain of GIRK function can reduce neuronal activity. Here we show that in rats on a high-cholesterol diet, cholesterol levels in hippocampal neurons are increased. We also demonstrate that cholesterol plays a critical role in modulating neuronal GIRK currents. Specifically, cholesterol enrichment of rat hippocampal neurons resulted in enhanced channel activity. In accordance, elevated currents upon cholesterol enrichment were also observed in Xenopus oocytes expressing GIRK2 channels, the primary GIRK subunit expressed in the brain. Furthermore, using planar lipid bilayers, we show that although cholesterol did not affect the unitary conductance of GIRK2, it significantly enhanced the frequency of channel openings. Last, combining computational and functional approaches, we identified two putative cholesterol-binding sites in the transmembrane domain of GIRK2. These findings establish that cholesterol plays a critical role in modulating GIRK activity in the brain. Because up-regulation of GIRK function can reduce neuronal activity, our findings may lead to novel approaches for prevention and therapy of cholesterol-driven neurodegenerative disease. PMID:28213520
Wu, Chenggang; Al Mamun, Abu Amar Mohamed; Luong, Truc Thanh; Hu, Bo; Gu, Jianhua; Lee, Ju Huck; D'Amore, Melissa; Das, Asis; Ton-That, Hung
2018-04-24
Fusobacterium nucleatum is a key member of the human oral biofilm. It is also implicated in preterm birth and colorectal cancer. To facilitate basic studies of fusobacterial virulence, we describe here a versatile transposon mutagenesis procedure and a pilot screen for mutants defective in biofilm formation. Out of 10 independent biofilm-defective mutants isolated, the affected genes included the homologs of the Escherichia coli cell division proteins FtsX and EnvC, the electron transport protein RnfA, and four proteins with unknown functions. Next, a facile new gene deletion method demonstrated that nonpolar, in-frame deletion of ftsX or envC produces viable bacteria that are highly filamentous due to defective cell division. Transmission electron and cryo-electron microscopy revealed that the Δ ftsX and Δ envC mutant cells remain joined with apparent constriction, and scanning electron microscopy (EM) uncovered a smooth cell surface without the microfolds present in wild-type cells. FtsX and EnvC proteins interact with each other as well as a common set of interacting partners, many with unknown function. Last, biofilm development is altered when cell division is blocked by MinC overproduction; however, unlike the phenotypes of Δ ftsX and Δ envC mutants, a weakly adherent biofilm is formed, and the wild-type rugged cell surface is maintained. Therefore, FtsX and EnvC may perform novel functions in Fusobacterium cell biology. This is the first report of an unbiased approach to uncover genetic determinants of fusobacterial biofilm development. It points to an intriguing link among cytokinesis, cell surface dynamics, and biofilm formation, whose molecular underpinnings remain to be elucidated. IMPORTANCE Little is known about the virulence mechanisms and associated factors in F. nucleatum , due mainly to the lack of convenient genetic tools for this organism. We employed two efficient genetic strategies to identify F. nucleatum biofilm-defective mutants, revealing FtsX and EnvC among seven biofilm-associated factors. Electron microscopy established cell division defects of the Δ ftsX and Δ envC mutants, accompanied with a smooth cell surface, unlike the microfold, rugged appearance of wild-type bacteria. Proteomic studies demonstrated that FtsX and EnvC interact with each other as well as a set of common and unique interacting proteins, many with unknown functions. Importantly, blocking cell division by MinC overproduction led to formation of a weakly adherent biofilm, without alteration of the wild-type cell surface. Thus, this work links cell division and surface dynamics to biofilm development and lays a foundation for future genetic and biochemical investigations of basic cellular processes in this clinically significant pathogen. Copyright © 2018 Wu et al.
Overexpression of a SNARE protein AtBS14b alters BR response in Arabidopsis.
Zhu, Zhong Xin; Ye, Hong Bo; Xuan, Yuan Hu; Yao, Da Nian
2014-12-01
N-ethyl-maleimide sensitive factor adaptor protein receptor (SNAREs) domain-containing proteins were known as key players in vesicle-associated membrane fusion. Genetic screening has revealed the function of SNAREs in different aspects of plant biology, but the role of many SNAREs are still unknown. In this study, we have characterized the role of Arabidopsis Qc-SNARE protein AtBS14b in brassinosteroids (BRs) signaling pathway. AtBS14b overexpression (AtBS14b ox) plants exhibited short hypocotyl and petioles lengths as well as insensitivity to exogenously supplied BR, while AtBS14b mutants did not show any visible BR-dependent morphological differences. BR biosynthesis enzyme BR6OX2 expression was slightly lower in AtBS14b ox than in wild type plants. Further BR-mediated repression of BR6OX2, CPD and DWF4 was inhibited in AtBS14b ox plants. AtBS14b-mCherry fusion protein localized in vesicular compartments surrounding plasma membrane in N. benthamiana leaves. In addition, isolation of AtBS14b-interacting BR signaling protein, which localized in plasma membrane, showed that AtBS14b directly interacted with membrane steroid binding protein 1 (MSBP1), but did not interact with BAK1 or BRI1. These data suggested that Qc-SNARE protein AtBS14b is the first SNARE protein identified that interacts with MSBP1, and the overexpression of AtBS14b modulates BR response in Arabidopsis.
The impact of different ale brewer's yeast strains on the proteome of immature beer.
Berner, Torben Sune; Jacobsen, Susanne; Arneborg, Nils
2013-09-30
It is well known that brewer's yeast affects the taste and aroma of beer. However, the influence of brewer's yeast on the protein composition of beer is currently unknown. In this study, changes of the proteome of immature beer, i.e. beer that has not been matured after fermentation, by ale brewer's yeast strains with different abilities to degrade fermentable sugars were investigated. Beers were fermented from standard hopped wort (13° Plato) using two ale brewer's yeast (Saccharomyces cerevisiae) strains with different attenuation degrees. Both immature beers had the same alcohol and protein concentrations. Immature beer and unfermented wort proteins were analysed by 2-DE and compared in order to determine protein changes arising from fermentation. Distinct protein spots in the beer and wort proteomes were identified using Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and MS/MS and revealed common beer proteins, such as lipid transfer proteins (LTP1 and LTP2), protein Z and amylase-protease inhibitors. During fermentation, two protein spots, corresponding to LTP2, disappeared, while three protein spots were exclusively found in beer. These three proteins, all derived from yeast, were identified as cell wall associated proteins, that is Exg1 (an exo-β-1,3-glucanase), Bgl2 (an endo-β-1,2-glucanase), and Uth1 (a cell wall biogenesis protein). Yeast strain dependent changes in the immature beer proteome were identified, i.e. Bgl2 was present in beer brewed with KVL011, while lacking in WLP001 beer.
The impact of different ale brewer’s yeast strains on the proteome of immature beer
2013-01-01
Background It is well known that brewer’s yeast affects the taste and aroma of beer. However, the influence of brewer’s yeast on the protein composition of beer is currently unknown. In this study, changes of the proteome of immature beer, i.e. beer that has not been matured after fermentation, by ale brewer’s yeast strains with different abilities to degrade fermentable sugars were investigated. Results Beers were fermented from standard hopped wort (13° Plato) using two ale brewer’s yeast (Saccharomyces cerevisiae) strains with different attenuation degrees. Both immature beers had the same alcohol and protein concentrations. Immature beer and unfermented wort proteins were analysed by 2-DE and compared in order to determine protein changes arising from fermentation. Distinct protein spots in the beer and wort proteomes were identified using Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and MS/MS and revealed common beer proteins, such as lipid transfer proteins (LTP1 and LTP2), protein Z and amylase-protease inhibitors. During fermentation, two protein spots, corresponding to LTP2, disappeared, while three protein spots were exclusively found in beer. These three proteins, all derived from yeast, were identified as cell wall associated proteins, that is Exg1 (an exo-β-1,3-glucanase), Bgl2 (an endo-β-1,2-glucanase), and Uth1 (a cell wall biogenesis protein). Conclusion Yeast strain dependent changes in the immature beer proteome were identified, i.e. Bgl2 was present in beer brewed with KVL011, while lacking in WLP001 beer. PMID:24079909
Goichon, Alexis; Bertrand, Julien; Chan, Philippe; Lecleire, Stéphane; Coquard, Aude; Cailleux, Anne-Françoise; Vaudry, David; Déchelotte, Pierre; Coëffier, Moïse
2015-08-01
Amino acids are well known to be key effectors of gut protein turnover. We recently reported that enteral delivery of proteins markedly stimulated global duodenal protein synthesis in carbohydrate-fed healthy humans, but specifically affected proteins remain unknown. We aimed to assess the influence of an enteral protein supply on the duodenal mucosal proteome in carbohydrate-fed humans. Six healthy volunteers received for 5 h, on 2 occasions and in random order, either an enteral infusion of maltodextrins alone (0.25 g · kg⁻¹ · h⁻¹) mimicking the fed state or maltodextrins with a protein powder (0.14 g proteins · kg⁻¹ · h⁻¹). Endoscopic duodenal biopsy specimens were then collected and frozen until analysis. A 2-dimensional polyacrylamide gel electrophoresis-based comparative proteomics analysis was then performed, and differentially expressed proteins (at least ±1.5-fold change; Student's t test, P < 0.05) were identified by mass spectrometry. Protein expression changes were confirmed by Western blot analysis. Thirty-two protein spots were differentially expressed after protein delivery compared with maltodextrins alone: 28 and 4 spots were up- or downregulated, respectively. Among the 22 identified proteins, 11 upregulated proteins were involved either in the cytoskeleton (ezrin, moesin, plastin 1, lamin B1, vimentin, and β-actin) or in protein biosynthesis (glutamyl-prolyl-transfer RNA synthetase, glutaminyl-transfer RNA synthetase, elongation factor 2, elongation factor 1δ, and eukaryotic translation and initiation factor 3 subunit f). Enteral delivery of proteins altered the duodenal mucosal proteome and mainly stimulated the expression of proteins involved in cytoskeleton and protein biosynthesis. These results suggest that protein supply may affect intestinal morphology by stimulating actin cytoskeleton remodeling. © 2015 American Society for Nutrition.
Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min
2006-08-01
To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.
Mitochondrial genome of the blackfin tuna Thunnus atlanticus Lesson, 1831 (Perciformes, Scrombidae).
Márquez, Edna J; Isaza, Juan P; Alzate, Juan F
2016-05-01
Blackfin tuna, Thunnus atlanticus is a widespread epipelagic oceanic species in the western Atlantic. So far the mitochondrial genome of this species remained unknown, although the mitogenomes of all congeners are known. The mitochondrial genome encodes for 13 proteins, 21 tRNAs, 2 ribosomal RNAs and the gene synteny is conserved with other previously reported mitogenomes of tunas.
USDA-ARS?s Scientific Manuscript database
Arabidopsis thaliana PLANT RNA HELICASE75 (AtPRH75) demonstrated an ATP-dependent, RNA duplex unwinding capacity and an ATP-independent, RNA duplex reforming ability. It is known to accumulate isoAsp, but the consequences of isoAsp formation in AtPRH75 are unknown. Duplex unwinding was abolished by ...
Escobar-Tovar, Lina; Guzmán-Quesada, Mauricio; Sandoval-Fernández, Jorge A; Gómez-Lim, Miguel A
2015-06-01
Black Sigatoka, a devastating disease of bananas and plantains worldwide, is caused by the fungus Mycosphaerella fijiensis. Several banana cultivars such as 'Yangambi Km 5' and Calcutta IV, have been known to be resistant to the fungus, but the resistance has been broken in 'Yangambi Km 5' in Costa Rica. Since the resistance of this variety still persists in Mexico, the aim of this study was to compare the in vitro and in planta secretomes from two avirulent and virulent M. fijiensis isolates using proteomics and bioinformatics approaches. We aimed to identify differentially expressed proteins in fungal isolates that differ in pathogenicity and that might be responsible for breaking the resistance in 'Yangambi Km 5'. We were able to identify 90 protein spots in the secretomes of fungal isolates encoding 42 unique proteins and 35 differential spots between them. Proteins involved in carbohydrate transport and metabolism were more prevalent. Several proteases, pathogenicity-related, ROS detoxification and unknown proteins were also highly or specifically expressed by the virulent isolate in vitro or during in planta infection. An unknown protein representing a virulence factor candidate was also identified. These results demonstrated that the secretome reflects major differences between both M. fijiensis isolates. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Chromosomal localization of murine and human oligodendrocyte-specific protein genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bronstein, J.M.; Wu, S.; Korenberg, J.R.
1996-06-01
Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.
Widespread genetic switches and toxicity resistance proteins for fluoride.
Baker, Jenny L; Sudarsan, Narasimhan; Weinberg, Zasha; Roth, Adam; Stockbridge, Randy B; Breaker, Ronald R
2012-01-13
Most riboswitches are metabolite-binding RNA structures located in bacterial messenger RNAs where they control gene expression. We have discovered a riboswitch class in many bacterial and archaeal species whose members are selectively triggered by fluoride but reject other small anions, including chloride. These fluoride riboswitches activate expression of genes that encode putative fluoride transporters, enzymes that are known to be inhibited by fluoride, and additional proteins of unknown function. Our findings indicate that most organisms are naturally exposed to toxic levels of fluoride and that many species use fluoride-sensing RNAs to control the expression of proteins that alleviate the deleterious effects of this anion.
Widespread Genetic Switches and Toxicity Resistance Proteins for Fluoride
Weinberg, Zasha; Roth, Adam; Stockbridge, Randy B.; Breaker, Ronald R.
2014-01-01
Most riboswitches are metabolite-binding RNA structures located in bacterial messenger RNAs where they control gene expression. We have discovered a riboswitch class in many bacterial and archaeal species whose members are selectively triggered by fluoride but reject other small anions, including chloride. These fluoride riboswitches activate expression of genes that encode putative fluoride transporters, enzymes that are known to be inhibited by fluoride, and additional proteins of unknown function. Our findings indicate that most organisms are naturally exposed to toxic levels of fluoride and that many species use fluoride-sensing RNAs to control the expression of proteins that alleviate the deleterious effects of this anion. PMID:22194412
Neuronal Activity and the Expression of Clathrin Assembly Protein AP180
Wu, Fangbai; Mattson, Mark P.; Yao, Pamela J.
2010-01-01
The clathrin assembly protein AP180 is known to promote the assembly of clathrin-coated vesicles in the neuron. However, it is unknown whether the expression of AP180 is influenced by neuronal activity. In this study, we report that chronic depolarization results in a reduction of AP180 from hippocampal neurons, while acute depolarization causes a dispersed synaptic distribution of AP180. Activity-induced effects are observed only for AP180, but not for the structurally-related clathrin assembly proteins CALM, epsin1, or HIP1. These findings suggest that AP180 levels and synaptic distribution are highly sensitive to neuronal activity. PMID:20937255
Twelve previously unknown phage genera are ubiquitous in global oceans.
Holmfeldt, Karin; Solonenko, Natalie; Shah, Manesh; Corrier, Kristen; Riemann, Lasse; Verberkmoes, Nathan C; Sullivan, Matthew B
2013-07-30
Viruses are fundamental to ecosystems ranging from oceans to humans, yet our ability to study them is bottlenecked by the lack of ecologically relevant isolates, resulting in "unknowns" dominating culture-independent surveys. Here we present genomes from 31 phages infecting multiple strains of the aquatic bacterium Cellulophaga baltica (Bacteroidetes) to provide data for an underrepresented and environmentally abundant bacterial lineage. Comparative genomics delineated 12 phage groups that (i) each represent a new genus, and (ii) represent one novel and four well-known viral families. This diversity contrasts the few well-studied marine phage systems, but parallels the diversity of phages infecting human-associated bacteria. Although all 12 Cellulophaga phages represent new genera, the podoviruses and icosahedral, nontailed ssDNA phages were exceptional, with genomes up to twice as large as those previously observed for each phage type. Structural novelty was also substantial, requiring experimental phage proteomics to identify 83% of the structural proteins. The presence of uncommon nucleotide metabolism genes in four genera likely underscores the importance of scavenging nutrient-rich molecules as previously seen for phages in marine environments. Metagenomic recruitment analyses suggest that these particular Cellulophaga phages are rare and may represent a first glimpse into the phage side of the rare biosphere. However, these analyses also revealed that these phage genera are widespread, occurring in 94% of 137 investigated metagenomes. Together, this diverse and novel collection of phages identifies a small but ubiquitous fraction of unknown marine viral diversity and provides numerous environmentally relevant phage-host systems for experimental hypothesis testing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Corbin, Cyrielle; Drouet, Samantha; Markulin, Lucija
Identification of DIR encoding genes in flax genome. Analysis of phylogeny, gene/protein structures and evolution. Identification of new conserved motifs linked to biochemical functions. Investigation of spatio-temporal gene expression and response to stress. Dirigent proteins (DIRs) were discovered during 8-8' lignan biosynthesis studies, through identification of stereoselective coupling to afford either (+)- or (-)-pinoresinols from E-coniferyl alcohol. DIRs are also involved or potentially involved in terpenoid, allyl/propenyl phenol lignan, pterocarpan and lignin biosynthesis. DIRs have very large multigene families in different vascular plants including flax, with most still of unknown function. DIR studies typically focus on a small subset ofmore » genes and identification of biochemical/physiological functions. Herein, a genome-wide analysis and characterization of the predicted flax DIR 44-membered multigene family was performed, this species being a rich natural grain source of 8-8' linked secoisolariciresinol-derived lignan oligomers. All predicted DIR sequences, including their promoters, were analyzed together with their public gene expression datasets. Expression patterns of selected DIRs were examined using qPCR, as well as through clustering analysis of DIR gene expression. These analyses further implicated roles for specific DIRs in (-)-pinoresinol formation in seed-coats, as well as (+)-pinoresinol in vegetative organs and/or specific responses to stress. Phylogeny and gene expression analysis segregated flax DIRs into six distinct clusters with new cluster-specific motifs identified. We propose that these findings can serve as a foundation to further systematically determine functions of DIRs, i.e. other than those already known in lignan biosynthesis in flax and other species. Given the differential expression profiles and inducibility of the flax DIR family, we provisionally propose that some DIR genes of unknown function could be involved in different aspects of secondary cell wall biosynthesis and plant defense.« less
Corbin, Cyrielle; Drouet, Samantha; Markulin, Lucija; Auguin, Daniel; Lainé, Éric; Davin, Laurence B; Cort, John R; Lewis, Norman G; Hano, Christophe
2018-05-01
Identification of DIR encoding genes in flax genome. Analysis of phylogeny, gene/protein structures and evolution. Identification of new conserved motifs linked to biochemical functions. Investigation of spatio-temporal gene expression and response to stress. Dirigent proteins (DIRs) were discovered during 8-8' lignan biosynthesis studies, through identification of stereoselective coupling to afford either (+)- or (-)-pinoresinols from E-coniferyl alcohol. DIRs are also involved or potentially involved in terpenoid, allyl/propenyl phenol lignan, pterocarpan and lignin biosynthesis. DIRs have very large multigene families in different vascular plants including flax, with most still of unknown function. DIR studies typically focus on a small subset of genes and identification of biochemical/physiological functions. Herein, a genome-wide analysis and characterization of the predicted flax DIR 44-membered multigene family was performed, this species being a rich natural grain source of 8-8' linked secoisolariciresinol-derived lignan oligomers. All predicted DIR sequences, including their promoters, were analyzed together with their public gene expression datasets. Expression patterns of selected DIRs were examined using qPCR, as well as through clustering analysis of DIR gene expression. These analyses further implicated roles for specific DIRs in (-)-pinoresinol formation in seed-coats, as well as (+)-pinoresinol in vegetative organs and/or specific responses to stress. Phylogeny and gene expression analysis segregated flax DIRs into six distinct clusters with new cluster-specific motifs identified. We propose that these findings can serve as a foundation to further systematically determine functions of DIRs, i.e. other than those already known in lignan biosynthesis in flax and other species. Given the differential expression profiles and inducibility of the flax DIR family, we provisionally propose that some DIR genes of unknown function could be involved in different aspects of secondary cell wall biosynthesis and plant defense.
2010-01-01
Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH) approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown novel proteins serve as molecular evidence for the physiological responses to arsenate stress in plants. Additionally, many of these cDNA clones showing strong upregulation due to arsenate stress could be used as valuable markers. Further characterization of these differentially expressed genes would be useful to develop novel strategies for efficient phytoremediation as well as for engineering arsenic tolerant crops with reduced arsenic translocation to the edible parts of plants. PMID:20546591
Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner
2010-10-01
Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.
NASA Astrophysics Data System (ADS)
Choi, Youngseon; Kim, Minjung; Cho, Yoojin; Yun, Eunsuk; Song, Rita
2013-02-01
Elucidation of unknown target proteins of a drug is of great importance in understanding cell biology and drug discovery. There have been extensive studies to discover and identify target proteins in the cell. Visualization of targets using drug-conjugated probes has been an important approach to gathering mechanistic information of drug action at the cellular level. As quantum dot (QD) nanocrystals have attracted much attention as a fluorescent probe in the bioimaging area, we prepared drug-conjugated QD to explore the potential of target discovery. As a model drug, we selected a well-known anticancer drug, methotrexate (MTX), which has been known to target dihydrofolate reductase (DHFR) with high affinity binding (Kd = 0.54 nM). MTX molecules were covalently attached to amino-PEG-polymer-coated QDs. Specific interactions of MTX-conjugated QDs with DHFR were identified using agarose gel electrophoresis and fluorescence microscopy. Cellular uptake of the MTX-conjugated QDs in living CHO cells was investigated with regard to their localization and distribution pattern. MTX-QD was found to be internalized into the cells via caveolae-medicated endocytosis without significant sequestration in endosomes. A colocalization experiment of the MTX-QD conjugate with antiDHFR-TAT-QD also confirmed that MTX-QD binds to the target DHFR. This study showed the potential of the drug-QD conjugate to identify or visualize drug-target interactions in the cell, which is currently of great importance in the area of drug discovery and chemical biology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bianchetti, Christopher M.; Bingman, Craig A.; Phillips, Jr., George N.
The thanatos (the Greek god of death)-associated protein (THAP) domain is a sequence-specific DNA-binding domain that contains a C2-CH (Cys-Xaa{sub 2-4}-Cys-Xaa{sub 35-50}-Cys-Xaa{sub 2}-His) zinc finger that is similar to the DNA domain of the P element transposase from Drosophila. THAP-containing proteins have been observed in the proteome of humans, pigs, cows, chickens, zebrafish, Drosophila, C. elegans, and Xenopus. To date, there are no known THAP domain proteins in plants, yeast, or bacteria. There are 12 identified human THAP domain-containing proteins (THAP0-11). In all human THAP protein, the THAP domain is located at the N-terminus and is {approx}90 residues in length.more » Although all of the human THAP-containing proteins have a homologous N-terminus, there is extensive variation in both the predicted structure and length of the remaining protein. Even though the exact function of these THAP proteins is not well defined, there is evidence that they play a role in cell proliferation, apoptosis, cell cycle modulation, chromatin modification, and transcriptional regulation. THAP-containing proteins have also been implicated in a number of human disease states including heart disease, neurological defects, and several types of cancers. Human THAP4 is a 577-residue protein of unknown function that is proposed to bind DNA in a sequence-specific manner similar to THAP1 and has been found to be upregulated in response to heat shock. THAP4 is expressed in a relatively uniform manner in a broad range of tissues and appears to be upregulated in lymphoma cells and highly expressed in heart cells. The C-terminal domain of THAP4 (residues 415-577), designated here as cTHAP4, is evolutionarily conserved and is observed in all known THAP4 orthologs. Several single-domain proteins lacking a THAP domain are found in plants and bacteria and show significant levels of homology to cTHAP4. It appears that cTHAP4 belongs to a large class of proteins that have yet to be fully functionally characterized. On the basis of prior work, we predicted that cTHAP4 is composed of a heme-binding nitrobindin domain, making THAP4 the only human THAP protein predicted to bind a cofactor. Nitrobindin, a recently characterized protein from Arabidopsis thaliana, is structurally similar and exhibits nitric oxide (NO)-binding properties that resemble the heme-binding nitrophorins. Nitrophorins use a heme moiety to store, transport, and release NO in a pH-specific manner. Although the exact function of nitrobindin is not fully known, the similarities between the well-characterized nitrophorins imply a role in NO transport, sensing, or metabolism. To better elucidate the possible function of THAP4, we solved the hemebound structure of cTHAP4 to a resolution of 1.79 {angstrom}.« less
Drosophila Protein Kinase CK2: Genetics, Regulatory Complexity and Emerging Roles during Development
Bandyopadhyay, Mohna; Arbet, Scott; Bishop, Clifton P.; Bidwai, Ashok P.
2016-01-01
CK2 is a Ser/Thr protein kinase that is highly conserved amongst all eukaryotes. It is a well-known oncogenic kinase that regulates vital cell autonomous functions and animal development. Genetic studies in the fruit fly Drosophila are providing unique insights into the roles of CK2 in cell signaling, embryogenesis, organogenesis, neurogenesis, and the circadian clock, and are revealing hitherto unknown complexities in CK2 functions and regulation. Here, we review Drosophila CK2 with respect to its structure, subunit diversity, potential mechanisms of regulation, developmental abnormalities linked to mutations in the gene encoding CK2 subunits, and emerging roles in multiple aspects of eye development. We examine the Drosophila CK2 “interaction map” and the eye-specific “transcriptome” databases, which raise the prospect that this protein kinase has many additional targets in the developing eye. We discuss the possibility that CK2 functions during early retinal neurogenesis in Drosophila and mammals bear greater similarity than has been recognized, and that this conservation may extend to other developmental programs. Together, these studies underscore the immense power of the Drosophila model organism to provide new insights and avenues to further investigate developmentally relevant targets of this protein kinase. PMID:28036067
Distinct chromosome segregation roles for spindle checkpoint proteins.
Warren, Cheryl D; Brady, D Michelle; Johnston, Raymond C; Hanna, Joseph S; Hardwick, Kevin G; Spencer, Forrest A
2002-09-01
The spindle checkpoint plays a central role in the fidelity of chromosome transmission by ensuring that anaphase is initiated only after kinetochore-microtubule associations of all sister chromatid pairs are complete. In this study, we find that known spindle checkpoint proteins do not contribute equally to chromosome segregation fidelity in Saccharomyces cerevisiae. Loss of Bub1 or Bub3 protein elicits the largest effect. Analysis of Bub1p reveals the presence of two molecular functions. An N-terminal 608-amino acid (nonkinase) portion of the protein supports robust checkpoint activity, and, as expected, contributes to chromosome segregation. A C-terminal kinase-encoding segment independently contributes to chromosome segregation through an unknown mechanism. Both molecular functions depend on association with Bub3p. A 156-amino acid fragment of Bub1p functions in Bub3p binding and in kinetochore localization by one-hybrid assay. An adjacent segment is required for Mad1p binding, detected by deletion analysis and coimmunoprecipitation. Finally, overexpression of wild-type BUB1 or MAD3 genes leads to chromosome instability. Analysis of this activity indicates that the Bub3p-binding domain of Bub1p contributes to this phenotype through disruption of checkpoint activity as well as through introduction of kinetochore or spindle damage.
Distinct Chromosome Segregation Roles for Spindle Checkpoint Proteins
Warren, Cheryl D.; Brady, D. Michelle; Johnston, Raymond C.; Hanna, Joseph S.; Hardwick, Kevin G.; Spencer, Forrest A.
2002-01-01
The spindle checkpoint plays a central role in the fidelity of chromosome transmission by ensuring that anaphase is initiated only after kinetochore-microtubule associations of all sister chromatid pairs are complete. In this study, we find that known spindle checkpoint proteins do not contribute equally to chromosome segregation fidelity in Saccharomyces cerevisiae. Loss of Bub1 or Bub3 protein elicits the largest effect. Analysis of Bub1p reveals the presence of two molecular functions. An N-terminal 608-amino acid (nonkinase) portion of the protein supports robust checkpoint activity, and, as expected, contributes to chromosome segregation. A C-terminal kinase-encoding segment independently contributes to chromosome segregation through an unknown mechanism. Both molecular functions depend on association with Bub3p. A 156-amino acid fragment of Bub1p functions in Bub3p binding and in kinetochore localization by one-hybrid assay. An adjacent segment is required for Mad1p binding, detected by deletion analysis and coimmunoprecipitation. Finally, overexpression of wild-type BUB1 or MAD3 genes leads to chromosome instability. Analysis of this activity indicates that the Bub3p-binding domain of Bub1p contributes to this phenotype through disruption of checkpoint activity as well as through introduction of kinetochore or spindle damage. PMID:12221113
The integral and extrinsic bioactive proteins in the aqueous extracted soybean oil bodies.
Zhao, Luping; Chen, Yeming; Cao, Yanyun; Kong, Xiangzhen; Hua, Yufei
2013-10-09
Soybean oil bodies (OBs), naturally pre-emulsified soybean oil, have been examined by many researchers owing to their great potential utilizations in food, cosmetics, pharmaceutical, and other applications requiring stable oil-in-water emulsions. This study was the first time to confirm that lectin, Gly m Bd 28K (Bd 28K, one soybean allergenic protein), Kunitz trypsin inhibitor (KTI), and Bowman-Birk inhibitor (BBI) were not contained in the extracted soybean OBs even by neutral pH aqueous extraction. It was clarified that the well-known Gly m Bd 30K (Bd 30K), another soybean allergenic protein, was strongly bound to soybean OBs through a disulfide bond with 24 kDa oleosin. One steroleosin isoform (41 kDa) and two caleosin isoforms (27 kDa, 29 kDa), the integral bioactive proteins, were confirmed for the first time in soybean OBs, and a considerable amount of calcium, necessary for the biological activities of caleosin, was strongly bound to OBs. Unexpectedly, it was found that 24 kDa and 18 kDa oleosins could be hydrolyzed by an unknown soybean endoprotease in the extracted soybean OBs, which might give some hints for improving the enzyme-assisted aqueous extraction processing of soybean free oil.
Necroptosis in Acute Kidney Injury.
Anders, Hans-Joachim
2018-05-31
Regulated necrosis is an expanding research field with important implications for acute kidney injury (AKI). A focused review of the evolving evidence for necroptosis in AKI, one of several forms of regulated necrosis defines the known and unknown. A literature search was performed in PUBMED and ScienceDirect between January 1957 and April 2018 using the following keywords: "acute kidney injury," "necrosis," "necroptosis," "necroinflammation." The necroptosis signaling cascade involves a number of proteins including receptor-interacting protein-1 (RIPK1), RIPK3, and mixed lineage kinase domain-like pseudokinase (MLKL) as well as the MLKL regulator RGMb. The existing experimental evidence in AKI based on mice with genetic deletions of these proteins, more or less specific inhibitory compounds, and diverse experimental AKI models is reviewed. There is broad consistency suggesting a role for necroptosis in AKI, but some studies report divergent evidence potentially relating to the specific model used and the time point of analysis. Mlkl-deficient mice are currently the most specific and reliable experimental tool to study necroptosis in vivo (in kidney disease). The clinical potential of necroptosis inhibition in AKI is to be evaluated, but conceptual problems in AKI definitions and in complex clinical scenarios remain a concern. © 2018 S. Karger AG, Basel.
Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.
Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U
2018-01-01
The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.
AnchorDock for Blind Flexible Docking of Peptides to Proteins.
Slutzki, Michal; Ben-Shimon, Avraham; Niv, Masha Y
2017-01-01
Due to increasing interest in peptides as signaling modulators and drug candidates, several methods for peptide docking to their target proteins are under active development. The "blind" docking problem, where the peptide-binding site on the protein surface is unknown, presents one of the current challenges in the field. AnchorDock protocol was developed by Ben-Shimon and Niv to address this challenge.This protocol narrows the docking search to the most relevant parts of the conformational space. This is achieved by pre-folding the free peptide and by computationally detecting anchoring spots on the surface of the unbound protein. Multiple flexible simulated annealing molecular dynamics (SAMD) simulations are subsequently carried out, starting from pre-folded peptide conformations, constrained to the various precomputed anchoring spots.Here, AnchorDock is demonstrated using two known protein-peptide complexes. A PDZ-peptide complex provides a relatively easy case due to the relatively small size of the protein, and a typical peptide conformation and binding region; a more challenging example is a complex between USP7 N-term and a p53-derived peptide, where the protein is larger, and the peptide conformation and a binding site are generally assumed to be unknown. AnchorDock returned native-like solutions ranked first and third for the PDZ and USP7 complexes, respectively. We describe the procedure step by step and discuss possible modifications where applicable.
The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses
Garcia, Rolando A. G.; Vasudevan, Kuzhalini; Buonanno, Andres
2000-01-01
Neuregulins regulate the expression of ligand- and voltage-gated channels in neurons and skeletal muscle by the activation of their cognate tyrosine kinase receptors, ErbB 1–4. The subcellular distribution and mechanisms that regulate the localization of ErbB receptors are unknown. We have found that ErbB receptors are present in brain subcellular fractions enriched for postsynaptic densities (PSD). The ErbB-4 receptor is unique among the ErbB proteins because its C-terminal tail (T-V-V) conforms to a sequence that binds to a protein motif known as the PDZ domain. Using the yeast two-hybrid system, we found that the C-terminal region of ErbB-4 interacts with the three related membrane-associated guanylate kinases (MAGUKs) PSD-95/SAP90, PSD-93/chapsyn-110, and SAP 102, which harbor three PDZ domains, as well as with β2-syntrophin, which has a single PDZ domain. As with N-methyl-d-aspartate (NMDA) receptors, ErbB4 interacts with the first two PDZ domains of PSD-95. Using coimmunoprecipitation assays, we confirmed the direct interactions between ErbB-4 and PSD-95 in transfected heterologous cells, as well as in vivo, where both proteins are coimmunoprecipitated from brain lysates. Moreover, evidence for colocalization of these proteins was also observed by immunofluorescence in cultured hippocampal neurons. ErbB-4 colocalizes with PSD-95 and NMDA receptors at a subset of excitatory synapses apposed to synaptophysin-positive presynaptic terminals. The capacity of ErbB receptors to interact with PDZ-domain proteins at cell junctions is conserved from invertebrates to mammals. As discussed, the interactions found between receptor tyrosine kinases and MAGUKs at neuronal synapses may have important implications for activity-dependent plasticity. PMID:10725395
Redox proteomics of tomato in response to Pseudomonas syringae infection
Balmant, Kelly Mayrink; Parker, Jennifer; Yoo, Mi-Jeong; Zhu, Ning; Dufresne, Craig; Chen, Sixue
2015-01-01
Unlike mammals with adaptive immunity, plants rely on their innate immunity based on pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) for pathogen defense. Reactive oxygen species, known to play crucial roles in PTI and ETI, can perturb cellular redox homeostasis and lead to changes of redox-sensitive proteins through modification of cysteine sulfhydryl groups. Although redox regulation of protein functions has emerged as an important mechanism in several biological processes, little is known about redox proteins and how they function in PTI and ETI. In this study, cysTMT proteomics technology was used to identify similarities and differences of protein redox modifications in tomato resistant (PtoR) and susceptible (prf3) genotypes in response to Pseudomonas syringae pv tomato (Pst) infection. In addition, the results of the redox changes were compared and corrected with the protein level changes. A total of 90 potential redox-regulated proteins were identified with functions in carbohydrate and energy metabolism, biosynthesis of cysteine, sucrose and brassinosteroid, cell wall biogenesis, polysaccharide/starch biosynthesis, cuticle development, lipid metabolism, proteolysis, tricarboxylic acid cycle, protein targeting to vacuole, and oxidation–reduction. This inventory of previously unknown protein redox switches in tomato pathogen defense lays a foundation for future research toward understanding the biological significance of protein redox modifications in plant defense responses. PMID:26504582
Irshad, Muhammad; Canut, Hervé; Borderies, Gisèle; Pont-Lezica, Rafael; Jamet, Elisabeth
2008-01-01
Background Cell elongation in plants requires addition and re-arrangements of cell wall components. Even if some protein families have been shown to play roles in these events, a global picture of proteins present in cell walls of elongating cells is still missing. A proteomic study was performed on etiolated hypocotyls of Arabidopsis used as model of cells undergoing elongation followed by growth arrest within a short time. Results Two developmental stages (active growth and after growth arrest) were compared. A new strategy consisting of high performance cation exchange chromatography and mono-dimensional electrophoresis was established for separation of cell wall proteins. This work allowed identification of 137 predicted secreted proteins, among which 51 had not been identified previously. Apart from expected proteins known to be involved in cell wall extension such as xyloglucan endotransglucosylase-hydrolases, expansins, polygalacturonases, pectin methylesterases and peroxidases, new proteins were identified such as proteases, proteins related to lipid metabolism and proteins of unknown function. Conclusion This work highlights the CWP dynamics that takes place between the two developmental stages. The presence of proteins known to be related to cell wall extension after growth arrest showed that these proteins may play other roles in cell walls. Finally, putative regulatory mechanisms of protein biological activity are discussed from this global view of cell wall proteins. PMID:18796151
Jelínek, Jan; Škoda, Petr; Hoksza, David
2017-12-06
Protein-protein interactions (PPI) play a key role in an investigation of various biochemical processes, and their identification is thus of great importance. Although computational prediction of which amino acids take part in a PPI has been an active field of research for some time, the quality of in-silico methods is still far from perfect. We have developed a novel prediction method called INSPiRE which benefits from a knowledge base built from data available in Protein Data Bank. All proteins involved in PPIs were converted into labeled graphs with nodes corresponding to amino acids and edges to pairs of neighboring amino acids. A structural neighborhood of each node was then encoded into a bit string and stored in the knowledge base. When predicting PPIs, INSPiRE labels amino acids of unknown proteins as interface or non-interface based on how often their structural neighborhood appears as interface or non-interface in the knowledge base. We evaluated INSPiRE's behavior with respect to different types and sizes of the structural neighborhood. Furthermore, we examined the suitability of several different features for labeling the nodes. Our evaluations showed that INSPiRE clearly outperforms existing methods with respect to Matthews correlation coefficient. In this paper we introduce a new knowledge-based method for identification of protein-protein interaction sites called INSPiRE. Its knowledge base utilizes structural patterns of known interaction sites in the Protein Data Bank which are then used for PPI prediction. Extensive experiments on several well-established datasets show that INSPiRE significantly surpasses existing PPI approaches.
Cognitive learning during surgical residency. A model for curriculum evaluation.
Rhodes, R S; Wile, M Z; Persons, M L; Shuck, J M
1987-02-01
The program summary of the American Board of Surgery In-Service Training Exam (ABSITE) can be used to quantitate cognitive learning during a surgical residency and to identify areas of curricular weakness in a residency program. Knowledge on each question is categorized as high (known) or low (unknown) depending on the percentage of residents who answered correctly. Knowledge of Level 1 (entry) residents is then compared with Level 5 (exit) residents. Each ABSITE question can thus be categorized on entry versus exit as known-known, unknown-unknown, unknown-known, and known-unknown. Only about half of unknown knowledge on entry appears to become known on exit. Very little knowledge known on entry becomes unknown on exit. Weaknesses in specific subject areas can be readily identified by ranking questions according to the number of exiting residents who answer incorrectly. Use of this technique to quantitate cognitive learning in a residency program may allow objective assessment of changes in curriculum.
Berner, Christine L; Staid, Andrea; Flage, Roger; Guikema, Seth D
2017-10-01
Recently, the concept of black swans has gained increased attention in the fields of risk assessment and risk management. Different types of black swans have been suggested, distinguishing between unknown unknowns (nothing in the past can convincingly point to its occurrence), unknown knowns (known to some, but not to relevant analysts), or known knowns where the probability of occurrence is judged as negligible. Traditional risk assessments have been questioned, as their standard probabilistic methods may not be capable of predicting or even identifying these rare and extreme events, thus creating a source of possible black swans. In this article, we show how a simulation model can be used to identify previously unknown potentially extreme events that if not identified and treated could occur as black swans. We show that by manipulating a verified and validated model used to predict the impacts of hazards on a system of interest, we can identify hazard conditions not previously experienced that could lead to impacts much larger than any previous level of impact. This makes these potential black swan events known and allows risk managers to more fully consider them. We demonstrate this method using a model developed to evaluate the effect of hurricanes on energy systems in the United States; we identify hurricanes with potentially extreme impacts, storms well beyond what the historic record suggests is possible in terms of impacts. © 2016 Society for Risk Analysis.
Characterization of myosin light chain in shrimp hemocytic phagocytosis.
Han, Fang; Wang, Zhiyong; Wang, Xiaoqing
2010-11-01
Myosin light chain, a well-known cytoskeleton gene, regulates multiple processes that are involved in material transport, muscle shrink and cell division. However, its function in phagocytosis against invading pathogens in crustacean remains unknown. In this investigation, a myosin light chain gene was obtained from Marsupenaeus japonicus shrimp. The full-length cDNA of this gene was of 766 bp and an open reading frame (ORF) of 462 bp encoding a polypeptide of 153 amino acids. The myosin light chain protein was expressed in Escherichia coli and purified. Subsequently the specific antibody was raised using the purified GST fusion protein. As revealed by immuno-electron microscopy, the myosin light chain protein was only expressed in the dark bands of muscle. In the present study, the myosin light chain gene was up-regulated in the WSSV-resistant shrimp as revealed by real-time PCR and western blot. And the phagocytic percentage and phagocytic index using FITC-labeled Vibrio parahemolyticus were remarkably increased in the WSSV-resistant shrimp, suggesting that the myosin light chain protein was essential in hemocytic phagocytosis. On the other hand, RNAi assays indicated that the phagocytic percentage and phagocytic index were significantly decreased when the myosin light chain gene was silenced by sequence-specific siRNA. These findings suggested that myosin light chain protein was involved in the regulation of hemocytic phagocytosis of shrimp. Copyright 2010 Elsevier Ltd. All rights reserved.
Orme, Rowan P; Gates, Monte A; Fricker-Gates, Rosemary A
2010-08-15
Cell transplantation using stem cell-derived neurons is commonly viewed as a candidate therapy for neurodegenerative diseases. However, methods for differentiating stem cells into homogenous populations of neurons suitable for transplant remain elusive. This suggests that there are as yet unknown signalling factors working in vivo to specify neuronal cell fate during development. These factors could be manipulated to better differentiate stem cells into neural populations useful for therapeutic transplantation. Here a quantitative proteomics approach is described for investigating cell signalling in the developing central nervous system (CNS), using the embryonic ventral mesencephalon as a model. Briefly, total protein was extracted from embryonic ventral midbrain tissue before, during and after the birth of dopaminergic neurons, and digested using trypsin. Two-dimensional liquid chromatography, coupled with tandem mass spectrometry, was then used to identify proteins from the tryptic peptides. Isobaric tagging for relative and absolute quantification (iTRAQ) reagents were used to label the tryptic peptides and facilitate relative quantitative analysis. The success of the experiment was confirmed by the identification of proteins known to be expressed in the developing ventral midbrain, as well as by Western blotting, and immunolabelling of embryonic tissue sections. This method of protein discovery improves upon previous attempts to identify novel signalling factors through microarray analysis. Importantly, the methods described here could be applied to virtually any aspect of development. (c) 2010 Elsevier B.V. All rights reserved.
Kachhap, Sangita; Priyadarshini, Pragya; Singh, Balvinder
2017-05-01
Aristaless (Al) and clawless (Cll) homeodomains that are involved in leg development in Drosophila melanogaster are known to bind cooperatively to 5'-(T/C)TAATTAA(T/A)(T/A)G-3' DNA sequence, but the mechanism of their binding to DNA is unknown. Molecular dynamics (MD) studies have been carried out on binary, ternary, and reconstructed protein-DNA complexes involving Al, Cll, and DNA along with binding free energy analysis of these complexes. Analysis of MD trajectories of Cll-3A01, binary complex reveals that C-terminal end of helixIII of Cll, unwind in the absence of Al and remains so in reconstructed ternary complex, Cll-3A01-Al. In addition, this change in secondary structure of Cll does not allow it to form protein-protein interactions with Al in the ternary reconstructed complex. However, secondary structure of Cll and its interactions are maintained in other reconstructed ternary complex, Al-3A01-Cll where Cll binds to Al-3A01, binary complex to form ternary complex. These interactions as observed during MD simulations compare well with those observed in ternary crystal structure. Thus, this study highlights the role of helixIII of Cll and protein-protein interactions while proposing likely mechanism of recognition in ternary complex, Al-Cll-DNA.
van der Ploeg, René; Goudelis, Spyridon Theodoros; den Blaauwen, Tanneke
2015-01-01
The increase in antibiotic resistant bacteria demands the development of new antibiotics against preferably new targets. The common approach is to test compounds for their ability to kill bacteria or to design molecules that inhibit essential protein activities in vitro. In the first case, the mode of action of the drug is unknown and in the second case, it is not known whether the compound will pass the impermeable barrier of the bacterial envelope. We developed an assay that detects the target of a compound, as well as its ability to pass the membrane(s) simultaneously. The Escherichia coli cytoskeletal protein MreB recruits protein complexes (elongasomes) that are essential for cell envelope growth. An in cell Förster Resonance Energy Transfer (FRET) assay was developed to detect the interaction between MreB molecules and between MreB and the elongasome proteins RodZ, RodA and PBP2. Inhibition of the polymerization of MreB by S-(3,4-dichlorobenzyl) isothiourea (A22) or of the activity of PBP2 by mecilinam resulted in loss or reduction of all measured interactions. This suggests that the interactions between the elongasome proteins are governed by a combination of weak affinities and substrate availability. This validated in cell FRET assay can be used to screen for cell envelope growth inhibitors. PMID:26263980
Douché, Thibaut; San Clemente, Hélène; Burlat, Vincent; Roujol, David; Valot, Benoît; Zivy, Michel; Pont-Lezica, Rafael; Jamet, Elisabeth
2013-08-01
Polysaccharides make up about 75% of plant cell walls and can be broken down to produce sugar substrates (saccharification) from which a whole range of products can be obtained, including bioethanol. Cell walls also contain 5-10% of proteins, which could be used to tailor them for agroindustrial uses. Here we present cell wall proteomics data of Brachypodium distachyon, a model plant for temperate grasses. Leaves and culms were analyzed during active growth and at mature stage. Altogether, 559 proteins were identified by LC-MS/MS and bioinformatics, among which 314 have predicted signal peptides. Sixty-three proteins were shared by two organs at two developmental stages where they could play housekeeping functions. Differences were observed between organs and stages of development, especially at the level of glycoside hydrolases and oxidoreductases. Differences were also found between the known cell wall proteomes of B. distachyon, Oryza sativa, and the Arabidopsis thaliana dicot. Three glycoside hydrolases could be immunolocalized in cell walls using polyclonal antibodies against proteotypic peptides. Organ-specific expression consistent with proteomics results could be observed as well as cell-specific localization. Moreover, the high number of proteins of unknown function in B. distachyon cell wall proteomes opens new fields of research for monocot cell walls. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tejera, Eduardo; Cruz-Monteagudo, Maykel; Burgos, Germán; Sánchez, María-Eugenia; Sánchez-Rodríguez, Aminael; Pérez-Castillo, Yunierkis; Borges, Fernanda; Cordeiro, Maria Natália Dias Soeiro; Paz-Y-Miño, César; Rebelo, Irene
2017-08-08
Preeclampsia is a multifactorial disease with unknown pathogenesis. Even when recent studies explored this disease using several bioinformatics tools, the main objective was not directed to pathogenesis. Additionally, consensus prioritization was proved to be highly efficient in the recognition of genes-disease association. However, not information is available about the consensus ability to early recognize genes directly involved in pathogenesis. Therefore our aim in this study is to apply several theoretical approaches to explore preeclampsia; specifically those genes directly involved in the pathogenesis. We firstly evaluated the consensus between 12 prioritization strategies to early recognize pathogenic genes related to preeclampsia. A communality analysis in the protein-protein interaction network of previously selected genes was done including further enrichment analysis. The enrichment analysis includes metabolic pathways as well as gene ontology. Microarray data was also collected and used in order to confirm our results or as a strategy to weight the previously enriched pathways. The consensus prioritized gene list was rationally filtered to 476 genes using several criteria. The communality analysis showed an enrichment of communities connected with VEGF-signaling pathway. This pathway is also enriched considering the microarray data. Our result point to VEGF, FLT1 and KDR as relevant pathogenic genes, as well as those connected with NO metabolism. Our results revealed that consensus strategy improve the detection and initial enrichment of pathogenic genes, at least in preeclampsia condition. Moreover the combination of the first percent of the prioritized genes with protein-protein interaction network followed by communality analysis reduces the gene space. This approach actually identifies well known genes related with pathogenesis. However, genes like HSP90, PAK2, CD247 and others included in the first 1% of the prioritized list need to be further explored in preeclampsia pathogenesis through experimental approaches.
Evidence Based Assessment of Public Health Planning: A Case Study of the 2014 Crisis in Ukraine
2015-06-12
Unknowns, Unknown Unknowns and the Propagation of Scientific Enquiry,” Journal of Experimental Botany 60, no. 3 (March 2009): 712-714. Risk...David C. Logan, “Known Knowns, Known Unknowns, Unknown Unknowns and the Propagation of Scientific Enquiry,” Journal of Experimental Botany 60, no. 3...Experimental Botany 60, no. 3 (March 2009): 712-714. Markel, Howard. “Facing Tuberculosis,” When Germs Travel: Six Major Epidemics That Have Invaded America
Bukiya, Anna N; Durdagi, Serdar; Noskov, Sergei; Rosenhouse-Dantsker, Avia
2017-04-14
Hypercholesterolemia is a well known risk factor for the development of neurodegenerative disease. However, the underlying mechanisms are mostly unknown. In recent years, it has become increasingly evident that cholesterol-driven effects on physiology and pathophysiology derive from its ability to alter the function of a variety of membrane proteins including ion channels. Yet, the effect of cholesterol on G protein-gated inwardly rectifying potassium (GIRK) channels expressed in the brain is unknown. GIRK channels mediate the actions of inhibitory brain neurotransmitters. As a result, loss of GIRK function can enhance neuron excitability, whereas gain of GIRK function can reduce neuronal activity. Here we show that in rats on a high-cholesterol diet, cholesterol levels in hippocampal neurons are increased. We also demonstrate that cholesterol plays a critical role in modulating neuronal GIRK currents. Specifically, cholesterol enrichment of rat hippocampal neurons resulted in enhanced channel activity. In accordance, elevated currents upon cholesterol enrichment were also observed in Xenopus oocytes expressing GIRK2 channels, the primary GIRK subunit expressed in the brain. Furthermore, using planar lipid bilayers, we show that although cholesterol did not affect the unitary conductance of GIRK2, it significantly enhanced the frequency of channel openings. Last, combining computational and functional approaches, we identified two putative cholesterol-binding sites in the transmembrane domain of GIRK2. These findings establish that cholesterol plays a critical role in modulating GIRK activity in the brain. Because up-regulation of GIRK function can reduce neuronal activity, our findings may lead to novel approaches for prevention and therapy of cholesterol-driven neurodegenerative disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Alosi, Daniela; Bisgaard, Marie Luise; Hemmingsen, Sophie Nowak; Krogh, Lotte Nylandsted; Mikkelsen, Hanne Birte; Binderup, Marie Louise Mølgaard
2017-02-01
Evaluation of the pathogenicity of a gene variant of unknown significance (VUS) is crucial for molecular diagnosis and genetic counseling, but can be challenging. This is especially so in phenotypically variable diseases, such as von Hippel-Lindau disease (vHL). vHL is caused by germline mutations in the VHL gene, which predispose to the development of multiple tumors such as central nervous system hemangioblastomas and renal cell carcinoma (RCC). We propose a method for the evaluation of VUS pathogenicity through our experience with the VHL missense mutation c.241C>T (p.P81S). 1) Clinical evaluation of known variant carriers: We evaluated a family of five VHL p.P81S carriers, as well as the clinical characteristics of all the p.P81S carriers reported in the literature; 2) Evaluation of tumor tissue via genetic analysis, histology, and immunohistochemistry (IHC); 3) Assessment of the variant's impact on protein structure and function, using multiple databases, in silico algorithms, and reports of functional studies. Only one family member had clinical signs of vHL with early-onset RCC. IHC analysis showed no VHL protein expressed in the tumor, consistent with biallelic VHL inactivation. The majority of in silico algorithms reported p.P81S as possibly pathogenic in relation to vHL or RCC, but there were discrepancies. Functional studies suggest that p.P81S impairs the VHL protein's function. The VHL p.P81S mutation is most likely a low-penetrant pathogenic variant predisposing to RCC development. We suggest the above-mentioned method for VUS evaluation with use of different methods, especially a variety of in silico methods and tumor tissue analysis.
A Novel Virus Causes Scale Drop Disease in Lates calcarifer
de Groof, Ad; Guelen, Lars; Deijs, Martin; van der Wal, Yorick; Miyata, Masato; Ng, Kah Sing; van Grinsven, Lotte; Simmelink, Bartjan; Biermann, Yvonne; Grisez, Luc; van Lent, Jan; de Ronde, Anthony; Chang, Siow Foong; Schrier, Carla; van der Hoek, Lia
2015-01-01
From 1992 onwards, outbreaks of a previously unknown illness have been reported in Asian seabass (Lates calcarifer) kept in maricultures in Southeast Asia. The most striking symptom of this emerging disease is the loss of scales. It was referred to as scale drop syndrome, but the etiology remained enigmatic. By using a next-generation virus discovery technique, VIDISCA-454, sequences of an unknown virus were detected in serum of diseased fish. The near complete genome sequence of the virus was determined, which shows a unique genome organization, and low levels of identity to known members of the Iridoviridae. Based on homology of a series of putatively encoded proteins, the virus is a novel member of the Megalocytivirus genus of the Iridoviridae family. The virus was isolated and propagated in cell culture, where it caused a cytopathogenic effect in infected Asian seabass kidney and brain cells. Electron microscopy revealed icosahedral virions of about 140 nm, characteristic for the Iridoviridae. In vitro cultured virus induced scale drop syndrome in Asian seabass in vivo and the virus could be reisolated from these infected fish. These findings show that the virus is the causative agent for the scale drop syndrome, as each of Koch’s postulates is fulfilled. We have named the virus Scale Drop Disease Virus. Vaccines prepared from BEI- and formalin inactivated virus, as well as from E. coli produced major capsid protein provide efficacious protection against scale drop disease. PMID:26252390
Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J
2010-08-03
Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.
Detection of functionally important regions in "hypothetical proteins" of known structure.
Nimrod, Guy; Schushan, Maya; Steinberg, David M; Ben-Tal, Nir
2008-12-10
Structural genomics initiatives provide ample structures of "hypothetical proteins" (i.e., proteins of unknown function) at an ever increasing rate. However, without function annotation, this structural goldmine is of little use to biologists who are interested in particular molecular systems. To this end, we used (an improved version of) the PatchFinder algorithm for the detection of functional regions on the protein surface, which could mediate its interactions with, e.g., substrates, ligands, and other proteins. Examination, using a data set of annotated proteins, showed that PatchFinder outperforms similar methods. We collected 757 structures of hypothetical proteins and their predicted functional regions in the N-Func database. Inspection of several of these regions demonstrated that they are useful for function prediction. For example, we suggested an interprotein interface and a putative nucleotide-binding site. A web-server implementation of PatchFinder and the N-Func database are available at http://patchfinder.tau.ac.il/.
Human long intrinsically disordered protein regions are frequent targets of positive selection.
Afanasyeva, Arina; Bockwoldt, Mathias; Cooney, Christopher R; Heiland, Ines; Gossmann, Toni I
2018-06-01
Intrinsically disordered regions occur frequently in proteins and are characterized by a lack of a well-defined three-dimensional structure. Although these regions do not show a higher order of structural organization, they are known to be functionally important. Disordered regions are rapidly evolving, largely attributed to relaxed purifying selection and an increased role of genetic drift. It has also been suggested that positive selection might contribute to their rapid diversification. However, for our own species, it is currently unknown whether positive selection has played a role during the evolution of these protein regions. Here, we address this question by investigating the evolutionary pattern of more than 6600 human proteins with intrinsically disordered regions and their ordered counterparts. Our comparative approach with data from more than 90 mammalian genomes uses a priori knowledge of disordered protein regions, and we show that this increases the power to detect positive selection by an order of magnitude. We can confirm that human intrinsically disordered regions evolve more rapidly, not only within humans but also across the entire mammalian phylogeny. They have, however, experienced substantial evolutionary constraint, hinting at their fundamental functional importance. We find compelling evidence that disordered protein regions are frequent targets of positive selection and estimate that the relative rate of adaptive substitutions differs fourfold between disordered and ordered protein regions in humans. Our results suggest that disordered protein regions are important targets of genetic innovation and that the contribution of positive selection in these regions is more pronounced than in other protein parts. © 2018 Afanasyeva et al.; Published by Cold Spring Harbor Laboratory Press.
Genomic and rapid effects of aldosterone: what we know and do not know thus far.
Hermidorff, Milla Marques; de Assis, Leonardo Vinícius Monteiro; Isoldi, Mauro César
2017-01-01
Aldosterone is the most known mineralocorticoid hormone synthesized by the adrenal cortex. The genomic pathway displayed by aldosterone is attributed to the mineralocorticoid receptor (MR) signaling. Even though the rapid effects displayed by aldosterone are long known, our knowledge regarding the receptor responsible for such event is still poor. It is intense that the debate whether the MR or another receptor-the "unknown receptor"-is the receptor responsible for the rapid effects of aldosterone. Recently, G protein-coupled estrogen receptor-1 (GPER-1) was elegantly shown to mediate some aldosterone-induced rapid effects in several tissues, a fact that strongly places GPER-1 as the unknown receptor. It has also been suggested that angiotensin receptor type 1 (AT1) also participates in the aldosterone-induced rapid effects. Despite this open question, the relevance of the beneficial effects of aldosterone is clear in the kidneys, colon, and CNS as aldosterone controls the important water reabsorption process; on the other hand, detrimental effects displayed by aldosterone have been reported in the cardiovascular system and in the kidneys. In this line, the MR antagonists are well-known drugs that display beneficial effects in patients with heart failure and hypertension; it has been proposed that MR antagonists could also play an important role in vascular disease, obesity, obesity-related hypertension, and metabolic syndrome. Taken altogether, our goal here was to (1) bring a historical perspective of both genomic and rapid effects of aldosterone in several tissues, and the receptors and signaling pathways involved in such processes; and (2) critically address the controversial points within the literature as regarding which receptor participates in the rapid pathway display by aldosterone.
USING THE MEDAKA EMBRYO ASSAY TO INVESTIGATE DEVELOPMENTAL ETHANOL TOXICITY.
Ethanol (EtOH) is a well-known developmental toxicant that produces a range of abnormal phenotypes. While the toxic potential of developmental EtOH exposure is well characterized, the effect of the timing of exposure on the extent of toxicity remains unknown. Fish models such as ...
The Association between Sensation Seeking and Well-Being among College-Attending Emerging Adults
ERIC Educational Resources Information Center
Ravert, Russell D.; Kim, Su Yeong; Schwartz, Seth J.; Weisskirch, Robert S.; Zamboanga, Byron L.; Ham, Lindsay S.; Donnellan, M. Brent; Bersamin, Melina M.
2013-01-01
Sensation seeking is a known risk factor for unsafe and reckless behavior among college students, but its association with well-being is unknown. Given that exploration plays an important psychosocial role during the transition to adulthood, we examined the possibility that sensation seeking is also associated with psychological well-being. In a…
Plastid intramembrane proteolysis.
Adam, Zach
2015-09-01
Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has not surpassed plant biology. Nevertheless, reports on RIP in plants, and especially in chloroplasts, are still scarce. Of the four different families of intramembrane proteases, only two have been linked to chloroplasts so far, rhomboids and site-2 proteases (S2Ps). The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology, probably due to perturbations in jasmonic acid biosynthesis, which occurs in chloroplasts. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development, through a yet unknown mechanism. To date, the only known substrate of RIP in chloroplasts is a PHD transcription factor, located in the envelope. Upon proteolytic cleavage by an unknown protease, the soluble N-terminal domain of this protein is released from the membrane and relocates to the nucleus, where it activates the transcription of the ABA response gene ABI4. Continuing studies on these proteases and substrates, as well as identification of the genes responsible for different chloroplast mutant phenotypes, are expected to shed more light on the roles of intramembrane proteases in chloroplast biology. Copyright © 2015 Elsevier B.V. All rights reserved.
Falkner, Jayson; Andrews, Philip
2005-05-15
Comparing tandem mass spectra (MSMS) against a known dataset of protein sequences is a common method for identifying unknown proteins; however, the processing of MSMS by current software often limits certain applications, including comprehensive coverage of post-translational modifications, non-specific searches and real-time searches to allow result-dependent instrument control. This problem deserves attention as new mass spectrometers provide the ability for higher throughput and as known protein datasets rapidly grow in size. New software algorithms need to be devised in order to address the performance issues of conventional MSMS protein dataset-based protein identification. This paper describes a novel algorithm based on converting a collection of monoisotopic, centroided spectra to a new data structure, named 'peptide finite state machine' (PFSM), which may be used to rapidly search a known dataset of protein sequences, regardless of the number of spectra searched or the number of potential modifications examined. The algorithm is verified using a set of commercially available tryptic digest protein standards analyzed using an ABI 4700 MALDI TOFTOF mass spectrometer, and a free, open source PFSM implementation. It is illustrated that a PFSM can accurately search large collections of spectra against large datasets of protein sequences (e.g. NCBI nr) using a regular desktop PC; however, this paper only details the method for identifying peptide and subsequently protein candidates from a dataset of known protein sequences. The concept of using a PFSM as a peptide pre-screening technique for MSMS-based search engines is validated by using PFSM with Mascot and XTandem. Complete source code, documentation and examples for the reference PFSM implementation are freely available at the Proteome Commons, http://www.proteomecommons.org and source code may be used both commercially and non-commercially as long as the original authors are credited for their work.
Palmieri, Ferdinando; Agrimi, Gennaro; Blanco, Emanuela; Castegna, Alessandra; Di Noia, Maria A; Iacobazzi, Vito; Lasorsa, Francesco M; Marobbio, Carlo M T; Palmieri, Luigi; Scarcia, Pasquale; Todisco, Simona; Vozza, Angelo; Walker, John
2006-01-01
The inner membranes of mitochondria contain a family of carrier proteins that are responsible for the transport in and out of the mitochondrial matrix of substrates, products, co-factors and biosynthetic precursors that are essential for the function and activities of the organelle. This family of proteins is characterized by containing three tandem homologous sequence repeats of approximately 100 amino acids, each folded into two transmembrane alpha-helices linked by an extensive polar loop. Each repeat contains a characteristic conserved sequence. These features have been used to determine the extent of the family in genome sequences. The genome of Saccharomyces cerevisiae contains 34 members of the family. The identity of five of them was known before the determination of the genome sequence, but the functions of the remaining family members were not. This review describes how the functions of 15 of these previously unknown transport proteins have been determined by a strategy that consists of expressing the genes in Escherichia coli or Saccharomyces cerevisiae, reconstituting the gene products into liposomes and establishing their functions by transport assay. Genetic and biochemical evidence as well as phylogenetic considerations have guided the choice of substrates that were tested in the transport assays. The physiological roles of these carriers have been verified by genetic experiments. Various pieces of evidence point to the functions of six additional members of the family, but these proposals await confirmation by transport assay. The sequences of many of the newly identified yeast carriers have been used to characterize orthologs in other species, and in man five diseases are presently known to be caused by defects in specific mitochondrial carrier genes. The roles of eight yeast mitochondrial carriers remain to be established.
Popescu, Sorina C.; Popescu, George V.; Bachan, Shawn; Zhang, Zimei; Seay, Montrell; Gerstein, Mark; Snyder, Michael; Dinesh-Kumar, S. P.
2007-01-01
Calmodulins (CaMs) are the most ubiquitous calcium sensors in eukaryotes. A number of CaM-binding proteins have been identified through classical methods, and many proteins have been predicted to bind CaMs based on their structural homology with known targets. However, multicellular organisms typically contain many CaM-like (CML) proteins, and a global identification of their targets and specificity of interaction is lacking. In an effort to develop a platform for large-scale analysis of proteins in plants we have developed a protein microarray and used it to study the global analysis of CaM/CML interactions. An Arabidopsis thaliana expression collection containing 1,133 ORFs was generated and used to produce proteins with an optimized medium-throughput plant-based expression system. Protein microarrays were prepared and screened with several CaMs/CMLs. A large number of previously known and novel CaM/CML targets were identified, including transcription factors, receptor and intracellular protein kinases, F-box proteins, RNA-binding proteins, and proteins of unknown function. Multiple CaM/CML proteins bound many binding partners, but the majority of targets were specific to one or a few CaMs/CMLs indicating that different CaM family members function through different targets. Based on our analyses, the emergent CaM/CML interactome is more extensive than previously predicted. Our results suggest that calcium functions through distinct CaM/CML proteins to regulate a wide range of targets and cellular activities. PMID:17360592
Problems in understanding the structure and assembly of viruses
DOE Office of Scientific and Technical Information (OSTI.GOV)
King, J.
1997-12-01
Though viruses infect the cells of all groups of animals, plants, and microorganisms, their structures follow a limited number of general themes; spherical or cylindrical shells built of hundreds of repeated protein subunits enclosing a nucleic acid - DNA or RNA - genome. Since the 1960s it has been known that the protein shells of spherical viruses in fact conform to icosahedral symmetry or to subtle deviations from icosahedral symmetry. The construction of the shell lattices and the transformations they go through in the different stages of the viral life cycle are not fully understood. The shells contain the nucleicmore » in a highly condensed state, of unknown coiling/organization. Features of the well studied bacterial viruses will be reviewed, with examples from adenoviruses, herpesviruses, poliovirus, and HIV. The emergence of new viral disease has led to increased interest in the development of agents which interfere with virus reproduction at the level of the assembly or function of the organized particle. Recently computational approaches to the problem of virus assembly have made important contributions to clarifying shell assembly processes. 1 ref.« less
Verma, Anju; Lee, Chris; Morriss, Stephanie; Odu, Fiona; Kenning, Charlotte; Rizzo, Nancy; Spollen, William G; Lin, Marriam; McRae, Amanda G; Givan, Scott A; Hewezi, Tarek; Hussey, Richard; Davis, Eric L; Baum, Thomas J; Mitchum, Melissa G
2018-05-04
Cyst nematodes deliver effector proteins into host cells to manipulate cellular processes and establish a metabolically hyperactive feeding site. The novel 30D08 effector protein is produced in the dorsal gland of parasitic juveniles, but its function has remained unknown. We demonstrate that expression of 30D08 contributes to nematode parasitism, the protein is packaged into secretory granules and it is targeted to the plant nucleus where it interacts with SMU2 (homolog of suppressor of mec-8 and unc-52 2), an auxiliary spliceosomal protein. We show that SMU2 is expressed in feeding sites and an smu2 mutant is less susceptible to nematode infection. In Arabidopsis expressing 30D08 under the SMU2 promoter, several genes were found to be alternatively spliced and the most abundant functional classes represented among differentially expressed genes were involved in RNA processing, transcription and binding, as well as in development, and hormone and secondary metabolism, representing key cellular processes known to be important for feeding site formation. In conclusion, we demonstrated that the 30D08 effector is secreted from the nematode and targeted to the plant nucleus where its interaction with a host auxiliary spliceosomal protein may alter the pre-mRNA splicing and expression of a subset of genes important for feeding site formation. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.
Wang, Nan; Zhang, Yeting; Gedvilaite, Erika; Loh, Jui Wan; Lin, Timothy; Liu, Xiuping; Liu, Chang-Gong; Kumar, Dibyendu; Donnelly, Robert; Raymond, Kimiyo; Schuchman, Edward H; Sleat, David E; Lobel, Peter; Xing, Jinchuan
2017-11-01
Lysosomes are membrane-bound, acidic eukaryotic cellular organelles that play important roles in the degradation of macromolecules. Mutations that cause the loss of lysosomal protein function can lead to a group of disorders categorized as the lysosomal storage diseases (LSDs). Suspicion of LSD is frequently based on clinical and pathologic findings, but in some cases, the underlying genetic and biochemical defects remain unknown. Here, we performed whole-exome sequencing (WES) on 14 suspected LSD cases to evaluate the feasibility of using WES for identifying causal mutations. By examining 2,157 candidate genes potentially associated with lysosomal function, we identified eight variants in five genes as candidate disease-causing variants in four individuals. These included both known and novel mutations. Variants were corroborated by targeted sequencing and, when possible, functional assays. In addition, we identified nonsense mutations in two individuals in genes that are not known to have lysosomal function. However, mutations in these genes could have resulted in phenotypes that were diagnosed as LSDs. This study demonstrates that WES can be used to identify causal mutations in suspected LSD cases. We also demonstrate cases where a confounding clinical phenotype may potentially reflect more than one lysosomal protein defect. © 2017 Wiley Periodicals, Inc.
Jogler, Christian; Waldmann, Jost; Huang, Xiaoluo; Jogler, Mareike; Glöckner, Frank Oliver; Mascher, Thorsten; Kolter, Roberto
2012-12-01
Members of the Planctomycetes clade share many unusual features for bacteria. Their cytoplasm contains membrane-bound compartments, they lack peptidoglycan and FtsZ, they divide by polar budding, and they are capable of endocytosis. Planctomycete genomes have remained enigmatic, generally being quite large (up to 9 Mb), and on average, 55% of their predicted proteins are of unknown function. Importantly, proteins related to the unusual traits of Planctomycetes remain largely unknown. Thus, we embarked on bioinformatic analyses of these genomes in an effort to predict proteins that are likely to be involved in compartmentalization, cell division, and signal transduction. We used three complementary strategies. First, we defined the Planctomycetes core genome and subtracted genes of well-studied model organisms. Second, we analyzed the gene content and synteny of morphogenesis and cell division genes and combined both methods using a "guilt-by-association" approach. Third, we identified signal transduction systems as well as sigma factors. These analyses provide a manageable list of candidate genes for future genetic studies and provide evidence for complex signaling in the Planctomycetes akin to that observed for bacteria with complex life-styles, such as Myxococcus xanthus.
Recovery of known T-cell epitopes by computational scanning of a viral genome
NASA Astrophysics Data System (ADS)
Logean, Antoine; Rognan, Didier
2002-04-01
A new computational method (EpiDock) is proposed for predicting peptide binding to class I MHC proteins, from the amino acid sequence of any protein of immunological interest. Starting from the primary structure of the target protein, individual three-dimensional structures of all possible MHC-peptide (8-, 9- and 10-mers) complexes are obtained by homology modelling. A free energy scoring function (Fresno) is then used to predict the absolute binding free energy of all possible peptides to the class I MHC restriction protein. Assuming that immunodominant epitopes are usually found among the top MHC binders, the method can thus be applied to predict the location of immunogenic peptides on the sequence of the protein target. When applied to the prediction of HLA-A*0201-restricted T-cell epitopes from the Hepatitis B virus, EpiDock was able to recover 92% of known high affinity binders and 80% of known epitopes within a filtered subset of all possible nonapeptides corresponding to about one tenth of the full theoretical list. The proposed method is fully automated and fast enough to scan a viral genome in less than an hour on a parallel computing architecture. As it requires very few starting experimental data, EpiDock can be used: (i) to predict potential T-cell epitopes from viral genomes (ii) to roughly predict still unknown peptide binding motifs for novel class I MHC alleles.
Park, Arnold; Yun, Tatyana; Vigant, Frederic; Pernet, Olivier; Won, Sohui T; Dawes, Brian E; Bartkowski, Wojciech; Freiberg, Alexander N; Lee, Benhur
2016-05-01
The budding of Nipah virus, a deadly member of the Henipavirus genus within the Paramyxoviridae, has been thought to be independent of the host ESCRT pathway, which is critical for the budding of many enveloped viruses. This conclusion was based on the budding properties of the virus matrix protein in the absence of other virus components. Here, we find that the virus C protein, which was previously investigated for its role in antagonism of innate immunity, recruits the ESCRT pathway to promote efficient virus release. Inhibition of ESCRT or depletion of the ESCRT factor Tsg101 abrogates the C enhancement of matrix budding and impairs live Nipah virus release. Further, despite the low sequence homology of the C proteins of known henipaviruses, they all enhance the budding of their cognate matrix proteins, suggesting a conserved and previously unknown function for the henipavirus C proteins.
NASA Astrophysics Data System (ADS)
Baker, Edward N.; Proft, Thomas; Kang, Haejoo
Proteins displayed on the cell surfaces of pathogenic organisms are the front-line troops of bacterial attack, playing critical roles in colonization, infection and virulence. Although such proteins can often be recognized from genome sequence data, through characteristic sequence motifs, their functions are often unknown. One such group of surface proteins is attached to the cell surface of Gram-positive pathogens through the action of sortase enzymes. Some of these proteins are now known to form pili: long filamentous structures that mediate attachment to human cells. Crystallographic analyses of these and other cell surface proteins have uncovered novel features in their structure, assembly and stability, including the presence of inter- and intramolecular isopeptide crosslinks. This improved understanding of structures on the bacterial cell surface offers opportunities for the development of some new drug targets and for novel approaches to vaccine design.
Ribeiro, José Marcos C.; Labruna, Marcelo B.; Mans, Ben J.; Maruyama, Sandra Regina; Francischetti, Ivo M. B.; Barizon, Gustavo Canavaci; de Miranda Santos, Isabel K. F.
2012-01-01
The hosts for Antricola delacruzi ticks are insectivorous, cave-dwelling bats on which only larvae are found. The mouthparts of nymphal and adult A. delacruzi are compatible with scavenging feeding because the hypostome is small and toothless. How a single blood meal of a larva provides energy for several molts as well as for oviposition by females is not known. Adults of A. delacruzi possibly feed upon an unknown food source in bat guano, a substrate on which nymphal and adult stages are always found. Guano produced by insectivorous bats contains twice the amount of protein and 60 times the amount of iron as beef. In addition, bacteria and chitin-rich fungi proliferate on guano. Comparative data on the transcriptome of the salivary glands of A. delacruzi is nonexistent and would help to understand the physiological adaptations of salivary glands that accompany different sources of food as well as the steps taken by the Acari towards haematophagy, believed to have evolved from scavenging dead animals. Annotation of the transcriptome of salivary glands from female instars of A. delacruzi collected on guano categorized 5.7% of the clusters of expressed genes as putative secreted proteins. They included abundantly expressed TIL domain-containing proteins (possible anti-microbials), an abundantly expressed protein similar to a serum amyloid found in the sialotranscriptomes of Ornithodoros spp., a savignygrin, a family of mucin/peritrophin/cuticle-like proteins, antimicrobials and an HIV envelope-like glycoprotein also found in soft ticks. When comparing the transcriptome of A. delacruzi with those of blood-feeding female soft and hard ticks some notable differences were observed; they consisted of the following transcripts over- or under-represented or absent in the sialotranscriptome of A. delacuzi that may reflect its source of food: ferritin, mucins with chitin-binding domains and TIL domain-containing proteins versus lipocalins, basic tail proteins, metalloproteases, glycine-rich proteins and Kunitz protease inhibitors, respectively. PMID:22306723
Harnessing Diversity towards the Reconstructing of Large Scale Gene Regulatory Networks
Yamanaka, Ryota; Kitano, Hiroaki
2013-01-01
Elucidating gene regulatory network (GRN) from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i) a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii) TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks. PMID:24278007
Detection of a troponin I-like protein in non-striated muscle of the tardigrades (water bears)
Obinata, Takashi; Ono, Kanako
2011-01-01
Tardigrades, also known as water bears, have somatic muscle fibers that are responsible for movement of their body and legs. These muscle fibers contain thin and thick filaments in a non-striated pattern. However, the regulatory mechanism of muscle contraction in tardigrades is unknown. In the absence of extensive molecular and genomic information, we detected a protein of 31 kDa in whole lysates of tardigrades that cross-reacted with the antibody raised against nematode troponin I (TnI). TnI is a component of the troponin complex that regulates actin-myosin interaction in a Ca2+-dependent and actin-linked manner. This TnI-like protein was co-extracted with actin in a buffer containing ATP and EGTA, which is known to induce relaxation of a troponin-regulated contractile system. The TnI-like protein was specifically expressed in the somatic muscle fibers in adult animals and partially co-localized with actin filaments in a non-striated manner. Interestingly, the pharyngeal muscle did not express this protein. These observations suggest that the non-striated somatic muscle of tardigrades has an actin-linked and troponin-regulated system for muscle contraction. PMID:21866271
On the joint bimodality of temperature and moisture near stratocumulus cloud tops
NASA Technical Reports Server (NTRS)
Randall, D. A.
1983-01-01
The observed distributions of the thermodynamic variables near stratocumulus top are highly bimodal. Two simple models of sub-grid fractional cloudiness motivated by this observed bimodality are examined. In both models, certain low order moments of two independent, moist-conservative thermodynamic variables are assumed to be known. The first model is based on the assumption of two discrete populations of parcels: a warm-day population and a cool-moist population. If only the first and second moments are assumed to be known, the number of unknowns exceeds the number of independent equations. If the third moments are assumed to be known as well, the number of independent equations exceeds the number of unknowns. The second model is based on the assumption of a continuous joint bimodal distribution of parcels, obtained as the weighted sum of two binormal distributions. For this model, the third moments are used to obtain 9 independent nonlinear algebraic equations in 11 unknowns. Two additional equations are needed to determine the covariance within the two subpopulations. In case these two internal covariance vanish, the system of equations can be solved analytically.
Sequence co-evolution gives 3D contacts and structures of protein complexes
Hopf, Thomas A; Schärfe, Charlotta P I; Rodrigues, João P G L M; Green, Anna G; Kohlbacher, Oliver; Sander, Chris; Bonvin, Alexandre M J J; Marks, Debora S
2014-01-01
Protein–protein interactions are fundamental to many biological processes. Experimental screens have identified tens of thousands of interactions, and structural biology has provided detailed functional insight for select 3D protein complexes. An alternative rich source of information about protein interactions is the evolutionary sequence record. Building on earlier work, we show that analysis of correlated evolutionary sequence changes across proteins identifies residues that are close in space with sufficient accuracy to determine the three-dimensional structure of the protein complexes. We evaluate prediction performance in blinded tests on 76 complexes of known 3D structure, predict protein–protein contacts in 32 complexes of unknown structure, and demonstrate how evolutionary couplings can be used to distinguish between interacting and non-interacting protein pairs in a large complex. With the current growth of sequences, we expect that the method can be generalized to genome-wide elucidation of protein–protein interaction networks and used for interaction predictions at residue resolution. DOI: http://dx.doi.org/10.7554/eLife.03430.001 PMID:25255213
Intrinsically disordered chromatin protein NUPR1 binds to the C-terminal region of Polycomb RING1B
Santofimia-Castaño, Patricia; Rizzuti, Bruno; Pey, Ángel L.; Soubeyran, Philippe; Vidal, Miguel; Urrutia, Raúl; Iovanna, Juan L.; Neira, José L.
2017-01-01
Intrinsically disordered proteins (IDPs) are ubiquitous in eukaryotes, and they are often associated with diseases in humans. The protein NUPR1 is a multifunctional IDP involved in chromatin remodeling and in the development and progression of pancreatic cancer; however, the details of such functions are unknown. Polycomb proteins are involved in specific transcriptional cascades and gene silencing. One of the proteins of the Polycomb complex is the Ring finger protein 1 (RING1). RING1 is related to aggressive tumor features in multiple cancer types. In this work we characterized the interaction between NUPR1 and the paralogue RING1B in vitro, in silico, and in cellulo. The interaction occurred through the C-terminal region of RING1B (C-RING1B), with an affinity in the low micromolar range (∼10 μM). The binding region of NUPR1, mapped by NMR, was a hydrophobic polypeptide patch at the 30s region of its sequence, as pinpointed by computational results and site-directed mutagenesis at Ala33. The association between C-RING1B and wild-type NUPR1 also occurred in cellulo as tested by protein ligation assays; this interaction is inhibited by trifluoperazine, a drug known to hamper binding of wild-type NUPR1 with other proteins. Furthermore, the Thr68Gln and Ala33Gln/Thr68Gln mutants had a reduction in the binding toward C-RING1B as shown by in vitro, in silico, and in cellulo studies. This is an example of a well-folded partner of NUPR1, because its other interacting proteins are also unfolded. We hypothesize that NUPR1 plays an active role in chromatin remodeling and carcinogenesis, together with Polycomb proteins. PMID:28720707
Definition of tumor-associated antigens in hepatocellular carcinoma.
Stenner-Liewen, F; Luo, G; Sahin, U; Tureci, O; Koslovski, M; Kautz, I; Liewen, H; Pfreundschuh, M
2000-03-01
With an estimated annual incidence of about one million cases, hepatocellular carcinoma (HCC) is one of the most common neoplasms worldwide. Of all malignant diseases, it is the major cause of death in some regions of Africa and Asia. The pathogenic mechanisms responsible for HCC are not well defined, and therapeutic means, especially in inoperable HCCs, are still unsatisfactory and await improvement. In the quest for tumor antigens exploitable for gene therapy, we studied immune responses in the context of HCC. A cDNA library derived from a human HCC sample was screened using the SEREX approach. Nineteen distinct antigens reactive with autologous IgG were identified. Sequence analysis revealed three of the cDNA clones to code for hitherto unknown proteins and 16 known genes products. Proteins as diverse in function as LDH, albumin, and kinectin were found. Furthermore, proteins involved in the transcription/translation machinery had elicited an immune response in the autologous host. A panel of allogenic sera including sera from patients with hepatitis, liver cirrhosis, HCC, and other tumor entities, as well as sera from normal individuals, was used for frequency analysis of antibody responses. Whereas allogenic sera of HCC patients detected most antigens at a high percentage, control sera were rarely antibody-positive. The nature of the major fraction of antigens described here are linked to liver. Thus, our findings demonstrate not only the complexity of the humoral immune response against HCC, but may also offer new insight into mechanisms underlying transformation of the liver cell.
NASA Astrophysics Data System (ADS)
Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.
2015-11-01
Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.
SELF-BLM: Prediction of drug-target interactions via self-training SVM.
Keum, Jongsoo; Nam, Hojung
2017-01-01
Predicting drug-target interactions is important for the development of novel drugs and the repositioning of drugs. To predict such interactions, there are a number of methods based on drug and target protein similarity. Although these methods, such as the bipartite local model (BLM), show promise, they often categorize unknown interactions as negative interaction. Therefore, these methods are not ideal for finding potential drug-target interactions that have not yet been validated as positive interactions. Thus, here we propose a method that integrates machine learning techniques, such as self-training support vector machine (SVM) and BLM, to develop a self-training bipartite local model (SELF-BLM) that facilitates the identification of potential interactions. The method first categorizes unlabeled interactions and negative interactions among unknown interactions using a clustering method. Then, using the BLM method and self-training SVM, the unlabeled interactions are self-trained and final local classification models are constructed. When applied to four classes of proteins that include enzymes, G-protein coupled receptors (GPCRs), ion channels, and nuclear receptors, SELF-BLM showed the best performance for predicting not only known interactions but also potential interactions in three protein classes compare to other related studies. The implemented software and supporting data are available at https://github.com/GIST-CSBL/SELF-BLM.
Generation and Analysis of Expressed Sequence Tags from Olea europaea L.
Ozdemir Ozgenturk, Nehir; Oruç, Fatma; Sezerman, Ugur; Kuçukural, Alper; Vural Korkut, Senay; Toksoz, Feriha; Un, Cemal
2010-01-01
Olive (Olea europaea L.) is an important source of edible oil which was originated in Near-East region. In this study, two cDNA libraries were constructed from young olive leaves and immature olive fruits for generation of ESTs to discover the novel genes and search the function of unknown genes of olive. The randomly selected 3840 colonies were sequenced for EST collection from both libraries. Readable 2228 sequences for olive leaf and 1506 sequences for olive fruit were assembled into 205 and 69 contigs, respectively, whereas 2478 were singletons. Putative functions of all 2752 differentially expressed unique sequences were designated by gene homology based on BLAST and annotated using BLAST2GO. While 1339 ESTs show no homology to the database, 2024 ESTs have homology (under 80%) with hypothetical proteins, putative proteins, expressed proteins, and unknown proteins in NCBI-GenBank. 635 EST's unique genes sequence have been identified by over 80% homology to known function in other species which were not previously described in Olea family. Only 3.1% of total EST's was shown similarity with olive database existing in NCBI. This generated EST's data and consensus sequences were submitted to NCBI as valuable source for functional genome studies of olive. PMID:21197085
SEQATOMS: a web tool for identifying missing regions in PDB in sequence context.
Brandt, Bernd W; Heringa, Jaap; Leunissen, Jack A M
2008-07-01
With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their position in space is unknown. Similarity searches are routinely carried out against sequences taken from PDB SEQRES. However, there no distinction is made between residues that have a known or unknown position in the 3D protein structure. We present a FASTA sequence database that is produced by combining the sequence and coordinate information. All residues absent from the PDB coordinate section are masked with lower-case letters, thereby providing a view of these residues in the context of the entire protein sequence, which facilitates inspecting 'missing' regions. We also provide a masked version of the CATH domain database. A user-friendly BLAST interface is available for similarity searching. In contrast to standard (stand-alone) BLAST output, which only contains upper-case letters, our output retains the lower-case letters of the masked regions. Thus, our server can be used to perform BLAST searching case-sensitively. Here, we have applied it to the study of missing regions in their sequence context. SEQATOMS is available at http://www.bioinformatics.nl/tools/seqatoms/.
Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-01-01
Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259
Patel, Meghna V; Zhu, Jun-Yi; Jiang, Zhiping; Richman, Adam; VanBerkum, Mark F A; Han, Zhe
2016-06-01
G-protein signaling is known to be required for cell-cell contacts during the development of the Drosophila dorsal vessel. However, the identity of the G protein-coupled receptor (GPCR) that regulates this signaling pathway activity is unknown. Here we describe the identification of a novel cardiac specific GPCR, called Gia, for "GPCR in aorta". Gia is the only heart-specific GPCR identified in Drosophila to date and it is specifically expressed in cardioblasts that fuse at the dorsal midline to become the aorta. Gia is the only Drosophila gene so far identified for which expression is entirely restricted to cells of the aorta. Deletion of Gia led to a broken-hearted phenotype, characterized by pericardial cells dissociated from cardioblasts and abnormal distribution of cell junction proteins. Both phenotypes were similar to those observed in mutants of the heterotrimeric cardiac G proteins. Lack of Gia also led to defects in the alignment and fusion of cardioblasts in the aorta. Gia forms a protein complex with G-αo47A, the alpha subunit of the heterotrimeric cardiac G proteins and interacts genetically with G-αo47A during cardiac morphogenesis. Our study identified Gia as an essential aorta-specific GPCR that functions upstream of cardiac heterotrimeric G proteins and is required for morphological integrity of the aorta during heart tube formation. These studies lead to a redefinition of the bro phenotype, to encompass morphological integrity of the heart tube as well as cardioblast-pericardial cell spatial interactions. Copyright © 2016 Elsevier Inc. All rights reserved.
Real-time ligand binding pocket database search using local surface descriptors.
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-07-01
Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.
GBF-dependent family genes morphologically suppress the partially active Dictyostelium STATa strain.
Shimada, Nao; Kanno-Tanabe, Naoko; Minemura, Kakeru; Kawata, Takefumi
2008-02-01
Transcription factor Dd-STATa, a functional Dictyostelium homologue of metazoan signal transducers and activators of transcription proteins, is necessary for culmination during development. We have isolated more than 18 putative multicopy suppressors of Dd-STATa using genetic screening. One was hssA gene, whose expression is known to be G-box-binding-factor-dependent and which was specific to prestalk A (pstA) cells, where Dd-STATa is activated. Also, hssA mRNA was expressed in pstA cells in the Dd-STATa-null mutant. At least 40 hssA-related genes are present in the genome and constitute a multigene family. The tagged HssA protein was translated; hssA encodes an unusually high-glycine-serine-rich small protein (8.37 kDa), which has strong homology to previously reported cyclic-adenosine-monophosphate-inducible 2C and 7E proteins. Overexpression of hssA mRNA as well as frame-shifted versions of hssA RNA suppressed the phenotype of the partially active Dd-STATa strain, suggesting that translation is not necessary for suppression. Although overexpression of prespore-specific genes among the family did not suppress the parental phenotype, prestalk-specific family members did. Although overexpression of the hssA did not revert the expression of Dd-STATa target genes, and although its suppression mechanism remains unknown, morphological reversion implies functional relationships between Dd-STATa and hssA.
Fatiguing contractions increase protein S-glutathionylation occupancy in mouse skeletal muscle.
Kramer, Philip A; Duan, Jicheng; Gaffrey, Matthew J; Shukla, Anil K; Wang, Lu; Bammler, Theo K; Qian, Wei-Jun; Marcinek, David J
2018-05-23
Protein S-glutathionylation is an important reversible post-translational modification implicated in redox signaling. Oxidative modifications to protein thiols can alter the activity of metabolic enzymes, transcription factors, kinases, phosphatases, and the function of contractile proteins. However, the extent to which muscle contraction induces oxidative modifications in redox sensitive thiols is not known. The purpose of this study was to determine the targets of S-glutathionylation redox signaling following fatiguing contractions. Anesthetized adult male CB6F1 (BALB/cBy × C57BL/6) mice were subjected to acute fatiguing contractions for 15 min using in vivo stimulations. The right (stimulated) and left (unstimulated) gastrocnemius muscleswere collected 60 min after the last stimulation and processed for redox proteomics assay of S-glutathionylation. Using selective reduction with a glutaredoxin enzyme cocktail and resin-assisted enrichment technique, we quantified the levels of site-specific protein S-glutathionylation at rest and following fatiguing contractions. Redox proteomics revealed over 2200 sites of S-glutathionylation modifications, of which 1290 were significantly increased after fatiguing contractions. Muscle contraction leads to the greatest increase in S-glutathionylation in the mitochondria (1.03%) and the smallest increase in the nucleus (0.47%). Regulatory cysteines were significantly S-glutathionylated on mitochondrial complex I and II, GAPDH, MDH1, ACO2, and mitochondrial complex V among others. Similarly, S-glutathionylation of RYR1, SERCA1, titin, and troponin I2 are known to regulate muscle contractility and were significantly S-glutathionylated after just 15 min of fatiguing contractions. The largest fold changes (> 1.6) in the S-glutathionylated proteome after fatigue occurred on signaling proteins such as 14-3-3 protein gamma and MAP2K4, as well as proteins like SERCA1, and NDUV2 of mitochondrial complex I, at previously unknown glutathionylation sites. These findings highlight the important role of redox control over muscle physiology, metabolism, and the exercise adaptive response. This study lays the groundwork for future investigation into the altered exercise adaptation associated with chronic conditions, such as sarcopenia. Copyright © 2018. Published by Elsevier B.V.
Comprehensive peptidomimetic libraries targeting protein-protein interactions.
Whitby, Landon R; Boger, Dale L
2012-10-16
Transient protein-protein interactions (PPIs) are essential components in cellular signaling pathways as well as in important processes such as viral infection, replication, and immune suppression. The unknown or uncharacterized PPIs involved in such interaction networks often represent compelling therapeutic targets for drug discovery. To date, however, the main strategies for discovery of small molecule modulators of PPIs are typically limited to structurally characterized targets. Recent developments in molecular scaffolds that mimic the side chain display of peptide secondary structures have yielded effective designs, but few screening libraries of such mimetics are available to interrogate PPI targets. We initiated a program to prepare a comprehensive small molecule library designed to mimic the three major recognition motifs that mediate PPIs (α-helix, β-turn, and β-strand). Three libraries would be built around templates designed to mimic each such secondary structure and substituted with all triplet combinations of groups representing the 20 natural amino acid side chains. When combined, the three libraries would contain a member capable of mimicking the key interaction and recognition residues of most targetable PPIs. In this Account, we summarize the results of the design, synthesis, and validation of an 8000 member α-helix mimetic library and a 4200 member β-turn mimetic library. We expect that the screening of these libraries will not only provide lead structures against α-helix- or β-turn-mediated protein-protein or peptide-receptor interactions, even if the nature of the interaction is unknown, but also yield key insights into the recognition motif (α-helix or β-turn) and identify the key residues mediating the interaction. Consistent with this expectation, the screening of the libraries against p53/MDM2 and HIV-1 gp41 (α-helix mimetic library) or the opioid receptors (β-turn mimetic library) led to the discovery of library members expected to mimic the known endogenous ligands. These efforts led to the discovery of high-affinity α-helix mimetics (K(i) = 0.7 μM) against HIV-1 gp41 as well as high-affinity and selective β-turn mimetics (K(i) = 80 nM) against the κ-opioid receptor. The results suggest that the use of such comprehensive libraries of peptide secondary structure mimetics, built around effective molecular scaffolds, constitutes a powerful method of interrogating PPIs. These structures provide small molecule modulators of PPI networks for therapeutic target validation, lead compound discovery, and the identification of modulators of biological processes for further study.
2011-01-01
Background The drug/metabolite transporter superfamily comprises a diversity of protein domain families with multiple functions including transport of nucleotide sugars. Drug/metabolite transporter domains are contained in both solute carrier families 30, 35 and 39 proteins as well as in acyl-malonyl condensing enzyme proteins. In this paper, we present an evolutionary analysis of nucleotide sugar transporters in relation to the entire superfamily of drug/metabolite transporters that considers crucial intra-protein duplication events that have shaped the transporters. We use a method that combines the strengths of hidden Markov models and maximum likelihood to find relationships between drug/metabolite transporter families, and branches within families. Results We present evidence that the triose-phosphate transporters, domain unknown function 914, uracil-diphosphate glucose-N-acetylglucosamine, and nucleotide sugar transporter families have evolved from a domain duplication event before the radiation of Viridiplantae in the EamA family (previously called domain unknown function 6). We identify previously unknown branches in the solute carrier 30, 35 and 39 protein families that emerged simultaneously as key physiological developments after the radiation of Viridiplantae, including the "35C/E" branch of EamA, which formed in the lineage of T. adhaerens (Animalia). We identify a second cluster of DMTs, called the domain unknown function 1632 cluster, which has non-cytosolic N- and C-termini, and thus appears to have been formed from a different domain duplication event. We identify a previously uncharacterized motif, G-X(6)-G, which is overrepresented in the fifth transmembrane helix of C-terminal domains. We present evidence that the family called fatty acid elongases are homologous to transporters, not enzymes as had previously been thought. Conclusions The nucleotide sugar transporters families were formed through differentiation of the gene cluster EamA (domain unknown function 6) before Viridiplantae, showing for the first time the significance of EamA. PMID:21569384
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Lei
2008-01-01
Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less
Yamamoto, Ryosuke; Alford, Lea M.; Ide, Takahiro; Owa, Mikito; Hwang, Juyeon; Inaba, Kazuo; James, Noliyanda; Ishikawa, Takashi
2017-01-01
Cytoplasmic assembly of ciliary dyneins, a process known as preassembly, requires numerous non-dynein proteins, but the identities and functions of these proteins are not fully elucidated. Here, we show that the classical Chlamydomonas motility mutant pf23 is defective in the Chlamydomonas homolog of DYX1C1. The pf23 mutant has a 494 bp deletion in the DYX1C1 gene and expresses a shorter DYX1C1 protein in the cytoplasm. Structural analyses, using cryo-ET, reveal that pf23 axonemes lack most of the inner dynein arms. Spectral counting confirms that DYX1C1 is essential for the assembly of the majority of ciliary inner dynein arms (IDA) as well as a fraction of the outer dynein arms (ODA). A C-terminal truncation of DYX1C1 shows a reduction in a subset of these ciliary IDAs. Sucrose gradients of cytoplasmic extracts show that preassembled ciliary dyneins are reduced compared to wild-type, which suggests an important role in dynein complex stability. The role of PF23/DYX1C1 remains unknown, but we suggest that DYX1C1 could provide a scaffold for macromolecular assembly. PMID:28892495
Evidence that Poly(A) Binding Protein C1 Binds Nuclear Pre-mRNA Poly(A) Tails
Hosoda, Nao; Lejeune, Fabrice; Maquat, Lynne E.
2006-01-01
In mammalian cells, poly(A) binding protein C1 (PABP C1) has well-known roles in mRNA translation and decay in the cytoplasm. However, PABPC1 also shuttles in and out of the nucleus, and its nuclear function is unknown. Here, we show that PABPC1, like the major nuclear poly(A) binding protein PABPN1, associates with nuclear pre-mRNAs that are polyadenylated and intron containing. PABPC1 does not bind nonpolyadenylated histone mRNA, indicating that the interaction of PABPC1 with pre-mRNA requires a poly(A) tail. Consistent with this conclusion, UV cross-linking results obtained using intact cells reveal that PABPC1 binds directly to pre-mRNA poly(A) tails in vivo. We also show that PABPC1 immunopurifies with poly(A) polymerase, suggesting that PABPC1 is acquired by polyadenylated transcripts during poly(A) tail synthesis. Our findings demonstrate that PABPC1 associates with polyadenylated transcripts earlier in mammalian mRNA biogenesis than previously thought and offer insights into the mechanism by which PABPC1 is recruited to newly synthesized poly(A). Our results are discussed in the context of pre-mRNA processing and stability and mRNA trafficking and the pioneer round of translation. PMID:16581783
A Risk-Based Multi-Objective Optimization Concept for Early-Warning Monitoring Networks
NASA Astrophysics Data System (ADS)
Bode, F.; Loschko, M.; Nowak, W.
2014-12-01
Groundwater is a resource for drinking water and hence needs to be protected from contaminations. However, many well catchments include an inventory of known and unknown risk sources which cannot be eliminated, especially in urban regions. As matter of risk control, all these risk sources should be monitored. A one-to-one monitoring situation for each risk source would lead to a cost explosion and is even impossible for unknown risk sources. However, smart optimization concepts could help to find promising low-cost monitoring network designs.In this work we develop a concept to plan monitoring networks using multi-objective optimization. Our considered objectives are to maximize the probability of detecting all contaminations and the early warning time and to minimize the installation and operating costs of the monitoring network. A qualitative risk ranking is used to prioritize the known risk sources for monitoring. The unknown risk sources can neither be located nor ranked. Instead, we represent them by a virtual line of risk sources surrounding the production well.We classify risk sources into four different categories: severe, medium and tolerable for known risk sources and an extra category for the unknown ones. With that, early warning time and detection probability become individual objectives for each risk class. Thus, decision makers can identify monitoring networks which are valid for controlling the top risk sources, and evaluate the capabilities (or search for least-cost upgrade) to also cover moderate, tolerable and unknown risk sources. Monitoring networks which are valid for the remaining risk also cover all other risk sources but the early-warning time suffers.The data provided for the optimization algorithm are calculated in a preprocessing step by a flow and transport model. Uncertainties due to hydro(geo)logical phenomena are taken into account by Monte-Carlo simulations. To avoid numerical dispersion during the transport simulations we use the particle-tracking random walk method.
Sabido, Rafael; Hernández-Davó, Jose Luis; Botella, Javier; Moya, Manuel
2016-01-01
To compare the effect of 4-week unknown vs known loads strength training intervention on power output performance and throwing velocity in junior team handball players. Twenty-eight junior team-handball players (17.2 ± 0.6 years, 1.79 ± 0.07 m, 75.6 ± 9.4 kg)were divided into two groups (unknown loads: UL; known loads: KL). Both groups performed two sessions weekly consisting of four sets of six repetitions of the bench press throw exercise, using the 30%, 50% and 70% of subjects' individual 1 repetition maximum (1RM). In each set, two repetitions with each load were performed, but the order of the loads was randomised. In the KL group, researchers told the subjects the load to mobilise prior each repetition, while in the UL group, researchers did not provide any information. Maximal dynamic strength (1RM bench press), power output (with 30, 50 and 70% of 1RM) and throwing velocity (7 m standing throw and 9 m jumping throw) were assessed pre- and post-training intervention. Both UL and KL group improved similarly their 1RM bench press as well as mean and peak power with all loads. There were significant improvements in power developed in all the early time intervals measured (150 ms) with the three loads (30, 50, 70% 1RM) in the UL group, while KL only improved with 30% 1RM (all the time intervals) and with 70% 1RM (at certain time intervals). Only the UL group improved throwing velocity in both standing (4.7%) and jumping (5.3%) throw (p > 0.05). The use of unknown loads has led to greater gains in power output in the early time intervals as well as to increases in throwing velocity compared with known loads. Therefore unknown loads are of significant practical use to increase both strength and in-field performance in a short period of training.
Lemay, Julie; Maidou-Peindara, Priscilla; Bader, Thomas; Ennifar, Eric; Rain, Jean-Christophe; Benarous, Richard; Liu, Lang Xia
2008-01-01
Reverse transcription of the genetic material of human immunodeficiency virus type 1 (HIV-1) is a critical step in the replication cycle of this virus. This process, catalyzed by reverse transcriptase (RT), is well characterized at the biochemical level. However, in infected cells, reverse transcription occurs in a multiprotein complex – the reverse transcription complex (RTC) – consisting of viral genomic RNA associated with viral proteins (including RT) and, presumably, as yet uncharacterized cellular proteins. Very little is known about the cellular proteins interacting with the RTC, and with reverse transcriptase in particular. We report here that HIV-1 reverse transcription is affected by the levels of a nucleocytoplasmic shuttling protein – the RNA-binding protein HuR. A direct protein-protein interaction between RT and HuR was observed in a yeast two-hybrid screen and confirmed in vitro by homogenous time-resolved fluorescence (HTRF). We mapped the domain interacting with HuR to the RNAse H domain of RT, and the binding domain for RT to the C-terminus of HuR, partially overlapping the third RRM RNA-binding domain of HuR. HuR silencing with specific siRNAs greatly impaired early and late steps of reverse transcription, significantly inhibiting HIV-1 infection. Moreover, by mutagenesis and immunoprecipitation studies, we could not detect the binding of HuR to the viral RNA. These results suggest that HuR may be involved in and may modulate the reverse transcription reaction of HIV-1, by an as yet unknown mechanism involving a protein-protein interaction with HIV-1 RT. PMID:18544151
Inward H+ pump xenorhodopsin: Mechanism and alternative optogenetic approach.
Shevchenko, Vitaly; Mager, Thomas; Kovalev, Kirill; Polovinkin, Vitaly; Alekseev, Alexey; Juettner, Josephine; Chizhov, Igor; Bamann, Christian; Vavourakis, Charlotte; Ghai, Rohit; Gushchin, Ivan; Borshchevskiy, Valentin; Rogachev, Andrey; Melnikov, Igor; Popov, Alexander; Balandin, Taras; Rodriguez-Valera, Francisco; Manstein, Dietmar J; Bueldt, Georg; Bamberg, Ernst; Gordeliy, Valentin
2017-09-01
Generation of an electrochemical proton gradient is the first step of cell bioenergetics. In prokaryotes, the gradient is created by outward membrane protein proton pumps. Inward plasma membrane native proton pumps are yet unknown. We describe comprehensive functional studies of the representatives of the yet noncharacterized xenorhodopsins from Nanohaloarchaea family of microbial rhodopsins. They are inward proton pumps as we demonstrate in model membrane systems, Escherichia coli cells, human embryonic kidney cells, neuroblastoma cells, and rat hippocampal neuronal cells. We also solved the structure of a xenorhodopsin from the nanohalosarchaeon Nanosalina ( Ns XeR) and suggest a mechanism of inward proton pumping. We demonstrate that the Ns XeR is a powerful pump, which is able to elicit action potentials in rat hippocampal neuronal cells up to their maximal intrinsic firing frequency. Hence, inwardly directed proton pumps are suitable for light-induced remote control of neurons, and they are an alternative to the well-known cation-selective channelrhodopsins.
NASA Astrophysics Data System (ADS)
Oh, Kyoung Joon; Senzel, Lisa; Collier, R. John; Finkelstein, Alan
1999-07-01
The T domain of diphtheria toxin is known to participate in the pH-dependent translocation of the catalytic C domain of the toxin across the endosomal membrane, but how it does so, and whether cellular proteins are also required for this process, remain unknown. Here, we report results showing that the T domain alone is capable of translocating the entire C domain across model, planar phospholipid bilayers in the absence of other proteins. The T domain therefore contains the entire molecular machinery for mediating transfer of the catalytic domain of diphtheria toxin across membranes.
Towards an understanding of wheat chloroplasts: a methodical investigation of thylakoid proteome.
Kamal, Abu Hena Mostafa; Cho, Kun; Komatsu, Setsuko; Uozumi, Nobuyuki; Choi, Jong-Soon; Woo, Sun Hee
2012-05-01
We utilized Percoll density gradient centrifugation to isolate and fractionate chloroplasts of Korean winter wheat cultivar cv. Kumgang (Triticum aestivum L.). The resulting protein fractions were separated by one dimensional polyacrylamide gel electrophoresis (1D-PAGE) coupled with LTQ-FTICR mass spectrometry. This enabled us to detect and identify 767 unique proteins. Our findings represent the most comprehensive exploration of a proteome to date. Based on annotation information from the UniProtKB/Swiss-Prot database and our analyses via WoLF PSORT and PSORT, these proteins are localized in the chloroplast (607 proteins), chloroplast stroma (145), thylakoid membrane (342), lumens (163), and integral membranes (166). In all, 67% were confirmed as chloroplast thylakoid proteins. Although nearly complete protein coverage (89% proteins) has been accomplished for the key chloroplast pathways in wheat, such as for photosynthesis, many other proteins are involved in regulating carbon metabolism. The identified proteins were assigned to 103 functional categories according to a classification system developed by the iProClass database and provided through Protein Information Resources. Those functions include electron transport, energy, cellular organization and biogenesis, transport, stress responses, and other metabolic processes. Whereas most of these proteins are associated with known complexes and metabolic pathways, about 13% of the proteins have unknown functions. The chloroplast proteome contains many proteins that are localized to the thylakoids but as yet have no known function. We propose that some of these familiar proteins participate in the photosynthetic pathway. Thus, our new and comprehensive protein profile may provide clues for better understanding that photosynthetic process in wheat.
Efficacy of function specific 3D-motifs in enzyme classification according to their EC-numbers.
Rahimi, Amir; Madadkar-Sobhani, Armin; Touserkani, Rouzbeh; Goliaei, Bahram
2013-11-07
Due to the increasing number of protein structures with unknown function originated from structural genomics projects, protein function prediction has become an important subject in bioinformatics. Among diverse function prediction methods, exploring known 3D-motifs, which are associated with functional elements in unknown protein structures is one of the most biologically meaningful methods. Homologous enzymes inherit such motifs in their active sites from common ancestors. However, slight differences in the properties of these motifs, results in variation in the reactions and substrates of the enzymes. In this study, we examined the possibility of discriminating highly related active site patterns according to their EC-numbers by 3D-motifs. For each EC-number, the spatial arrangement of an active site, which has minimum average distance to other active sites with the same function, was selected as a representative 3D-motif. In order to characterize the motifs, various points in active site elements were tested. The results demonstrated the possibility of predicting full EC-number of enzymes by 3D-motifs. However, the discriminating power of 3D-motifs varies among different enzyme families and depends on selecting the appropriate points and features. © 2013 Elsevier Ltd. All rights reserved.
Gevaert, Bert; D'Hondt, Matthias; Bracke, Nathalie; Yao, Han; Wynendaele, Evelien; Vissers, Johannes Petrus Cornelis; De Cecco, Martin; Claereboudt, Jan; De Spiegeleer, Bart
2015-09-01
Cerebrolysin, a parenteral peptide preparation produced by controlled digestion of porcine brain proteins, is an approved nootropic medicine in some countries. However, it is also easily and globally available on the Internet. Nevertheless, until now, its exact chemical composition was unknown. Using high performance liquid chromatography (HPLC) coupled to ion trap and ultra high performance liquid chromatography (UHPLC) coupled to quadrupole-ion mobility-time-of-flight mass spectrometry (Q-IM-TOF MS), combined with UniProt pig protein database search and PEAKS de novo sequencing, we identified 638 unique peptides in an Internet-obtained Cerebrolysin sample. The main components in this sample originate from tubulin alpha- and beta-chain, actin, and myelin basic protein. No fragments of known neurotrophic factors like glial cell-derived neurotrophic factor (GDNF), neurotrophin nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and ciliary neurotrophic factor (CNTF) were found, suggesting that the activities reported in the literature are likely the result of new, hitherto unknown cryptic peptides with nootropic properties. Copyright © 2015 John Wiley & Sons, Ltd.
Nguyen, Vi N; Park, Annsea; Xu, Anting; Srouji, John R; Brenner, Steven E; Kirsch, Jack F
2016-12-01
The nearly 50,000 known Nudix proteins have a diverse array of functions, of which the most extensively studied is the catalyzed hydrolysis of aberrant nucleotide triphosphates. The functions of 171 Nudix proteins have been characterized to some degree, although physiological relevance of the assayed activities has not always been conclusively demonstrated. We investigated substrate specificity for eight structurally characterized Nudix proteins, whose functions were unknown. These proteins were screened for hydrolase activity against a 74-compound library of known Nudix enzyme substrates. We found substrates for four enzymes with k cat /K m values >10,000 M -1 s -1 : Q92EH0_LISIN of Listeria innocua serovar 6a against ADP-ribose, Q5LBB1_BACFN of Bacillus fragilis against 5-Me-CTP, and Q0TTC5_CLOP1 and Q0TS82_CLOP1 of Clostridium perfringens against 8-oxo-dATP and 3'-dGTP, respectively. To ascertain whether these identified substrates were physiologically relevant, we surveyed all reported Nudix hydrolytic activities against NTPs. Twenty-two Nudix enzymes are reported to have activity against canonical NTPs. With a single exception, we find that the reported k cat /K m values exhibited against these canonical substrates are well under 10 5 M -1 s -1 . By contrast, several Nudix enzymes show much larger k cat /K m values (in the range of 10 5 to >10 7 M -1 s -1 ) against noncanonical NTPs. We therefore conclude that hydrolytic activities exhibited by these enzymes against canonical NTPs are not likely their physiological function, but rather the result of unavoidable collateral damage occasioned by the enzymes' inability to distinguish completely between similar substrate structures. Proteins 2016; 84:1810-1822. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Method for identifying known materials within a mixture of unknowns
Wagner, John S.
2000-01-01
One or both of two methods and systems are used to determine concentration of a known material in an unknown mixture on the basis of the measured interaction of electromagnetic waves upon the mixture. One technique is to utilize a multivariate analysis patch technique to develop a library of optimized patches of spectral signatures of known materials containing only those pixels most descriptive of the known materials by an evolutionary algorithm. Identity and concentration of the known materials within the unknown mixture is then determined by minimizing the residuals between the measurements from the library of optimized patches and the measurements from the same pixels from the unknown mixture. Another technique is to train a neural network by the genetic algorithm to determine the identity and concentration of known materials in the unknown mixture. The two techniques may be combined into an expert system providing cross checks for accuracy.
System for identifying known materials within a mixture of unknowns
Wagner, John S.
1999-01-01
One or both of two methods and systems are used to determine concentration of a known material in an unknown mixture on the basis of the measured interaction of electromagnetic waves upon the mixture. One technique is to utilize a multivariate analysis patch technique to develop a library of optimized patches of spectral signatures of known materials containing only those pixels most descriptive of the known materials by an evolutionary algorithm. Identity and concentration of the known materials within the unknown mixture is then determined by minimizing the residuals between the measurements from the library of optimized patches and the measurements from the same pixels from the unknown mixture. Another technique is to train a neural network by the genetic algorithm to determine the identity and concentration of known materials in the unknown mixture. The two techniques may be combined into an expert system providing cross checks for accuracy.
System for identifying known materials within a mixture of unknowns
Wagner, J.S.
1999-07-20
One or both of two methods and systems are used to determine concentration of a known material in an unknown mixture on the basis of the measured interaction of electromagnetic waves upon the mixture. One technique is to utilize a multivariate analysis patch technique to develop a library of optimized patches of spectral signatures of known materials containing only those pixels most descriptive of the known materials by an evolutionary algorithm. Identity and concentration of the known materials within the unknown mixture is then determined by minimizing the residuals between the measurements from the library of optimized patches and the measurements from the same pixels from the unknown mixture. Another technique is to train a neural network by the genetic algorithm to determine the identity and concentration of known materials in the unknown mixture. The two techniques may be combined into an expert system providing cross checks for accuracy. 37 figs.
Bos, H M W; Gartrell, N K
2011-03-01
The current study is based on the US National Longitudinal Lesbian Family Study (NLLFS), which was designed to document the development of the first generation of lesbian families with children conceived through donor insemination. Data were collected in five waves, first at insemination or during pregnancy, and subsequently when the index children were 2, 5, 10 and 17 years old. The study is ongoing, with a 93% retention rate to date. The purpose of the current investigation was to assess changes in psychological adjustment of the index offspring between the time that they were 10 and 17 years old (T4 and T5) and to examine the effects of having a known or an as-yet-unknown donor. The total T5 sample consisted of 78 adolescents. The mothers in 74 families completed a Child Behaviour Checklist (CBCL) on their offspring at both T4 and T5: 26 of these offspring had been conceived through known sperm donors and 48 through unknown donors. Changes in psychological adjustment were assessed through computations of stability coefficients between T4 and T5 on all CBCL subscales, and by means of a general linear model (GLM). On 10 out of 11 CBCL subscales, the stability coefficients were not significantly different for adolescents with known and unknown donors. Findings from the GLM showed that no main effect for donor type was found; for offspring in both donor groups thought problems and rule-breaking behaviour were higher and scores on social problems and aggressive behaviour were lower at T5 than T4. The development of psychological well-being in the offspring of lesbian mothers over a 7-year period from childhood through adolescence is the same for those who were conceived through known and unknown donors.
Affinity resins as new tools for identifying target proteins of ascorbic acid.
Iwaoka, Yuji; Nishino, Kohei; Ishikawa, Takahiro; Ito, Hideyuki; Sawa, Yoshihiro; Tai, Akihiro
2018-02-12
l-Ascorbic acid (AA) has diverse physiological functions, but little is known about the functional mechanisms of AA. In this study, we synthesized two types of affinity resin on which AA is immobilized in a stable form to identify new AA-targeted proteins, which can provide important clues for elucidating unknown functional mechanisms of AA. To our knowledge, an affinity resin on which AA as a ligand is immobilized has not been prepared, because AA is very unstable and rapidly degraded in an aqueous solution. By using the affinity resins, cytochrome c (cyt c) was identified as an AA-targeted protein, and we showed that oxidized cyt c exhibits specific affinity for AA. These results suggest that two kinds of AA-affinity resin can be powerful tools to identify new target proteins of AA.
Mammalian Per-Arnt-Sim proteins in environmental adaptation.
McIntosh, Brian E; Hogenesch, John B; Bradfield, Christopher A
2010-01-01
The Per-Arnt-Sim (PAS) domain is conserved across the kingdoms of life and found in an ever-growing list of proteins. This domain can bind to and sense endogenous or xenobiotic small molecules such as molecular oxygen, cellular metabolites, or polyaromatic hydrocarbons. Members of this family are often found in pathways that regulate responses to environmental change; in mammals these include the hypoxia, circadian, and dioxin response pathways. These pathways function in development and throughout life to regulate cellular, organ, and whole-organism adaptive responses. Remarkably, in the case of the clock, this adaptation includes anticipation of environmental change. In this review, we summarize the roles of PAS domain-containing proteins in mammals. We provide structural evidence that functionally classifies both known and unknown biological roles. Finally, we discuss the role of PAS proteins in anticipation of and adaptation to environmental change.
The use of polyoxometalates in protein crystallography – An attempt to widen a well-known bottleneck
Bijelic, Aleksandar; Rompel, Annette
2015-01-01
Polyoxometalates (POMs) are discrete polynuclear metal-oxo anions with a fascinating variety of structures and unique chemical and physical properties. Their application in various fields is well covered in the literature, however little information about their usage in protein crystallization is available. This review summarizes the impact of the vast class of POMs on the formation of protein crystals, a well-known (frustrating) bottleneck in macromolecular crystallography, with the associated structure elucidation and a particular emphasis focused on POM's potential as a powerful crystallization additive for future research. The Protein Data Bank (PDB) was scanned for protein structures with incorporated POMs which were assigned a PDB ligand ID resulting in 30 PDB entries. These structures have been analyzed with regard to (i) the structure of POM itself in the immediate protein environment, (ii) the kind of interaction and position of the POM within the protein structure and (iii) the beneficial effects of POM on protein crystallography apparent so far. PMID:26339074
Martí-Arbona, Ricardo; Mu, Fangping; Nowak-Lovato, Kristy L.; ...
2014-12-18
In this study, the clustering of genes in a pathway and the co-location of functionally related genes is widely recognized in prokaryotes. We used these characteristics to predict the metabolic involvement for a Transcriptional Regulator (TR) of unknown function, identified and confirmed its biological activity. software tool that identifies the genes encoded within a defined genomic neighborhood for the subject TR and its homologs was developed. The output lists of genes in the genetic neighborhoods, their annotated functions, the reactants/products, and identifies the metabolic pathway in which the encoded-proteins function. When a set of TRs of known function was analyzed,more » we observed that their homologs frequently had conserved genomic neighborhoods that co-located the metabolically related genes regulated by the subject TR. We postulate that TR effectors are metabolites in the identified pathways; indeed the known effectors were present. We analyzed Bxe_B3018 from Burkholderia xenovorans, a TR of unknown function and predicted that this TR was related to the glycine, threonine and serine degradation. We tested the binding of metabolites in these pathways and for those that bound, their ability to modulate TR binding to its specific DNA operator sequence. Using rtPCR, we confirmed that methylglyoxal was an effector of Bxe_3018. These studies provide the proof of concept and validation of a systematic approach to the discovery of the biological activity for proteins of unknown function, in this case a TR. Bxe_B3018 is a methylglyoxal responsive TR that controls the expression of an operon composed of a putative efflux system.« less
Vidovszky, Márton; Kohl, Claudia; Boldogh, Sándor; Görföl, Tamás; Wibbelt, Gudrun; Kurth, Andreas; Harrach, Balázs
2015-12-01
From over 1250 extant species of the order Chiroptera, 25 and 28 are known to occur in Germany and Hungary, respectively. Close to 350 samples originating from 28 bat species (17 from Germany, 27 from Hungary) were screened for the presence of adenoviruses (AdVs) using a nested PCR that targets the DNA polymerase gene of AdVs. An additional PCR was designed and applied to amplify a fragment from the gene encoding the IVa2 protein of mastadenoviruses. All German samples originated from organs of bats found moribund or dead. The Hungarian samples were excrements collected from colonies of known bat species, throat or rectal swab samples, taken from live individuals that had been captured for faunistic surveys and migration studies, as well as internal organs of dead specimens. Overall, 51 samples (14.73%) were found positive. We detected 28 seemingly novel and six previously described bat AdVs by sequencing the PCR products. The positivity rate was the highest among the guano samples of bat colonies. In phylogeny reconstructions, the AdVs detected in bats clustered roughly, but not perfectly, according to the hosts' families (Vespertilionidae, Rhinolophidae, Hipposideridae, Phyllostomidae and Pteropodidae). In a few cases, identical sequences were derived from animals of closely related species. On the other hand, some bat species proved to harbour more than one type of AdV. The high prevalence of infection and the large number of chiropteran species worldwide make us hypothesise that hundreds of different yet unknown AdV types might circulate in bats.
Identification of the Mitochondrial Heme Metabolism Complex
Medlock, Amy E.; Shiferaw, Mesafint T.; Marcero, Jason R.; Vashisht, Ajay A.; Wohlschlegel, James A.; Phillips, John D.; Dailey, Harry A.
2015-01-01
Heme is an essential cofactor for most organisms and all metazoans. While the individual enzymes involved in synthesis and utilization of heme are fairly well known, less is known about the intracellular trafficking of porphyrins and heme, or regulation of heme biosynthesis via protein complexes. To better understand this process we have undertaken a study of macromolecular assemblies associated with heme synthesis. Herein we have utilized mass spectrometry with coimmunoprecipitation of tagged enzymes of the heme biosynthetic pathway in a developing erythroid cell culture model to identify putative protein partners. The validity of these data obtained in the tagged protein system is confirmed by normal porphyrin/heme production by the engineered cells. Data obtained are consistent with the presence of a mitochondrial heme metabolism complex which minimally consists of ferrochelatase, protoporphyrinogen oxidase and aminolevulinic acid synthase-2. Additional proteins involved in iron and intermediary metabolism as well as mitochondrial transporters were identified as potential partners in this complex. The data are consistent with the known location of protein components and support a model of transient protein-protein interactions within a dynamic protein complex. PMID:26287972
Naqvi, Ahmad Abu Turab; Shahbaaz, Mohd; Ahmad, Faizan; Hassan, Md Imtaiyaz
2015-01-01
Syphilis is a globally occurring venereal disease, and its infection is propagated through sexual contact. The causative agent of syphilis, Treponema pallidum ssp. pallidum, a Gram-negative sphirochaete, is an obligate human parasite. Genome of T. pallidum ssp. pallidum SS14 strain (RefSeq NC_010741.1) encodes 1,027 proteins, of which 444 proteins are known as hypothetical proteins (HPs), i.e., proteins of unknown functions. Here, we performed functional annotation of HPs of T. pallidum ssp. pallidum using various database, domain architecture predictors, protein function annotators and clustering tools. We have analyzed the sequences of 444 HPs of T. pallidum ssp. pallidum and subsequently predicted the function of 207 HPs with a high level of confidence. However, functions of 237 HPs are predicted with less accuracy. We found various enzymes, transporters, binding proteins in the annotated group of HPs that may be possible molecular targets, facilitating for the survival of pathogen. Our comprehensive analysis helps to understand the mechanism of pathogenesis to provide many novel potential therapeutic interventions.
Jang, H B; Kim, Y R; Cha, I S; Noh, S W; Park, S B; Ohtani, M; Hikima, J; Aoki, T; Jung, T S
2011-07-01
Although the major capsid proteins (MCPs) of lymphocystis disease virus (LCDV) have been characterized, little is known about the host-derived immune response to MCPs and other LCDV antigenic proteins. To identify antigenic proteins of LCDV that could be used as vaccine candidates in olive flounder, Paralichthys olivaceus, we analysed the viral proteins responsible for its virulence by applying immuno-proteomics. LCDV proteins were separated by one-dimensional gel electrophoresis, transferred to polyvinylidene difluoride membrane, and probed with homogeneous P. olivaceus antisera elicited by LCDV natural infection and vaccination with formalin-killed LCDV. Four immune-reactive proteins were obtained at 68-, 51-, 41- and 21 kDa using antisera collected from natural infection while two proteins at 51- and 21 kDa exhibited response to antisera from vaccinated fish, indicating that the latter two proteins have vaccine potential. Using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and nanoelectrospray MS/MS, the 51 and 21 kDa proteins were identified as MCP and an unknown protein, respectively. © 2011 Blackwell Publishing Ltd.
Proteomic analysis of the venom from the scorpion Mesobuthus martensii.
Xu, Xiaobo; Duan, Zhigui; Di, Zhiyong; He, Yawen; Li, Jianglin; Li, Zhongjie; Xie, Chunliang; Zeng, Xiongzhi; Cao, Zhijian; Wu, Yingliang; Liang, Songping; Li, Wenxin
2014-06-25
The scorpion Mesobuthus martensii is the most populous species in eastern Asian countries, and several toxic components have been identified from their venoms. Nevertheless, a complete proteomic profile of the venom of M. martensii is still not available. In this study, the venom of M. martensii was analyzed by comprehensive proteomic approaches. 153 fractions were isolated from the M. martensii venom by 2-DE, SDS-PAGE and RP-HPLC. The ESI-Q-TOF MS results of all fractions were used to search the scorpion genomic and transcriptomic databases. Totally, 227 non-redundant protein sequences were unambiguously identified, composed of 134 previously known and 93 previously unknown proteins. Among 134 previously known proteins, 115 proteins were firstly confirmed from the M. martensii crude venom and 19 toxins were confirmed once again, involving 43 typical toxins, 7 atypical toxins, 12 venom enzymes and 72 cell associated proteins. In typical toxins, 7 novel-toxin sequences were identified, including 3 Na(+)-channel toxins, 3K(+)-channel toxins and 1 no-annotation toxin. These results increased 230% (115/50) venom components compared with previous studies from the M. martensii venom, especially 50% (24/48) typical toxins. Additionally, a mass fingerprint obtained by MALDI-TOF MS indicated that the scorpion venom contained more than 200 different molecular mass components. This work firstly gave a systematic investigation of the M. martensii venom by combined proteomics strategy coupled with genomics and transcriptomics. A large number of protein components were unambiguously identified from the venom of M. martensii, most of which were confirmed for the first time. We also contributed 7 novel-toxin sequences and 93 protein sequences previously unknown to be part of the venom, for which we assigned potential biological functions. Besides, we obtained a mass fingerprint of the M. martensii venom. Together, our study not only provides the most comprehensive catalog of the molecular diversity of the M. martensii venom at the proteomic level, but also enriches the composition information of scorpion venom. Copyright © 2014 Elsevier B.V. All rights reserved.
Fantini, Jacques; Garmy, Nicolas; Yahi, Nouara
2006-09-12
Protein-glycolipid interactions mediate the attachment of various pathogens to the host cell surface as well as the association of numerous cellular proteins with lipid rafts. Thus, it is of primary importance to identify the protein domains involved in glycolipid recognition. Using structure similarity searches, we could identify a common glycolipid-binding domain in the three-dimensional structure of several proteins known to interact with lipid rafts. Yet the three-dimensional structure of most raft-targeted proteins is still unknown. In the present study, we have identified a glycolipid-binding domain in the amino acid sequence of a bacterial adhesin (Helicobacter pylori adhesin A, HpaA). The prediction was based on the major properties of the glycolipid-binding domains previously characterized by structural searches. A short (15-mer) synthetic peptide corresponding to this putative glycolipid-binding domain was synthesized, and we studied its interaction with glycolipid monolayers at the air-water interface. The synthetic HpaA peptide recognized LacCer but not Gb3. This glycolipid specificity was in line with that of the whole bacterium. Molecular modeling studies gave some insights into this high selectivity of interaction. It also suggested that Phe147 in HpaA played a key role in LacCer recognition, through sugar-aromatic CH-pi stacking interactions with the hydrophobic side of the galactose ring of LacCer. Correspondingly, the replacement of Phe147 with Ala strongly affected LacCer recognition, whereas substitution with Trp did not. Our method could be used to identify glycolipid-binding domains in microbial and cellular proteins interacting with lipid shells, rafts, and other specialized membrane microdomains.
Ivarsson, Ylva; Arnold, Roland; McLaughlin, Megan; Nim, Satra; Joshi, Rakesh; Ray, Debashish; Liu, Bernard; Teyra, Joan; Pawson, Tony; Moffat, Jason; Li, Shawn Shun-Cheng; Sidhu, Sachdev S; Kim, Philip M
2014-02-18
The human proteome contains a plethora of short linear motifs (SLiMs) that serve as binding interfaces for modular protein domains. Such interactions are crucial for signaling and other cellular processes, but are difficult to detect because of their low to moderate affinities. Here we developed a dedicated approach, proteomic peptide-phage display (ProP-PD), to identify domain-SLiM interactions. Specifically, we generated phage libraries containing all human and viral C-terminal peptides using custom oligonucleotide microarrays. With these libraries we screened the nine PSD-95/Dlg/ZO-1 (PDZ) domains of human Densin-180, Erbin, Scribble, and Disks large homolog 1 for peptide ligands. We identified several known and putative interactions potentially relevant to cellular signaling pathways and confirmed interactions between full-length Scribble and the target proteins β-PIX, plakophilin-4, and guanylate cyclase soluble subunit α-2 using colocalization and coimmunoprecipitation experiments. The affinities of recombinant Scribble PDZ domains and the synthetic peptides representing the C termini of these proteins were in the 1- to 40-μM range. Furthermore, we identified several well-established host-virus protein-protein interactions, and confirmed that PDZ domains of Scribble interact with the C terminus of Tax-1 of human T-cell leukemia virus with micromolar affinity. Previously unknown putative viral protein ligands for the PDZ domains of Scribble and Erbin were also identified. Thus, we demonstrate that our ProP-PD libraries are useful tools for probing PDZ domain interactions. The method can be extended to interrogate all potential eukaryotic, bacterial, and viral SLiMs and we suggest it will be a highly valuable approach for studying cellular and pathogen-host protein-protein interactions.
Super-resolution biomolecular crystallography with low-resolution data.
Schröder, Gunnar F; Levitt, Michael; Brunger, Axel T
2010-04-22
X-ray diffraction plays a pivotal role in the understanding of biological systems by revealing atomic structures of proteins, nucleic acids and their complexes, with much recent interest in very large assemblies like the ribosome. As crystals of such large assemblies often diffract weakly (resolution worse than 4 A), we need methods that work at such low resolution. In macromolecular assemblies, some of the components may be known at high resolution, whereas others are unknown: current refinement methods fail as they require a high-resolution starting structure for the entire complex. Determining the structure of such complexes, which are often of key biological importance, should be possible in principle as the number of independent diffraction intensities at a resolution better than 5 A generally exceeds the number of degrees of freedom. Here we introduce a method that adds specific information from known homologous structures but allows global and local deformations of these homology models. Our approach uses the observation that local protein structure tends to be conserved as sequence and function evolve. Cross-validation with R(free) (the free R-factor) determines the optimum deformation and influence of the homology model. For test cases at 3.5-5 A resolution with known structures at high resolution, our method gives significant improvements over conventional refinement in the model as monitored by coordinate accuracy, the definition of secondary structure and the quality of electron density maps. For re-refinements of a representative set of 19 low-resolution crystal structures from the Protein Data Bank, we find similar improvements. Thus, a structure derived from low-resolution diffraction data can have quality similar to a high-resolution structure. Our method is applicable to the study of weakly diffracting crystals using X-ray micro-diffraction as well as data from new X-ray light sources. Use of homology information is not restricted to X-ray crystallography and cryo-electron microscopy: as optical imaging advances to subnanometre resolution, it can use similar tools.
Genomic Insights into the Atopic Eczema-Associated Skin Commensal Yeast Malassezia sympodialis
Gioti, Anastasia; Nystedt, Björn; Li, Wenjun; Xu, Jun; Andersson, Anna; Averette, Anna F.; Münch, Karin; Wang, Xuying; Kappauf, Catharine; Kingsbury, Joanne M.; Kraak, Bart; Walker, Louise A.; Johansson, Henrik J.; Holm, Tina; Lehtiö, Janne; Stajich, Jason E.; Mieczkowski, Piotr; Kahmann, Regine; Kennell, John C.; Cardenas, Maria E.; Lundeberg, Joakim; Saunders, Charles W.; Boekhout, Teun; Dawson, Thomas L.; Munro, Carol A.; de Groot, Piet W. J.; Butler, Geraldine; Heitman, Joseph; Scheynius, Annika
2013-01-01
ABSTRACT Malassezia commensal yeasts are associated with a number of skin disorders, such as atopic eczema/dermatitis and dandruff, and they also can cause systemic infections. Here we describe the 7.67-Mbp genome of Malassezia sympodialis, a species associated with atopic eczema, and contrast its genome repertoire with that of Malassezia globosa, associated with dandruff, as well as those of other closely related fungi. Ninety percent of the predicted M. sympodialis protein coding genes were experimentally verified by mass spectrometry at the protein level. We identified a relatively limited number of genes related to lipid biosynthesis, and both species lack the fatty acid synthase gene, in line with the known requirement of these yeasts to assimilate lipids from the host. Malassezia species do not appear to have many cell wall-localized glycosylphosphatidylinositol (GPI) proteins and lack other cell wall proteins previously identified in other fungi. This is surprising given that in other fungi these proteins have been shown to mediate interactions (e.g., adhesion and biofilm formation) with the host. The genome revealed a complex evolutionary history for an allergen of unknown function, Mala s 7, shown to be encoded by a member of an amplified gene family of secreted proteins. Based on genetic and biochemical studies with the basidiomycete human fungal pathogen Cryptococcus neoformans, we characterized the allergen Mala s 6 as the cytoplasmic cyclophilin A. We further present evidence that M. sympodialis may have the capacity to undergo sexual reproduction and present a model for a pseudobipolar mating system that allows limited recombination between two linked MAT loci. PMID:23341551
Halouska, Steven; Chacon, Ofelia; Fenton, Robert J.; Zinniel, Denise K.; Barletta, Raul G.; Powers, Robert
2008-01-01
D-cycloserine (DCS) is only used with multi-drug resistant strains of tuberculosis because of serious side-effects. DCS is known to inhibit cell wall biosynthesis, but the in vivo lethal target is still unknown. We have applied NMR-based metabolomics combined with principal component analysis to monitor the in vivo affect of DCS on M. smegmatis. Our analysis suggests DCS functions by inhibiting multiple protein targets. PMID:17979227
SEM-EDX analysis of an unknown "known" white powder found in a shipping container from Peru
NASA Astrophysics Data System (ADS)
Albright, Douglas C.
2009-05-01
In 2008, an unknown white powder was discovered spilled inside of a shipping container of whole kernel corn during an inspection by federal inspectors in the port of Baltimore, Maryland. The container was detained and quarantined while a sample of the powder was collected and sent to a federal laboratory where it was screened using chromatography for the presence of specific poisons and pesticides with negative results. Samples of the corn kernels and the white powder were forwarded to the Food and Drug Administration, Forensic Chemistry Center for further analysis. Stereoscopic Light Microscopy (SLM), Scanning Electron Microscopy/Energy Dispersive X-ray Spectrometry (SEM/EDX), and Polarized Light Microscopy/Infrared Spectroscopy (PLM-IR) were used in the analysis of the kernels and the unknown powder. Based on the unique particle analysis by SLM and SEM as well as the detection of the presence of aluminum and phosphorous by EDX, the unknown was determined to be consistent with reacted aluminum phosphide (AlP). While commonly known in the agricultural industry, aluminum phosphide is relatively unknown in the forensic community. A history of the use and acute toxicity of this compound along with some very unique SEM/EDX analysis characteristics of aluminum phosphide will be discussed.
Extensive Crosstalk Between O-GlcNAcylation and Phosphorylation Regulates Cytokinesis
Wang, Zihao; Udeshi, Namrata D.; Slawson, Chad; Compton, Philip D.; Sakabe, Kaoru; Cheung, Win D.; Shabanowitz, Jeffrey; Hunt, Donald F.; Hart, Gerald W.
2010-01-01
Like phosphorylation, the addition of O-linked β-N-acetylglucosamine (O-GlcNAcylation) is a ubiquitous, reversible process that modifies serine and threonine residues on nuclear and cytoplasmic proteins. Overexpression of the enzyme that adds O-GlcNAc to target proteins, O-GlcNAc transferase (OGT), perturbs cytokinesis and promotes polyploidy, but the molecular targets of OGT that are important for its cell cycle functions are unknown. Here, we identify 141 previously unknown O-GlcNAc sites on proteins that function in spindle assembly and cytokinesis. Many of these O-GlcNAcylation sites are either identical to known phosphorylation sites or in close proximity to them. Furthermore, we found that O-GlcNAcylation altered the phosphorylation of key proteins associated with the mitotic spindle and midbody. Forced overexpression of OGT increased the inhibitory phosphorylation of cyclin-dependent kinase 1 (CDK1) and reduced the phosphorylation of CDK1 target proteins. The increased phosphorylation of CDK1 is explained by increased activation of its upstream kinase, MYT1, and by a concomitant reduction in the transcript for the CDK1 phosphatase, CDC25C. OGT overexpression also caused a reduction in both messenger RNA expression and protein abundance of Polo-like kinase 1, which is upstream of both MYT1 and CDC25C. The data not only illustrate the crosstalk between O-GlcNAcylation and phosphorylation of proteins that are regulators of crucial signaling pathways, but also uncover a mechanism for the role of O-GlcNAcylation in regulation of cell division. PMID:20068230
Tripathi, S; Batra, J; Cao, W; Sharma, K; Patel, J R; Ranjan, P; Kumar, A; Katz, J M; Cox, N J; Lal, R B; Sambhara, S; Lal, S K
2013-01-01
Apoptosis induction is an antiviral host response, however, influenza A virus (IAV) infection promotes host cell death. The nucleoprotein (NP) of IAV is known to contribute to viral pathogenesis, but its role in virus-induced host cell death was hitherto unknown. We observed that NP contributes to IAV infection induced cell death and heterologous expression of NP alone can induce apoptosis in human airway epithelial cells. The apoptotic effect of IAV NP was significant when compared with other known proapoptotic proteins of IAV. The cell death induced by IAV NP was executed through the intrinsic apoptosis pathway. We screened host cellular factors for those that may be targeted by NP for inducing apoptosis and identified human antiapoptotic protein Clusterin (CLU) as a novel interacting partner. The interaction between IAV NP and CLU was highly conserved and mediated through β-chain of the CLU protein. Also CLU was found to interact specifically with IAV NP and not with any other known apoptosis modulatory protein of IAV. CLU prevents induction of the intrinsic apoptosis pathway by binding to Bax and inhibiting its movement into the mitochondria. We found that the expression of IAV NP reduced the association between CLU and Bax in mammalian cells. Further, we observed that CLU overexpression attenuated NP-induced cell death and had a negative effect on IAV replication. Collectively, these findings indicate a new function for IAV NP in inducing host cell death and suggest a role for the host antiapoptotic protein CLU in this process. PMID:23538443
On Space Exploration and Human Error: A Paper on Reliability and Safety
NASA Technical Reports Server (NTRS)
Bell, David G.; Maluf, David A.; Gawdiak, Yuri
2005-01-01
NASA space exploration should largely address a problem class in reliability and risk management stemming primarily from human error, system risk and multi-objective trade-off analysis, by conducting research into system complexity, risk characterization and modeling, and system reasoning. In general, in every mission we can distinguish risk in three possible ways: a) known-known, b) known-unknown, and c) unknown-unknown. It is probably almost certain that space exploration will partially experience similar known or unknown risks embedded in the Apollo missions, Shuttle or Station unless something alters how NASA will perceive and manage safety and reliability
Chang, Yi-Chien; Hu, Zhenjun; Rachlin, John; Anton, Brian P; Kasif, Simon; Roberts, Richard J; Steffen, Martin
2016-01-04
The COMBREX database (COMBREX-DB; combrex.bu.edu) is an online repository of information related to (i) experimentally determined protein function, (ii) predicted protein function, (iii) relationships among proteins of unknown function and various types of experimental data, including molecular function, protein structure, and associated phenotypes. The database was created as part of the novel COMBREX (COMputational BRidges to EXperiments) effort aimed at accelerating the rate of gene function validation. It currently holds information on ∼ 3.3 million known and predicted proteins from over 1000 completely sequenced bacterial and archaeal genomes. The database also contains a prototype recommendation system for helping users identify those proteins whose experimental determination of function would be most informative for predicting function for other proteins within protein families. The emphasis on documenting experimental evidence for function predictions, and the prioritization of uncharacterized proteins for experimental testing distinguish COMBREX from other publicly available microbial genomics resources. This article describes updates to COMBREX-DB since an initial description in the 2011 NAR Database Issue. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Latex Clearing Protein—an Oxygenase Cleaving Poly(cis-1,4-Isoprene) Rubber at the cis Double Bonds
Hiessl, Sebastian; Böse, Dietrich; Oetermann, Sylvia; Eggers, Jessica; Pietruszka, Jörg
2014-01-01
Gordonia polyisoprenivorans strain VH2, a potent rubber-degrading actinomycete, harbors two latex clearing proteins (Lcps), which are known to be essential for the microbial degradation of rubber. However, biochemical information on the exact role of this protein in the degradation of polyisoprene was lacking. In this study, the gene encoding Lcp1VH2 was heterologously expressed in strains of Escherichia coli, the corresponding protein was purified, and its role in rubber degradation was examined by measurement of oxygen consumption as well as by chromatographic and spectroscopic methods. It turned out that active Lcp1VH2 is a monomer and is responsible for the oxidative cleavage of poly(cis-1,4-isoprene) in synthetic as well as in natural rubber by the addition of oxygen (O2) to the cis double bonds. The resulting oligomers possess repetitive isoprene units with aldehyde (CHO-CH2—) and ketone (—CH2-CO-CH3) functional groups at the termini. Two fractions with average isoprene contents of 18 and 10, respectively, were isolated, thus indicating an endocleavage mechanism. The activity of Lcp1VH2 was determined by applying a polarographic assay. Alkenes, acyclic terpenes, or other rubber-like polymers, such as poly(cis-1,4-butadiene) or poly(trans-1,4-isoprene), are not oxidatively cleaved by Lcp1VH2. The pH and temperature optima of the enzyme are at pH 7 and 30°C, respectively. Furthermore, it was demonstrated that active Lcp1VH2 is a Cu(II)-containing oxygenase that exhibits a conserved domain of unknown function which cannot be detected in any other hitherto-characterized enzyme. The results presented here indicate that this domain might represent a new protein family of oxygenases. PMID:24928880
Thomas, Sabrina; Bakkes, Patrick J; Smits, Sander H J; Schmitt, Lutz
2014-09-01
HlyA from Escherichia coli is a member of the repeats in toxin (RTX) protein family, produced by a wide range of Gram-negative bacteria and secreted by a dedicated Type 1 Secretion System (T1SS). RTX proteins are thought to be secreted in an unfolded conformation and to fold upon secretion by Ca(2+) binding. However, the exact mechanism of secretion, ion binding and folding to the correct native state remains largely unknown. In this study we provide an easy protocol for high-level pro-HlyA purification from E. coli. Equilibrium folding studies, using intrinsic tryptophan fluorescence, revealed the well-known fact that Ca(2+) is essential for stability as well as correct folding of the whole protein. In the absence of Ca(2+), pro-HlyA adopts a non-native conformation. Such molecules could however be rescued by Ca(2+) addition, indicating that these are not dead-end species and that Ca(2+) drives pro-HlyA folding. More importantly, pro-HlyA unfolded via a two-state mechanism, whereas folding was a three-state process. The latter is indicative of the presence of a stable folding intermediate. Analysis of deletion and Trp mutants revealed that the first folding transition, at 6-7M urea, relates to Ca(2+) dependent structural changes at the extreme C-terminus of pro-HlyA, sensed exclusively by Trp914. Since all Trp residues of HlyA are located outside the RTX domain, our results demonstrate that Ca(2+) induced folding is not restricted to the RTX domain. Taken together, Ca(2+) binding to the pro-HlyA RTX domain is required to drive the folding of the entire protein to its native conformation. Copyright © 2014 Elsevier B.V. All rights reserved.
Nedd4-2 Modulates Renal Na+-Cl− Cotransporter via the Aldosterone-SGK1-Nedd4-2 Pathway
Arroyo, Juan Pablo; Lagnaz, Dagmara; Ronzaud, Caroline; Vázquez, Norma; Ko, Benjamin S.; Moddes, Lauren; Ruffieux-Daidié, Dorothée; Hausel, Pierrette; Koesters, Robert; Yang, Baoli; Stokes, John B.; Hoover, Robert S.
2011-01-01
Regulation of renal Na+ transport is essential for controlling blood pressure, as well as Na+ and K+ homeostasis. Aldosterone stimulates Na+ reabsorption by the Na+-Cl− cotransporter (NCC) in the distal convoluted tubule (DCT) and by the epithelial Na+ channel (ENaC) in the late DCT, connecting tubule, and collecting duct. Aldosterone increases ENaC expression by inhibiting the channel's ubiquitylation and degradation; aldosterone promotes serum-glucocorticoid-regulated kinase SGK1-mediated phosphorylation of the ubiquitin-protein ligase Nedd4-2 on serine 328, which prevents the Nedd4-2/ENaC interaction. It is important to note that aldosterone increases NCC protein expression by an unknown post-translational mechanism. Here, we present evidence that Nedd4-2 coimmunoprecipitated with NCC and stimulated NCC ubiquitylation at the surface of transfected HEK293 cells. In Xenopus laevis oocytes, coexpression of NCC with wild-type Nedd4-2, but not its catalytically inactive mutant, strongly decreased NCC activity and surface expression. SGK1 prevented this inhibition in a kinase-dependent manner. Furthermore, deficiency of Nedd4-2 in the renal tubules of mice and in cultured mDCT15 cells upregulated NCC. In contrast to ENaC, Nedd4-2-mediated inhibition of NCC did not require the PY-like motif of NCC. Moreover, the mutation of Nedd4-2 at either serine 328 or 222 did not affect SGK1 action, and mutation at both sites enhanced Nedd4-2 activity and abolished SGK1-dependent inhibition. Taken together, these results suggest that aldosterone modulates NCC protein expression via a pathway involving SGK1 and Nedd4-2 and provides an explanation for the well-known aldosterone-induced increase in NCC protein expression. PMID:21852580
Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
NASA Astrophysics Data System (ADS)
Kocurek, Klaudia I.; Stones, Leanne; Bunch, Josephine; May, Robin C.; Cooper, Helen J.
2017-10-01
We have previously shown that liquid extraction surface analysis (LESA) mass spectrometry (MS) is a technique suitable for the top-down analysis of proteins directly from intact colonies of the Gram-negative bacterium Escherichia coli K-12. Here we extend the application of LESA MS to Gram-negative Pseudomonas aeruginosa PS1054 and Gram-positive Staphylococcus aureus MSSA476, as well as two strains of E. coli (K-12 and BL21 mCherry) and an unknown species of Staphylococcus. Moreover, we demonstrate the discrimination between three species of Gram-positive Streptococcus ( Streptococcus pneumoniae D39, and the viridans group Streptococcus oralis ATCC 35037 and Streptococcus gordonii ATCC35105), a recognized challenge for matrix-assisted laser desorption ionization time-of-flight MS. A range of the proteins detected were selected for top-down LESA MS/MS. Thirty-nine proteins were identified by top-down LESA MS/MS, including 16 proteins that have not previously been observed by any other technique. The potential of LESA MS for classification and characterization of novel species is illustrated by the de novo sequencing of a new protein from the unknown species of Staphylococcus. [Figure not available: see fulltext.
Overview of Fusion Tags for Recombinant Proteins.
Kosobokova, E N; Skrypnik, K A; Kosorukov, V S
2016-03-01
Virtually all recombinant proteins are now prepared using fusion domains also known as "tags". The use of tags helps to solve some serious problems: to simplify procedures of protein isolation, to increase expression and solubility of the desired protein, to simplify protein refolding and increase its efficiency, and to prevent proteolysis. In this review, advantages and disadvantages of such fusion tags are analyzed and data on both well-known and new tags are generalized. The authors own data are also presented.
Analysis of extracellular proteins of Aspergillus oryzae grown on soy sauce koji.
Liang, Yanchang; Pan, Li; Lin, Ying
2009-01-01
Aspergillus oryzae AS 3.951 is widely used in Chinese soy sauce manufacture, but little is known about the profiles of the extracellular proteins from the culture of soybean koji. In this study, we carried out MALDI-TOF/TOF MS analysis of extracellular proteins during koji culture. Besides well-known proteins (TAA and Oryzin), a variety of aminopeptidase and proteases were identical at the proteome level. This suggests that A. oryzae AS 3.951 has a powerful capacity to digest soybean protein.
Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy.
Mancias, Joseph D; Wang, Xiaoxu; Gygi, Steven P; Harper, J Wade; Kimmelman, Alec C
2014-05-01
Autophagy, the process by which proteins and organelles are sequestered in double-membrane structures called autophagosomes and delivered to lysosomes for degradation, is critical in diseases such as cancer and neurodegeneration. Much of our understanding of this process has emerged from analysis of bulk cytoplasmic autophagy, but our understanding of how specific cargo, including organelles, proteins or intracellular pathogens, are targeted for selective autophagy is limited. Here we use quantitative proteomics to identify a cohort of novel and known autophagosome-enriched proteins in human cells, including cargo receptors. Like known cargo receptors, nuclear receptor coactivator 4 (NCOA4) was highly enriched in autophagosomes, and associated with ATG8 proteins that recruit cargo-receptor complexes into autophagosomes. Unbiased identification of NCOA4-associated proteins revealed ferritin heavy and light chains, components of an iron-filled cage structure that protects cells from reactive iron species but is degraded via autophagy to release iron through an unknown mechanism. We found that delivery of ferritin to lysosomes required NCOA4, and an inability of NCOA4-deficient cells to degrade ferritin led to decreased bioavailable intracellular iron. This work identifies NCOA4 as a selective cargo receptor for autophagic turnover of ferritin (ferritinophagy), which is critical for iron homeostasis, and provides a resource for further dissection of autophagosomal cargo-receptor connectivity.
Storr, Helen L.; Kind, Barbara; Parfitt, David A.; Chapple, J. Paul; Lorenz, M.; Koehler, Katrin; Huebner, Angela; Clark, Adrian J. L.
2009-01-01
Triple A syndrome is a rare autosomal recessive disorder characterized by ACTH-resistant adrenal failure, alacrima, achalasia, and progressive neurological manifestations. The majority of cases are associated with mutations in the AAAS gene, which encodes a novel, 60-kDa WD-repeat nuclear pore protein, alacrima-achalasia-adrenal insufficiency neurological disorder (ALADIN) of unknown function. Our aim was to elucidate the functional role of ALADIN by determining its interacting protein partners using the bacterial two-hybrid (B2-H) technique. Nonidentical cDNA fragments were identified from both a HeLa S-3 cell and human cerebellar cDNA library that encoded the full-length ferritin heavy chain protein (FTH1). This interaction was confirmed by both co-immunoprecipitation and fluorescence lifetime imaging microscopy-fluorescence resonance energy transfer studies. Immunoblotting showed that fibroblasts from triple A patients (with known AAAS mutations) lack nuclear FTH1, suggesting that the nuclear translocation of FTH1 is defective. Cells transfected with FTH1 and visualized by confocal microscopy had very little nuclear FTH1, but when cotransfected with AAAS, FTH1 is readily visible in the nuclei. Therefore, FTH1 nuclear translocation is enhanced when ALADIN is coexpressed in these cells. In addition to its well known iron storage role, FTH1 has been shown to protect the nucleus from oxidative damage. Apoptosis of neuronal cells induced by hydrogen peroxide was significantly reduced by transfection of AAAS or by FTH1 or maximally by both genes together. Taken together, this work offers a plausible mechanism for the progressive clinical features of triple A syndrome. PMID:19855093
Butterfield, Cristina N; Tebo, Bradley M
2017-02-22
Manganese(ii) oxidation in the environment is thought to be driven by bacteria because enzymatic catalysis is many orders of magnitude faster than the abiotic processes. The heterologously purified Mn oxidase (Mnx) from marine Bacillus sp. PL-12 is made up of the multicopper oxidase (MCO) MnxG and two small Cu and heme-binding proteins of unknown function, MnxE and MnxF. Mnx binds Cu and oxidizes both Mn(ii) and Mn(iii), generating Mn(iv) oxide minerals that resemble those found on the Bacillus spore surface. Spectroscopic techniques have illuminated details about the metallo-cofactors of Mnx, but very little is known about their requirement for catalytic activity, and even less is known about the substrate specificity of Mnx. Here we quantify the canonical MCO Cu and persistent peripheral Cu bound to Mnx, and test Mnx oxidizing ability toward different substrates at varying pH. Mn(ii) appears to be the best substrate in terms of k cat , but its oxidation does not follow Michaelis-Menten kinetics, instead showing a sigmoidal cooperative behavior. Mnx also oxidizes Fe(ii) substrate, but in a Michaelis-Menten manner and with a decreased activity, as well as organic substrates. The reduced metals are more rapidly consumed than the larger organic substrates, suggesting the hypothesis that the Mnx substrate site is small and tuned for metal oxidation. Of biological relevance is the result that Mnx has the highest catalytic efficiency for Mn(ii) at the pH of sea water, especially when the protein is loaded with greater than the requisite four MCO copper atoms, suggesting that the protein has evolved specifically for Mn oxidation.
Dayaram, Anisha; Galatowitsch, Mark L; Argüello-Astorga, Gerardo R; van Bysterveldt, Katherine; Kraberger, Simona; Stainton, Daisy; Harding, Jon S; Roumagnac, Philippe; Martin, Darren P; Lefeuvre, Pierre; Varsani, Arvind
2016-04-01
Over the last five years next-generation sequencing has become a cost effective and efficient method for identifying known and unknown microorganisms. Access to this technique has dramatically changed the field of virology, enabling a wide range of environmental viral metagenome studies to be undertaken of organisms and environmental samples from polar to tropical regions. These studies have led to the discovery of hundreds of highly divergent single stranded DNA (ssDNA) virus-like sequences encoding replication-associated proteins. Yet, few studies have explored how viruses might be shared in an ecosystem through feeding relationships. Here we identify 169 circular molecules (160 CRESS DNA molecules, nine circular molecules) recovered from a New Zealand freshwater lake, that we have tentatively classified into 51 putatively novel species and five previously described species (DflaCV-3, -5, -6, -8, -10). The CRESS DNA viruses identified in this study were recovered from molluscs (Echyridella menzeisii, Musculium novaezelandiae, Potamopyrgus antipodarum and Physella acuta) and insect larvae (Procordulia grayi, Xanthocnemis zealandica, and Chironomus zealandicus) collected from Lake Sarah, as well as from the lake water and benthic sediments. Extensive diversity was observed across most CRESS DNA molecules recovered. The putative capsid protein of one viral species was found to be most similar to those of members of the Tombusviridae family, thus expanding the number of known RNA-DNA hybrid viruses in nature. We noted a strong association between the CRESS DNA viruses and circular molecules identified in the water and browser organisms (C. zealandicus, P. antipodarum and P. acuta), and between water sediments and undefended prey species (C. zealandicus). However, we were unable to find any significant correlation of viral assemblages to the potential feeding relationships of the host aquatic invertebrates. Copyright © 2016 Elsevier B.V. All rights reserved.
Kotzsch, Alexander; Pawolski, Damian; Milentyev, Alexander; Shevchenko, Anna; Scheffel, André; Poulsen, Nicole; Shevchenko, Andrej; Kröger, Nils
2016-01-01
The nano- and micropatterned biosilica cell walls of diatoms are remarkable examples of biological morphogenesis and possess highly interesting material properties. Only recently has it been demonstrated that biosilica-associated organic structures with specific nanopatterns (termed insoluble organic matrices) are general components of diatom biosilica. The model diatom Thalassiosira pseudonana contains three types of insoluble organic matrices: chitin meshworks, organic microrings, and organic microplates, the latter being described in the present study for the first time. To date, little is known about the molecular composition, intracellular assembly, and biological functions of organic matrices. Here we have performed structural and functional analyses of the organic microrings and organic microplates from T. pseudonana. Proteomics analysis yielded seven proteins of unknown function (termed SiMat proteins) together with five known silica biomineralization proteins (four cingulins and one silaffin). The location of SiMat1-GFP in the insoluble organic microrings and the similarity of tyrosine- and lysine-rich functional domains identifies this protein as a new member of the cingulin protein family. Mass spectrometric analysis indicates that most of the lysine residues of cingulins and the other insoluble organic matrix proteins are post-translationally modified by short polyamine groups, which are known to enhance the silica formation activity of proteins. Studies with recombinant cingulins (rCinY2 and rCinW2) demonstrate that acidic conditions (pH 5.5) trigger the assembly of mixed cingulin aggregates that have silica formation activity. Our results suggest an important role for cingulins in the biogenesis of organic microrings and support the hypothesis that this type of insoluble organic matrix functions in biosilica morphogenesis. PMID:26710847
How to Decide? Multi-Objective Early-Warning Monitoring Networks for Water Suppliers
NASA Astrophysics Data System (ADS)
Bode, Felix; Loschko, Matthias; Nowak, Wolfgang
2015-04-01
Groundwater is a resource for drinking water and hence needs to be protected from contaminations. However, many well catchments include an inventory of known and unknown risk sources, which cannot be eliminated, especially in urban regions. As a matter of risk control, all these risk sources should be monitored. A one-to-one monitoring situation for each risk source would lead to a cost explosion and is even impossible for unknown risk sources. However, smart optimization concepts could help to find promising low-cost monitoring network designs. In this work we develop a concept to plan monitoring networks using multi-objective optimization. Our considered objectives are to maximize the probability of detecting all contaminations, to enhance the early warning time before detected contaminations reach the drinking water well, and to minimize the installation and operating costs of the monitoring network. Using multi-objectives optimization, we avoid the problem of having to weight these objectives to a single objective-function. These objectives are clearly competing, and it is impossible to know their mutual trade-offs beforehand - each catchment differs in many points and it is hardly possible to transfer knowledge between geological formations and risk inventories. To make our optimization results more specific to the type of risk inventory in different catchments we do risk prioritization of all known risk sources. Due to the lack of the required data, quantitative risk ranking is impossible. Instead, we use a qualitative risk ranking to prioritize the known risk sources for monitoring. Additionally, we allow for the existence of unknown risk sources that are totally uncertain in location and in their inherent risk. Therefore, they can neither be located nor ranked. Instead, we represent them by a virtual line of risk sources surrounding the production well. We classify risk sources into four different categories: severe, medium and tolerable for known risk sources and an extra category for the unknown ones. With that, early warning time and detection probability become individual objectives for each risk class. Thus, decision makers can identify monitoring networks valid for controlling the top risk sources, and evaluate the capabilities (or search for least-cost upgrades) to also cover moderate, tolerable and unknown risk sources. Monitoring networks, which are valid for the remaining risk also cover all other risk sources, but only with a relatively poor early-warning time. The data provided for the optimization algorithm are calculated in a preprocessing step by a flow and transport model. It simulates, which potential contaminant plumes from the risk sources would be detectable where and when by all possible candidate positions for monitoring wells. Uncertainties due to hydro(geo)logical phenomena are taken into account by Monte-Carlo simulations. These include uncertainty in ambient flow direction of the groundwater, uncertainty of the conductivity field, and different scenarios for the pumping rates of the production wells. To avoid numerical dispersion during the transport simulations, we use particle-tracking random walk methods when simulating transport.
Structure of a Trypanosoma Brucei Alpha/Beta--Hydrolase Fold Protein With Unknown Function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, E.A.; Holmes, M.; Buckner, F.S.
2009-05-26
The structure of a structural genomics target protein, Tbru020260AAA from Trypanosoma brucei, has been determined to a resolution of 2.2 {angstrom} using multiple-wavelength anomalous diffraction at the Se K edge. This protein belongs to Pfam sequence family PF08538 and is only distantly related to previously studied members of the {alpha}/{beta}-hydrolase fold family. Structural superposition onto representative {alpha}/{beta}-hydrolase fold proteins of known function indicates that a possible catalytic nucleophile, Ser116 in the T. brucei protein, lies at the expected location. However, the present structure and by extension the other trypanosomatid members of this sequence family have neither sequence nor structural similaritymore » at the location of other active-site residues typical for proteins with this fold. Together with the presence of an additional domain between strands {beta}6 and {beta}7 that is conserved in trypanosomatid genomes, this suggests that the function of these homologs has diverged from other members of the fold family.« less
Pi, Liya; Fu, Chunhua; Lu, Yuanquing; Zhou, Junmei; Jorgensen, Marda; Shenoy, Vinayak; Lipson, Kenneth E; Scott, Edward W; Bryant, Andrew J
2018-01-01
Chronic hypoxia frequently complicates the care of patients with interstitial lung disease, contributing to the development of pulmonary hypertension (PH), and premature death. Connective tissue growth factor (CTGF), a matricellular protein of the Cyr61/CTGF/Nov (CCN) family, is known to exacerbate vascular remodeling within the lung. We have previously demonstrated that vascular endothelial-cell specific down-regulation of CTGF is associated with protection against the development of PH associated with hypoxia, though the mechanism for this effect is unknown. In this study, we generated a transgenic mouse line in which the Ctgf gene was floxed and deleted in vascular endothelial cells that expressed Cre recombinase under the control of VE-Cadherin promoter (eCTGF KO mice). Lack of vascular endothelial-derived CTGF protected against the development of PH secondary to chronic hypoxia, as well as in another model of bleomycin-induced pulmonary hypertension. Importantly, attenuation of PH was associated with a decrease in infiltrating inflammatory cells expressing CD11b or integrin α M (ITGAM), a known adhesion receptor for CTGF, in the lungs of hypoxia-exposed eCTGF KO mice. Moreover, these pathological changes were associated with activation of-Rho GTPase family member-cell division control protein 42 homolog (Cdc42) signaling, known to be associated with alteration in endothelial barrier function. These data indicate that endothelial-specific deletion of CTGF results in protection against development of chronic-hypoxia induced PH. This protection is conferred by both a decrease in inflammatory cell recruitment to the lung, and a reduction in lung Cdc42 activity. Based on our studies, CTGF inhibitor treatment should be investigated in patients with PH associated with chronic hypoxia secondary to chronic lung disease.
Chao, Honglu; Liu, Yinlong; Lin, Chao; Xu, Xiupeng; Li, Zheng; Bao, Zhongyuan; Fan, Liang; Tao, Chao; Zhao, Lin; Liu, Yan; Wang, Xiaoming; You, Yongping; Liu, Ning; Ji, Jing
2018-06-09
Phospholipase A 2 is a known aggravator of inflammation and deteriorates neurological outcomes after traumatic brain injury (TBI), however the exact inflammatory mechanisms remain unknown. This study investigated the role of bradykinin and its receptor, which are known initial mediators within inflammation activation, as well as the mechanisms of the cytosolic phospholipase A 2 (cPLA 2 )-related inflammatory responses after TBI. We found that cPLA 2 and bradykinin B2 receptor were upregulated after a TBI. Rats treated with the bradykinin B2 receptor inhibitor LF 16-0687 exhibited significantly less cPLA 2 expression and related inflammatory responses in the brain cortex after sustaining a controlled cortical impact (CCI) injury. Both the cPLA 2 inhibitor and the LF16-0687 improved CCI rat outcomes by decreasing neuron death and reducing brain edema. The following TBI model utilized both primary astrocytes and primary neurons in order to gain further understanding of the inflammation mechanisms of the B2 bradykinin receptor and the cPLA 2 in the central nervous system. There was a stronger reaction from the astrocytes as well as a protective effect of LF16-0687 after the stretch injury and bradykinin treatment. The protein kinase C pathway was thought to be involved in the B2 bradykinin receptor as well as the cPLA 2 -related inflammatory responses. Rottlerin, a Protein Kinase C (PKC) δ inhibitor, decreased the activity of the cPLA 2 activity post-injury, and LF16-0687 suppressed both the PKC pathway and the cPLA 2 activity within the astrocytes. These results indicated that the bradykinin B2 receptor-mediated pathway is involved in the cPLA 2 -related inflammatory response from the PKC pathway. Copyright © 2018. Published by Elsevier B.V.
Persistence of enteric viruses within oysters (Crassostrea virginica)
USDA-ARS?s Scientific Manuscript database
It is well known that water-borne enteric viruses are concentrated by bivalves. Why these viruses are selectively retained and remain infectious within shellfish tissues for extended periods is unknown. Our current hypothesis is that phagocytic hemocytes (blood cells) are a site of virus persiste...
Predictive and comparative analysis of Ebolavirus proteins
Cong, Qian; Pei, Jimin; Grishin, Nick V
2015-01-01
Ebolavirus is the pathogen for Ebola Hemorrhagic Fever (EHF). This disease exhibits a high fatality rate and has recently reached a historically epidemic proportion in West Africa. Out of the 5 known Ebolavirus species, only Reston ebolavirus has lost human pathogenicity, while retaining the ability to cause EHF in long-tailed macaque. Significant efforts have been spent to determine the three-dimensional (3D) structures of Ebolavirus proteins, to study their interaction with host proteins, and to identify the functional motifs in these viral proteins. Here, in light of these experimental results, we apply computational analysis to predict the 3D structures and functional sites for Ebolavirus protein domains with unknown structure, including a zinc-finger domain of VP30, the RNA-dependent RNA polymerase catalytic domain and a methyltransferase domain of protein L. In addition, we compare sequences of proteins that interact with Ebolavirus proteins from RESTV-resistant primates with those from RESTV-susceptible monkeys. The host proteins that interact with GP and VP35 show an elevated level of sequence divergence between the RESTV-resistant and RESTV-susceptible species, suggesting that they may be responsible for host specificity. Meanwhile, we detect variable positions in protein sequences that are likely associated with the loss of human pathogenicity in RESTV, map them onto the 3D structures and compare their positions to known functional sites. VP35 and VP30 are significantly enriched in these potential pathogenicity determinants and the clustering of such positions on the surfaces of VP35 and GP suggests possible uncharacterized interaction sites with host proteins that contribute to the virulence of Ebolavirus. PMID:26158395
Predictive and comparative analysis of Ebolavirus proteins.
Cong, Qian; Pei, Jimin; Grishin, Nick V
2015-01-01
Ebolavirus is the pathogen for Ebola Hemorrhagic Fever (EHF). This disease exhibits a high fatality rate and has recently reached a historically epidemic proportion in West Africa. Out of the 5 known Ebolavirus species, only Reston ebolavirus has lost human pathogenicity, while retaining the ability to cause EHF in long-tailed macaque. Significant efforts have been spent to determine the three-dimensional (3D) structures of Ebolavirus proteins, to study their interaction with host proteins, and to identify the functional motifs in these viral proteins. Here, in light of these experimental results, we apply computational analysis to predict the 3D structures and functional sites for Ebolavirus protein domains with unknown structure, including a zinc-finger domain of VP30, the RNA-dependent RNA polymerase catalytic domain and a methyltransferase domain of protein L. In addition, we compare sequences of proteins that interact with Ebolavirus proteins from RESTV-resistant primates with those from RESTV-susceptible monkeys. The host proteins that interact with GP and VP35 show an elevated level of sequence divergence between the RESTV-resistant and RESTV-susceptible species, suggesting that they may be responsible for host specificity. Meanwhile, we detect variable positions in protein sequences that are likely associated with the loss of human pathogenicity in RESTV, map them onto the 3D structures and compare their positions to known functional sites. VP35 and VP30 are significantly enriched in these potential pathogenicity determinants and the clustering of such positions on the surfaces of VP35 and GP suggests possible uncharacterized interaction sites with host proteins that contribute to the virulence of Ebolavirus.
Outer membrane protein e of Escherichia coli K-12 is co-regulated with alkaline phosphatase.
Tommassen, J; Lugtenberg, B
1980-07-01
Outer membrane protein e is induced in wild-type cells, just like alkaline phosphatase and some other periplasmic proteins, by growth under phosphatase limitation. nmpA and nmpB mutants, which synthesize protein e constitutively, are shown also to produce the periplasmic enzyme alkaline phosphatase constitutively. Alternatively, individual phoS, phoT, and phoR mutants as well as pit pst double mutants, all of which are known to produce alkaline phosphatase constitutively, were found to be constitutive for protein e. Also, the periplasmic space of most nmpA mutants and of all nmpB mutants grown in excess phosphate was found to contain, in addition to alkaline phosphatase, at least two new proteins, a phenomenon known for individual phoT and phoR mutants as well as for pit pst double mutants. The other nmpA mutants as well as phoS mutants lacked one of these extra periplasmic proteins, namely the phosphate-binding protein. From these data and from the known positions of the mentioned genes on the chromosomal map, it is concluded that nmpB mutants are identical to phoR mutants. Moreover, some nmpA mutants were shown to be identical to phoS mutants, whereas other nmpA mutants are likely to contain mutations in one of the genes phoS, phoT, or pst.
Molecular Components of Nitrate and Nitrite Efflux in Yeast
Cabrera, Elisa; González-Montelongo, Rafaela; Giraldez, Teresa; de la Rosa, Diego Alvarez
2014-01-01
Some eukaryotes, such as plant and fungi, are capable of utilizing nitrate as the sole nitrogen source. Once transported into the cell, nitrate is reduced to ammonium by the consecutive action of nitrate and nitrite reductase. How nitrate assimilation is balanced with nitrate and nitrite efflux is unknown, as are the proteins involved. The nitrate assimilatory yeast Hansenula polymorpha was used as a model to dissect these efflux systems. We identified the sulfite transporters Ssu1 and Ssu2 as effective nitrate exporters, Ssu2 being quantitatively more important, and we characterize the Nar1 protein as a nitrate/nitrite exporter. The use of strains lacking either SSU2 or NAR1 along with the nitrate reductase gene YNR1 showed that nitrate reductase activity is not required for net nitrate uptake. Growth test experiments indicated that Ssu2 and Nar1 exporters allow yeast to cope with nitrite toxicity. We also have shown that the well-known Saccharomyces cerevisiae sulfite efflux permease Ssu1 is also able to excrete nitrite and nitrate. These results characterize for the first time essential components of the nitrate/nitrite efflux system and their impact on net nitrate uptake and its regulation. PMID:24363367
ERK3 signals through SRC-3 coactivator to promote human lung cancer cell invasion
Long, Weiwen; Foulds, Charles E.; Qin, Jun; Liu, Jian; Ding, Chen; Lonard, David M.; Solis, Luisa M.; Wistuba, Ignacio I.; Qin, Jun; Tsai, Sophia Y.; Tsai, Ming-Jer; O’Malley, Bert W.
2012-01-01
In contrast to the well-studied classic MAPKs, such as ERK1/2, little is known concerning the regulation and substrates of the atypical MAPK ERK3 signaling cascade and its function in cancer progression. Here, we report that ERK3 interacted with and phosphorylated steroid receptor coactivator 3 (SRC-3), an oncogenic protein overexpressed in multiple human cancers at serine 857 (S857). This ERK3-mediated phosphorylation at S857 was essential for interaction of SRC-3 with the ETS transcription factor PEA3, which promotes upregulation of MMP gene expression and proinvasive activity in lung cancer cells. Importantly, knockdown of ERK3 or SRC-3 inhibited the ability of lung cancer cells to invade and form tumors in the lung in a xenograft mouse model. In addition, ERK3 was found to be highly upregulated in human lung carcinomas. Our study identifies a previously unknown role for ERK3 in promoting lung cancer cell invasiveness by phosphorylating SRC-3 and regulating SRC-3 proinvasive activity by site-specific phosphorylation. As such, ERK3 protein kinase may be an attractive target for therapeutic treatment of invasive lung cancer. PMID:22505454
Cross- and Co-Packaging of Retroviral RNAs and Their Consequences
Ali, Lizna M.; Rizvi, Tahir A.; Mustafa, Farah
2016-01-01
Retroviruses belong to the family Retroviridae and are ribonucleoprotein (RNP) particles that contain a dimeric RNA genome. Retroviral particle assembly is a complex process, and how the virus is able to recognize and specifically capture the genomic RNA (gRNA) among millions of other cellular and spliced retroviral RNAs has been the subject of extensive investigation over the last two decades. The specificity towards RNA packaging requires higher order interactions of the retroviral gRNA with the structural Gag proteins. Moreover, several retroviruses have been shown to have the ability to cross-/co-package gRNA from other retroviruses, despite little sequence homology. This review will compare the determinants of gRNA encapsidation among different retroviruses, followed by an examination of our current understanding of the interaction between diverse viral genomes and heterologous proteins, leading to their cross-/co-packaging. Retroviruses are well-known serious animal and human pathogens, and such a cross-/co-packaging phenomenon could result in the generation of novel viral variants with unknown pathogenic potential. At the same time, however, an enhanced understanding of the molecular mechanisms involved in these specific interactions makes retroviruses an attractive target for anti-viral drugs, vaccines, and vectors for human gene therapy. PMID:27727192
Cross- and Co-Packaging of Retroviral RNAs and Their Consequences.
Ali, Lizna M; Rizvi, Tahir A; Mustafa, Farah
2016-10-11
Retroviruses belong to the family Retroviridae and are ribonucleoprotein (RNP) particles that contain a dimeric RNA genome. Retroviral particle assembly is a complex process, and how the virus is able to recognize and specifically capture the genomic RNA (gRNA) among millions of other cellular and spliced retroviral RNAs has been the subject of extensive investigation over the last two decades. The specificity towards RNA packaging requires higher order interactions of the retroviral gRNA with the structural Gag proteins. Moreover, several retroviruses have been shown to have the ability to cross-/co-package gRNA from other retroviruses, despite little sequence homology. This review will compare the determinants of gRNA encapsidation among different retroviruses, followed by an examination of our current understanding of the interaction between diverse viral genomes and heterologous proteins, leading to their cross-/co-packaging. Retroviruses are well-known serious animal and human pathogens, and such a cross-/co-packaging phenomenon could result in the generation of novel viral variants with unknown pathogenic potential. At the same time, however, an enhanced understanding of the molecular mechanisms involved in these specific interactions makes retroviruses an attractive target for anti-viral drugs, vaccines, and vectors for human gene therapy.
Zhao, Ming; Zhang, Dong-lian; Su, Xiao-qin; Duan, Shuang-mei; Wan, Jin-qiong; Yuan, Wen-xia; Liu, Ben-ying; Ma, Yan; Pan, Ying-hong
2015-01-01
Microbial enzymes during solid-state fermentation (SSF), which play important roles in the food, chemical, pharmaceutical and environmental fields, remain relatively unknown. In this work, the microbial communities and enzymes in SSF of Pu-erh tea, a well-known traditional Chinese tea, were investigated by integrated metagenomics/metaproteomics approach. The dominant bacteria and fungi were identified as Proteobacteria (48.42%) and Aspergillus (94.98%), through pyrosequencing-based analyses of the bacterial 16S and fungal 18S rRNA genes, respectively. In total, 335 proteins with at least two unique peptides were identified and classified into 28 Biological Processes and 35 Molecular Function categories using a metaproteomics analysis. The integration of metagenomics and metaproteomics data demonstrated that Aspergillus was dominant fungus and major host of identified proteins (50.45%). Enzymes involved in the degradation of the plant cell wall were identified and associated with the soft-rotting of tea leaves. Peroxiredoxins, catalase and peroxidases were associated with the oxidation of catechins. In conclusion, this work greatly advances our understanding of the SSF of Pu-erh tea and provides a powerful tool for studying SSF mechanisms, especially in relation to the microbial communities present. PMID:25974221
Cho, Hana; Park, Ok Hyun; Park, Joori; Ryu, Incheol; Kim, Jeonghan; Ko, Jesang; Kim, Yoon Ki
2015-03-31
Glucocorticoid receptor (GR), which was originally known to function as a nuclear receptor, plays a role in rapid mRNA degradation by acting as an RNA-binding protein. The mechanism by which this process occurs remains unknown. Here, we demonstrate that GR, preloaded onto the 5'UTR of a target mRNA, recruits UPF1 through proline-rich nuclear receptor coregulatory protein 2 (PNRC2) in a ligand-dependent manner, so as to elicit rapid mRNA degradation. We call this process GR-mediated mRNA decay (GMD). Although GMD, nonsense-mediated mRNA decay (NMD), and staufen-mediated mRNA decay (SMD) share upstream frameshift 1 (UPF1) and PNRC2, we find that GMD is mechanistically distinct from NMD and SMD. We also identify de novo cellular GMD substrates using microarray analysis. Intriguingly, GMD functions in the chemotaxis of human monocytes by targeting chemokine (C-C motif) ligand 2 (CCL2) mRNA. Thus, our data provide molecular evidence of a posttranscriptional role of the well-studied nuclear hormone receptor, GR, which is traditionally considered a transcription factor.
Fan, Guangyi; Jiao, Yu; Zhang, He; Huang, Ronglian; Zheng, Zhe; Bian, Chao; Deng, Yuewen; Wang, Qingheng; Wang, Zhongduo; Liang, Xinming; Liang, Haiying; Shi, Chengcheng; Zhao, Xiaoxia; Sun, Fengming; Hao, Ruijuan; Bai, Jie; Liu, Jialiang; Chen, Wenbin; Liang, Jinlian; Liu, Weiqing; Xu, Zhe; Shi, Qiong; Xu, Xun
2017-01-01
Abstract Nacre, the iridescent material found in pearls and shells of molluscs, is formed through an extraordinary process of matrix-assisted biomineralization. Despite recent advances, many aspects of the biomineralization process and its evolutionary origin remain unknown. The pearl oyster Pinctada fucata martensii is a well-known master of biomineralization, but the molecular mechanisms that underlie its production of shells and pearls are not fully understood. We sequenced the highly polymorphic genome of the pearl oyster and conducted multi-omic and biochemical studies to probe nacre formation. We identified a large set of novel proteins participating in matrix-framework formation, many in expanded families, including components similar to that found in vertebrate bones such as collagen-related VWA-containing proteins, chondroitin sulfotransferases, and regulatory elements. Considering that there are only collagen-based matrices in vertebrate bones and chitin-based matrices in most invertebrate skeletons, the presence of both chitin and elements of collagen-based matrices in nacre suggests that elements of chitin- and collagen-based matrices have deep roots and might be part of an ancient biomineralizing matrix. Our results expand the current shell matrix-framework model and provide new insights into the evolution of diverse biomineralization systems. PMID:28873964
Schiefthaler, Ursula; Balasubramanian, Sureshkumar; Sieber, Patrick; Chevalier, David; Wisman, Ellen; Schneitz, Kay
1999-01-01
Sexual reproduction is a salient aspect of plants, and elaborate structures, such as the flowers of angiosperms, have evolved that aid in this process. Within the flower the corresponding sex organs, the anther and the ovule, form the male and female sporangia, the pollen sac and the nucellus, respectively. However, despite their central role for sexual reproduction little is known about the mechanisms that control the establishment of these important structures. Here we present the identification and molecular characterization of the NOZZLE (NZZ) gene in the flowering plant Arabidopsis thaliana. In several nzz mutants the nucellus and the pollen sac fail to form. It indicates that NZZ plays an early and central role in the development of both types of sporangia and that the mechanisms controlling these processes share a crucial factor. In addition, NZZ may have an early function during male and female sporogenesis as well. The evolutionary aspects of these findings are discussed. NZZ encodes a putative protein of unknown function. However, based on sequence analysis we speculate that NZZ is a nuclear protein and possibly a transcription factor. PMID:10500234
Dewhurst, Henry M.; Choudhury, Shilpa; Torres, Matthew P.
2015-01-01
Predicting the biological function potential of post-translational modifications (PTMs) is becoming increasingly important in light of the exponential increase in available PTM data from high-throughput proteomics. We developed structural analysis of PTM hotspots (SAPH-ire)—a quantitative PTM ranking method that integrates experimental PTM observations, sequence conservation, protein structure, and interaction data to allow rank order comparisons within or between protein families. Here, we applied SAPH-ire to the study of PTMs in diverse G protein families, a conserved and ubiquitous class of proteins essential for maintenance of intracellular structure (tubulins) and signal transduction (large and small Ras-like G proteins). A total of 1728 experimentally verified PTMs from eight unique G protein families were clustered into 451 unique hotspots, 51 of which have a known and cited biological function or response. Using customized software, the hotspots were analyzed in the context of 598 unique protein structures. By comparing distributions of hotspots with known versus unknown function, we show that SAPH-ire analysis is predictive for PTM biological function. Notably, SAPH-ire revealed high-ranking hotspots for which a functional impact has not yet been determined, including phosphorylation hotspots in the N-terminal tails of G protein gamma subunits—conserved protein structures never before reported as regulators of G protein coupled receptor signaling. To validate this prediction we used the yeast model system for G protein coupled receptor signaling, revealing that gamma subunit–N-terminal tail phosphorylation is activated in response to G protein coupled receptor stimulation and regulates protein stability in vivo. These results demonstrate the utility of integrating protein structural and sequence features into PTM prioritization schemes that can improve the analysis and functional power of modification-specific proteomics data. PMID:26070665
Minocycline attenuates cardiac dysfunction in tumor-burdened mice.
Devine, Raymond D; Eichenseer, Clayton M; Wold, Loren E
2016-11-01
Cardiovascular dysfunction as a result of tumor burden is becoming a recognized complication; however, the mechanisms remain unknown. A murine model of cancer cachexia has shown marked increases of matrix metalloproteinases (MMPs), known mediators of cardiac remodeling, in the left ventricle. The extent to which MMPs are involved in remodeling remains obscured. To this end a common antibiotic, minocycline, with MMP inhibitory properties was used to elucidate MMP involvement in tumor induced cardiovascular dysfunction. Tumor-bearing mice showed decreased cardiac function with reduced posterior wall thickness (PWTs) during systole, increased MMP and collagen expression consistent with fibrotic remodeling. Administration of minocycline preserved cardiac function in tumor bearing mice and decreased collagen RNA expression in the left ventricle. MMP protein levels were unaffected by minocycline administration, with the exception of MMP-9, indicating minocycline inhibition mechanisms are directly affecting MMP activity. Cancer induced cardiovascular dysfunction is an increasing concern; novel therapeutics are needed to prevent cardiac complications. Minocycline is a well-known antibiotic and recently has been shown to possess MMP inhibitory properties. Our findings presented here show that minocycline could represent a novel use for a long established drug in the prevention and treatment of cancer induced cardiovascular dysfunction. Copyright © 2016 Elsevier Ltd. All rights reserved.
Internal amino acid state modulates yeast taste neurons to support protein homeostasis in Drosophila
Itskov, Pavel M; Baltazar, Célia; Moreira, José-Maria
2018-01-01
To optimize fitness, animals must dynamically match food choices to their current needs. For drosophilids, yeast fulfills most dietary protein and micronutrient requirements. While several yeast metabolites activate known gustatory receptor neurons (GRNs) in Drosophila melanogaster, the chemosensory channels mediating yeast feeding remain unknown. Here we identify a class of proboscis GRNs required for yeast intake. Within this class, taste peg GRNs are specifically required to sustain yeast feeding. Sensillar GRNs, however, mediate feeding initiation. Furthermore, the response of yeast GRNs, but not sweet GRNs, is enhanced following deprivation from amino acids, providing a potential basis for protein-specific appetite. Although nutritional and reproductive states synergistically increase yeast appetite, reproductive state acts independently of nutritional state, modulating processing downstream of GRNs. Together, these results suggest that different internal states act at distinct levels of a dedicated gustatory circuit to elicit nutrient-specific appetites towards a complex, ecologically relevant protein source. PMID:29393045
Complete fold annotation of the human proteome using a novel structural feature space.
Middleton, Sarah A; Illuminati, Joseph; Kim, Junhyong
2017-04-13
Recognition of protein structural fold is the starting point for many structure prediction tools and protein function inference. Fold prediction is computationally demanding and recognizing novel folds is difficult such that the majority of proteins have not been annotated for fold classification. Here we describe a new machine learning approach using a novel feature space that can be used for accurate recognition of all 1,221 currently known folds and inference of unknown novel folds. We show that our method achieves better than 94% accuracy even when many folds have only one training example. We demonstrate the utility of this method by predicting the folds of 34,330 human protein domains and showing that these predictions can yield useful insights into potential biological function, such as prediction of RNA-binding ability. Our method can be applied to de novo fold prediction of entire proteomes and identify candidate novel fold families.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Middleton, Sarah A.; Illuminati, Joseph; Kim, Junhyong
Recognition of protein structural fold is the starting point for many structure prediction tools and protein function inference. Fold prediction is computationally demanding and recognizing novel folds is difficult such that the majority of proteins have not been annotated for fold classification. Here we describe a new machine learning approach using a novel feature space that can be used for accurate recognition of all 1,221 currently known folds and inference of unknown novel folds. We show that our method achieves better than 94% accuracy even when many folds have only one training example. We demonstrate the utility of this methodmore » by predicting the folds of 34,330 human protein domains and showing that these predictions can yield useful insights into potential biological function, such as prediction of RNA-binding ability. Finally, our method can be applied to de novo fold prediction of entire proteomes and identify candidate novel fold families.« less
Protein-like fully reversible tetramerisation and super-association of an aminocellulose
NASA Astrophysics Data System (ADS)
Nikolajski, Melanie; Adams, Gary G.; Gillis, Richard B.; Besong, David Tabot; Rowe, Arthur J.; Heinze, Thomas; Harding, Stephen E.
2014-01-01
Unusual protein-like, partially reversible associative behaviour has recently been observed in solutions of the water soluble carbohydrates known as 6-deoxy-6-(ω-aminoalkyl)aminocelluloses, which produce controllable self-assembling films for enzyme immobilisation and other biotechnological applications. Now, for the first time, we have found a fully reversible self-association (tetramerisation) within this family of polysaccharides. Remarkably these carbohydrate tetramers are then seen to associate further in a regular way into supra-molecular complexes. Fully reversible oligomerisation has been hitherto completely unknown for carbohydrates and instead resembles in some respects the assembly of polypeptides and proteins like haemoglobin and its sickle cell mutation. Our traditional perceptions as to what might be considered ``protein-like'' and what might be considered as ``carbohydrate-like'' behaviour may need to be rendered more flexible, at least as far as interaction phenomena are concerned.
RPA-Binding Protein ETAA1 Is an ATR Activator Involved in DNA Replication Stress Response.
Lee, Yuan-Cho; Zhou, Qing; Chen, Junjie; Yuan, Jingsong
2016-12-19
ETAA1 (Ewing tumor-associated antigen 1), also known as ETAA16, was identified as a tumor-specific antigen in the Ewing family of tumors. However, the biological function of this protein remains unknown. Here, we report the identification of ETAA1 as a DNA replication stress response protein. ETAA1 specifically interacts with RPA (Replication protein A) via two conserved RPA-binding domains and is therefore recruited to stalled replication forks. Interestingly, further analysis of ETAA1 function revealed that ETAA1 participates in the activation of ATR signaling pathway via a conserved ATR-activating domain (AAD) located near its N terminus. Importantly, we demonstrate that both RPA binding and ATR activation are required for ETAA1 function at stalled replication forks to maintain genome stability. Therefore, our data suggest that ETAA1 is a new ATR activator involved in replication checkpoint control. Copyright © 2016 Elsevier Ltd. All rights reserved.
Complete fold annotation of the human proteome using a novel structural feature space
Middleton, Sarah A.; Illuminati, Joseph; Kim, Junhyong
2017-01-01
Recognition of protein structural fold is the starting point for many structure prediction tools and protein function inference. Fold prediction is computationally demanding and recognizing novel folds is difficult such that the majority of proteins have not been annotated for fold classification. Here we describe a new machine learning approach using a novel feature space that can be used for accurate recognition of all 1,221 currently known folds and inference of unknown novel folds. We show that our method achieves better than 94% accuracy even when many folds have only one training example. We demonstrate the utility of this method by predicting the folds of 34,330 human protein domains and showing that these predictions can yield useful insights into potential biological function, such as prediction of RNA-binding ability. Our method can be applied to de novo fold prediction of entire proteomes and identify candidate novel fold families. PMID:28406174
Petyuk, Vladislav A.; Qian, Wei-Jun; Hinault, Charlotte; Gritsenko, Marina A.; Singhal, Mudita; Monroe, Matthew E.; Camp, David G.; Kulkarni, Rohit N.; Smith, Richard D.
2009-01-01
The pancreatic islets of Langerhans, and especially the insulin-producing beta cells, play a central role in the maintenance of glucose homeostasis. Alterations in the expression of multiple proteins in the islets that contribute to the maintenance of islet function are likely to underlie the pathogenesis of type 2 diabetes. To identify proteins that constitute the islet proteome, we provide the first comprehensive proteomic characterization of pancreatic islets for mouse, the most commonly used animal model in diabetes research. Using strong cation exchange fractionation coupled with reversed phase LC-MS/MS we report the confident identification of 17,350 different tryptic peptides covering 2,612 proteins having at least two unique peptides per protein. The dataset also identified ~60 post-translationally modified peptides including oxidative modifications and phosphorylation. While many of the identified phosphorylation sites corroborate those previously known, the oxidative modifications observed on cysteinyl residues reveal potentially novel information suggesting a role for oxidative stress in islet function. Comparative analysis with 15 available proteomic datasets from other mouse tissues and cells revealed a set of 133 proteins predominantly expressed in pancreatic islets. This unique set of proteins, in addition to those with known functions such as peptide hormones secreted from the islets, contains several proteins with as yet unknown functions. The mouse islet protein and peptide database accessible at http://ncrr.pnl.gov, provides an important reference resource for the research community to facilitate research in the diabetes and metabolism fields. PMID:18570455
Allan, Christopher M.; Awad, Agape M.; Johnson, Jarrett S.; Shirasaki, Dyna I.; Wang, Charles; Blaby-Haas, Crysten E.; Merchant, Sabeeha S.; Loo, Joseph A.; Clarke, Catherine F.
2015-01-01
Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1–COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. Here, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11. PMID:25631044
Allan, Christopher M.; Awad, Agape M.; Johnson, Jarrett S.; ...
2015-01-28
Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1–COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. In thismore » paper, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q 6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Finally, given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allan, Christopher M.; Awad, Agape M.; Johnson, Jarrett S.
Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1–COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. In thismore » paper, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q 6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Finally, given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11.« less
Detection of an unknown fusion protein in confiscated black market products.
Walpurgis, Katja; Krug, Oliver; Thomas, Andreas; Laussmann, Tim; Schänzer, Wilhelm; Thevis, Mario
2014-01-01
Even without clinical approval, many performance-enhancing drugs are available on the black market and can therefore be easily obtained by cheating athletes. The misuse of these preparations can be associated with unforeseeable health risks - either due to a poor quality of the drugs or as a result of an insufficient clinical assessment. Moreover, confiscated black market products have frequently been shown to contain ingredients other than those declared on the label as well as additional by-products or compounds with a modified molecular structure. This communication describes the identification of an unknown fusion protein observed in several unlabelled black market products obtained from independent sources. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of the confiscated preparations indicated the presence of an 18-kDa fusion protein consisting of the bacterial redox protein thioredoxin-1 (Trx, 12 kDa) and a 6-kDa peptide of unassigned composition. Trx has no relevance as performance enhancing agent but is routinely used as solubility tag for recombinant protein production. Further evaluation of the acquired MS/MS data revealed both an additional His tag and a thrombin cleavage site between the tags and the presumed bioactive peptide. However, thrombin cleavage of the fusion protein and LC-MS/MS analysis of the resulting peptide fragment finally suggested that the unknown protein is only the product of an empty expression vector without the DNA insert of interest. These findings are a further alarming example for the high level of risk that athletes take when misusing drugs obtained from the black market. Copyright © 2014 John Wiley & Sons, Ltd.
Coram, Nicolette J; van Zyl, Leonardo J; Rawlings, Douglas E
2005-11-01
Two plasmids, of 28,878 bp and 28,012 bp, were isolated from Leptospirillum ferrooxidans ATCC 49879. Altogether, a total of 67 open reading frames (ORFs) were identified on both plasmids, of which 32 had predicted products with high homology to proteins of known function, while 11 ORFs had predicted products with homology to previously identified proteins of unknown function. Twenty-four ORFs had products with no homologues in the GenBank/NCBI database. An analysis of the ORFs and other features of the two plasmids, the first to be isolated from a bacterium of the genus Leptospirillum, is presented.
Lagkouvardos, Ilias; Weinmaier, Thomas; Lauro, Federico M; Cavicchioli, Ricardo; Rattei, Thomas; Horn, Matthias
2014-01-01
In the era of metagenomics and amplicon sequencing, comprehensive analyses of available sequence data remain a challenge. Here we describe an approach exploiting metagenomic and amplicon data sets from public databases to elucidate phylogenetic diversity of defined microbial taxa. We investigated the phylum Chlamydiae whose known members are obligate intracellular bacteria that represent important pathogens of humans and animals, as well as symbionts of protists. Despite their medical relevance, our knowledge about chlamydial diversity is still scarce. Most of the nine known families are represented by only a few isolates, while previous clone library-based surveys suggested the existence of yet uncharacterized members of this phylum. Here we identified more than 22 000 high quality, non-redundant chlamydial 16S rRNA gene sequences in diverse databases, as well as 1900 putative chlamydial protein-encoding genes. Even when applying the most conservative approach, clustering of chlamydial 16S rRNA gene sequences into operational taxonomic units revealed an unexpectedly high species, genus and family-level diversity within the Chlamydiae, including 181 putative families. These in silico findings were verified experimentally in one Antarctic sample, which contained a high diversity of novel Chlamydiae. In our analysis, the Rhabdochlamydiaceae, whose known members infect arthropods, represents the most diverse and species-rich chlamydial family, followed by the protist-associated Parachlamydiaceae, and a putative new family (PCF8) with unknown host specificity. Available information on the origin of metagenomic samples indicated that marine environments contain the majority of the newly discovered chlamydial lineages, highlighting this environment as an important chlamydial reservoir. PMID:23949660
Wilms tumour is an embryonal tumour of childhood that closely resembles the developing kidney. Genomic changes responsible for the development of the majority of Wilms tumours remain largely unknown. Here we identify recurrent mutations within Wilms tumours that involve the highly conserved YEATS domain of MLLT1 (ENL), a gene known to be involved in transcriptional elongation during early development. The mutant MLLT1 protein shows altered binding to acetylated histone tails.
A new gene for asthma: would you ADAM and Eve it?
Cookson, William
2003-04-01
Recently, a novel gene was reported to underlie asthma. Linkage to the short arm of chromosome 20 in a genome screen was followed by positive tests of association that centre on the gene for a membrane-anchored zinc-dependent metalloproteinase known as ADAM33. The domain structure of the ADAM33 protein gives capabilities of proteolysis, adhesion, cell fusion and intracellular signalling. Although its function is at present unknown, these potential actions of ADAM33 provide many possibilities for further research.
Mandaokar, Ajin; Kumar, V Dinesh; Amway, Matt; Browse, John
2003-07-01
Jasmonate (JA) is a signaling compound essential for anther development and pollen fertility in Arabidopsis. Mutations that block the pathway of JA synthesis result into male sterility. To understand the processes of anther and pollen maturation, we used microarray and differential display approaches to compare gene expression pattern in anthers of wild-type Arabidopsis and the male-sterile mutant, opr3. Microarray experiment revealed 25 genes that were up-regulated more than 1.8-fold in wild-type anthers as compared to mutant anthers. Experiments based on differential display identified 13 additional genes up-regulated in wild-type anthers compared to opr3 for a total of 38 differentially expressed genes. Searches of the Arabidopsis and non-redundant databases disclosed known or likely functions for 28 of the 38 genes identified, while 10 genes encode proteins of unknown function. Northern blot analysis of eight representative clones as probes confirmed low expression in opr3 anthers compared with wild-type anthers. JA responsiveness of these same genes was also investigated by northern blot analysis of anther RNA isolated from wild-type and opr3 plants, In these experiments, four genes were induced in opr3 anthers within 0.5-1 h of JA treatment while the remaining genes were up-regulated only 1-8 h after JA application. None of these genes was induced by JA in anthers of the coil mutant that is deficient in JA responsiveness. The four early-induced genes in opr3 encode lipoxygenase, a putative bHLH transcription factor, epithiospecifier protein and an unknown protein. We propose that these and other early components may be involved in JA signaling and in the initiation of developmental processes. The four late genes encode an extensin-like protein, a peptide transporter and two unknown proteins, which may represent components required later in anther and pollen maturation. Transcript profiling has provided a successful approach to identify genes involved in anther and pollen maturation in Arabidopsis.
Nadzirin, Nurul; Firdaus-Raih, Mohd
2012-10-08
Proteins of uncharacterized functions form a large part of many of the currently available biological databases and this situation exists even in the Protein Data Bank (PDB). Our analysis of recent PDB data revealed that only 42.53% of PDB entries (1084 coordinate files) that were categorized under "unknown function" are true examples of proteins of unknown function at this point in time. The remainder 1465 entries also annotated as such appear to be able to have their annotations re-assessed, based on the availability of direct functional characterization experiments for the protein itself, or for homologous sequences or structures thus enabling computational function inference.
Parathyroid hormone-dependent signaling pathways regulating genes in bone cells
NASA Technical Reports Server (NTRS)
Swarthout, John T.; D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Partridge, Nicola C.
2002-01-01
Parathyroid hormone (PTH) is an 84-amino-acid polypeptide hormone functioning as a major mediator of bone remodeling and as an essential regulator of calcium homeostasis. PTH and PTH-related protein (PTHrP) indirectly activate osteoclasts resulting in increased bone resorption. During this process, PTH changes the phenotype of the osteoblast from a cell involved in bone formation to one directing bone resorption. In addition to these catabolic effects, PTH has been demonstrated to be an anabolic factor in skeletal tissue and in vitro. As a result, PTH has potential medical application to the treatment of osteoporosis, since intermittent administration of PTH stimulates bone formation. Activation of osteoblasts by PTH results in expression of genes important for the degradation of the extracellular matrix, production of growth factors, and stimulation and recruitment of osteoclasts. The ability of PTH to drive changes in gene expression is dependent upon activation of transcription factors such as the activator protein-1 family, RUNX2, and cAMP response element binding protein (CREB). Much of the regulation of these processes by PTH is protein kinase A (PKA)-dependent. However, while PKA is linked to many of the changes in gene expression directed by PTH, PKA activation has been shown to inhibit mitogen-activated protein kinase (MAPK) and proliferation of osteoblasts. It is now known that stimulation of MAPK and proliferation by PTH at low concentrations is protein kinase C (PKC)-dependent in both osteoblastic and kidney cells. Furthermore, PTH has been demonstrated to regulate components of the cell cycle. However, whether this regulation requires PKC and/or extracellular signal-regulated kinases or whether PTH is able to stimulate other components of the cell cycle is unknown. It is possible that stimulation of this signaling pathway by PTH mediates a unique pattern of gene expression resulting in proliferation in osteoblastic and kidney cells; however, specific examples of this are still unknown. This review will focus on what is known about PTH-mediated cell signaling, and discuss the established or putative PTH-regulated pattern of gene expression in osteoblastic cells following treatment with catabolic (high) or anabolic (low) concentrations of the hormone.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sachleben, Joseph R.; Adhikari, Aashish N.; Gawlak, Grzegorz
2016-11-10
We determined the NMR structure of a highly aromatic (13%) protein of unknown function, Aq1974 from Aquifex aeolicus (PDB ID: 5SYQ). The unusual sequence of this protein has a tryptophan content five times the normal (six tryptophan residues of 114 or 5.2% while the average tryptophan content is 1.0%) with the tryptophans occurring in a WXW motif. It has no detectable sequence homology with known protein structures. Although its NMR spectrum suggested that the protein was rich in β-sheet, upon resonance assignment and solution structure determination, the protein was found to be primarily α-helical with a small two-stranded β-sheet withmore » a novel fold that we have termed an Aromatic Claw. As this fold was previously unknown and the sequence unique, we submitted the sequence to CASP10 as a target for blind structural prediction. At the end of the competition, the sequence was classified a hard template based model; the structural relationship between the template and the experimental structure was small and the predictions all failed to predict the structure. CSRosetta was found to predict the secondary structure and its packing; however, it was found that there was little correlation between CSRosetta score and the RMSD between the CSRosetta structure and the NMR determined one. This work demonstrates that even in relatively small proteins, we do not yet have the capacity to accurately predict the fold for all primary sequences. The experimental discovery of new folds helps guide the improvement of structural prediction methods.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Yongil; Yoo, Chang Geun; Guo, Hao -Bo
Domain of Unknown Function 266 (DUF266) is a plant-specific domain. DUF266-containing proteins (DUF266 proteins) have been categorized as ‘not classified glycosyltransferases (GTnc)’ due to amino acid similarity with GTs. However, little is known about the function of DUF266 proteins. As a result, Phylogenetic analysis revealed that DUF266 proteins are only present in the land plants including moss and lycophyte. We report the functional characterization of one member of DUF266 proteins in Populus, PdDUF266A. PdDUF266A was ubiquitously expressed with high abundance in the xylem. In Populus transgenic plants overexpressing PdDUF266A ( OXPdDUF266A), the glucose and cellulose contents were significantly higher, whilemore » the lignin content was lower than that in the wild type. Degree of polymerization of cellulose in OXPdDUF266A transgenic plants was also higher, whereas cellulose crystallinity index remained unchanged. Gene expression analysis indicated that cellulose biosynthesis-related genes such as CESA and SUSY were upregulated in mature leaf and xylem of OXPdDUF266A transgenic plants. Moreover, PdDUF266A overexpression resulted in an increase of biomass production. Their glucose contents and biomass phenotypes were further validated via heterologous expression of PdDUF266A in Arabidopsis. Results from saccharification treatment demonstrated that the rate of sugar release was increased by approximately 38% in the OXPdDUF266A transgenic plants.« less
Yang, Yongil; Yoo, Chang Geun; Guo, Hao -Bo; ...
2017-03-23
Domain of Unknown Function 266 (DUF266) is a plant-specific domain. DUF266-containing proteins (DUF266 proteins) have been categorized as ‘not classified glycosyltransferases (GTnc)’ due to amino acid similarity with GTs. However, little is known about the function of DUF266 proteins. As a result, Phylogenetic analysis revealed that DUF266 proteins are only present in the land plants including moss and lycophyte. We report the functional characterization of one member of DUF266 proteins in Populus, PdDUF266A. PdDUF266A was ubiquitously expressed with high abundance in the xylem. In Populus transgenic plants overexpressing PdDUF266A ( OXPdDUF266A), the glucose and cellulose contents were significantly higher, whilemore » the lignin content was lower than that in the wild type. Degree of polymerization of cellulose in OXPdDUF266A transgenic plants was also higher, whereas cellulose crystallinity index remained unchanged. Gene expression analysis indicated that cellulose biosynthesis-related genes such as CESA and SUSY were upregulated in mature leaf and xylem of OXPdDUF266A transgenic plants. Moreover, PdDUF266A overexpression resulted in an increase of biomass production. Their glucose contents and biomass phenotypes were further validated via heterologous expression of PdDUF266A in Arabidopsis. Results from saccharification treatment demonstrated that the rate of sugar release was increased by approximately 38% in the OXPdDUF266A transgenic plants.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Green, Jaromy; Sun Zaijing; Wells, Doug
2009-03-10
Photon activation analysis detected elements in two NIST standards that did not have reported concentration values. A method is currently being developed to infer these concentrations by using scaling parameters and the appropriate known quantities within the NIST standard itself. Scaling parameters include: threshold, peak and endpoint energies; photo-nuclear cross sections for specific isotopes; Bremstrahlung spectrum; target thickness; and photon flux. Photo-nuclear cross sections and energies from the unknown elements must also be known. With these quantities, the same integral was performed for both the known and unknown elements resulting in an inference of the concentration of the un-reported elementmore » based on the reported value. Since Rb and Mn were elements that were reported in the standards, and because they had well-identified peaks, they were used as the standards of inference to determine concentrations of the unreported elements of As, I, Nb, Y, and Zr. This method was tested by choosing other known elements within the standards and inferring a value based on the stated procedure. The reported value of Mn in the first NIST standard was 403{+-}15 ppm and the reported value of Ca in the second NIST standard was 87000 ppm (no reported uncertainty). The inferred concentrations were 370{+-}23 ppm and 80200{+-}8700 ppm respectively.« less
Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach
Cambronne, Xiaolu A.; Shen, Rongkun; Auer, Paul L.; Goodman, Richard H.
2012-01-01
Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA– RNA-induced silencing complex (RISC)–messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs. PMID:23184980
Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.
Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H
2012-12-11
Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.
Characterization of Durham virus, a novel rhabdovirus that encodes both a C and SH protein.
Allison, A B; Palacios, G; Travassos da Rosa, A; Popov, V L; Lu, L; Xiao, S Y; DeToy, K; Briese, T; Lipkin, W I; Keel, M K; Stallknecht, D E; Bishop, G R; Tesh, R B
2011-01-01
The family Rhabdoviridae is a diverse group of non-segmented, negative-sense RNA viruses that are distributed worldwide and infect a wide range of hosts including vertebrates, invertebrates, and plants. Of the 114 currently recognized vertebrate rhabdoviruses, relatively few have been well characterized at both the antigenic and genetic level; hence, the phylogenetic relationships between many of the vertebrate rhabdoviruses remain unknown. The present report describes a novel rhabdovirus isolated from the brain of a moribund American coot (Fulica americana) that exhibited neurological signs when found in Durham County, North Carolina, in 2005. Antigenic characterization of the virus revealed that it was serologically unrelated to 68 other known vertebrate rhabdoviruses. Genomic sequencing of the virus indicated that it shared the highest identity to Tupaia rhabdovirus (TUPV), and as only previously observed in TUPV, the genome encoded a putative C protein in an overlapping open reading frame (ORF) of the phosphoprotein gene and a small hydrophobic (SH) protein located in a novel ORF between the matrix and glycoprotein genes. Phylogenetic analysis of partial amino acid sequences of the nucleoprotein and polymerase protein indicated that, in addition to TUPV, the virus was most closely related to avian and small mammal rhabdoviruses from Africa and North America. In this report, we present the morphological, pathological, antigenic, and genetic characterization of the new virus, tentatively named Durham virus (DURV), and discuss its potential evolutionary relationship to other vertebrate rhabdoviruses. Copyright © 2010 Elsevier B.V. All rights reserved.
Differential gene expression and alternative splicing between diploid and tetraploid watermelon
Saminathan, Thangasamy; Nimmakayala, Padma; Manohar, Sumanth; Malkaram, Sridhar; Almeida, Aldo; Cantrell, Robert; Tomason, Yan; Abburi, Lavanya; Rahman, Mohammad A.; Vajja, Venkata G.; Khachane, Amit; Kumar, Brajendra; Rajasimha, Harsha K.; Levi, Amnon; Wehner, Todd; Reddy, Umesh K.
2015-01-01
The exploitation of synthetic polyploids for producing seedless fruits is well known in watermelon. Tetraploid progenitors of triploid watermelon plants, compared with their diploid counterparts, exhibit wide phenotypic differences. Although many factors modulate alternative splicing (AS) in plants, the effects of autopolyploidization on AS are still unknown. In this study, we used tissues of leaf, stem, and fruit of diploid and tetraploid sweet watermelon to understand changes in gene expression and the occurrence of AS. RNA-sequencing analysis was performed along with reverse transcription quantitative PCR and rapid amplification of cDNA ends (RACE)-PCR to demonstrate changes in expression and splicing. All vegetative tissues except fruit showed an increased level of AS in the tetraploid watermelon throughout the growth period. The ploidy levels of diploids and the tetraploid were confirmed using a ploidy analyser. We identified 5362 and 1288 genes that were up- and downregulated, respectively, in tetraploid as compared with diploid plants. We further confirmed that 22 genes underwent AS events across tissues, indicating possibilities of generating different protein isoforms with altered functions of important transcription factors and transporters. Arginine biosynthesis, chlorophyllide synthesis, GDP mannose biosynthesis, trehalose biosynthesis, and starch and sucrose degradation pathways were upregulated in autotetraploids. Phloem protein 2, chloroplastic PGR5-like protein, zinc-finger protein, fructokinase-like 2, MYB transcription factor, and nodulin MtN21 showed AS in fruit tissues. These results should help in developing high-quality seedless watermelon and provide additional transcriptomic information related to other cucurbits. PMID:25520388
Characterization of Durham virus, a novel rhabdovirus that encodes both a C and SH protein
Allison, A. B.; Palacios, G.; Rosa, A. Travassos da; Popov, V. L.; Lu, L.; Xiao, S. Y.; DeToy, K.; Briese, T.; Lipkin, W. Ian; Keel, M. K.; Stallknecht, D. E.; Bishop, G. R.; Tesh, R. B.
2010-01-01
The family Rhabdoviridae is a diverse group of non-segmented, negative-sense RNA viruses that are distributed worldwide and infect a wide range of hosts including vertebrates, invertebrates, and plants. Of the 114 currently recognized vertebrate rhabdoviruses, relatively few have been well characterized at both the antigenic and genetic level; hence, the phylogenetic relationships between many of the vertebrate rhabdoviruses remain unknown. The present report describes a novel rhabdovirus isolated from the brain of a moribund American coot (Fulica americana) that exhibited neurological signs when found in Durham County, North Carolina, in 2005. Antigenic characterization of the virus revealed that it was serologically unrelated to 68 other known vertebrate rhabdoviruses. Genomic sequencing of the virus indicated that it shared the highest identity to Tupaia rhabdovirus (TUPV), and as only previously observed in TUPV, the genome encoded a putative C protein in an overlapping open reading frame (ORF) of the phosphoprotein gene and a small hydrophobic protein located in a novel ORF between the matrix and glycoprotein genes. Phylogenetic analysis of partial amino acid sequences of the nucleoprotein and polymerase proteins indicated that, in addition to TUPV, the virus was most closely related to avian and small mammal rhabdoviruses from Africa and North America. In this report, we present the morphological, pathological, antigenic, and genetic characterization of the new virus, tentatively named Durham virus (DURV), and discuss its potential evolutionary relationship to other vertebrate rhabdoviruses. PMID:20863863
Bioinformatic Analysis Reveals Archaeal tRNATyr and tRNATrp Identities in Bacteria
Mukai, Takahito; Reynolds, Noah M.; Crnković, Ana; Söll, Dieter
2017-01-01
The tRNA identity elements for some amino acids are distinct between the bacterial and archaeal domains. Searching in recent genomic and metagenomic sequence data, we found some candidate phyla radiation (CPR) bacteria with archaeal tRNA identity for Tyr-tRNA and Trp-tRNA synthesis. These bacteria possess genes for tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase (TrpRS) predicted to be derived from DPANN superphylum archaea, while the cognate tRNATyr and tRNATrp genes reveal bacterial or archaeal origins. We identified a trace of domain fusion and swapping in the archaeal-type TyrRS gene of a bacterial lineage, suggesting that CPR bacteria may have used this mechanism to create diverse proteins. Archaeal-type TrpRS of bacteria and a few TrpRS species of DPANN archaea represent a new phylogenetic clade (named TrpRS-A). The TrpRS-A open reading frames (ORFs) are always associated with another ORF (named ORF1) encoding an unknown protein without global sequence identity to any known protein. However, our protein structure prediction identified a putative HIGH-motif and KMSKS-motif as well as many α-helices that are characteristic of class I aminoacyl-tRNA synthetase (aaRS) homologs. These results provide another example of the diversity of molecular components that implement the genetic code and provide a clue to the early evolution of life and the genetic code. PMID:28230768
Cheng, Zhanzhan; Zhou, Shuigeng; Wang, Yang; Liu, Hui; Guan, Jihong; Chen, Yi-Ping Phoebe
2016-05-18
Prediction of compound-protein interactions (CPIs) is to find new compound-protein pairs where a protein is targeted by at least a compound, which is a crucial step in new drug design. Currently, a number of machine learning based methods have been developed to predict new CPIs in the literature. However, as there is not yet any publicly available set of validated negative CPIs, most existing machine learning based approaches use the unknown interactions (not validated CPIs) selected randomly as the negative examples to train classifiers for predicting new CPIs. Obviously, this is not quite reasonable and unavoidably impacts the CPI prediction performance. In this paper, we simply take the unknown CPIs as unlabeled examples, and propose a new method called PUCPI (the abbreviation of PU learning for Compound-Protein Interaction identification) that employs biased-SVM (Support Vector Machine) to predict CPIs using only positive and unlabeled examples. PU learning is a class of learning methods that leans from positive and unlabeled (PU) samples. To the best of our knowledge, this is the first work that identifies CPIs using only positive and unlabeled examples. We first collect known CPIs as positive examples and then randomly select compound-protein pairs not in the positive set as unlabeled examples. For each CPI/compound-protein pair, we extract protein domains as protein features and compound substructures as chemical features, then take the tensor product of the corresponding compound features and protein features as the feature vector of the CPI/compound-protein pair. After that, biased-SVM is employed to train classifiers on different datasets of CPIs and compound-protein pairs. Experiments over various datasets show that our method outperforms six typical classifiers, including random forest, L1- and L2-regularized logistic regression, naive Bayes, SVM and k-nearest neighbor (kNN), and three types of existing CPI prediction models. Source code, datasets and related documents of PUCPI are available at: http://admis.fudan.edu.cn/projects/pucpi.html.
Prabhala, Pavan; Bunge, Kristin; Ge, Qi; Ammit, Alaina J
2016-10-01
Exaggerated cytokine secretion drives pathogenesis of a number of chronic inflammatory diseases, including asthma. Anti-inflammatory pharmacotherapies, including corticosteroids, are front-line therapies and although they have proven clinical utility, the molecular mechanisms responsible for their actions are not fully understood. The corticosteroid-inducible gene, mitogen-activated protein kinase (MAPK) phosphatase 1 (MKP-1, DUSP1) has emerged as a key molecule responsible for the repressive effects of steroids. MKP-1 is known to deactivate p38 MAPK phosphorylation and can control the expression and activity of the mRNA destabilizing protein-tristetraprolin (TTP). But whether corticosteroid-induced MKP-1 acts via p38 MAPK-mediated modulation of TTP function in a pivotal airway cell type, airway smooth muscle (ASM), was unknown. While pretreatment of ASM cells with the corticosteroid dexamethasone (preventative protocol) is known to reduce ASM synthetic function in vitro, the impact of adding dexamethasone after stimulation (therapeutic protocol) had not been explored. Whether dexamethasone modulates TTP in a p38 MAPK-dependent manner in this cell type was also unknown. We address this herein and utilize an in vitro model of asthmatic inflammation where ASM cells were stimulated with the pro-asthmatic cytokine tumor necrosis factor (TNF) and the impact of adding dexamethasone 1 h after stimulation assessed. IL-6 mRNA expression and protein secretion was significantly repressed by dexamethasone acting in a temporally distinct manner to increase MKP-1, deactivate p38 MAPK, and modulate TTP phosphorylation status. In this way, dexamethasone-induced MKP-1 acts via p38 MAPK to switch on the mRNA destabilizing function of TTP to repress pro-inflammatory cytokine secretion from ASM cells. J. Cell. Physiol. 231: 2153-2158, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
The CASTOR proteins are arginine sensors for the mTORC1 pathway
Chantranupong, Lynne; Scaria, Sonia M.; Saxton, Robert A.; Gygi, Melanie P.; Shen, Kuang; Wyant, Gregory A.; Wang, Tim; Harper, J. Wade; Gygi, Steven P.; Sabatini, David M.
2016-01-01
Amino acids signal to the mTOR complex I (mTORC1) growth pathway through the Rag GTPases. Multiple distinct complexes regulate the Rags, including GATOR1, a GTPase activating protein (GAP), and GATOR2, a positive regulator of unknown molecular function. Arginine stimulation of cells activates mTORC1, but how it is sensed is not well understood. Recently, SLC38A9 was identified as a putative lysosomal arginine sensor required for arginine to activate mTORC1 but how arginine deprivation represses mTORC1 is unknown. Here, we show that CASTOR1, a previously uncharacterized protein, interacts with GATOR2 and is required for arginine deprivation to inhibit mTORC1. CASTOR1 homodimerizes and can also heterodimerize with the related protein, CASTOR2. Arginine disrupts the CASTOR1-GATOR2 complex by binding to CASTOR1 with a dissociation constant of ~30 μM, and its arginine-binding capacity is required for arginine to activate mTORC1 in cells. Collectively, these results establish CASTOR1 as an arginine sensor for the mTORC1 pathway. PMID:26972053
Lipper, Colin H; Paddock, Mark L; Onuchic, José N; Mittler, Ron; Nechushtai, Rachel; Jennings, Patricia A
2015-01-01
Iron-sulfur cluster biogenesis is executed by distinct protein assembly systems. Mammals have two systems, the mitochondrial Fe-S cluster assembly system (ISC) and the cytosolic assembly system (CIA), that are connected by an unknown mechanism. The human members of the NEET family of 2Fe-2S proteins, nutrient-deprivation autophagy factor-1 (NAF-1) and mitoNEET (mNT), are located at the interface between the mitochondria and the cytosol. These proteins have been implicated in cancer cell proliferation, and they can transfer their 2Fe-2S clusters to a standard apo-acceptor protein. Here we report the first physiological 2Fe-2S cluster acceptor for both NEET proteins as human Anamorsin (also known as cytokine induced apoptosis inhibitor-1; CIAPIN-1). Anamorsin is an electron transfer protein containing two iron-sulfur cluster-binding sites that is required for cytosolic Fe-S cluster assembly. We show, using UV-Vis spectroscopy, that both NAF-1 and mNT can transfer their 2Fe-2S clusters to apo-Anamorsin with second order rate constants similar to those of other known human 2Fe-2S transfer proteins. A direct protein-protein interaction of the NEET proteins with apo-Anamorsin was detected using biolayer interferometry. Furthermore, electrospray mass spectrometry of holo-Anamorsin prepared by cluster transfer shows that it receives both of its 2Fe-2S clusters from the NEETs. We propose that mNT and NAF-1 can provide parallel routes connecting the mitochondrial ISC system and the CIA. 2Fe-2S clusters assembled in the mitochondria are received by NEET proteins and when needed transferred to Anamorsin, activating the CIA.
Gu, Shuo; Chen, Kai; Yin, Minzhi; Wu, Zhixiang; Wu, Yeming
2017-05-08
Medulloblastoma is the most common malignant brain tumor in children. Around 30% of medulloblastoma patients are diagnosed with metastasis, which often results in a poor prognosis. Unfortunately, molecular mechanisms of medulloblastoma metastasis remain largely unknown. In this study, we employed the recently developed deep proteome analysis approach to quantitatively profile the expression of >10,000 proteins from CHLA-01-MED and CHLA-01R-MED isogenic cell lines derived from the primary and metastatic tumor of the same patient diagnosed with a group IV medulloblastoma. Using statistical analysis, we identified ~1400 significantly altered proteins between the primary and metastatic cell lines including known factors such as placental growth factor (PLGF), LIM homeobox 1 (LHX1) and prominim 1 (PROM1), as well as the negative regulator secreted protein acidic and cysteine rich (SPARC). Additional transwell experiments and immunohistochemical analysis of clinical medulloblastoma samples implicated yes-associated protein 1 (YAP1) as a potential key factor contributing to metastasis. Taken together, our data broadly defines the metastasis-relevant regulated proteome and provides a precious resource for further investigating potential mechanisms of medulloblastoma metastasis. This study represented the first deep proteome analysis of metastatic medulloblastomas and provided a valuable candidate list of altered proteins in metastatic medulloblastomas. The primary data suggested YAP1 as a potential driver for the metastasis of medulloblastoma. These results open up numerous avenues for further investigating the underlying mechanisms of medulloblastoma metastasis and improving the prognosis of medulloblastoma patients. Copyright © 2017 Elsevier B.V. All rights reserved.
2013-01-01
Despite its prominence for characterization of complex mixtures, LC–MS/MS frequently fails to identify many proteins. Network-based analysis methods, based on protein–protein interaction networks (PPINs), biological pathways, and protein complexes, are useful for recovering non-detected proteins, thereby enhancing analytical resolution. However, network-based analysis methods do come in varied flavors for which the respective efficacies are largely unknown. We compare the recovery performance and functional insights from three distinct instances of PPIN-based approaches, viz., Proteomics Expansion Pipeline (PEP), Functional Class Scoring (FCS), and Maxlink, in a test scenario of valproic acid (VPA)-treated mice. We find that the most comprehensive functional insights, as well as best non-detected protein recovery performance, are derived from FCS utilizing real biological complexes. This outstrips other network-based methods such as Maxlink or Proteomics Expansion Pipeline (PEP). From FCS, we identified known biological complexes involved in epigenetic modifications, neuronal system development, and cytoskeletal rearrangements. This is congruent with the observed phenotype where adult mice showed an increase in dendritic branching to allow the rewiring of visual cortical circuitry and an improvement in their visual acuity when tested behaviorally. In addition, PEP also identified a novel complex, comprising YWHAB, NR1, NR2B, ACTB, and TJP1, which is functionally related to the observed phenotype. Although our results suggest different network analysis methods can produce different results, on the whole, the findings are mutually supportive. More critically, the non-overlapping information each provides can provide greater holistic understanding of complex phenotypes. PMID:23557376
Ribeiro, José Marcos C; Labruna, Marcelo B; Mans, Ben J; Maruyama, Sandra Regina; Francischetti, Ivo M B; Barizon, Gustavo Canavaci; de Miranda Santos, Isabel K F
2012-05-01
The hosts for Antricola delacruzi ticks are insectivorous, cave-dwelling bats on which only larvae are found. The mouthparts of nymphal and adult A. delacruzi are compatible with scavenging feeding because the hypostome is small and toothless. How a single blood meal of a larva provides energy for several molts as well as for oviposition by females is not known. Adults of A. delacruzi possibly feed upon an unknown food source in bat guano, a substrate on which nymphal and adult stages are always found. Guano produced by insectivorous bats contains twice the amount of protein and 60 times the amount of iron as beef. In addition, bacteria and chitin-rich fungi proliferate on guano. Comparative data on the transcriptome of the salivary glands of A. delacruzi is nonexistent and would help to understand the physiological adaptations of salivary glands that accompany different sources of food as well as the steps taken by the Acari toward haematophagy, believed to have evolved from scavenging dead animals. Annotation of the transcriptome of salivary glands from female instars of A. delacruzi collected on guano categorized 5.7% of the clusters of expressed genes as putative secreted proteins. They included abundantly expressed TIL-domain-containing proteins (possible anti-microbials), an abundantly expressed protein similar to a serum amyloid found in the sialotranscriptomes of Ornithodoros spp., a savignygrin, a family of mucin/peritrophin/cuticle-like proteins, anti-microbials and an HIV envelope-like glycoprotein also found in soft ticks. When comparing the transcriptome of A. delacruzi with those of blood-feeding female soft and hard ticks some notable differences were observed; they consisted of the following transcripts over- or under-represented or absent in the sialotranscriptome of A. delacruzi that may reflect its source of food: ferritin, mucins with chitin-binding domains and TIL-domain-containing proteins versus lipocalins, basic tail proteins, metalloproteases, glycine-rich proteins and Kunitz protease inhibitors, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.
2011-01-01
Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814
Shah, Dilip; Romero, Freddy; Duong, Michelle; Wang, Nadan; Paudyal, Bishnuhari; Suratt, Benjamin T; Kallen, Caleb B; Sun, Jianxin; Zhu, Ying; Walsh, Kenneth; Summer, Ross
2015-06-12
Obesity is a risk factor for the development of acute respiratory distress syndrome (ARDS) but mechanisms mediating this association are unknown. While obesity is known to impair systemic blood vessel function, and predisposes to systemic vascular diseases, its effects on the pulmonary circulation are largely unknown. We hypothesized that the chronic low grade inflammation of obesity impairs pulmonary vascular homeostasis and primes the lung for acute injury. The lung endothelium from obese mice expressed higher levels of leukocyte adhesion markers and lower levels of cell-cell junctional proteins when compared to lean mice. We tested whether systemic factors are responsible for these alterations in the pulmonary endothelium; treatment of primary lung endothelial cells with obese serum enhanced the expression of adhesion proteins and reduced the expression of endothelial junctional proteins when compared to lean serum. Alterations in pulmonary endothelial cells observed in obese mice were associated with enhanced susceptibility to LPS-induced lung injury. Restoring serum adiponectin levels reversed the effects of obesity on the lung endothelium and attenuated susceptibility to acute injury. Our work indicates that obesity impairs pulmonary vascular homeostasis and enhances susceptibility to acute injury and provides mechanistic insight into the increased prevalence of ARDS in obese humans.
Shah, Dilip; Romero, Freddy; Duong, Michelle; Wang, Nadan; Paudyal, Bishnuhari; Suratt, Benjamin T.; Kallen, Caleb B.; Sun, Jianxin; Zhu, Ying; Walsh, Kenneth; Summer, Ross
2015-01-01
Obesity is a risk factor for the development of acute respiratory distress syndrome (ARDS) but mechanisms mediating this association are unknown. While obesity is known to impair systemic blood vessel function, and predisposes to systemic vascular diseases, its effects on the pulmonary circulation are largely unknown. We hypothesized that the chronic low grade inflammation of obesity impairs pulmonary vascular homeostasis and primes the lung for acute injury. The lung endothelium from obese mice expressed higher levels of leukocyte adhesion markers and lower levels of cell-cell junctional proteins when compared to lean mice. We tested whether systemic factors are responsible for these alterations in the pulmonary endothelium; treatment of primary lung endothelial cells with obese serum enhanced the expression of adhesion proteins and reduced the expression of endothelial junctional proteins when compared to lean serum. Alterations in pulmonary endothelial cells observed in obese mice were associated with enhanced susceptibility to LPS-induced lung injury. Restoring serum adiponectin levels reversed the effects of obesity on the lung endothelium and attenuated susceptibility to acute injury. Our work indicates that obesity impairs pulmonary vascular homeostasis and enhances susceptibility to acute injury and provides mechanistic insight into the increased prevalence of ARDS in obese humans. PMID:26068229
Probabilistic Open Set Recognition
NASA Astrophysics Data System (ADS)
Jain, Lalit Prithviraj
Real-world tasks in computer vision, pattern recognition and machine learning often touch upon the open set recognition problem: multi-class recognition with incomplete knowledge of the world and many unknown inputs. An obvious way to approach such problems is to develop a recognition system that thresholds probabilities to reject unknown classes. Traditional rejection techniques are not about the unknown; they are about the uncertain boundary and rejection around that boundary. Thus traditional techniques only represent the "known unknowns". However, a proper open set recognition algorithm is needed to reduce the risk from the "unknown unknowns". This dissertation examines this concept and finds existing probabilistic multi-class recognition approaches are ineffective for true open set recognition. We hypothesize the cause is due to weak adhoc assumptions combined with closed-world assumptions made by existing calibration techniques. Intuitively, if we could accurately model just the positive data for any known class without overfitting, we could reject the large set of unknown classes even under this assumption of incomplete class knowledge. For this, we formulate the problem as one of modeling positive training data by invoking statistical extreme value theory (EVT) near the decision boundary of positive data with respect to negative data. We provide a new algorithm called the PI-SVM for estimating the unnormalized posterior probability of class inclusion. This dissertation also introduces a new open set recognition model called Compact Abating Probability (CAP), where the probability of class membership decreases in value (abates) as points move from known data toward open space. We show that CAP models improve open set recognition for multiple algorithms. Leveraging the CAP formulation, we go on to describe the novel Weibull-calibrated SVM (W-SVM) algorithm, which combines the useful properties of statistical EVT for score calibration with one-class and binary support vector machines. Building from the success of statistical EVT based recognition methods such as PI-SVM and W-SVM on the open set problem, we present a new general supervised learning algorithm for multi-class classification and multi-class open set recognition called the Extreme Value Local Basis (EVLB). The design of this algorithm is motivated by the observation that extrema from known negative class distributions are the closest negative points to any positive sample during training, and thus should be used to define the parameters of a probabilistic decision model. In the EVLB, the kernel distribution for each positive training sample is estimated via an EVT distribution fit over the distances to the separating hyperplane between positive training sample and closest negative samples, with a subset of the overall positive training data retained to form a probabilistic decision boundary. Using this subset as a frame of reference, the probability of a sample at test time decreases as it moves away from the positive class. Possessing this property, the EVLB is well-suited to open set recognition problems where samples from unknown or novel classes are encountered at test. Our experimental evaluation shows that the EVLB provides a substantial improvement in scalability compared to standard radial basis function kernel machines, as well as P I-SVM and W-SVM, with improved accuracy in many cases. We evaluate our algorithm on open set variations of the standard visual learning benchmarks, as well as with an open subset of classes from Caltech 256 and ImageNet. Our experiments show that PI-SVM, WSVM and EVLB provide significant advances over the previous state-of-the-art solutions for the same tasks.
Exploring Protein Function Using the Saccharomyces Genome Database.
Wong, Edith D
2017-01-01
Elucidating the function of individual proteins will help to create a comprehensive picture of cell biology, as well as shed light on human disease mechanisms, possible treatments, and cures. Due to its compact genome, and extensive history of experimentation and annotation, the budding yeast Saccharomyces cerevisiae is an ideal model organism in which to determine protein function. This information can then be leveraged to infer functions of human homologs. Despite the large amount of research and biological data about S. cerevisiae, many proteins' functions remain unknown. Here, we explore ways to use the Saccharomyces Genome Database (SGD; http://www.yeastgenome.org ) to predict the function of proteins and gain insight into their roles in various cellular processes.
López Villar, Elena; Wang, Xiangdong; Madero, Luis; Cho, William C
2015-01-01
Oncoproteomics is an important innovation in the early diagnosis, management and development of personalized treatment of acute lymphoblastic leukaemia (ALL). As inherent factors are not completely known - e.g. age or family history, radiation exposure, benzene chemical exposure, certain viral exposures such as infection with the human T-cell lymphoma/leukaemia virus-1, as well as some inherited syndromes may raise the risk of ALL - each ALL patient may modify the susceptibility of therapy. Indeed, we consider these unknown inherent factors could be explained via coupling cytogenetics plus proteomics, especially when proteins are the ones which play function within cells. Innovative proteomics to ALL therapy may help to understand the mechanism of drug resistance and toxicities, which in turn will provide some leads to improve ALL management. Most important of these are shotgun proteomic strategies to unravel ALL aberrant signalling networks. Some shotgun proteomic innovations and bioinformatic tools for ALL therapies will be discussed. As network proteins are distinctive characteristics for ALL patients, unrevealed by cytogenetics, those network proteins are currently an important source of novel therapeutic targets that emerge from shotgun proteomics. Indeed, ALL evolution can be studied for each individual patient via oncoproteomics. © 2014 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Orellana, Luis H.; Rodriguez-R, Luis M.; Konstantinidis, Konstantinos T.
2016-10-07
Functional annotation of metagenomic and metatranscriptomic data sets relies on similarity searches based on e-value thresholds resulting in an unknown number of false positive and negative matches. To overcome these limitations, we introduce ROCker, aimed at identifying position-specific, most-discriminant thresholds in sliding windows along the sequence of a target protein, accounting for non-discriminative domains shared by unrelated proteins. ROCker employs the receiver operating characteristic (ROC) curve to minimize false discovery rate (FDR) and calculate the best thresholds based on how simulated shotgun metagenomic reads of known composition map onto well-curated reference protein sequences and thus, differs from HMM profiles andmore » related methods. We showcase ROCker using ammonia monooxygenase (amoA) and nitrous oxide reductase (nosZ) genes, mediating oxidation of ammonia and the reduction of the potent greenhouse gas, N 2O, to inert N 2, respectively. ROCker typically showed 60-fold lower FDR when compared to the common practice of using fixed e-values. Previously uncounted ‘atypical’ nosZ genes were found to be two times more abundant, on average, than their typical counterparts in most soil metagenomes and the abundance of bacterial amoA was quantified against the highly-related particulate methane monooxygenase (pmoA). Therefore, ROCker can reliably detect and quantify target genes in short-read metagenomes.« less
2015-01-01
Protein farnesytransferase (PFTase) catalyzes the farnesylation of proteins with a carboxy-terminal tetrapeptide sequence denoted as a Ca1a2X box. To explore the specificity of this enzyme, an important therapeutic target, solid-phase peptide synthesis in concert with a peptide inversion strategy was used to prepare two libraries, each containing 380 peptides. The libraries were screened using an alkyne-containing isoprenoid analogue followed by click chemistry with biotin azide and subsequent visualization with streptavidin-AP. Screening of the CVa2X and CCa2X libraries with Rattus norvegicus PFTase revealed reaction by many known recognition sequences as well as numerous unknown ones. Some of the latter occur in the genomes of bacteria and viruses and may be important for pathogenesis, suggesting new targets for therapeutic intervention. Screening of the CVa2X library with alkyne-functionalized isoprenoid substrates showed that those prepared from C10 or C15 precursors gave similar results, whereas the analogue synthesized from a C5 unit gave a different pattern of reactivity. Lastly, the substrate specificities of PFTases from three organisms (R. norvegicus, Saccharomyces cerevisiae, and Candida albicans) were compared using CVa2X libraries. R. norvegicus PFTase was found to share more peptide substrates with S. cerevisiae PFTase than with C. albicans PFTase. In general, this method is a highly efficient strategy for rapidly probing the specificity of this important enzyme. PMID:24841702
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orellana, Luis H.; Rodriguez-R, Luis M.; Konstantinidis, Konstantinos T.
Functional annotation of metagenomic and metatranscriptomic data sets relies on similarity searches based on e-value thresholds resulting in an unknown number of false positive and negative matches. To overcome these limitations, we introduce ROCker, aimed at identifying position-specific, most-discriminant thresholds in sliding windows along the sequence of a target protein, accounting for non-discriminative domains shared by unrelated proteins. ROCker employs the receiver operating characteristic (ROC) curve to minimize false discovery rate (FDR) and calculate the best thresholds based on how simulated shotgun metagenomic reads of known composition map onto well-curated reference protein sequences and thus, differs from HMM profiles andmore » related methods. We showcase ROCker using ammonia monooxygenase (amoA) and nitrous oxide reductase (nosZ) genes, mediating oxidation of ammonia and the reduction of the potent greenhouse gas, N 2O, to inert N 2, respectively. ROCker typically showed 60-fold lower FDR when compared to the common practice of using fixed e-values. Previously uncounted ‘atypical’ nosZ genes were found to be two times more abundant, on average, than their typical counterparts in most soil metagenomes and the abundance of bacterial amoA was quantified against the highly-related particulate methane monooxygenase (pmoA). Therefore, ROCker can reliably detect and quantify target genes in short-read metagenomes.« less
A negative effector of blue light-induced and gravitropic bending in Arabidopsis.
Knauer, Torsten; Dümmer, Michaela; Landgraf, Frank; Forreiter, Christoph
2011-05-01
Although sessile, plants are able to grow toward or away from an environmental stimulus. Important examples are stem or leaf orientation of higher plants in response to the direction of the incident light. The responsible photoreceptors belong to the phototropin photoreceptor family. Although the mode of phototropin action is quite well understood, much less is known of how the light signal is transformed into a bending response. Several lines of evidence indicate that a lateral auxin gradient is responsible for asymmetric cell elongation along the light gradient within the stem. However, some of the molecular key players leading to this asymmetric auxin distribution are, as yet, unidentified. Previously, it was shown that phototropin gets autophosphorylated upon illumination and binds to a scaffold protein termed NPH3 (for nonphototropic hypocotyl 3). Using a yeast three-hybrid approach with phototropin and NPH3 as a bait complex, we isolated a protein, termed EHB1 (for enhanced bending 1), with a so far unknown function, which binds to this binary complex. This novel interacting factor negatively affects hypocotyl bending under blue light conditions in Arabidopsis (Arabidopsis thaliana) and thus seems to be an important component regulating phototropism. Interestingly, it could be shown that the gravitropic response was also affected. Thus, it cannot be ruled out that this protein might also have a more general role in auxin-mediated bending toward an environmental stimulus.
2017-01-01
Abstract Functional annotation of metagenomic and metatranscriptomic data sets relies on similarity searches based on e-value thresholds resulting in an unknown number of false positive and negative matches. To overcome these limitations, we introduce ROCker, aimed at identifying position-specific, most-discriminant thresholds in sliding windows along the sequence of a target protein, accounting for non-discriminative domains shared by unrelated proteins. ROCker employs the receiver operating characteristic (ROC) curve to minimize false discovery rate (FDR) and calculate the best thresholds based on how simulated shotgun metagenomic reads of known composition map onto well-curated reference protein sequences and thus, differs from HMM profiles and related methods. We showcase ROCker using ammonia monooxygenase (amoA) and nitrous oxide reductase (nosZ) genes, mediating oxidation of ammonia and the reduction of the potent greenhouse gas, N2O, to inert N2, respectively. ROCker typically showed 60-fold lower FDR when compared to the common practice of using fixed e-values. Previously uncounted ‘atypical’ nosZ genes were found to be two times more abundant, on average, than their typical counterparts in most soil metagenomes and the abundance of bacterial amoA was quantified against the highly-related particulate methane monooxygenase (pmoA). Therefore, ROCker can reliably detect and quantify target genes in short-read metagenomes. PMID:28180325
Screening of beta-glucan contents in commercially cultivated and wild growing mushrooms.
Sari, Miriam; Prange, Alexander; Lelley, Jan I; Hambitzer, Reinhard
2017-02-01
Mushrooms have unique sensory properties and nutritional values as well as health benefits due to their bioactive compounds, especially beta-glucans. Well-known edible and medicinal mushroom species as well as uncommon or unknown species representing interesting sources of bioactive beta-glucans have been widely studied. Commercially cultivated and wild growing mushrooms were analysed for their beta-glucan contents. Enzymatic determinations of all glucans, alpha-glucans and beta-glucans in 39 mushrooms species were performed, leading to very remarkable results. Many wild growing species present high beta-glucan contents, especially Bracket fungi. The well-known cultivated species Agaricus bisporus, Lentinula edodes and Cantharellus cibarius as well as most screened wild growing species show higher glucan contents in their stipes than caps. Copyright © 2016 Elsevier Ltd. All rights reserved.
Sabido, Rafael; Hernández-Davó, Jose Luis; Botella, Javier; Moya, Manuel
2016-01-01
Purpose To compare the effect of 4-week unknown vs known loads strength training intervention on power output performance and throwing velocity in junior team handball players. Methods Twenty-eight junior team-handball players (17.2 ± 0.6 years, 1.79 ± 0.07 m, 75.6 ± 9.4 kg)were divided into two groups (unknown loads: UL; known loads: KL). Both groups performed two sessions weekly consisting of four sets of six repetitions of the bench press throw exercise, using the 30%, 50% and 70% of subjects’ individual 1 repetition maximum (1RM). In each set, two repetitions with each load were performed, but the order of the loads was randomised. In the KL group, researchers told the subjects the load to mobilise prior each repetition, while in the UL group, researchers did not provide any information. Maximal dynamic strength (1RM bench press), power output (with 30, 50 and 70% of 1RM) and throwing velocity (7 m standing throw and 9 m jumping throw) were assessed pre- and post-training intervention. Results Both UL and KL group improved similarly their 1RM bench press as well as mean and peak power with all loads. There were significant improvements in power developed in all the early time intervals measured (150 ms) with the three loads (30, 50, 70% 1RM) in the UL group, while KL only improved with 30% 1RM (all the time intervals) and with 70% 1RM (at certain time intervals). Only the UL group improved throwing velocity in both standing (4.7%) and jumping (5.3%) throw (p > 0.05). Conclusions The use of unknown loads has led to greater gains in power output in the early time intervals as well as to increases in throwing velocity compared with known loads. Therefore unknown loads are of significant practical use to increase both strength and in-field performance in a short period of training. PMID:27310598
Liu, Yin; Chen, Yulong; Zhang, Jinlong; Liu, Yulan; Zhang, Yanjie; Su, Zhiguang
2017-08-25
Adipose tissue inflammation has been linked to metabolic diseases such as obesity and type 2 diabetes. However, the molecules that mediate inflammation in adipose tissue have not been addressed. Although retinoic acid receptor-related orphan receptor α (RORα) is known to be involved in the regulation of inflammatory response in some tissues, its role is largely unknown in adipose tissue. Conversely, it is known that endoplasmic reticulum (ER) stress and unfolding protein response (UPR) signaling affect the inflammatory response in obese adipose tissue, but whether RORα regulates these processes remains unknown. In this study, we investigate the link between RORα and adipose tissue inflammation. We showed that the inflammatory response in macrophages or 3T3-L1 adipocytes stimulated by lipopolysaccharide, as well as adipose tissue in obese mice, markedly increased the expression of RORα. Adenovirus-mediated overexpression of RORα or treatment with the RORα-specific agonist SR1078 enhanced the expression of inflammatory cytokines and increased the number of infiltrated macrophages into adipose tissue. Furthermore, SR1078 up-regulated the mRNA expression of ER stress response genes and enhanced phosphorylations of two of the three mediators of major UPR signaling pathways, PERK and IRE1α. Finally, we found that alleviation of ER stress using a chemical chaperone followed by the suppression of RORα induced inflammation in adipose tissue. Our data suggest that RORα-induced ER stress response potentially contributes to the adipose tissue inflammation that can be mitigated by treatment with chemical chaperones. The relationships established here between RORα expression, inflammation, and UPR signaling may have implications for therapeutic targeting of obesity-related metabolic diseases. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Leandro de Jesus, Teresa Cristina; Calderano, Simone Guedes; Vitorino, Francisca Nathalia de Luna; Llanos, Ricardo Pariona; Lopes, Mariana de Camargo; de Araújo, Christiane Bezerra; Thiemann, Otavio Henrique; Reis, Marcelo da Silva; Elias, Maria Carolina
2017-01-01
Chromatin associated proteins are key regulators of many important processes in the cell. Trypanosoma cruzi, a protozoa flagellate that causes Chagas disease, alternates between replicative and nonreplicative forms accompanied by a shift on global transcription levels and by changes in its chromatin architecture. Here, we investigated the T. cruzi chromatin proteome using three different protocols and compared it between replicative (epimastigote) and nonreplicative (trypomastigote) forms by high-resolution mass spectrometry. More than 2000 proteins were identified and quantified both in chromatin and nonchromatin extracts. Besides histones and other known nuclear proteins, trypanosomes chromatin also contains metabolic (mainly from carbohydrate pathway), cytoskeleton and many other proteins with unknown functions. Strikingly, the two parasite forms differ greatly regarding their chromatin-associated factors composition and amount. Although the nucleosome content is the same for both life forms (as seen by MNase digestion), the remaining proteins were much less detected in nonreplicative forms, suggesting that they have a naked chromatin. Proteins associated to DNA proliferation, such as PCNA, RPA, and DNA topoisomerases were exclusively found in the chromatin of replicative stages. On the other hand, the nonreplicative stages have an enrichment of a histone H2B variant. Furthermore, almost 20% of replicative stages chromatin-associated proteins are expressed in nonreplicative forms, but located at nonchromatin space. We identified different classes of proteins including phosphatases and a Ran-binding protein, that may shuttle between chromatin and nonchromatin space during differentiation. Seven proteins, including those with unknown functions, were selected for further validation. We confirmed their location in chromatin and their differential expression, using Western blotting assays and chromatin immunoprecipitation (ChIP). Our results indicate that the replicative state in trypanosomes involves an increase of chromatin associated proteins content. We discuss in details, the qualitative and quantitative implication of this chromatin set in trypanosome chromatin biology. Because trypanosomes are early-branching organisms, this data can boost our understanding of chromatin-associated processes in other cell types. PMID:27852749
Assembling a protein-protein interaction map of the SSU processome from existing datasets.
Lim, Young H; Charette, J Michael; Baserga, Susan J
2011-03-10
The small subunit (SSU) processome is a large ribonucleoprotein complex involved in small ribosomal subunit assembly. It consists of the U3 snoRNA and ∼72 proteins. While most of its components have been identified, the protein-protein interactions (PPIs) among them remain largely unknown, and thus the assembly, architecture and function of the SSU processome remains unclear. We queried PPI databases for SSU processome proteins to quantify the degree to which the three genome-wide high-throughput yeast two-hybrid (HT-Y2H) studies, the genome-wide protein fragment complementation assay (PCA) and the literature-curated (LC) datasets cover the SSU processome interactome. We find that coverage of the SSU processome PPI network is remarkably sparse. Two of the three HT-Y2H studies each account for four and six PPIs between only six of the 72 proteins, while the third study accounts for as little as one PPI and two proteins. The PCA dataset has the highest coverage among the genome-wide studies with 27 PPIs between 25 proteins. The LC dataset was the most extensive, accounting for 34 proteins and 38 PPIs, many of which were validated by independent methods, thereby further increasing their reliability. When the collected data were merged, we found that at least 70% of the predicted PPIs have yet to be determined and 26 proteins (36%) have no known partners. Since the SSU processome is conserved in all Eukaryotes, we also queried HT-Y2H datasets from six additional model organisms, but only four orthologues and three previously known interologous interactions were found. This provides a starting point for further work on SSU processome assembly, and spotlights the need for a more complete genome-wide Y2H analysis.
Assembling a Protein-Protein Interaction Map of the SSU Processome from Existing Datasets
Baserga, Susan J.
2011-01-01
Background The small subunit (SSU) processome is a large ribonucleoprotein complex involved in small ribosomal subunit assembly. It consists of the U3 snoRNA and ∼72 proteins. While most of its components have been identified, the protein-protein interactions (PPIs) among them remain largely unknown, and thus the assembly, architecture and function of the SSU processome remains unclear. Methodology We queried PPI databases for SSU processome proteins to quantify the degree to which the three genome-wide high-throughput yeast two-hybrid (HT-Y2H) studies, the genome-wide protein fragment complementation assay (PCA) and the literature-curated (LC) datasets cover the SSU processome interactome. Conclusions We find that coverage of the SSU processome PPI network is remarkably sparse. Two of the three HT-Y2H studies each account for four and six PPIs between only six of the 72 proteins, while the third study accounts for as little as one PPI and two proteins. The PCA dataset has the highest coverage among the genome-wide studies with 27 PPIs between 25 proteins. The LC dataset was the most extensive, accounting for 34 proteins and 38 PPIs, many of which were validated by independent methods, thereby further increasing their reliability. When the collected data were merged, we found that at least 70% of the predicted PPIs have yet to be determined and 26 proteins (36%) have no known partners. Since the SSU processome is conserved in all Eukaryotes, we also queried HT-Y2H datasets from six additional model organisms, but only four orthologues and three previously known interologous interactions were found. This provides a starting point for further work on SSU processome assembly, and spotlights the need for a more complete genome-wide Y2H analysis. PMID:21423703
[A fever of finally known origin].
Jenni, Stefan; Kositz, Christian; Diethelm, Markus; Albrich, Werner
2014-05-21
We present the case of a 77 year old man with fever of unknown origin. Despite a thorough assessment in hospital the diagnosis could only be made after discharge when positive results for C. burnetii serology revealed acute Q-fever. However, retrospectively history and clinical findings matched well with acute Q-fever.
Naqvi, Ahmad Abu Turab; Shahbaaz, Mohd; Ahmad, Faizan; Hassan, Md. Imtaiyaz
2015-01-01
Syphilis is a globally occurring venereal disease, and its infection is propagated through sexual contact. The causative agent of syphilis, Treponema pallidum ssp. pallidum, a Gram-negative sphirochaete, is an obligate human parasite. Genome of T. pallidum ssp. pallidum SS14 strain (RefSeq NC_010741.1) encodes 1,027 proteins, of which 444 proteins are known as hypothetical proteins (HPs), i.e., proteins of unknown functions. Here, we performed functional annotation of HPs of T. pallidum ssp. pallidum using various database, domain architecture predictors, protein function annotators and clustering tools. We have analyzed the sequences of 444 HPs of T. pallidum ssp. pallidum and subsequently predicted the function of 207 HPs with a high level of confidence. However, functions of 237 HPs are predicted with less accuracy. We found various enzymes, transporters, binding proteins in the annotated group of HPs that may be possible molecular targets, facilitating for the survival of pathogen. Our comprehensive analysis helps to understand the mechanism of pathogenesis to provide many novel potential therapeutic interventions. PMID:25894582
A Framework for Globular Proteins
NASA Astrophysics Data System (ADS)
Lezon, Timothy
2006-03-01
Due to their remarkable chemical specificity and diversity, globular proteins play a crucial role in the network of molecular interactions of life. Over the past several decades, much experimental data has been accumulated on proteins, but the overarching principles that govern the general features of proteins remain largely unknown. Here, a novel framework for understanding many key attributes of globular proteins is presented. This framework suggests that the characteristics of globular proteins that make them well-suited for biological function are the emergent properties of a unique phase of matter. Implications of this picture include the provision of a fixed backdrop for molecular evolution and natural selection and design restrictions on molecular machinery. The work described here was carried out in collaboration with Jayanth Banavar and Amos Maritan.
Predicting protein-protein interactions from protein domains using a set cover approach.
Huang, Chengbang; Morcos, Faruck; Kanaan, Simon P; Wuchty, Stefan; Chen, Danny Z; Izaguirre, Jesús A
2007-01-01
One goal of contemporary proteome research is the elucidation of cellular protein interactions. Based on currently available protein-protein interaction and domain data, we introduce a novel method, Maximum Specificity Set Cover (MSSC), for the prediction of protein-protein interactions. In our approach, we map the relationship between interactions of proteins and their corresponding domain architectures to a generalized weighted set cover problem. The application of a greedy algorithm provides sets of domain interactions which explain the presence of protein interactions to the largest degree of specificity. Utilizing domain and protein interaction data of S. cerevisiae, MSSC enables prediction of previously unknown protein interactions, links that are well supported by a high tendency of coexpression and functional homogeneity of the corresponding proteins. Focusing on concrete examples, we show that MSSC reliably predicts protein interactions in well-studied molecular systems, such as the 26S proteasome and RNA polymerase II of S. cerevisiae. We also show that the quality of the predictions is comparable to the Maximum Likelihood Estimation while MSSC is faster. This new algorithm and all data sets used are accessible through a Web portal at http://ppi.cse.nd.edu.
Paek, David S.; Sakurai, Reiko; Saraswat, Aditi; Li, Yishi; Khorram, Omid; Torday, John S.
2015-01-01
Maternal food restriction (MFR) causes intrauterine growth restriction, a known risk factor for developing chronic lung disease. However, it is unknown whether this negative outcome is gender specific or preventable by blocking the MFR-induced hyperglucocorticoidism. Using a well-established rat model, we used metyrapone (MTP), an inhibitor of glucocorticoid synthesis, to study the MFR-induced lung changes on postnatal day (p) 21 in a gender-specific manner. From embryonic day 10 until delivery, pregnant dams were fed either an ad libitum diet or a 50% caloric restricted diet with or without MTP supplementation. Postnatally, the offspring were fed ad libitum from healthy dams until p21. Morphometric, Western blot, and immunohistochemical analysis of the lungs demonstrated that MTP mitigated the MFR-mediated decrease in alveolar count, decrease in adipogenic protein peroxisome proliferator-activated receptor γ, increase in myogenic proteins (fibronectin, α-smooth muscle actin, and calponin), increase in Wnt signaling intermediates (lymphoid enhancer-binding factor 1 and β-catenin), and increase in glucocorticoid receptor (GR) levels. The MFR-induced lung phenotype and the effects of MTP were similar in both genders. To elucidate the mechanism of MFR-induced shift of the adipogenic-to-myogenic phenotype, lung fibroblasts were used to independently study the effects of (1) nutrient restriction and (2) excess steroid exposure. Nutrient deprivation increased myogenic proteins, Wnt signaling intermediates, and GR, all changes blocked by protein supplementation. MTP also blocked, likely by normalizing nicotinamide adenine dinucleotide phosphate levels, the corticosterone-induced increase in myogenic proteins, but had no effect on GR levels. In summary, protein restriction and increased glucocorticoid levels appear to be the key players in MFR-induced lung disease, affecting both genders. PMID:24916330
Paek, David S; Sakurai, Reiko; Saraswat, Aditi; Li, Yishi; Khorram, Omid; Torday, John S; Rehan, Virender K
2015-02-01
Maternal food restriction (MFR) causes intrauterine growth restriction, a known risk factor for developing chronic lung disease. However, it is unknown whether this negative outcome is gender specific or preventable by blocking the MFR-induced hyperglucocorticoidism. Using a well-established rat model, we used metyrapone (MTP), an inhibitor of glucocorticoid synthesis, to study the MFR-induced lung changes on postnatal day (p) 21 in a gender-specific manner. From embryonic day 10 until delivery, pregnant dams were fed either an ad libitum diet or a 50% caloric restricted diet with or without MTP supplementation. Postnatally, the offspring were fed ad libitum from healthy dams until p21. Morphometric, Western blot, and immunohistochemical analysis of the lungs demonstrated that MTP mitigated the MFR-mediated decrease in alveolar count, decrease in adipogenic protein peroxisome proliferator-activated receptor γ, increase in myogenic proteins (fibronectin, α-smooth muscle actin, and calponin), increase in Wnt signaling intermediates (lymphoid enhancer-binding factor 1 and β-catenin), and increase in glucocorticoid receptor (GR) levels. The MFR-induced lung phenotype and the effects of MTP were similar in both genders. To elucidate the mechanism of MFR-induced shift of the adipogenic-to-myogenic phenotype, lung fibroblasts were used to independently study the effects of (1) nutrient restriction and (2) excess steroid exposure. Nutrient deprivation increased myogenic proteins, Wnt signaling intermediates, and GR, all changes blocked by protein supplementation. MTP also blocked, likely by normalizing nicotinamide adenine dinucleotide phosphate levels, the corticosterone-induced increase in myogenic proteins, but had no effect on GR levels. In summary, protein restriction and increased glucocorticoid levels appear to be the key players in MFR-induced lung disease, affecting both genders. © The Author(s) 2014.
Savikj, Mladen; Ruby, Maxwell A; Kostovski, Emil; Iversen, Per O; Zierath, Juleen R; Krook, Anna; Widegren, Ulrika
2018-06-01
Despite the well-known role of satellite cells in skeletal muscle plasticity, the effect of spinal cord injury on their function in humans remains unknown. We determined whether spinal cord injury affects the intrinsic ability of satellite cells to differentiate and produce metabolically healthy myotubes. We obtained vastus lateralis biopsies from eight spinal cord-injured and six able-bodied individuals. Satellite cells were isolated, grown and differentiated in vitro. Gene expression was measured by quantitative PCR. Abundance of differentiation markers and regulatory proteins was determined by Western blotting. Protein synthesis and fatty acid oxidation were measured by radioactive tracer-based assays. Activated satellite cells (myoblasts) and differentiated myotubes derived from skeletal muscle of able-bodied and spinal cord-injured individuals expressed similar (P > 0.05) mRNA levels of myogenic regulatory factors. Myogenic differentiation factor 1 expression was higher in myoblasts from spinal cord-injured individuals. Desmin and myogenin protein content was increased upon differentiation in both groups, while myotubes from spinal cord-injured individuals contained more type I and II myosin heavy chain. Phosphorylated and total protein levels of Akt-mechanistic target of rapamycin and forkhead box protein O signalling axes and protein synthesis rate in myotubes were similar (P > 0.05) between groups. Additionally, fatty acid oxidation of myotubes from spinal cord-injured individuals was unchanged (P > 0.05) compared to able-bodied controls. Our results indicate that the intrinsic differentiation capacity of satellite cells and metabolic characteristics of myotubes are preserved following spinal cord injury. This may inform potential interventions targeting satellite cell activation to alleviate skeletal muscle atrophy. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.
Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*
Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun
2012-01-01
Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balakrishnan, Meenakshi P.; Cilenti, Lucia; Ambivero, Camilla
2011-01-07
Research highlights: {yields} THAP5 is a DNA-binding protein and a transcriptional repressor. {yields} THAP5 is induced in melanoma cells upon exposure to UV or treatment with cisplatin. {yields} THAP5 induction correlates with the degree of apoptosis in melanoma cell population. {yields} THAP5 is a pro-apoptotic protein involved in melanoma cell death. -- Abstract: THAP5 was originally isolated as a specific interactor and substrate of the mitochondrial pro-apoptotic Omi/HtrA2 protease. It is a human zinc finger protein characterized by a restricted pattern of expression and the lack of orthologs in mouse and rat. The biological function of THAP5 is unknown butmore » our previous studies suggest it could regulate G2/M transition in kidney cells and could be involved in human cardiomyocyte cell death associated with coronary artery disease (CAD). In this report, we expanded our studies on the properties and function of THAP5 in human melanoma cells. THAP5 was expressed in primary human melanocytes as well as in all melanoma cell lines that were tested. THAP5 protein level was significantly induced by UV irradiation or cisplatin treatment, conditions known to cause DNA damage. The induction of THAP5 correlated with a significant increase in apoptotic cell death. In addition, we show that THAP5 is a nuclear protein that could recognize and bind a specific DNA motif. THAP5 could also repress the transcription of a reporter gene in a heterologous system. Our work suggests that THAP5 is a DNA-binding protein and a transcriptional repressor. Furthermore, THAP5 has a pro-apoptotic function and it was induced in melanoma cells under conditions that promoted cell death.« less
Marcu, Orly; Dodson, Emma-Joy; Alam, Nawsad; Sperber, Michal; Kozakov, Dima; Lensink, Marc F; Schueler-Furman, Ora
2017-03-01
CAPRI rounds 28 and 29 included, for the first time, peptide-receptor targets of three different systems, reflecting increased appreciation of the importance of peptide-protein interactions. The CAPRI rounds allowed us to objectively assess the performance of Rosetta FlexPepDock, one of the first protocols to explicitly include peptide flexibility in docking, accounting for peptide conformational changes upon binding. We discuss here successes and challenges in modeling these targets: we obtain top-performing, high-resolution models of the peptide motif for cases with known binding sites but there is a need for better modeling of flanking regions, as well as better selection criteria, in particular for unknown binding sites. These rounds have also provided us the opportunity to reassess the success criteria, to better reflect the quality of a peptide-protein complex model. Using all models submitted to CAPRI, we analyze the correlation between current classification criteria and the ability to retrieve critical interface features, such as hydrogen bonds and hotspots. We find that loosening the backbone (and ligand) RMSD threshold, together with a restriction on the side chain RMSD measure, allows us to improve the selection of high-accuracy models. We also suggest a new measure to assess interface hydrogen bond recovery, which is not assessed by the current CAPRI criteria. Finally, we find that surprisingly much can be learned from rather inaccurate models about binding hotspots, suggesting that the current status of peptide-protein docking methods, as reflected by the submitted CAPRI models, can already have a significant impact on our understanding of protein interactions. Proteins 2017; 85:445-462. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Castel, M; Belenky, M; Cohen, S; Wagner, S; Schwartz, W J
1997-09-01
Although light is known to regulate the level of c-fos gene expression in the suprachiasmatic nucleus (SCN), the site of an endogenous circadian clock, little is known about the identities of the photically activated cells. We used light-microscopic immunocytochemistry and immunoelectron microscopy to detect c-Fos protein in the SCN of Sabra mice exposed to brief nocturnal light pulses at zeitgeber time 15-16. Stimulation with light pulses that saturated the phase-shifting response of the circadian locomotor rhythm revealed an upper limit to the number of photo-inducible c-Fos cells at about one-fifth of the estimated total SCN cell population. This functionally defined set was morphologically and phenotypically heterogeneous. About 24% could be labelled for vasoactive intestinal polypeptide, 13% for vasopressin-neurophysin, and 7% for glial fibrillary acidic protein. The remaining 56% of c-Fos-positive cells were largely of unknown phenotype, although many were presumptive interneurons, some of which were immunoreactive for nitric oxide synthase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Hongbing; Franz, Carl J.; Wu, Guang
2014-02-15
Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated intomore » Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.« less
Onuk, A. Emre; Akcakaya, Murat; Bardhan, Jaydeep P.; Erdogmus, Deniz; Brooks, Dana H.; Makowski, Lee
2015-01-01
In this paper, we describe a model for maximum likelihood estimation (MLE) of the relative abundances of different conformations of a protein in a heterogeneous mixture from small angle X-ray scattering (SAXS) intensities. To consider cases where the solution includes intermediate or unknown conformations, we develop a subset selection method based on k-means clustering and the Cramér-Rao bound on the mixture coefficient estimation error to find a sparse basis set that represents the space spanned by the measured SAXS intensities of the known conformations of a protein. Then, using the selected basis set and the assumptions on the model for the intensity measurements, we show that the MLE model can be expressed as a constrained convex optimization problem. Employing the adenylate kinase (ADK) protein and its known conformations as an example, and using Monte Carlo simulations, we demonstrate the performance of the proposed estimation scheme. Here, although we use 45 crystallographically determined experimental structures and we could generate many more using, for instance, molecular dynamics calculations, the clustering technique indicates that the data cannot support the determination of relative abundances for more than 5 conformations. The estimation of this maximum number of conformations is intrinsic to the methodology we have used here. PMID:26924916
Li, Hong-Bo; Du, Yu-Zhou
2013-05-15
The heat shock 90/70 organizing protein (Hop), also known as Sti-1 (stress-induced protein-1), is a co-chaperone that usually mediates the interaction of Hsp90 and Hsp70 and has been extensively characterized in mammals and plants. However, its role in insects remains unknown. In the present study, we isolated and characterized a Hop homologue gene from Frankliniella occidentalis (Fohop). The Fohop contains a 1659bp ORF encoding a protein of 552 amino acids with a caculated molecular mass of approximately 62.25kDa, which displays a reasonable degree of identity with the known Hops and shares several canonical motifs, including three tetratricopeptide repeated motif domains (TPR1, TPR2A and TPR2B) and two aspartic acid-proline (DP) repeat motifs (DP1 and DP2). As in other hops, Fohop contains introns, but the number and the position are quite variable. The mRNA expression patterns indicated that Fohop was constitutively expressed throughout the developmental stages, but was obviously upregulated by heat stress both in larvae and adults. Our studies imply that Hop, as in other Hsps, may play an important role in heat shock response of F. occidentalis. Copyright © 2013 Elsevier B.V. All rights reserved.
Computational mining for hypothetical patterns of amino acid side chains in protein data bank (PDB)
NASA Astrophysics Data System (ADS)
Ghani, Nur Syatila Ab; Firdaus-Raih, Mohd
2018-04-01
The three-dimensional structure of a protein can provide insights regarding its function. Functional relationship between proteins can be inferred from fold and sequence similarities. In certain cases, sequence or fold comparison fails to conclude homology between proteins with similar mechanism. Since the structure is more conserved than the sequence, a constellation of functional residues can be similarly arranged among proteins of similar mechanism. Local structural similarity searches are able to detect such constellation of amino acids among distinct proteins, which can be useful to annotate proteins of unknown function. Detection of such patterns of amino acids on a large scale can increase the repertoire of important 3D motifs since available known 3D motifs currently, could not compensate the ever-increasing numbers of uncharacterized proteins to be annotated. Here, a computational platform for an automated detection of 3D motifs is described. A fuzzy-pattern searching algorithm derived from IMagine an Amino Acid 3D Arrangement search EnGINE (IMAAAGINE) was implemented to develop an automated method for searching of hypothetical patterns of amino acid side chains in Protein Data Bank (PDB), without the need for prior knowledge on related sequence or structure of pattern of interest. We present an example of the searches, which is the detection of a hypothetical pattern derived from known structural motif of C2H2 structural pattern from zinc fingers. The conservation of particular patterns of amino acid side chains in unrelated proteins is highlighted. This approach can act as a complementary method for available structure- and sequence-based platforms and may contribute in improving functional association between proteins.
Rebreikina, A B; Larionova, E B; Varlamov, A A
2015-01-01
The aim of this investigation is to study neurophysiologic mechanisms of processing of relevant words and unknown words. Event-related synchronization/desynchronization during categorization of three types of stimuli (known targets, known no targets and unknown words) was examined. The main difference between known targets and unknown stimuli was revealed in the thetal and theta2 bands at the early stage after stimuli onset (150-300 ms) and in the delta band (400-700 ms). In the late time window at about 800-1500 ms thetal ERS in response to the target stimuli was smaller than to other stimuli, but theta2 and alpha ERD in response to the target stimuli was larger than to known nontarget words.
Plasma proteomic analysis reveals altered protein abundances in cardiovascular disease.
Lygirou, Vasiliki; Latosinska, Agnieszka; Makridakis, Manousos; Mullen, William; Delles, Christian; Schanstra, Joost P; Zoidakis, Jerome; Pieske, Burkert; Mischak, Harald; Vlahou, Antonia
2018-04-17
Cardiovascular disease (CVD) describes the pathological conditions of the heart and blood vessels. Despite the large number of studies on CVD and its etiology, its key modulators remain largely unknown. To this end, we performed a comprehensive proteomic analysis of blood plasma, with the scope to identify disease-associated changes after placing them in the context of existing knowledge, and generate a well characterized dataset for further use in CVD multi-omics integrative analysis. LC-MS/MS was employed to analyze plasma from 32 subjects (19 cases of various CVD phenotypes and 13 controls) in two steps: discovery (13 cases and 8 controls) and test (6 cases and 5 controls) set analysis. Following label-free quantification, the detected proteins were correlated to existing plasma proteomics datasets (plasma proteome database; PPD) and functionally annotated (Cytoscape, Ingenuity Pathway Analysis). Differential expression was defined based on identification confidence (≥ 2 peptides per protein), statistical significance (Mann-Whitney p value ≤ 0.05) and a minimum of twofold change. Peptides detected in at least 50% of samples per group were considered, resulting in a total of 3796 identified proteins (838 proteins based on ≥ 2 peptides). Pathway annotation confirmed the functional relevance of the findings (representation of complement cascade, fibrin clot formation, platelet degranulation, etc.). Correlation of the relative abundance of the proteins identified in the discovery set with their reported concentrations in the PPD was significant, confirming the validity of the quantification method. The discovery set analysis revealed 100 differentially expressed proteins between cases and controls, 39 of which were verified (≥ twofold change) in the test set. These included proteins already studied in the context of CVD (such as apolipoprotein B, alpha-2-macroglobulin), as well as novel findings (such as low density lipoprotein receptor related protein 2 [LRP2], protein SZT2) for which a mechanism of action is suggested. This proteomic study provides a comprehensive dataset to be used for integrative and functional studies in the field. The observed protein changes reflect known CVD-related processes (e.g. lipid uptake, inflammation) but also novel hypotheses for further investigation including a potential pleiotropic role of LPR2 but also links of SZT2 to CVD.
Ramakrishnan, Gayatri; Ochoa-Montaño, Bernardo; Raghavender, Upadhyayula S; Mudgal, Richa; Joshi, Adwait G; Chandra, Nagasuma R; Sowdhamini, Ramanathan; Blundell, Tom L; Srinivasan, Narayanaswamy
2015-01-01
The availability of the genome sequence of Mycobacterium tuberculosis H37Rv has encouraged determination of large numbers of protein structures and detailed definition of the biological information encoded therein; yet, the functions of many proteins in M. tuberculosis remain unknown. The emergence of multidrug resistant strains makes it a priority to exploit recent advances in homology recognition and structure prediction to re-analyse its gene products. Here we report the structural and functional characterization of gene products encoded in the M. tuberculosis genome, with the help of sensitive profile-based remote homology search and fold recognition algorithms resulting in an enhanced annotation of the proteome where 95% of the M. tuberculosis proteins were identified wholly or partly with information on structure or function. New information includes association of 244 proteins with 205 domain families and a separate set of new association of folds to 64 proteins. Extending structural information across uncharacterized protein families represented in the M. tuberculosis proteome, by determining superfamily relationships between families of known and unknown structures, has contributed to an enhancement in the knowledge of structural content. In retrospect, such superfamily relationships have facilitated recognition of probable structure and/or function for several uncharacterized protein families, eventually aiding recognition of probable functions for homologous proteins corresponding to such families. Gene products unique to mycobacteria for which no functions could be identified are 183. Of these 18 were determined to be M. tuberculosis specific. Such pathogen-specific proteins are speculated to harbour virulence factors required for pathogenesis. A re-annotated proteome of M. tuberculosis, with greater completeness of annotated proteins and domain assigned regions, provides a valuable basis for experimental endeavours designed to obtain a better understanding of pathogenesis and to accelerate the process of drug target discovery. Copyright © 2014 Elsevier Ltd. All rights reserved.
Berg, Stefan; Starbuck, James; Torrelles, Jordi B; Vissa, Varalakshmi D; Crick, Dean C; Chatterjee, Delphi; Brennan, Patrick J
2005-02-18
D-Arabinans, composed of D-arabinofuranose (D-Araf), dominate the structure of mycobacterial cell walls in two settings, as part of lipoarabinomannan (LAM) and arabinogalactan, each with markedly different structures and functions. Little is known of the complexity of their biosynthesis. beta-D-Arabinofuranosyl-1-monophosphoryldecaprenol is the only known sugar donor. EmbA, EmbB, and EmbC, products of the paralogous genes embA, embB, and embC, the sites of resistance to the anti-tuberculosis drug ethambutol (EMB), are the only known implicated enzymes. EmbA and -B apparently contribute to the synthesis of arabinogalactan, whereas EmbC is reserved for the synthesis of LAM. The Emb proteins show no overall similarity to any known proteins beyond Mycobacterium and related genera. However, functional motifs, equivalent to a proline-rich motif of several bacterial polysaccharide co-polymerases and a superfamily of glycosyltransferases, were found. Site-directed mutagenesis in glycosyltransferase superfamily C resulted in complete ablation of LAM synthesis. Point mutations in three amino acids of the proline motif of EmbC resulted in marked reduction of LAM-arabinan synthesis and accumulation of an unknown intermediate and of the known precursor lipomannan. Yet the pattern of the differently linked d-Araf units observed in wild type LAM-arabinan was largely retained in the proline motif mutants. The results allow for the presentation of a unique model of arabinan synthesis.
Amyot, Whitney M.; deJesus, Dennise
2013-01-01
Legionella pneumophila uses the Icm/Dot type 4B secretion system (T4BSS) to deliver translocated protein substrates to the host cell, promoting replication vacuole formation. The conformational state of the translocated substrates within the bacterial cell is unknown, so we sought to determine if folded substrates could be translocated via this system. Fusions of L. pneumophila Icm/Dot-translocated substrates (IDTS) to dihydrofolate reductase (DHFR) or ubiquitin (Ub), small proteins known to fold rapidly, resulted in proteins with low translocation efficiencies. The folded moieties did not cause increased aggregation of the IDTS and did not impede interaction with the adaptor protein complex IcmS/IcmW, which is thought to form a soluble complex that promotes translocation. The translocation defect was alleviated with a Ub moiety harboring mutations known to destabilize its structure, indicating that unfolded proteins are preferred substrates. Real-time analysis of translocation, following movement during the first 30 min after bacterial contact with host cells, revealed that the folded moiety caused a kinetic defect in IDTS translocation. Expression of an IDTS fused to a folded moiety interfered with the translocation of other IDTS, consistent with it causing a blockage of the translocation channel. Furthermore, the folded protein fusions also interfered with intracellular growth, consistent with inefficient or impaired translocation of proteins critical for L. pneumophila intracellular growth. These studies indicate that substrates of the Icm/Dot T4SS are translocated to the host cytosol in an unfolded conformation and that folded proteins are stalled within the translocation channel, impairing the function of the secretion system. PMID:23798536
Webber, Jason; Stone, Timothy C.; Katilius, Evaldas; Smith, Breanna C.; Gordon, Bridget; Mason, Malcolm D.; Tabi, Zsuzsanna; Brewis, Ian A.; Clayton, Aled
2014-01-01
We have used a novel affinity-based proteomics technology to examine the protein signature of small secreted extracellular vesicles called exosomes. The technology uses a new class of protein binding reagents called SOMAmers® (slow off-rate modified aptamers) and allows the simultaneous precise measurement of over 1000 proteins. Exosomes were highly purified from the Du145 prostate cancer cell line, by pooling selected fractions from a continuous sucrose gradient (within the density range of 1.1 to 1.2 g/ml), and examined under standard conditions or with additional detergent treatment by the SOMAscanTM array (version 3.0). Lysates of Du145 cells were also prepared, and the profiles were compared. Housekeeping proteins such as cyclophilin-A, LDH, and Hsp70 were present in exosomes, and we identified almost 100 proteins that were enriched in exosomes relative to cells. These included proteins of known association with cancer exosomes such as MFG-E8, integrins, and MET, and also those less widely reported as exosomally associated, such as ROR1 and ITIH4. Several proteins with no previously known exosomal association were confirmed as exosomally expressed in experiments using individual SOMAmer® reagents or antibodies in micro-plate assays. Western blotting confirmed the SOMAscanTM-identified enrichment of exosomal NOTCH-3, L1CAM, RAC1, and ADAM9. In conclusion, we describe here over 300 proteins of hitherto unknown association with prostate cancer exosomes and suggest that the SOMAmer®-based assay technology is an effective proteomics platform for exosome-associated biomarker discovery in diverse clinical settings. PMID:24505114
Xing, Junji; Ly, Hinh
2014-01-01
ABSTRACT Arenavirus pathogens cause a wide spectrum of diseases in humans ranging from central nervous system disease to lethal hemorrhagic fevers with few treatment options. The reason why some arenaviruses can cause severe human diseases while others cannot is unknown. We find that the Z proteins of all known pathogenic arenaviruses, lymphocytic choriomeningitis virus (LCMV) and Lassa, Junin, Machupo, Sabia, Guanarito, Chapare, Dandenong, and Lujo viruses, can inhibit retinoic acid-inducible gene 1 (RIG-i) and Melanoma Differentiation-Associated protein 5 (MDA5), in sharp contrast to those of 14 other nonpathogenic arenaviruses. Inhibition of the RIG-i-like receptors (RLRs) by pathogenic Z proteins is mediated by the protein-protein interactions of Z and RLRs, which lead to the disruption of the interactions between RLRs and mitochondrial antiviral signaling (MAVS). The Z-RLR interactive interfaces are located within the N-terminal domain (NTD) of the Z protein and the N-terminal CARD domains of RLRs. Swapping of the LCMV Z NTD into the nonpathogenic Pichinde virus (PICV) genome does not affect virus growth in Vero cells but significantly inhibits the type I interferon (IFN) responses and increases viral replication in human primary macrophages. In summary, our results show for the first time an innate immune-system-suppressive mechanism shared by the diverse pathogenic arenaviruses and thus shed important light on the pathogenic mechanism of human arenavirus pathogens. IMPORTANCE We show that all known human-pathogenic arenaviruses share an innate immune suppression mechanism that is based on viral Z protein-mediated RLR inhibition. Our report offers important insights into the potential mechanism of arenavirus pathogenesis, provides a convenient way to evaluate the pathogenic potential of known and/or emerging arenaviruses, and reveals a novel target for the development of broad-spectrum therapies to treat this group of diverse pathogens. More broadly, our report provides a better understanding of the mechanisms of viral immune suppression and host-pathogen interactions. PMID:25552708
LANP mediates neuritic pathology in Spinocerebellar ataxia type 1
Cvetanovic, Marija; Kular, Rupinder K.; Opal, Puneet
2014-01-01
Spinocerebellar ataxia type 1 (SCA1) is an autosomal dominant neurodegenerative disease that results from a pathogenic glutamine-repeat expansion in the protein ataxin-1 (ATXN1). Although the functions of ATXN1 are still largely unknown, there is evidence to suggest that ATXN1 plays a role in regulating gene expression, the earliest process known to go awry in SCA1 mouse models. In this study, we show that ATXN1 reduces histone acetylation, a post-translational modification of histones associated with enhanced transcription, and represses histone acetyl transferase-mediated transcription. In addition, we find that depleting the Leucine-rich Acidic Nuclear Protein (LANP)—an ATXN1 binding inhibitor of histone acetylation—reverses aspects of SCA1 neuritic pathology. PMID:22884877
Pathway connectivity and signaling coordination in the yeast stress-activated signaling network
Chasman, Deborah; Ho, Yi-Hsuan; Berry, David B; Nemec, Corey M; MacGilvray, Matthew E; Hose, James; Merrill, Anna E; Lee, M Violet; Will, Jessica L; Coon, Joshua J; Ansari, Aseem Z; Craven, Mark; Gasch, Audrey P
2014-01-01
Stressed cells coordinate a multi-faceted response spanning many levels of physiology. Yet knowledge of the complete stress-activated regulatory network as well as design principles for signal integration remains incomplete. We developed an experimental and computational approach to integrate available protein interaction data with gene fitness contributions, mutant transcriptome profiles, and phospho-proteome changes in cells responding to salt stress, to infer the salt-responsive signaling network in yeast. The inferred subnetwork presented many novel predictions by implicating new regulators, uncovering unrecognized crosstalk between known pathways, and pointing to previously unknown ‘hubs’ of signal integration. We exploited these predictions to show that Cdc14 phosphatase is a central hub in the network and that modification of RNA polymerase II coordinates induction of stress-defense genes with reduction of growth-related transcripts. We find that the orthologous human network is enriched for cancer-causing genes, underscoring the importance of the subnetwork's predictions in understanding stress biology. PMID:25411400
Panfoli, Isabella; Ponassi, Marco; Ravera, Silvia; Calzia, Daniela; Beitia, Maider; Morelli, Alessandro; Rosano, Camillo
2017-01-22
F 1 F o -ATP synthase is a multisubunit enzyme responsible for the synthesis of ATP. Among its multiple subunits (8 in E. coli, 17 in yeast S. cerevisiae, 16 in vertebrates), two subunits a and c are known to play a central role controlling the H + flow through the inner mitochondrial membrane which allows the subsequent synthesis of ATP, but the pathway followed by H + within the two proteins is still a matter of debate. In fact, even though the structure of ATP synthase is now well defined, the molecular mechanisms determining the function of both F 1 and F O domains are still largely unknown. In this study, we propose a pathway for proton migration along the ATP synthase by hydrogen-bonded chain mechanism, with a key role of serine and threonine residues, by X-ray diffraction data on the subunit a of E. coli Fo. Copyright © 2016 Elsevier Inc. All rights reserved.
NAMPT and NAMPT-controlled NAD Metabolism in Vascular Repair.
Wang, Pei; Li, Wen-Lin; Liu, Jian-Min; Miao, Chao-Yu
2016-06-01
Vascular repair plays important roles in postischemic remodeling and rehabilitation in cardiovascular and cerebrovascular disease, such as stroke and myocardial infarction. Nicotinamide adenine dinucleotide (NAD), a well-known coenzyme involved in electron transport chain for generation of adenosine triphosphate, has emerged as an important controller regulating various biological signaling pathways. Nicotinamide phosphoribosyltransferase (NAMPT) is the rate-limiting enzyme for NAD biosynthesis in mammals. NAMPT may also act in a nonenzymatic manner, presumably mediated by unknown receptor(s). Rapidly accumulating data in the past decade show that NAMPT and NAMPT-controlled NAD metabolism regulate fundamental biological functions in endothelial cells, vascular smooth muscle cells, and endothelial progenitor cells. The NAD-consuming proteins, including sirtuins, poly-ADP-ribose polymerases (PARPs), and CD38, may contribute to the regulatory effects of NAMPT-NAD axis in these cells and vascular repair. This review discusses the current data regarding NAMPT and NAMPT-controlled NAD metabolism in vascular repair and the clinical potential translational application of NAMPT-related products in treatment of cardiovascular and cerebrovascular disease.
Ab initio solution of macromolecular crystal structures without direct methods.
McCoy, Airlie J; Oeffner, Robert D; Wrobel, Antoni G; Ojala, Juha R M; Tryggvason, Karl; Lohkamp, Bernhard; Read, Randy J
2017-04-04
The majority of macromolecular crystal structures are determined using the method of molecular replacement, in which known related structures are rotated and translated to provide an initial atomic model for the new structure. A theoretical understanding of the signal-to-noise ratio in likelihood-based molecular replacement searches has been developed to account for the influence of model quality and completeness, as well as the resolution of the diffraction data. Here we show that, contrary to current belief, molecular replacement need not be restricted to the use of models comprising a substantial fraction of the unknown structure. Instead, likelihood-based methods allow a continuum of applications depending predictably on the quality of the model and the resolution of the data. Unexpectedly, our understanding of the signal-to-noise ratio in molecular replacement leads to the finding that, with data to sufficiently high resolution, fragments as small as single atoms of elements usually found in proteins can yield ab initio solutions of macromolecular structures, including some that elude traditional direct methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panfoli, Isabella; Ponassi, Marco; Ravera, Silvia
F{sub 1}F{sub o}-ATP synthase is a multisubunit enzyme responsible for the synthesis of ATP. Among its multiple subunits (8 in E. coli, 17 in yeast S. cerevisiae, 16 in vertebrates), two subunits a and c are known to play a central role controlling the H{sup +} flow through the inner mitochondrial membrane which allows the subsequent synthesis of ATP, but the pathway followed by H{sup +} within the two proteins is still a matter of debate. In fact, even though the structure of ATP synthase is now well defined, the molecular mechanisms determining the function of both F{sub 1} andmore » F{sub O} domains are still largely unknown. In this study, we propose a pathway for proton migration along the ATP synthase by hydrogen-bonded chain mechanism, with a key role of serine and threonine residues, by X-ray diffraction data on the subunit a of E. coli Fo.« less
USDA-ARS?s Scientific Manuscript database
Fish meal may contain “unknown growth factors” that have yet to be identified for their physiological role. Carnosine is a histidine-ß-alanine dipeptide found in muscle and nervous system tissue which has been demonstrated to have biological activity, but its physiological role is not well defined. ...
NASA Astrophysics Data System (ADS)
Chevalier, Pascal; Oukaci, Abdelkader; Delmas, Jean-Pierre
2011-12-01
The detection of a known signal with unknown parameters in the presence of noise plus interferences (called total noise) whose covariance matrix is unknown is an important problem which has received much attention these last decades for applications such as radar, satellite localization or time acquisition in radio communications. However, most of the available receivers assume a second order (SO) circular (or proper) total noise and become suboptimal in the presence of SO noncircular (or improper) interferences, potentially present in the previous applications. The scarce available receivers which take the potential SO noncircularity of the total noise into account have been developed under the restrictive condition of a known signal with known parameters or under the assumption of a random signal. For this reason, following a generalized likelihood ratio test (GLRT) approach, the purpose of this paper is to introduce and to analyze the performance of different array receivers for the detection of a known signal, with different sets of unknown parameters, corrupted by an unknown noncircular total noise. To simplify the study, we limit the analysis to rectilinear known useful signals for which the baseband signal is real, which concerns many applications.
Asojo, Oluwatoyin A.; Loukas, Alex; Inan, Mehmet; Barent, Rick; Huang, Jicai; Plantz, Brad; Swanson, Amber; Gouthro, Mark; Meagher, Michael M.; Hotez, Peter J.
2005-01-01
Human hookworm infection is a major cause of anemia and malnutrition in the developing world. In an effort to control hookworm infection, the Human Hookworm Vaccine Initiative has identified candidate vaccine antigens from the infective larval stage (L3) of the parasite, including a family of pathogenesis-related-1 (PR-1) proteins known as the ancylostoma-secreted proteins (ASPs). The functions of the ASPs are unknown. In addition, it is unclear why some ASPs have one while others have multiple PR-1 domains. There are no known structures of a multi-domain ASP and in an effort to remedy this situation, recombinant Na-ASP-1 has been expressed, purified and crystallized. Na-ASP-1 is a 406-amino-acid multi-domain ASP from the prevalent human hookworm parasite Necator americanus. Useful X-ray data to 2.2 Å have been collected from a crystal that belongs to the monoclinic space group P21 with unit-cell parameters a = 67.7, b = 74.27, c = 84.60 Å, β = 112.12°. An initial molecular-replacement solution has been obtained with one monomer in the asymmetric unit. PMID:16511050
Genetic Dissection of DivIVA Functions in Listeria monocytogenes.
Kaval, Karan Gautam; Hauf, Samuel; Rismondo, Jeanine; Hahn, Birgitt; Halbedel, Sven
2017-12-15
DivIVA is a membrane binding protein that clusters at curved membrane regions, such as the cell poles and the membrane invaginations occurring during cell division. DivIVA proteins recruit many other proteins to these subcellular sites through direct protein-protein interactions. DivIVA-dependent functions are typically associated with cell growth and division, even though species-specific differences in the spectrum of DivIVA functions and their causative interaction partners exist. DivIVA from the Gram-positive human pathogen Listeria monocytogenes has at least three different functions. In this bacterium, DivIVA is required for precise positioning of the septum at midcell, it contributes to the secretion of autolysins required for the breakdown of peptidoglycan at the septum after the completion of cell division, and it is essential for flagellar motility. While the DivIVA interaction partners for control of division site selection are well established, the proteins connecting DivIVA with autolysin secretion or swarming motility are completely unknown. We set out to identify divIVA alleles in which these three DivIVA functions could be separated, since the question of the degree to which the three functions of L. monocytogenes DivIVA are interlinked could not be answered before. Here, we identify such alleles, and our results show that division site selection, autolysin secretion, and swarming represent three discrete pathways that are independently influenced by DivIVA. These findings provide the required basis for the identification of DivIVA interaction partners controlling autolysin secretion and swarming in the future. IMPORTANCE DivIVA of the pathogenic bacterium Listeria monocytogenes is a central scaffold protein that influences at least three different cellular processes, namely, cell division, protein secretion, and bacterial motility. How DivIVA coordinates these rather unrelated processes is not known. We here identify variants of L. monocytogenes DivIVA, in which these functions are separated from each other. These results have important implications for the models explaining how DivIVA interacts with other proteins. Copyright © 2017 American Society for Microbiology.
Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica; ...
2016-04-28
Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica
Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less
Shen, Yanna; Cooper, Gregory F
2012-09-01
This paper investigates Bayesian modeling of known and unknown causes of events in the context of disease-outbreak detection. We introduce a multivariate Bayesian approach that models multiple evidential features of every person in the population. This approach models and detects (1) known diseases (e.g., influenza and anthrax) by using informative prior probabilities and (2) unknown diseases (e.g., a new, highly contagious respiratory virus that has never been seen before) by using relatively non-informative prior probabilities. We report the results of simulation experiments which support that this modeling method can improve the detection of new disease outbreaks in a population. A contribution of this paper is that it introduces a multivariate Bayesian approach for jointly modeling both known and unknown causes of events. Such modeling has general applicability in domains where the space of known causes is incomplete. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Ullmann-Zeunert, Lynn; Muck, Alexander; Wielsch, Natalie; Hufsky, Franziska; Stanton, Mariana A; Bartram, Stefan; Böcker, Sebastian; Baldwin, Ian T; Groten, Karin; Svatoš, Aleš
2012-10-05
Herbivory leads to changes in the allocation of nitrogen among different pools and tissues; however, a detailed quantitative analysis of these changes has been lacking. Here, we demonstrate that a mass spectrometric data-independent acquisition approach known as LC-MS(E), combined with a novel algorithm to quantify heavy atom enrichment in peptides, is able to quantify elicited changes in protein amounts and (15)N flux in a high throughput manner. The reliable identification/quantitation of rabbit phosphorylase b protein spiked into leaf protein extract was achieved. The linear dynamic range, reproducibility of technical and biological replicates, and differences between measured and expected (15)N-incorporation into the small (SSU) and large (LSU) subunits of ribulose-1,5-bisphosphate-carboxylase/oxygenase (RuBisCO) and RuBisCO activase 2 (RCA2) of Nicotiana attenuata plants grown in hydroponic culture at different known concentrations of (15)N-labeled nitrate were used to further evaluate the procedure. The utility of the method for whole-plant studies in ecologically realistic contexts was demonstrated by using (15)N-pulse protocols on plants growing in soil under unknown (15)N-incorporation levels. Additionally, we quantified the amounts of lipoxygenase 2 (LOX2) protein, an enzyme important in antiherbivore defense responses, demonstrating that the approach allows for in-depth quantitative proteomics and (15)N flux analyses of the metabolic dynamics elicited during plant-herbivore interactions.
Prediction of new bioactive molecules using a Bayesian belief network.
Abdo, Ammar; Leclère, Valérie; Jacques, Philippe; Salim, Naomie; Pupin, Maude
2014-01-27
Natural products and synthetic compounds are a valuable source of new small molecules leading to novel drugs to cure diseases. However identifying new biologically active small molecules is still a challenge. In this paper, we introduce a new activity prediction approach using Bayesian belief network for classification (BBNC). The roots of the network are the fragments composing a compound. The leaves are, on one side, the activities to predict and, on another side, the unknown compound. The activities are represented by sets of known compounds, and sets of inactive compounds are also used. We calculated a similarity between an unknown compound and each activity class. The more similar activity is assigned to the unknown compound. We applied this new approach on eight well-known data sets extracted from the literature and compared its performance to three classical machine learning algorithms. Experiments showed that BBNC provides interesting prediction rates (from 79% accuracy for high diverse data sets to 99% for low diverse ones) with a short time calculation. Experiments also showed that BBNC is particularly effective for homogeneous data sets but has been found to perform less well with structurally heterogeneous sets. However, it is important to stress that we believe that using several approaches whenever possible for activity prediction can often give a broader understanding of the data than using only one approach alone. Thus, BBNC is a useful addition to the computational chemist's toolbox.
A molecular switch on an arrestin-like protein relays glucose signaling to transporter endocytosis.
Becuwe, Michel; Vieira, Neide; Lara, David; Gomes-Rezende, Jéssica; Soares-Cunha, Carina; Casal, Margarida; Haguenauer-Tsapis, Rosine; Vincent, Olivier; Paiva, Sandra; Léon, Sébastien
2012-01-23
Endocytosis regulates the plasma membrane protein landscape in response to environmental cues. In yeast, the endocytosis of transporters depends on their ubiquitylation by the Nedd4-like ubiquitin ligase Rsp5, but how extracellular signals trigger this ubiquitylation is unknown. Various carbon source transporters are known to be ubiquitylated and endocytosed when glucose-starved cells are exposed to glucose. We show that this required the conserved arrestin-related protein Rod1/Art4, which was activated in response to glucose addition. Indeed, Rod1 was a direct target of the glucose signaling pathway composed of the AMPK homologue Snf1 and the PP1 phosphatase Glc7/Reg1. Glucose promoted Rod1 dephosphorylation and its subsequent release from a phospho-dependent interaction with 14-3-3 proteins. Consequently, this allowed Rod1 ubiquitylation by Rsp5, which was a prerequisite for transporter endocytosis. This paper therefore demonstrates that the arrestin-related protein Rod1 relays glucose signaling to transporter endocytosis and provides the first molecular insights into the nutrient-induced activation of an arrestin-related protein through a switch in post-translational modifications.
Yang, Yongil; Yoo, Chang Geun; Guo, Hao-Bo; Rottmann, William; Winkeler, Kimberly A; Collins, Cassandra M; Gunter, Lee E; Jawdy, Sara S; Yang, Xiaohan; Guo, Hong; Pu, Yunqiao; Ragauskas, Arthur J; Tuskan, Gerald A; Chen, Jin-Gui
2017-01-01
Domain of Unknown Function 266 (DUF266) is a plant-specific domain. DUF266-containing proteins (DUF266 proteins) have been categorized as 'not classified glycosyltransferases (GTnc)' due to amino acid similarity with GTs. However, little is known about the function of DUF266 proteins. Phylogenetic analysis revealed that DUF266 proteins are only present in the land plants including moss and lycophyte. We report the functional characterization of one member of DUF266 proteins in Populus, PdDUF266A. PdDUF266A was ubiquitously expressed with high abundance in the xylem. In Populus transgenic plants overexpressing PdDUF266A ( OXPdDUF266A ), the glucose and cellulose contents were significantly higher, while the lignin content was lower than that in the wild type. Degree of polymerization of cellulose in OXPdDUF266A transgenic plants was also higher, whereas cellulose crystallinity index remained unchanged. Gene expression analysis indicated that cellulose biosynthesis-related genes such as CESA and SUSY were upregulated in mature leaf and xylem of OXPdDUF266A transgenic plants. Moreover, PdDUF266A overexpression resulted in an increase of biomass production. Their glucose contents and biomass phenotypes were further validated via heterologous expression of PdDUF266A in Arabidopsis. Results from saccharification treatment demonstrated that the rate of sugar release was increased by approximately 38% in the OXPdDUF266A transgenic plants. These results suggest that the overexpression of PdDUF266A can increase cellulose content, reduce recalcitrance, and enhance biomass production, and that PdDUF266A is a promising target for genetic manipulation for biofuel production.
30 CFR 250.504 - Hydrogen sulfide.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 30 Mineral Resources 2 2011-07-01 2011-07-01 false Hydrogen sulfide. 250.504 Section 250.504...-Completion Operations § 250.504 Hydrogen sulfide. When a well-completion operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in...
30 CFR 250.604 - Hydrogen sulfide.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 30 Mineral Resources 2 2011-07-01 2011-07-01 false Hydrogen sulfide. 250.604 Section 250.604...-Workover Operations § 250.604 Hydrogen sulfide. When a well-workover operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in...
Competitive Food Sales in Schools and Childhood Obesity: A Longitudinal Study
ERIC Educational Resources Information Center
Van Hook, Jennifer; Altman, Claire E.
2012-01-01
The vast majority of American middle schools and high schools sell what are known as "competitive foods," such as soft drinks, candy bars, and chips, to children. The relationship between consumption of sugar-sweetened drinks and snacks and childhood obesity is well established, but it remains unknown whether competitive food sales in…
[Attitudes of medieval doctors on birth].
Lallouette, Anne-Laure
2009-01-01
In the towns practitioners taught midwives whoses attendance is noticed in well-known texts. Labour rooms might have been in lazarettos from the thirteenth century. Practice of delivery by Salerne's School was uncertain and heavy with superstition as the child birth's time was considered with fear of unknown forces and Chauliac's work seemed important during this period.
Ederveen, Ellen G T; van Hunsel, Florence P A M; Wondergem, Marielle J; van Puijenbroek, Eugène P
2018-02-02
After a registered drug is available on the market and used in everyday circumstances, hitherto unknown adverse drug reactions (ADRs) may occur. Furthermore, the patient can experience a previously unknown course of a known ADR. Voluntary reports by patients play an important role in gaining knowledge about ADRs in daily practice. The Netherlands Pharmacovigilance Centre Lareb received a report from a 55-year-old female-to-male transgender patient who experiences secondary polycythemia while using lifelong testosterone therapy. The onset age of the symptoms was 38 years. The symptoms appeared gradually and after approximately 1 year it was clear that the patient's hemoglobin and hematocrit had started to increase. A Naranjo assessment score of 6 was obtained, indicating a probable relationship between the patient's polycythemia and use of the suspect drug. Polycythemia is a known ADR in testosterone treatment, but little attention has been paid to the possible severity and complications of these symptoms as well as the impact on the patient's well-being.
Remote Memory and Cortical Synaptic Plasticity Require Neuronal CCCTC-Binding Factor (CTCF).
Kim, Somi; Yu, Nam-Kyung; Shim, Kyu-Won; Kim, Ji-Il; Kim, Hyopil; Han, Dae Hee; Choi, Ja Eun; Lee, Seung-Woo; Choi, Dong Il; Kim, Myung Won; Lee, Dong-Sung; Lee, Kyungmin; Galjart, Niels; Lee, Yong-Seok; Lee, Jae-Hyung; Kaang, Bong-Kiun
2018-05-30
The molecular mechanism of long-term memory has been extensively studied in the context of the hippocampus-dependent recent memory examined within several days. However, months-old remote memory maintained in the cortex for long-term has not been investigated much at the molecular level yet. Various epigenetic mechanisms are known to be important for long-term memory, but how the 3D chromatin architecture and its regulator molecules contribute to neuronal plasticity and systems consolidation is still largely unknown. CCCTC-binding factor (CTCF) is an 11-zinc finger protein well known for its role as a genome architecture molecule. Male conditional knock-out mice in which CTCF is lost in excitatory neurons during adulthood showed normal recent memory in the contextual fear conditioning and spatial water maze tasks. However, they showed remarkable impairments in remote memory in both tasks. Underlying the remote memory-specific phenotypes, we observed that female CTCF conditional knock-out mice exhibit disrupted cortical LTP, but not hippocampal LTP. Similarly, we observed that CTCF deletion in inhibitory neurons caused partial impairment of remote memory. Through RNA sequencing, we observed that CTCF knockdown in cortical neuron culture caused altered expression of genes that are highly involved in cell adhesion, synaptic plasticity, and memory. These results suggest that remote memory storage in the cortex requires CTCF-mediated gene regulation in neurons, whereas recent memory formation in the hippocampus does not. SIGNIFICANCE STATEMENT CCCTC-binding factor (CTCF) is a well-known 3D genome architectural protein that regulates gene expression. Here, we use two different CTCF conditional knock-out mouse lines and reveal, for the first time, that CTCF is critically involved in the regulation of remote memory. We also show that CTCF is necessary for appropriate expression of genes, many of which we found to be involved in the learning- and memory-related processes. Our study provides behavioral and physiological evidence for the involvement of CTCF-mediated gene regulation in the remote long-term memory and elucidates our understanding of systems consolidation mechanisms. Copyright © 2018 the authors 0270-6474/18/385042-11$15.00/0.
McDougall, Carmel; Woodcroft, Ben J.
2016-01-01
In nature, numerous mechanisms have evolved by which organisms fabricate biological structures with an impressive array of physical characteristics. Some examples of metazoan biological materials include the highly elastic byssal threads by which bivalves attach themselves to rocks, biomineralized structures that form the skeletons of various animals, and spider silks that are renowned for their exceptional strength and elasticity. The remarkable properties of silks, which are perhaps the best studied biological materials, are the result of the highly repetitive, modular, and biased amino acid composition of the proteins that compose them. Interestingly, similar levels of modularity/repetitiveness and similar bias in amino acid compositions have been reported in proteins that are components of structural materials in other organisms, however the exact nature and extent of this similarity, and its functional and evolutionary relevance, is unknown. Here, we investigate this similarity and use sequence features common to silks and other known structural proteins to develop a bioinformatics-based method to identify similar proteins from large-scale transcriptome and whole-genome datasets. We show that a large number of proteins identified using this method have roles in biological material formation throughout the animal kingdom. Despite the similarity in sequence characteristics, most of the silk-like structural proteins (SLSPs) identified in this study appear to have evolved independently and are restricted to a particular animal lineage. Although the exact function of many of these SLSPs is unknown, the apparent independent evolution of proteins with similar sequence characteristics in divergent lineages suggests that these features are important for the assembly of biological materials. The identification of these characteristics enable the generation of testable hypotheses regarding the mechanisms by which these proteins assemble and direct the construction of biological materials with diverse morphologies. The SilkSlider predictor software developed here is available at https://github.com/wwood/SilkSlider. PMID:27415783
Palavicini, Juan Pablo; Wang, Hongjie; Minond, Dmitriy; Bianchi, Elisabetta; Xu, Shaohua; Lakshmana, Madepalli K
2014-01-01
Loss of synaptic proteins and functional synapses in the brains of patients with Alzheimer's disease (AD) as well as transgenic mouse models expressing amyloid-β protein precursor is now well established. However, the earliest age at which such loss of synapses occurs, and whether known markers of AD progression accelerate functional deficits is completely unknown. We previously showed that RanBP9 overexpression leads to enhanced amyloid plaque burden in a mouse model of AD. In this study, we found significant reductions in the levels of synaptophysin and spinophilin, compared with wild-type controls, in both the cortex and the hippocampus of 5- and 6-month old but not 3- or 4-month old APΔE9/RanBP9 triple transgenic mice, and not in APΔE9 double transgenic mice, nor in RanBP9 single transgenic mice. Interestingly, amyloid plaque burden was also increased in the APΔE9/RanBP9 mice at 5-6 months. Consistent with these results, we found significant deficits in learning and memory in the APΔE9/RanBP9 mice at 5 and 6 month. These data suggest that increased amyloid plaques and accelerated learning and memory deficits and loss of synaptic proteins induced by RanBP9 are correlated. Most importantly, APΔE9/RanBP9 mice also showed significantly reduced levels of the phosphorylated form of cofilin in the hippocampus. Taken together these data suggest that RanBP9 overexpression down-regulates cofilin, causes early synaptic deficits and impaired learning, and accelerates accumulation of amyloid plaques in the mouse brain.
2002-01-01
the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N
The T-cell-specific adapter protein family: TSAd, ALX, and SH2D4A/SH2D4B.
Lapinski, Philip E; Oliver, Jennifer A; Bodie, Jennifer N; Marti, Francesc; King, Philip D
2009-11-01
Adapter proteins play key roles in intracellular signal transduction through complex formation with catalytically active signaling molecules. In T lymphocytes, the role of several different types of adapter proteins in T-cell antigen receptor signal transduction is well established. An exception to this is the family of T-cell-specific adapter (TSAd) proteins comprising of TSAd, adapter protein of unknown function (ALX), SH2D4A, and SH2D4B. Only recently has the function of these adapters in T-cell signal transduction been explored. Here, we discuss advances in our understanding of the role of this family of adapter proteins in T cells. Their function as regulators of signal transduction in other cell types is also discussed.
A Xanthomonas uridine 5'-monophosphate transferase inhibits plant immune kinases.
Feng, Feng; Yang, Fan; Rong, Wei; Wu, Xiaogang; Zhang, Jie; Chen, She; He, Chaozu; Zhou, Jian-Min
2012-04-15
Plant innate immunity is activated on the detection of pathogen-associated molecular patterns (PAMPs) at the cell surface, or of pathogen effector proteins inside the plant cell. Together, PAMP-triggered immunity and effector-triggered immunity constitute powerful defences against various phytopathogens. Pathogenic bacteria inject a variety of effector proteins into the host cell to assist infection or propagation. A number of effector proteins have been shown to inhibit plant immunity, but the biochemical basis remains unknown for the vast majority of these effectors. Here we show that the Xanthomonas campestris pathovar campestris type III effector AvrAC enhances virulence and inhibits plant immunity by specifically targeting Arabidopsis BIK1 and RIPK, two receptor-like cytoplasmic kinases known to mediate immune signalling. AvrAC is a uridylyl transferase that adds uridine 5'-monophosphate to and conceals conserved phosphorylation sites in the activation loop of BIK1 and RIPK, reducing their kinase activity and consequently inhibiting downstream signalling.
Uhlig, Christiane; Kilpert, Fabian; Frickenhaus, Stephan; Kegel, Jessica U; Krell, Andreas; Mock, Thomas; Valentin, Klaus; Beszteri, Bánk
2015-11-01
Ice-binding proteins (IBPs) have been isolated from various sea-ice organisms. Their characterisation points to a crucial role in protecting the organisms in sub-zero environments. However, their in situ abundance and diversity in natural sea-ice microbial communities is largely unknown. In this study, we analysed the expression and phylogenetic diversity of eukaryotic IBP transcripts from microbial communities of Arctic and Antarctic sea ice. IBP transcripts were found in abundances similar to those of proteins involved in core cellular processes such as photosynthesis. Eighty-nine percent of the IBP transcripts grouped with known IBP sequences from diatoms, haptophytes and crustaceans, but the majority represented novel sequences not previously characterized in cultured organisms. The observed high eukaryotic IBP expression in natural eukaryotic sea ice communities underlines the essential role of IBPs for survival of many microorganisms in communities living under the extreme conditions of polar sea ice.
The Survival Motor Neuron Protein Forms Soluble Glycine Zipper Oligomers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, Renee; Gupta, Kushol; Ninan, Nisha S.
2012-11-01
The survival motor neuron (SMN) protein forms the oligomeric core of a multiprotein complex that functions in spliceosomal snRNP biogenesis. Loss of function mutations in the SMN gene cause spinal muscular atrophy (SMA), a leading genetic cause of infant mortality. Nearly half of the known SMA patient missense mutations map to the SMN YG-box, a highly conserved oligomerization domain of unknown structure that contains a (YxxG)3 motif. Here, we report that the SMN YG-box forms helical oligomers similar to the glycine zippers found in transmembrane channel proteins. A network of tyrosine-glycine packing between helices drives formation of soluble YG-box oligomers,more » providing a structural basis for understanding SMN oligomerization and for relating defects in oligomerization to the mutations found in SMA patients. These results have important implications for advancing our understanding of SMN function and glycine zipper-mediated helix-helix interactions.« less
HHsvm: fast and accurate classification of profile–profile matches identified by HHsearch
Dlakić, Mensur
2009-01-01
Motivation: Recently developed profile–profile methods rival structural comparisons in their ability to detect homology between distantly related proteins. Despite this tremendous progress, many genuine relationships between protein families cannot be recognized as comparisons of their profiles result in scores that are statistically insignificant. Results: Using known evolutionary relationships among protein superfamilies in SCOP database, support vector machines were trained on four sets of discriminatory features derived from the output of HHsearch. Upon validation, it was shown that the automatic classification of all profile–profile matches was superior to fixed threshold-based annotation in terms of sensitivity and specificity. The effectiveness of this approach was demonstrated by annotating several domains of unknown function from the Pfam database. Availability: Programs and scripts implementing the methods described in this manuscript are freely available from http://hhsvm.dlakiclab.org/. Contact: mdlakic@montana.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19773335
Tzfp represses the androgen receptor in mouse testis.
Furu, Kari; Klungland, Arne
2013-01-01
The testis zinc finger protein (Tzfp), also known as Repressor of GATA, belongs to the BTB/POZ zinc finger family of transcription factors and is thought to play a role in spermatogenesis due to its remarkably high expression in testis. Despite many attempts to find the in vivo role of the protein, the molecular function is still largely unknown. Here, we address this issue using a novel mouse model with a disrupted Tzfp gene. Homozygous Tzfp null mice are born at reduced frequency but appear viable and fertile. Sertoli cells in testes lacking Tzfp display an increase in Androgen Receptor (AR) signaling, and several genes in the testis, including Gata1, Aie1 and Fanc, show increased expression. Our results indicate that Tzfp function as a transcriptional regulator and that loss of the protein leads to alterations in AR signaling and reduced number of apoptotic cells in the testicular tubules.
Peterson, Thomas A; Nehrt, Nathan L; Park, DoHwan
2012-01-01
Background and objective With recent breakthroughs in high-throughput sequencing, identifying deleterious mutations is one of the key challenges for personalized medicine. At the gene and protein level, it has proven difficult to determine the impact of previously unknown variants. A statistical method has been developed to assess the significance of disease mutation clusters on protein domains by incorporating domain functional annotations to assist in the functional characterization of novel variants. Methods Disease mutations aggregated from multiple databases were mapped to domains, and were classified as either cancer- or non-cancer-related. The statistical method for identifying significantly disease-associated domain positions was applied to both sets of mutations and to randomly generated mutation sets for comparison. To leverage the known function of protein domain regions, the method optionally distributes significant scores to associated functional feature positions. Results Most disease mutations are localized within protein domains and display a tendency to cluster at individual domain positions. The method identified significant disease mutation hotspots in both the cancer and non-cancer datasets. The domain significance scores (DS-scores) for cancer form a bimodal distribution with hotspots in oncogenes forming a second peak at higher DS-scores than non-cancer, and hotspots in tumor suppressors have scores more similar to non-cancers. In addition, on an independent mutation benchmarking set, the DS-score method identified mutations known to alter protein function with very high precision. Conclusion By aggregating mutations with known disease association at the domain level, the method was able to discover domain positions enriched with multiple occurrences of deleterious mutations while incorporating relevant functional annotations. The method can be incorporated into translational bioinformatics tools to characterize rare and novel variants within large-scale sequencing studies. PMID:22319177
Lu, Xin; Sun, Jibin; Nimtz, Manfred; Wissing, Josef; Zeng, An-Ping; Rinas, Ursula
2010-04-20
The filamentous fungus Aspergillus niger is well-known as a producer of primary metabolites and extracellular proteins. For example, glucoamylase is the most efficiently secreted protein of Aspergillus niger, thus the homologous glucoamylase (glaA) promoter as well as the glaA signal sequence are widely used for heterologous protein production. Xylose is known to strongly repress glaA expression while maltose is a potent inducer of glaA promoter controlled genes. For a more profound understanding of A. niger physiology, a comprehensive analysis of the intra- and extracellular proteome of Aspergillus niger AB1.13 growing on defined medium with xylose or maltose as carbon substrate was carried out using 2-D gel electrophoresis/Maldi-ToF and nano-HPLC MS/MS. The intracellular proteome of A. niger growing either on xylose or maltose in well-aerated controlled bioreactor cultures revealed striking similarities. In both cultures the most abundant intracellular protein was the TCA cycle enzyme malate-dehydrogenase. Moreover, the glycolytic enzymes fructose-bis-phosphate aldolase and glyceraldehyde-3-phosphate-dehydrogenase and the flavohemoglobin FhbA were identified as major proteins in both cultures. On the other hand, enzymes involved in the removal of reactive oxygen species, such as superoxide dismutase and peroxiredoxin, were present at elevated levels in the culture growing on maltose but only in minor amounts in the xylose culture. The composition of the extracellular proteome differed considerably depending on the carbon substrate. In the secretome of the xylose-grown culture, a variety of plant cell wall degrading enzymes were identified, mostly under the control of the xylanolytic transcriptional activator XlnR, with xylanase B and ferulic acid esterase as the most abundant ones. The secretome of the maltose-grown culture did not contain xylanolytic enzymes, instead high levels of catalases were found and glucoamylase (multiple spots) was identified as the most abundant extracellular protein. Surprisingly, the intracellular proteome of A. niger growing on xylose in bioreactor cultures differed more from a culture growing in shake flasks using the same medium than from the bioreactor culture growing on maltose. For example, in shake flask cultures with xylose as carbon source the most abundant intracellular proteins were not the glycolytic and the TCA cycle enzymes and the flavohemoglobin, but CipC, a protein of yet unknown function, superoxide dismutase and an NADPH dependent aldehyde reductase. Moreover, vacuolar proteases accumulated to higher and ER-resident chaperones and foldases to lower levels in shake flask compared to the bioreactor cultures. The utilization of xylose or maltose was strongly affecting the composition of the secretome but of minor influence on the composition of the intracellular proteome. On the other hand, differences in culture conditions (pH control versus no pH control, aeration versus no aeration and stirring versus shaking) have a profound effect on the intracellular proteome. For example, lower levels of ER-resident chaperones and foldases and higher levels of vacuolar proteases render shake flask conditions less favorable for protein production compared to controlled bioreactor cultures.
2010-01-01
Background The filamentous fungus Aspergillus niger is well-known as a producer of primary metabolites and extracellular proteins. For example, glucoamylase is the most efficiently secreted protein of Aspergillus niger, thus the homologous glucoamylase (glaA) promoter as well as the glaA signal sequence are widely used for heterologous protein production. Xylose is known to strongly repress glaA expression while maltose is a potent inducer of glaA promoter controlled genes. For a more profound understanding of A. niger physiology, a comprehensive analysis of the intra- and extracellular proteome of Aspergillus niger AB1.13 growing on defined medium with xylose or maltose as carbon substrate was carried out using 2-D gel electrophoresis/Maldi-ToF and nano-HPLC MS/MS. Results The intracellular proteome of A. niger growing either on xylose or maltose in well-aerated controlled bioreactor cultures revealed striking similarities. In both cultures the most abundant intracellular protein was the TCA cycle enzyme malate-dehydrogenase. Moreover, the glycolytic enzymes fructose-bis-phosphate aldolase and glyceraldehyde-3-phosphate-dehydrogenase and the flavohemoglobin FhbA were identified as major proteins in both cultures. On the other hand, enzymes involved in the removal of reactive oxygen species, such as superoxide dismutase and peroxiredoxin, were present at elevated levels in the culture growing on maltose but only in minor amounts in the xylose culture. The composition of the extracellular proteome differed considerably depending on the carbon substrate. In the secretome of the xylose-grown culture, a variety of plant cell wall degrading enzymes were identified, mostly under the control of the xylanolytic transcriptional activator XlnR, with xylanase B and ferulic acid esterase as the most abundant ones. The secretome of the maltose-grown culture did not contain xylanolytic enzymes, instead high levels of catalases were found and glucoamylase (multiple spots) was identified as the most abundant extracellular protein. Surprisingly, the intracellular proteome of A. niger growing on xylose in bioreactor cultures differed more from a culture growing in shake flasks using the same medium than from the bioreactor culture growing on maltose. For example, in shake flask cultures with xylose as carbon source the most abundant intracellular proteins were not the glycolytic and the TCA cycle enzymes and the flavohemoglobin, but CipC, a protein of yet unknown function, superoxide dismutase and an NADPH dependent aldehyde reductase. Moreover, vacuolar proteases accumulated to higher and ER-resident chaperones and foldases to lower levels in shake flask compared to the bioreactor cultures. Conclusions The utilization of xylose or maltose was strongly affecting the composition of the secretome but of minor influence on the composition of the intracellular proteome. On the other hand, differences in culture conditions (pH control versus no pH control, aeration versus no aeration and stirring versus shaking) have a profound effect on the intracellular proteome. For example, lower levels of ER-resident chaperones and foldases and higher levels of vacuolar proteases render shake flask conditions less favorable for protein production compared to controlled bioreactor cultures. PMID:20406453
Background: It is well known that a variety of teratogens induce neural tube defects in animals; however, less is known about proteins that play a role in protecting embryos from teratogen-induced neural tube defects. Previously, our lab has shown that embryos over-expressing th...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, Roslyn N.; Sanford, James A.; Park, Jea H.
Towards developing a systems-level pathobiological understanding of Salmonella enterica, we performed a subcellular proteomic analysis of this pathogen grown under standard laboratory and infection-mimicking conditions in vitro. Analysis of proteins from cytoplasmic, inner membrane, periplasmic, and outer membrane fractions yielded coverage of over 30% of the theoretical proteome. Confident subcellular location could be assigned to over 1000 proteins, with good agreement between experimentally observed location and predicted/known protein properties. Comparison of protein location under the different environmental conditions provided insight into dynamic protein localization and possible moonlighting (multiple function) activities. Notable examples of dynamic localization were the response regulators ofmore » two-component regulatory systems (e.g., ArcB, PhoQ). The DNA-binding protein Dps that is generally regarded as cytoplasmic was significantly enriched in the outer membrane for all growth conditions examined, suggestive of moonlighting activities. These observations imply the existence of unknown transport mechanisms and novel functions for a subset of Salmonella proteins. Overall, this work provides a catalog of experimentally verified subcellular protein location for Salmonella and a framework for further investigations using computational modeling.« less
ERIC Educational Resources Information Center
Forbes, Bethany E.; Skinner, Christopher H.; Black, Michelle P.; Yaw, Jared; Booher, Joshua; Delisle, Jean
2013-01-01
Using alternating treatments designs, we compared learning rates across 2 computer-based flash-card interventions (3?min each): a traditional drill intervention with 15 unknown words and an interspersal intervention with 12 known words and 3 unknown words. Each student acquired more words under the traditional drill intervention. Discussion…
Strop, Pavel; Brunger, Axel T.
2005-01-01
The concentration of detergent in membrane protein preparations can have a critical role on protein stability, function, and the potential for crystallization. Unfortunately, dialysis or protein concentration can lead to an unknown amount of detergent in the final membrane protein preparations. Here we present a method for the determination of detergent concentration based on refractive index of the detergent solution. This method was applied to quantitate the amount of detergent remaining in solution after concentration in various concentrators. We found that the ability of the tested detergents to pass through the molecular weight cutoff membrane correlates well with detergent micelle size. Therefore, the micelle size can be used as a rough guide to estimate the retention of a given detergent in various molecular weight cutoff concentrators. The refractive index method is exceptionally informative when coupled with size exclusion chromatography and light scattering, and can be used to determine the oligomeric state of the membrane protein, the size of a protein-associated micelle, as well as the amount and size of the unbound detergent micelle. PMID:16046633
Strop, Pavel; Brunger, Axel T
2005-08-01
The concentration of detergent in membrane protein preparations can have a critical role on protein stability, function, and the potential for crystallization. Unfortunately, dialysis or protein concentration can lead to an unknown amount of detergent in the final membrane protein preparations. Here we present a method for the determination of detergent concentration based on refractive index of the detergent solution. This method was applied to quantitate the amount of detergent remaining in solution after concentration in various concentrators. We found that the ability of the tested detergents to pass through the molecular weight cutoff membrane correlates well with detergent micelle size. Therefore, the micelle size can be used as a rough guide to estimate the retention of a given detergent in various molecular weight cutoff concentrators. The refractive index method is exceptionally informative when coupled with size exclusion chromatography and light scattering, and can be used to determine the oligomeric state of the membrane protein, the size of a protein-associated micelle, as well as the amount and size of the unbound detergent micelle.
Ladics, Gregory S; Cressman, Robert F; Herouet-Guicheney, Corinne; Herman, Rod A; Privalle, Laura; Song, Ping; Ward, Jason M; McClain, Scott
2011-06-01
Bioinformatic tools are being increasingly utilized to evaluate the degree of similarity between a novel protein and known allergens within the context of a larger allergy safety assessment process. Importantly, bioinformatics is not a predictive analysis that can determine if a novel protein will ''become" an allergen, but rather a tool to assess whether the protein is a known allergen or is potentially cross-reactive with an existing allergen. Bioinformatic tools are key components of the 2009 CodexAlimentarius Commission's weight-of-evidence approach, which encompasses a variety of experimental approaches for an overall assessment of the allergenic potential of a novel protein. Bioinformatic search comparisons between novel protein sequences, as well as potential novel fusion sequences derived from the genome and transgene, and known allergens are required by all regulatory agencies that assess the safety of genetically modified (GM) products. The objective of this paper is to identify opportunities for consensus in the methods of applying bioinformatics and to outline differences that impact a consistent and reliable allergy safety assessment. The bioinformatic comparison process has some critical features, which are outlined in this paper. One of them is a curated, publicly available and well-managed database with known allergenic sequences. In this paper, the best practices, scientific value, and food safety implications of bioinformatic analyses, as they are applied to GM food crops are discussed. Recommendations for conducting bioinformatic analysis on novel food proteins for potential cross-reactivity to known allergens are also put forth. Copyright © 2011 Elsevier Inc. All rights reserved.
Bultema, Jarred J.; Ambrosio, Andrea L.; Burek, Carolyn L.; Di Pietro, Santiago M.
2012-01-01
Lysosome-related organelles (LROs) are synthesized in specialized cell types where they largely coexist with conventional lysosomes. Most of the known cellular transport machinery involved in biogenesis are ubiquitously expressed and shared between lysosomes and LROs. Examples of common components are the adaptor protein complex-3 (AP-3) and biogenesis of lysosome-related organelle complex (BLOC)-2. These protein complexes control sorting and transport of newly synthesized integral membrane proteins from early endosomes to both lysosomes and LROs such as the melanosome. However, it is unknown what factors cooperate with the ubiquitous transport machinery to mediate transport to LROs in specialized cells. Focusing on the melanosome, we show that the ubiquitous machinery interacts with cell type-specific Rab proteins, Rab38 and Rab32, to facilitate transport to the maturing organelle. BLOC-2, AP-3, and AP-1 coimmunoprecipitated with Rab38 and Rab32 from MNT-1 melanocytic cell extracts. BLOC-2, AP-3, AP-1, and clathrin partially colocalized with Rab38 and Rab32 by confocal immunofluorescence microscopy in MNT-1 cells. Rab38- and Rab32-deficient MNT-1 cells displayed abnormal trafficking and steady state levels of known cargoes of the BLOC-2, AP-3, and AP-1 pathways, the melanin-synthesizing enzymes tyrosinase and tyrosinase-related protein-1. These observations support the idea that Rab38 and Rab32 are the specific factors that direct the ubiquitous machinery to mediate transport from early endosomes to maturing LROs. Additionally, analysis of tyrosinase-related protein-2 and total melanin production indicates that Rab32 has unique functions that cannot be carried out by Rab38 in melanosome biogenesis. PMID:22511774
Bultema, Jarred J; Ambrosio, Andrea L; Burek, Carolyn L; Di Pietro, Santiago M
2012-06-01
Lysosome-related organelles (LROs) are synthesized in specialized cell types where they largely coexist with conventional lysosomes. Most of the known cellular transport machinery involved in biogenesis are ubiquitously expressed and shared between lysosomes and LROs. Examples of common components are the adaptor protein complex-3 (AP-3) and biogenesis of lysosome-related organelle complex (BLOC)-2. These protein complexes control sorting and transport of newly synthesized integral membrane proteins from early endosomes to both lysosomes and LROs such as the melanosome. However, it is unknown what factors cooperate with the ubiquitous transport machinery to mediate transport to LROs in specialized cells. Focusing on the melanosome, we show that the ubiquitous machinery interacts with cell type-specific Rab proteins, Rab38 and Rab32, to facilitate transport to the maturing organelle. BLOC-2, AP-3, and AP-1 coimmunoprecipitated with Rab38 and Rab32 from MNT-1 melanocytic cell extracts. BLOC-2, AP-3, AP-1, and clathrin partially colocalized with Rab38 and Rab32 by confocal immunofluorescence microscopy in MNT-1 cells. Rab38- and Rab32-deficient MNT-1 cells displayed abnormal trafficking and steady state levels of known cargoes of the BLOC-2, AP-3, and AP-1 pathways, the melanin-synthesizing enzymes tyrosinase and tyrosinase-related protein-1. These observations support the idea that Rab38 and Rab32 are the specific factors that direct the ubiquitous machinery to mediate transport from early endosomes to maturing LROs. Additionally, analysis of tyrosinase-related protein-2 and total melanin production indicates that Rab32 has unique functions that cannot be carried out by Rab38 in melanosome biogenesis.
Fearnley, I M; Finel, M; Skehel, J M; Walker, J E
1991-01-01
The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859
Yu, Jianzhong; Zheng, Yonggang; Dong, Jixin; Klusza, Stephen; Deng, Wu-Min; Pan, Duojia
2010-01-01
Summary The Hippo signaling pathway regulates organ size and tissue homeostasis from Drosophila to mammals. Central to this pathway is a kinase cascade wherein Hippo (Hpo), in complex with Salvador (Sav), phosphorylates and activates Warts (Wts), which in turn phosphorylates and inactivates the Yorkie (Yki) oncoprotein, known as the YAP coactivator in mammalian cells. The FERM domain proteins Merlin (Mer) and Expanded (Ex) are upstream components that regulate Hpo activity through unknown mechanisms. Here we identify Kibra (Kbr) as another upstream component of the Hippo signaling pathway. We show that Kbr functions together with Mer and Ex in a protein complex localized to the apical domain of epithelial cells, and that this protein complex regulates the Hippo kinase cascade via direct binding to Hpo and Sav. These results shed light on the mechanism of Ex and Mer function, and implicate Kbr as a potential tumor suppressor with relevance to neurofibromatosis. PMID:20159598
Biological iron-sulfur storage in a thioferrate-protein nanoparticle
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vaccaro, Brian J.; Clarkson, Sonya M.; Holden, James F.
Iron–sulfur clusters are ubiquitous in biology and function in electron transfer and catalysis. We assembled them from iron and cysteine sulfur on protein scaffolds. Iron is typically stored as iron oxyhydroxide, ferrihydrite, encapsulated in 12 nm shells of ferritin, which buffers cellular iron availability. We have characterized IssA, a protein that stores iron and sulfur as thioferrate, an inorganic anionic polymer previously unknown in biology. IssA forms nanoparticles reaching 300 nm in diameter and is the largest natural metalloprotein complex known. It is a member of a widely distributed protein family that includes nitrogenase maturation factors, NifB and NifX. IssAmore » nanoparticles are visible by electron microscopy as electron-dense bodies in the cytoplasm. Purified nanoparticles appear to be generated from 20 nm units containing B 6,400 Fe atoms and B 170 IssA monomers. In support of roles in both iron–sulfur storage and cluster biosynthesis, IssA reconstitutes the [4Fe-4S] cluster in ferredoxin in vitro.« less
Biological iron-sulfur storage in a thioferrate-protein nanoparticle
Vaccaro, Brian J.; Clarkson, Sonya M.; Holden, James F.; ...
2017-07-20
Iron–sulfur clusters are ubiquitous in biology and function in electron transfer and catalysis. We assembled them from iron and cysteine sulfur on protein scaffolds. Iron is typically stored as iron oxyhydroxide, ferrihydrite, encapsulated in 12 nm shells of ferritin, which buffers cellular iron availability. We have characterized IssA, a protein that stores iron and sulfur as thioferrate, an inorganic anionic polymer previously unknown in biology. IssA forms nanoparticles reaching 300 nm in diameter and is the largest natural metalloprotein complex known. It is a member of a widely distributed protein family that includes nitrogenase maturation factors, NifB and NifX. IssAmore » nanoparticles are visible by electron microscopy as electron-dense bodies in the cytoplasm. Purified nanoparticles appear to be generated from 20 nm units containing B 6,400 Fe atoms and B 170 IssA monomers. In support of roles in both iron–sulfur storage and cluster biosynthesis, IssA reconstitutes the [4Fe-4S] cluster in ferredoxin in vitro.« less
Complete fold annotation of the human proteome using a novel structural feature space
Middleton, Sarah A.; Illuminati, Joseph; Kim, Junhyong
2017-04-13
Recognition of protein structural fold is the starting point for many structure prediction tools and protein function inference. Fold prediction is computationally demanding and recognizing novel folds is difficult such that the majority of proteins have not been annotated for fold classification. Here we describe a new machine learning approach using a novel feature space that can be used for accurate recognition of all 1,221 currently known folds and inference of unknown novel folds. We show that our method achieves better than 94% accuracy even when many folds have only one training example. We demonstrate the utility of this methodmore » by predicting the folds of 34,330 human protein domains and showing that these predictions can yield useful insights into potential biological function, such as prediction of RNA-binding ability. Finally, our method can be applied to de novo fold prediction of entire proteomes and identify candidate novel fold families.« less
Cao, Han; Ng, Marcus C K; Jusoh, Siti Azma; Tai, Hio Kuan; Siu, Shirley W I
2017-09-01
[Formula: see text]-Helical transmembrane proteins are the most important drug targets in rational drug development. However, solving the experimental structures of these proteins remains difficult, therefore computational methods to accurately and efficiently predict the structures are in great demand. We present an improved structure prediction method TMDIM based on Park et al. (Proteins 57:577-585, 2004) for predicting bitopic transmembrane protein dimers. Three major algorithmic improvements are introduction of the packing type classification, the multiple-condition decoy filtering, and the cluster-based candidate selection. In a test of predicting nine known bitopic dimers, approximately 78% of our predictions achieved a successful fit (RMSD <2.0 Å) and 78% of the cases are better predicted than the two other methods compared. Our method provides an alternative for modeling TM bitopic dimers of unknown structures for further computational studies. TMDIM is freely available on the web at https://cbbio.cis.umac.mo/TMDIM . Website is implemented in PHP, MySQL and Apache, with all major browsers supported.
3D RNA and functional interactions from evolutionary couplings
Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.
2016-01-01
Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444
TMDIM: an improved algorithm for the structure prediction of transmembrane domains of bitopic dimers
NASA Astrophysics Data System (ADS)
Cao, Han; Ng, Marcus C. K.; Jusoh, Siti Azma; Tai, Hio Kuan; Siu, Shirley W. I.
2017-09-01
α-Helical transmembrane proteins are the most important drug targets in rational drug development. However, solving the experimental structures of these proteins remains difficult, therefore computational methods to accurately and efficiently predict the structures are in great demand. We present an improved structure prediction method TMDIM based on Park et al. (Proteins 57:577-585, 2004) for predicting bitopic transmembrane protein dimers. Three major algorithmic improvements are introduction of the packing type classification, the multiple-condition decoy filtering, and the cluster-based candidate selection. In a test of predicting nine known bitopic dimers, approximately 78% of our predictions achieved a successful fit (RMSD <2.0 Å) and 78% of the cases are better predicted than the two other methods compared. Our method provides an alternative for modeling TM bitopic dimers of unknown structures for further computational studies. TMDIM is freely available on the web at https://cbbio.cis.umac.mo/TMDIM. Website is implemented in PHP, MySQL and Apache, with all major browsers supported.
Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions
Jiang, Jiansen; Chan, Henry; Cash, Darian D.; ...
2015-10-15
Telomerase helps maintain telomeres by processive synthesis of telomere repeat DNA at their 3'-ends, using an integral telomerase RNA (TER) and telomerase reverse transcriptase (TERT). In this paper, we report the cryo–electron microscopy structure of Tetrahymena telomerase at ~9 angstrom resolution. In addition to seven known holoenzyme proteins, we identify two additional proteins that form a complex (TEB) with single-stranded telomere DNA-binding protein Teb1, paralogous to heterotrimeric replication protein A (RPA). The p75-p45-p19 subcomplex is identified as another RPA-related complex, CST (CTC1-STN1-TEN1). This study reveals the paths of TER in the TERT-TER-p65 catalytic core and single-stranded DNA exit; extensive subunitmore » interactions of the TERT essential N-terminal domain, p50, and TEB; and other subunit identities and structures, including p19 and p45C crystal structures. Finally, our findings provide structural and mechanistic insights into telomerase holoenzyme function.« less
Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Jiansen; Chan, Henry; Cash, Darian D.
Telomerase helps maintain telomeres by processive synthesis of telomere repeat DNA at their 3'-ends, using an integral telomerase RNA (TER) and telomerase reverse transcriptase (TERT). In this paper, we report the cryo–electron microscopy structure of Tetrahymena telomerase at ~9 angstrom resolution. In addition to seven known holoenzyme proteins, we identify two additional proteins that form a complex (TEB) with single-stranded telomere DNA-binding protein Teb1, paralogous to heterotrimeric replication protein A (RPA). The p75-p45-p19 subcomplex is identified as another RPA-related complex, CST (CTC1-STN1-TEN1). This study reveals the paths of TER in the TERT-TER-p65 catalytic core and single-stranded DNA exit; extensive subunitmore » interactions of the TERT essential N-terminal domain, p50, and TEB; and other subunit identities and structures, including p19 and p45C crystal structures. Finally, our findings provide structural and mechanistic insights into telomerase holoenzyme function.« less
Statistical Physics Approaches to RNA Editing
NASA Astrophysics Data System (ADS)
Bundschuh, Ralf
2012-02-01
The central dogma of molecular Biology states that DNA is transcribed base by base into RNA which is in turn translated into proteins. However, some organisms edit their RNA before translation by inserting, deleting, or substituting individual or short stretches of bases. In many instances the mechanisms by which an organism recognizes the positions at which to edit or by which it performs the actual editing are unknown. One model system that stands out by its very high rate of on average one out of 25 bases being edited are the Myxomycetes, a class of slime molds. In this talk we will show how the computational methods and concepts from statistical Physics can be used to analyze DNA and protein sequence data to predict editing sites in these slime molds and to guide experiments that identified previously unknown types of editing as well as the complete set of editing events in the slime mold Physarum polycephalum.
Bélec, L
1999-01-01
The evaluation of the hypothesis of an infectious etiology to some neurological diseases comprises four different situations. First, numerous neurological diseases have an obvious infectious etiology (encephilitis, meningoencephilitis). Second, some neurological disorders were primarily suspected to be have an infectious etiology, but the causative microorganism was discovered either longtime after the princeps description of the disease (neurologic Whipple disease, due to Tropheryma whippelii), or at the same time (tropical spastic para-paresis secondary to HTLV-I infection). Third, for other neurological diseases, an infectious etiology that was not suspected at time of their anatomoclinic descriptions, was further demonstrated in the context of a generally complex physiopathology (Guillain-Barré syndrome and infection by Campylobacter jejuni). Finally, some idiopathic neurological diseases could be related to well known or yet unknown microorganisms, in association with some environmental factors, and with a particular genetic or acquired susceptibility of the host. The evaluation of an infectious etiology to these idiopathic neurological disorders must be envisioned according to 3 possibilities: 1) generally, the neurological disease is well defined, but its etiology remains unknown and an infectious hypothesis could be relevant (multiple sclerosis, post-polio syndrome, amyotrophic lateral sclerosis); 2) sometimes, a microorganism that is not associated with a known disease, and then qualified as "orphelin", could be associated with neurological disorders (spumaretrovirus); 3) finally, a new neurological disease could be associated with a known or yet unknown microorganism, directly or indirectly. In conclusion, some idiopathic neurological diseases could have an infectious etiology, with physiopathologic, diagnostic, prophylactic (vaccination) and therapeutic (use of anti-infectious drugs) consequences.
Kim, Hak-Su; Kim, Myung-Jin; Kim, Eun Ju; Yang, Young; Lee, Myeong-Sok; Lim, Jong-Seok
2012-02-01
Berberine is clinically important natural isoquinoline alkaloid that affects various biological functions, such as cell proliferation, migration and survival. The activation of AMP-activated protein kinase (AMPK) regulates tumor cell migration. However, the specific role of AMPK on the metastatic potential of cancer cells remains largely unknown. The present study investigated whether berberine induces AMPK activation and whether this induction directly affects mouse melanoma cell migration, adhesion and invasion. Berberine strongly increased AMPK phosphorylation via reactive oxygen species (ROS) production. 5-Aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR), a well-known AMPK activator, also inhibited tumor cell adhesion and invasion and reduced the expression of epithelial to mesenchymal transition (EMT)-related genes. Knockdown of AMPKα subunits using siRNAs significantly abated the berberine-induced inhibition of tumor cell invasion. Furthermore, berberine inhibited the metastatic potential of melanoma cells through a decrease in ERK activity and protein levels of cyclooxygenase-2 (COX-2) by a berberine-induced AMPK activation. These data were confirmed using specific MEK inhibitor, PD98059, and a COX-2 inhibitor, celecoxib. Berberine- and AICAR-treated groups demonstrated significantly decreased lung metastases in the pulmonary metastasis model in vivo. Treatment with berberine also decreased the metastatic potential of A375 human melanoma cells. Collectively, our results suggest that berberine-induced AMPK activation inhibits the metastatic potential of tumor cells through a reduction in the activity of the ERK signaling pathway and COX-2 protein levels. Copyright © 2011 Elsevier Inc. All rights reserved.
Matsunaga, Ryo; Abe, Ryota; Ishii, Daisuke; Watanabe, Shun-Ichi; Kiyoshi, Masato; Nöcker, Bernd; Tsuchiya, Masaru; Tsumoto, Kouhei
2013-09-01
Since their first finding in wool 50years ago, keratin-associated proteins (KAPs), which are classified into three groups; high sulfur (HS) KAPs, ultra high sulfur (UHS) KAPs, and high glycine-tyrosine (HGT) KAPs, have been the target of curiosity for scientists due to their characteristic amino acid sequences. While HS and UHS KAPs are known to function in disulfide bond crosslinking, the function of HGT KAPs remains unknown. To clarify the function as well as the binding partners of HGT KAPs, we prepared KAP8.1 and other KAP family proteins, the trichocyte intermediate filament proteins (IFP) K85 and K35, the head domain of K85, and the C subdomain of desmoplakin C-terminus (DPCT-C) and investigated the interactions between them in vitro. Western blot analysis and isothermal titration calorimetry (ITC) indicate that KAP8.1 binds to the head domain of K85, which is helically aligned around the axis of the intermediate filament (IF). From these results and transmission electron microscopy (TEM) observations of bundled filament complex in vitro, we propose that the helical arrangement of IFs found in the orthocortex, which is uniquely distributed on the convex fiber side of the hair, is regulated by KAP8.1. Structure-dependent binding of DPCT-C to trichocyte IFP was confirmed by Western blotting, ITC, and circular dichroism. Moreover, DPCT-C also binds to some HGT KAPs. It is probable that such bidirectional binding property of HGT KAPs contribute to the mechanical robustness of hair. Copyright © 2013 Elsevier Inc. All rights reserved.
Parkin protein expression and its impact on survival of patients with advanced colorectal cancer.
da Silva-Camargo, Claudia Caroline Veloso; Svoboda Baldin, Rosimeri Kuhl; Costacurta Polli, Nayanne Louise; Agostinho, Amanda Pereira; Olandosk, Marcia; de Noronha, Lúcia; Sotomaior, Vanessa Santos
2018-02-01
Features of colorectal cancer such as natural history, molecular, chromosomal, and epigenetic alterations have been well described. However, there is still a lack of accurate prognostic markers, which is evident by the lower overall survival rates of patients with advanced cancer. Although alterations in parkin protein expression have been described in colorectal cancer, the functional significance of this protein remains unknown. The present study aimed to investigate the involvement of parkin expression in colorectal adenocarcinoma development and progression by evaluating the association between its expression, clinicopathological parameters, and expression of known proteins involved in colorectal cancer. Tissue microarrays consisting of 73 tumor and 64 normal tissue samples were generated to examine parkin expression and localization by immunohistochemistry. A positive correlation of parkin and APC expression was observed in the superficial, intermediate, and profound regions of all cases (ρ = 0.37; P = 0.001). Parkin expression was also significantly associated with tumors in men ( P = 0.049), those of the mucinous subtype ( P = 0.028), and of advanced stage (III + IV, P = 0.041). In addition, increased parkin expression was observed in the invasive front tumor region ( P = 0.013). More importantly, a positive correlation was found between parkin expression and the overall survival of patients with advanced colorectal cancer ( P = 0.019). Multivariate analysis showed that parkin expression was independent of any of the clinicopathological parameters evaluated in relation to patient survival. These results suggest that parkin expression status can be used as a potential independent prognostic marker of survival in advanced colorectal cancer.
A Global Survey of ATPase Activity in Plasmodium falciparum Asexual Blood Stages and Gametocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ortega, Corrie; Frando, Andrew; Webb-Robertson, Bobbie-Jo
Effective malaria control and elimination in hyperendemic areas of the world will require treatment of disease-causing Plasmodium falciparum (Pf) blood stage infection but also blocking parasite transmission from humans to mosquito to prevent disease spread. Numerous antimalarial drugs have become ineffective due to parasite drug resistance and many currently used therapies do not kill gametocytes, highly specialized sexual parasite stages with distinct physiology that are necessary for transmission from the human host to the mosquito vector. Further confounding next generation drug development against Pf is the lack of known biochemical activity for most parasite gene products as well as themore » unknown metabolic needs of non-replicating gametocyte. Here, we take a systematic activity-based proteomics approach to survey the large and druggable ATPase family that is associated with replicating blood stage asexual parasites and transmissible gametocytes. We experimentally confirm existing annotation and predict ATPase function for 38 uncharacterized proteins. ATPase activity broadly changes during the transition from asexual schizonts to gametocytes, indicating altered metabolism and regulatory roles of ATPases specific for each lifecycle stage. By mapping the activity of ATPases associated with gametocytogenesis, we assign biochemical activity to a large number of uncharacterized proteins and identify new candidate transmission blocking targets.« less
Xie, G.; Chain, P.S.G.; Lo, C.; Liu, K-L.; Gans, J.; Merritt, J.; Qi, F.
2010-01-01
SUMMARY Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~ 2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance. PMID:21040513
Xie, G; Chain, P S G; Lo, C-C; Liu, K-L; Gans, J; Merritt, J; Qi, F
2010-12-01
Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance. © 2010 John Wiley & Sons A/S.
Otake, Kaori; Omoto, Shinya; Yamamoto, Takuya; Okuyama, Harumi; Okada, Hidechika; Okada, Noriko; Kawai, Masahiro; Saksena, Nitin K; Fujii, Yoichi R
2004-01-23
Although the HIV-1 Nef protein (27 kDa) localizes primarily in cytoplasm, there is considerable evidence suggesting its occasional localization in the nucleus. Nef is known to play an important role in transcriptional events and viral replication, but the actual target of Nef in the nucleus remains to be identified. To examine the functional roles of Nef in the nucleus and its possible interactions with other unknown factors in the nucleus. High-density microarray analysis was used to screen directly the unique functions of Nef on host gene transcription. The nuclear localization of Nef and its effects on the expression of peroxisome proliferator-activated receptors (PPAR) was examined using PPAR promoter/reporter assay and immunoblotting. A long terminal repeat/reporter assay was used to investigated the effects of Nef and PPAR on viral transcription. Nef in the nucleus suppressed PPAR gamma expression and reduced fatty acid levels in human T and macrophage cell lines. Expression of Nef or PPAR suppressed viral replication; the effect of PPAR gamma or retinoid X receptor-alpha on viral replication were reduced by coexpression of Nef in MT(-)4 T cells. Nef may be involved in both viral replication and the wasting syndrome associated with AIDS.
Pannexin 1 regulates bidirectional hippocampal synaptic plasticity in adult mice.
Ardiles, Alvaro O; Flores-Muñoz, Carolina; Toro-Ayala, Gabriela; Cárdenas, Ana M; Palacios, Adrian G; Muñoz, Pablo; Fuenzalida, Marco; Sáez, Juan C; Martínez, Agustín D
2014-01-01
The threshold for bidirectional modification of synaptic plasticity is known to be controlled by several factors, including the balance between protein phosphorylation and dephosphorylation, postsynaptic free Ca(2+) concentration and NMDA receptor (NMDAR) composition of GluN2 subunits. Pannexin 1 (Panx1), a member of the integral membrane protein family, has been shown to form non-selective channels and to regulate the induction of synaptic plasticity as well as hippocampal-dependent learning. Although Panx1 channels have been suggested to play a role in excitatory long-term potentiation (LTP), it remains unknown whether these channels also modulate long-term depression (LTD) or the balance between both types of synaptic plasticity. To study how Panx1 contributes to excitatory synaptic efficacy, we examined the age-dependent effects of eliminating or blocking Panx1 channels on excitatory synaptic plasticity within the CA1 region of the mouse hippocampus. By using different protocols to induce bidirectional synaptic plasticity, Panx1 channel blockade or lack of Panx1 were found to enhance LTP, whereas both conditions precluded the induction of LTD in adults, but not in young animals. These findings suggest that Panx1 channels restrain the sliding threshold for the induction of synaptic plasticity and underlying brain mechanisms of learning and memory.
Pannexin 1 regulates bidirectional hippocampal synaptic plasticity in adult mice
Ardiles, Alvaro O.; Flores-Muñoz, Carolina; Toro-Ayala, Gabriela; Cárdenas, Ana M.; Palacios, Adrian G.; Muñoz, Pablo; Fuenzalida, Marco; Sáez, Juan C.; Martínez, Agustín D.
2014-01-01
The threshold for bidirectional modification of synaptic plasticity is known to be controlled by several factors, including the balance between protein phosphorylation and dephosphorylation, postsynaptic free Ca2+ concentration and NMDA receptor (NMDAR) composition of GluN2 subunits. Pannexin 1 (Panx1), a member of the integral membrane protein family, has been shown to form non-selective channels and to regulate the induction of synaptic plasticity as well as hippocampal-dependent learning. Although Panx1 channels have been suggested to play a role in excitatory long-term potentiation (LTP), it remains unknown whether these channels also modulate long-term depression (LTD) or the balance between both types of synaptic plasticity. To study how Panx1 contributes to excitatory synaptic efficacy, we examined the age-dependent effects of eliminating or blocking Panx1 channels on excitatory synaptic plasticity within the CA1 region of the mouse hippocampus. By using different protocols to induce bidirectional synaptic plasticity, Panx1 channel blockade or lack of Panx1 were found to enhance LTP, whereas both conditions precluded the induction of LTD in adults, but not in young animals. These findings suggest that Panx1 channels restrain the sliding threshold for the induction of synaptic plasticity and underlying brain mechanisms of learning and memory. PMID:25360084
DNA Damage and Pulmonary Hypertension
Ranchoux, Benoît; Meloche, Jolyane; Paulin, Roxane; Boucherat, Olivier; Provencher, Steeve; Bonnet, Sébastien
2016-01-01
Pulmonary hypertension (PH) is defined by a mean pulmonary arterial pressure over 25 mmHg at rest and is diagnosed by right heart catheterization. Among the different groups of PH, pulmonary arterial hypertension (PAH) is characterized by a progressive obstruction of distal pulmonary arteries, related to endothelial cell dysfunction and vascular cell proliferation, which leads to an increased pulmonary vascular resistance, right ventricular hypertrophy, and right heart failure. Although the primary trigger of PAH remains unknown, oxidative stress and inflammation have been shown to play a key role in the development and progression of vascular remodeling. These factors are known to increase DNA damage that might favor the emergence of the proliferative and apoptosis-resistant phenotype observed in PAH vascular cells. High levels of DNA damage were reported to occur in PAH lungs and remodeled arteries as well as in animal models of PH. Moreover, recent studies have demonstrated that impaired DNA-response mechanisms may lead to an increased mutagen sensitivity in PAH patients. Finally, PAH was linked with decreased breast cancer 1 protein (BRCA1) and DNA topoisomerase 2-binding protein 1 (TopBP1) expression, both involved in maintaining genome integrity. This review aims to provide an overview of recent evidence of DNA damage and DNA repair deficiency and their implication in PAH pathogenesis. PMID:27338373
Heat shock protein 27 regulates human prostate cancer cell motility and metastatic progression
Voll, Eric A; Ogden, Irene M; Pavese, Janet M; Huang, XiaoKe; Xu, Li; Jovanovic, Borko D; Bergan, Raymond C
2014-01-01
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27) is known to increase human PCa cell invasion and its overexpression is associated with metastatic disease. The role of HSP27 in driving PCa cell movement from the prostate to distant metastatic sites is unknown. Increased HSP27 expression increased metastasis as well as primary tumor mass. In vitro studies further examined the mechanism of HSP27-induced metastatic behavior. HSP27 did not affect cell detachment, adhesion, or migration, but did increase cell invasion. Cell invasion was dependent upon matrix metalloproteinase 2 (MMP-2), whose expression was increased by HSP27. In vivo, HSP27 induced commensurate changes in MMP-2 expression in tumors. These findings demonstrate that HSP27 drives metastatic spread of cancer cells from the prostate to distant sites, does so across a continuum of expression levels, and identifies HSP27-driven increases in MMP-2 expression as functionally relevant. These findings add to prior studies demonstrating that HSP27 increases PCa cell motility, growth and survival. Together, they demonstrate that HSP27 plays an important role in PCa progression. PMID:24798191
Carlson, Jonathan; Yan, Jiyu; Akinsiku, Olusimidele T.; Schaefer, Malinda; Sabbaj, Steffanie; Bet, Anne; Levy, David N.; Heath, Sonya; Tang, Jianming; Kaslow, Richard A.; Walker, Bruce D.; Ndung’u, Thumbi; Goulder, Philip J.; Heckerman, David; Hunter, Eric; Goepfert, Paul A.
2010-01-01
Retroviruses pack multiple genes into relatively small genomes by encoding several genes in the same genomic region with overlapping reading frames. Both sense and antisense HIV-1 transcripts contain open reading frames for known functional proteins as well as numerous alternative reading frames (ARFs). At least some ARFs have the potential to encode proteins of unknown function, and their antigenic properties can be considered as cryptic epitopes (CEs). To examine the extent of active immune response to virally encoded CEs, we analyzed human leukocyte antigen class I–associated polymorphisms in HIV-1 gag, pol, and nef genes from a large cohort of South Africans with chronic infection. In all, 391 CEs and 168 conventional epitopes were predicted, with the majority (307; 79%) of CEs derived from antisense transcripts. In further evaluation of CD8 T cell responses to a subset of the predicted CEs in patients with primary or chronic infection, both sense- and antisense-encoded CEs were immunogenic at both stages of infection. In addition, CEs often mutated during the first year of infection, which was consistent with immune selection for escape variants. These findings indicate that the HIV-1 genome might encode and deploy a large potential repertoire of unconventional epitopes to enhance vaccine-induced antiviral immunity. PMID:20065064
Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan
2017-10-03
Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.
Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan
2017-01-01
Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274
Mooney, Claire M.; Jimenez-Mateos, Eva M.; Engel, Tobias; Mooney, Catherine; Diviney, Mairead; Venø, Morten T.; Kjems, Jørgen; Farrell, Michael A.; O’Brien, Donncha F.; Delanty, Norman; Henshall, David C.
2017-01-01
The nonsense mediated decay (NMD) pathway is a critical surveillance mechanism for identifying aberrant mRNA transcripts. It is unknown, however, whether the NMD system is affected by seizures in vivo and whether changes confer beneficial or maladaptive responses that influence long-term outcomes such the network alterations that produce spontaneous recurrent seizures. Here we explored the responses of the NMD pathway to prolonged seizures (status epilepticus) and investigated the effects of NMD inhibition on epilepsy in mice. Status epilepticus led to increased protein levels of Up-frameshift suppressor 1 homolog (Upf1) within the mouse hippocampus. Upf1 protein levels were also higher in resected hippocampus from patients with intractable temporal lobe epilepsy. Immunoprecipitation of Upf1-bound RNA from the cytoplasmic and synaptosomal compartments followed by RNA sequencing identified unique populations of NMD-associated transcripts and altered levels after status epilepticus, including known substrates such as Arc as well as novel targets including Inhba and Npas4. Finally, long-term video-EEG recordings determined that pharmacologic interference in the NMD pathway after status epilepticus reduced the later occurrence of spontaneous seizures in mice. These findings suggest compartment-specific recruitment and differential loading of transcripts by NMD pathway components may contribute to the process of epileptogenesis. PMID:28128343
Significance of increased expression of decoy receptor 3 in chronic liver disease.
Kim, S; Kotoula, V; Hytiroglou, P; Zardavas, D; Zhang, L
2009-08-01
Considerable evidence has indicated that apoptosis plays an important role in hepatocyte death in chronic liver disease. However, the cellular and molecular mechanisms underlying liver regeneration in these diseases are largely unknown. Plausibly, certain molecules expressed to counteract apoptosis might provide survival advantage of certain liver cells. Therefore, we investigated a possible expression of decoy receptor 3 of the tumour necrosis factor receptor family in chronic liver diseases since decoy receptor 3 is known to inhibit apoptosis mediated by pro-apoptotic tumour necrosis factor family ligands including Fas ligand. A series of liver biopsies from patients with different stages of fibrosis were subjected to immunohistochemistry and in situ hybridization. Both decoy receptor 3 protein and mRNA were mainly expressed in biliary epithelial cells and infiltrating lymphocytes in the diseased livers. Most noticeably, intense decoy receptor 3 expression was observed in newly developing biliary ductules in regenerative nodules as well as dysplastic nodules of cirrhotic livers. In addition, decoy receptor 3 secretion in hepatocellular carcinoma cells in culture was via the activation of mitogen-activated protein kinases. Decoy receptor 3 was specifically expressed in chronic liver diseases and hepatocellular carcinoma cells, and decoy receptor 3 might facilitate the survival of liver cells by exerting its anti-apoptotic activity during the progression of liver cirrhosis and hepatocarcinogenesis.
Zou, Shenshan; Zhu, Yufu; Wang, Bin; Qian, Fengyuan; Zhang, Xiang; Wang, Lei; Fu, Chunling; Bao, Hanmo; Xie, Manyi; Gao, Shangfeng; Yu, Rutong; Shi, Hengliang
2017-09-01
Human glioma causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying glioma progression are still largely unknown. COP1 (constitutively photomorphogenic 1), an E3 ubiquitin ligase, is important in cell survival, development, cell growth, and cancer biology by regulating different substrates. As is well known, both tumor suppressor p53 and oncogenic protein c-JUN could be ubiquitinated and degraded by ubiquitin ligase COP1, which may be the reason that COP1 serves as an oncogene or a tumor suppressor in different cancer types. Up to now, the possible role of COP1 in human glioma is still unclear. In the present study, we found that the expression of COP1 was upregulated in human glioma tissues. The role of COP1 in glioma cell proliferation was investigated using COP1 loss- and gain-of-function. The results showed that downregulation of COP1 by short hairpin RNA (shRNA) inhibited glioma cell proliferation, while overexpression of COP1 significantly promoted it. Furthermore, we demonstrated that COP1 only interacted with and regulated p53, but not c-JUN. Taken together, these results indicate that COP1 may play a role in promoting glioma cell proliferation by interacting with and downregulating tumor suppressor p53 rather than oncogenic protein c-JUN.
Biederman, Michelle K; Nelson, Megan M; Asalone, Kathryn C; Pedersen, Alyssa L; Saldanha, Colin J; Bracht, John R
2018-05-21
Developmentally programmed genome rearrangements are rare in vertebrates, but have been reported in scattered lineages including the bandicoot, hagfish, lamprey, and zebra finch (Taeniopygia guttata) [1]. In the finch, a well-studied animal model for neuroendocrinology and vocal learning [2], one such programmed genome rearrangement involves a germline-restricted chromosome, or GRC, which is found in germlines of both sexes but eliminated from mature sperm [3, 4]. Transmitted only through the oocyte, it displays uniparental female-driven inheritance, and early in embryonic development is apparently eliminated from all somatic tissue in both sexes [3, 4]. The GRC comprises the longest finch chromosome at over 120 million base pairs [3], and previously the only known GRC-derived sequence was repetitive and non-coding [5]. Because the zebra finch genome project was sourced from male muscle (somatic) tissue [6], the remaining genomic sequence and protein-coding content of the GRC remain unknown. Here we report the first protein-coding gene from the GRC: a member of the α-soluble N-ethylmaleimide sensitive fusion protein (NSF) attachment protein (α-SNAP) family hitherto missing from zebra finch gene annotations. In addition to the GRC-encoded α-SNAP, we find an additional paralogous α-SNAP residing in the somatic genome (a somatolog)-making the zebra finch the first example in which α-SNAP is not a single-copy gene. We show divergent, sex-biased expression for the paralogs and also that positive selection is detectable across the bird α-SNAP lineage, including the GRC-encoded α-SNAP. This study presents the identification and evolutionary characterization of the first protein-coding GRC gene in any organism. Copyright © 2018 Elsevier Ltd. All rights reserved.
[Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less
Supra-domains: evolutionary units larger than single protein domains.
Vogel, Christine; Berzuini, Carlo; Bashton, Matthew; Gough, Julian; Teichmann, Sarah A
2004-02-20
Domains are the evolutionary units that comprise proteins, and most proteins are built from more than one domain. Domains can be shuffled by recombination to create proteins with new arrangements of domains. Using structural domain assignments, we examined the combinations of domains in the proteins of 131 completely sequenced organisms. We found two-domain and three-domain combinations that recur in different protein contexts with different partner domains. The domains within these combinations have a particular functional and spatial relationship. These units are larger than individual domains and we term them "supra-domains". Amongst the supra-domains, we identified some 1400 (1203 two-domain and 166 three-domain) combinations that are statistically significantly over-represented relative to the occurrence and versatility of the individual component domains. Over one-third of all structurally assigned multi-domain proteins contain these over-represented supra-domains. This means that investigation of the structural and functional relationships of the domains forming these popular combinations would be particularly useful for an understanding of multi-domain protein function and evolution as well as for genome annotation. These and other supra-domains were analysed for their versatility, duplication, their distribution across the three kingdoms of life and their functional classes. By examining the three-dimensional structures of several examples of supra-domains in different biological processes, we identify two basic types of spatial relationships between the component domains: the combined function of the two domains is such that either the geometry of the two domains is crucial and there is a tight constraint on the interface, or the precise orientation of the domains is less important and they are spatially separate. Frequently, the role of the supra-domain becomes clear only once the three-dimensional structure is known. Since this is the case for only a quarter of the supra-domains, we provide a list of the most important unknown supra-domains as potential targets for structural genomics projects.
Guo, Fengguang; Lei, Jiaxin; Sun, Yucheng; Chi, Yong Hun; Ge, Feng; Patil, Bhimanagouda S; Koiwa, Hisashi; Zeng, Rensen; Zhu-Salzman, Keyan
2012-01-01
The furanocoumarin compound bergapten is a plant secondary metabolite that has anti-insect function. When incorporated into artificial diet, it retarded cowpea bruchid development, decreased fecundity, and caused mortality at a sufficient dose. cDNA microarray analysis indicated that cowpea bruchid altered expression of 543 midgut genes in response to dietary bergapten. Among these bergapten-regulated genes, 225 have known functions; for instance, those encoding proteins related to nutrient transport and metabolism, development, detoxification, defense and various cellular functions. Such differential gene regulation presumably facilitates the bruchids' countering the negative effect of dietary bergapten. Many genes did not have homology (E-value cutoff 10(-6)) with known genes in a BlastX search (206), or had homology only with genes of unknown function (112). Interestingly, when compared with the transcriptomic profile of cowpea bruchids treated with dietary soybean cysteine protease inhibitor N (scN), 195 out of 200 coregulated midgut genes are oppositely regulated by the two compounds. Simultaneous administration of bergapten and scN attenuated magnitude of change in selected oppositely-regulated genes, as well as led to synergistic delay in insect development. Therefore, targeting insect vulnerable sites that may compromise each other's counter-defensive response has the potential to increase the efficacy of the anti-insect molecules.
New steroid 5alpha-reductase type I (SRD5A1) homologous sequences on human chromosomes 6 and 8.
Eminović, I; Liović, M; Prezelj, J; Kocijancic, A; Rozman, D; Komel, R
2001-01-01
To date, two genes encoding 5alpha-reductase isoenzymes are known (type I, type II), and one type I pseudogene. The divergent localization of these genes and the still not fully understood function of the encoded enzymes as well as the perplexing results we obtained after sequencing PCR-amplified SRD5A1 gene fragments (out of genomic DNA), made us assume that, in addition to the known SRD5A1 gene, one or more different human 5alpha-reductase type I coding genes may exist. Our research provide the first evidence for the existence of two new SRD5A1 related, previously unidentified sequences in the human genome. These sequences which were localized to chromosomes 6 and 8 are highly homologous (> 99%) to SRD5A1, and also do not contain any deletions or insertions that are otherwise a characteristic of the SRD5API pseudogene. Our results imply that these sequences may be either coding parts of yet unknown, active SRD5A1 genes, and/or of previously unidentified pseudogenes. These findings additionally support data of Chen et al. who confirmed the existence of various SRD5A1 proteins in cultured human skin cells.
Crystallization of the C-terminal head domain of the avian adenovirus CELO long fibre
Guardado Calvo, Pablo; Llamas-Saiz, Antonio L.; Langlois, Patrick; van Raaij, Mark J.
2006-01-01
Avian adenovirus CELO contains two different fibres: fibre 1, the long fibre, and fibre 2, the short fibre. The short fibre is responsible for binding to an unknown avian receptor and is essential for infection of birds. The long fibre is not essential, but is known to bind the coxsackievirus and adenovirus receptor protein. Both trimeric fibres are attached to the same penton base, of which each icosahedral virus contains 12 copies. The short fibre extends straight outwards, while the long fibre emerges at an angle. The carboxy-terminal amino acids 579–793 of the avian adenovirus long fibre have been expressed with an amino-terminal hexahistidine tag and the expressed trimeric protein has been purified by nickel-affinity chromatography and crystallized. Crystals were grown at low pH using PEG 10 000 as precipitant and belonged to space group C2. The crystals diffracted rotating-anode Cu Kα radiation to at least 1.9 Å resolution and a complete data set was collected from a single crystal to 2.2 Å resolution. Unit-cell parameters were a = 216.5, b = 59.2, c = 57.5 Å, β = 101.3°, suggesting one trimer per asymmetric unit and a solvent content of 46%. The long fibre head does not have significant sequence homology to any other protein of known structure and molecular-replacement attempts with known fibre-head structures were unsuccessful. However, a map calculated using SIRAS phasing shows a clear trimer with a shape similar to known adenovirus fibre-head structures. Structure solution is in progress. PMID:16682773
Dewhurst, Henry M; Choudhury, Shilpa; Torres, Matthew P
2015-08-01
Predicting the biological function potential of post-translational modifications (PTMs) is becoming increasingly important in light of the exponential increase in available PTM data from high-throughput proteomics. We developed structural analysis of PTM hotspots (SAPH-ire)--a quantitative PTM ranking method that integrates experimental PTM observations, sequence conservation, protein structure, and interaction data to allow rank order comparisons within or between protein families. Here, we applied SAPH-ire to the study of PTMs in diverse G protein families, a conserved and ubiquitous class of proteins essential for maintenance of intracellular structure (tubulins) and signal transduction (large and small Ras-like G proteins). A total of 1728 experimentally verified PTMs from eight unique G protein families were clustered into 451 unique hotspots, 51 of which have a known and cited biological function or response. Using customized software, the hotspots were analyzed in the context of 598 unique protein structures. By comparing distributions of hotspots with known versus unknown function, we show that SAPH-ire analysis is predictive for PTM biological function. Notably, SAPH-ire revealed high-ranking hotspots for which a functional impact has not yet been determined, including phosphorylation hotspots in the N-terminal tails of G protein gamma subunits--conserved protein structures never before reported as regulators of G protein coupled receptor signaling. To validate this prediction we used the yeast model system for G protein coupled receptor signaling, revealing that gamma subunit-N-terminal tail phosphorylation is activated in response to G protein coupled receptor stimulation and regulates protein stability in vivo. These results demonstrate the utility of integrating protein structural and sequence features into PTM prioritization schemes that can improve the analysis and functional power of modification-specific proteomics data. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhang, Yeting; Fernandez-Aparicio, Monica; Wafula, Eric K; Das, Malay; Jiao, Yuannian; Wickett, Norman J; Honaas, Loren A; Ralph, Paula E; Wojciechowski, Martin F; Timko, Michael P; Yoder, John I; Westwood, James H; Depamphilis, Claude W
2013-02-20
Parasitic plants, represented by several thousand species of angiosperms, use modified structures known as haustoria to tap into photosynthetic host plants and extract nutrients and water. As a result of their direct plant-plant connections with their host plant, parasitic plants have special opportunities for horizontal gene transfer, the nonsexual transmission of genetic material across species boundaries. There is increasing evidence that parasitic plants have served as recipients and donors of horizontal gene transfer (HGT), but the long-term impacts of eukaryotic HGT in parasitic plants are largely unknown. Here we show that a gene encoding albumin 1 KNOTTIN-like protein, closely related to the albumin 1 genes only known from papilionoid legumes, where they serve dual roles as food storage and insect toxin, was found in Phelipanche aegyptiaca and related parasitic species of family Orobanchaceae, and was likely acquired by a Phelipanche ancestor via HGT from a legume host based on phylogenetic analyses. The KNOTTINs are well known for their unique "disulfide through disulfide knot" structure and have been extensively studied in various contexts, including drug design. Genomic sequences from nine related parasite species were obtained, and 3D protein structure simulation tests and evolutionary constraint analyses were performed. The parasite gene we identified here retains the intron structure, six highly conserved cysteine residues necessary to form a KNOTTIN protein, and displays levels of purifying selection like those seen in legumes. The albumin 1 xenogene has evolved through >150 speciation events over ca. 16 million years, forming a small family of differentially expressed genes that may confer novel functions in the parasites. Moreover, further data show that a distantly related parasitic plant, Cuscuta, obtained two copies of albumin 1 KNOTTIN-like genes from legumes through a separate HGT event, suggesting that legume KNOTTIN structures have been repeatedly co-opted by parasitic plants. The HGT-derived albumins in Phelipanche represent a novel example of how plants can acquire genes from other plants via HGT that then go on to duplicate, evolve, and retain the specialized features required to perform a unique host-derived function.
The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.
Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela
2017-09-06
In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.
Precursor-product discrimination by La protein during tRNA metabolism
Bayfield, Mark A.; Maraia, Richard J.
2009-01-01
SUMMARY La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. While the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA-binding β-sheet surface of RRM1 is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 β surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding while processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA but not UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair a RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA. PMID:19287396
Naboulsi, Wael; Bracht, Thilo; Megger, Dominik A; Reis, Henning; Ahrens, Maike; Turewicz, Michael; Eisenacher, Martin; Tautges, Stephanie; Canbay, Ali E; Meyer, Helmut E; Weber, Frank; Baba, Hideo A; Sitek, Barbara
2016-11-01
The majority of poorly differentiated hepatocellular carcinomas (HCCs) develop from well-differentiated tumors. Endocytosis is a cellular function which is likely to take part in this development due to its important role in regulating the abundances of vital signaling receptors. Here, we aimed to investigate the abundance of endocytosis-associated proteins in HCCs with various differentiation grades. Therefore, we analyzed 36 tissue specimens from HCC patients via LC-MS/MS-based label-free quantitative proteomics including 19 HCC tissue samples with different degrees of histological grades and corresponding non-tumorous tissue controls. As a result, 277 proteins were differentially regulated between well-differentiated tumors and controls. In moderately and poorly differentiated tumors, 278 and 1181 proteins, respectively, were significantly differentially regulated compared to non-tumorous tissue. We explored the regulated proteins based on their functions and identified thirty endocytosis-associated proteins, mostly overexpressed in poorly differentiated tumors. These included proteins that have been shown to be up-regulated in HCC like clathrin heavy chain-1 (CLTC) as well as unknown proteins, such as secretory carrier-associated membrane protein 3 (SCAMP3). The abundances of SCAMP3 and CLTC were immunohistochemically examined in tissue sections of 84 HCC patients. We demonstrate the novel association of several endocytosis-associated proteins, in particular, SCAMP3 with HCC progression. Copyright © 2016 Elsevier B.V. All rights reserved.
The Role of Pathogen-Secreted Proteins in Fungal Vascular Wilt Diseases
de Sain, Mara; Rep, Martijn
2015-01-01
A limited number of fungi can cause wilting disease in plants through colonization of the vascular system, the most well-known being Verticillium dahliae and Fusarium oxysporum. Like all pathogenic microorganisms, vascular wilt fungi secrete proteins during host colonization. Whole-genome sequencing and proteomics screens have identified many of these proteins, including small, usually cysteine-rich proteins, necrosis-inducing proteins and enzymes. Gene deletion experiments have provided evidence that some of these proteins are required for pathogenicity, while the role of other secreted proteins remains enigmatic. On the other hand, the plant immune system can recognize some secreted proteins or their actions, resulting in disease resistance. We give an overview of proteins currently known to be secreted by vascular wilt fungi and discuss their role in pathogenicity and plant immunity. PMID:26473835
Toll-6 and Toll-7 function as neurotrophin receptors in the Drosophila melanogaster CNS.
McIlroy, Graham; Foldi, Istvan; Aurikko, Jukka; Wentzell, Jill S; Lim, Mei Ann; Fenton, Janine C; Gay, Nicholas J; Hidalgo, Alicia
2013-09-01
Neurotrophin receptors corresponding to vertebrate Trk, p75(NTR) or Sortilin have not been identified in Drosophila, thus it is unknown how neurotrophism may be implemented in insects. Two Drosophila neurotrophins, DNT1 and DNT2, have nervous system functions, but their receptors are unknown. The Toll receptor superfamily has ancient evolutionary origins and a universal function in innate immunity. Here we show that Toll paralogs unrelated to the mammalian neurotrophin receptors function as neurotrophin receptors in fruit flies. Toll-6 and Toll-7 are expressed in the CNS throughout development and regulate locomotion, motor axon targeting and neuronal survival. DNT1 (also known as NT1 and spz2) and DNT2 (also known as NT2 and spz5) interact genetically with Toll-6 and Toll-7, and DNT1 and DNT2 bind to Toll-6 and Toll-7 promiscuously and are distributed in vivo in domains complementary to or overlapping with those of Toll-6 and Toll-7. We conclude that in fruit flies, Tolls are not only involved in development and immunity but also in neurotrophism, revealing an unforeseen relationship between the neurotrophin and Toll protein families.
González-Díaz, Humberto; Munteanu, Cristian R; Postelnicu, Lucian; Prado-Prado, Francisco; Gestal, Marcos; Pazos, Alejandro
2012-03-01
Lipid-Binding Proteins (LIBPs) or Fatty Acid-Binding Proteins (FABPs) play an important role in many diseases such as different types of cancer, kidney injury, atherosclerosis, diabetes, intestinal ischemia and parasitic infections. Thus, the computational methods that can predict LIBPs based on 3D structure parameters became a goal of major importance for drug-target discovery, vaccine design and biomarker selection. In addition, the Protein Data Bank (PDB) contains 3000+ protein 3D structures with unknown function. This list, as well as new experimental outcomes in proteomics research, is a very interesting source to discover relevant proteins, including LIBPs. However, to the best of our knowledge, there are no general models to predict new LIBPs based on 3D structures. We developed new Quantitative Structure-Activity Relationship (QSAR) models based on 3D electrostatic parameters of 1801 different proteins, including 801 LIBPs. We calculated these electrostatic parameters with the MARCH-INSIDE software and they correspond to the entire protein or to specific protein regions named core, inner, middle, and surface. We used these parameters as inputs to develop a simple Linear Discriminant Analysis (LDA) classifier to discriminate 3D structure of LIBPs from other proteins. We implemented this predictor in the web server named LIBP-Pred, freely available at , along with other important web servers of the Bio-AIMS portal. The users can carry out an automatic retrieval of protein structures from PDB or upload their custom protein structural models from their disk created with LOMETS server. We demonstrated the PDB mining option performing a predictive study of 2000+ proteins with unknown function. Interesting results regarding the discovery of new Cancer Biomarkers in humans or drug targets in parasites have been discussed here in this sense.
Tovar, Armando; Manzano, Natalia; Torres, Nimbe
2005-01-01
Hyperlipidemia occurs during nephrotic syndrome (NS). It is known that cholesterol and fatty acid biosynthesis is controlled by the transcription factors sterol regulatory element binding proteins (SREBPs). Soy protein consumption reduces the concentration of these lipids, although its mechanism of action is not well known. The aim of the present study was to establish whether soy protein consumption reduces cholesterol and triglycerides levels by regulating of SREBPs. Male Wistar rats with experimental NS were studied for 64 days. The results showed that rats fed with soy protein had significantly lower plasma cholesterol and triglyceride concentrations as well as proteinuria than rats fed with casein diet. These decrements were associated with a decrease in the expression of SREBP-1 and fatty acid biosynthetic enzymes. In addition, Western blot analysis revealed that in nuclear extracts from hepatocytes of rats fed with soy protein, there was a lower concentration of SREBP-1 than in rats fed with casein. The results of this study indicate that consumption of a soy protein diet has beneficial effects on nephrotic syndrome.
Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.
Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R
2001-08-10
The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.
Hoover, G J; el-Mowafi, A; Simko, E; Kocal, T E; Ferguson, H W; Hayes, M A
1998-07-01
In an attempt to find plasma proteins that might be involved in the constitutive resistance of rainbow trout to furunculosis, a disease caused by Aeromonas salmonicida (AS), we purified serum and plasma proteins based on their calcium- and carbohydrate-dependent affinity for A. salmonicida lipopolysaccharide (LPS) coupled to an epoxy-activated synthetic matrix (Toyopearl AF Epoxy 650M). A multimeric family of high molecular weight (96 to 200-kDa) LPS-binding proteins exhibiting both calcium and mannose dependent binding was isolated. Upon reduction the multimers collapsed to subunits of approximately 16-kDa as estimated by 1D-PAGE and exhibited pI values of 5.30 and 5.75 as estimated from 2D-PAGE. Their N-terminal sequences were related to rainbow trout ladderlectin (RT-LL), a Sepharose-binding protein. Polyclonal antibodies to the LPS-purified 16-kDa subunits recognized both the reduced 16-kDa subunits and the non-reduced multimeric forms. A calcium- and N-acetylglucosamine (GlcNAc)-dependent LPS-binding multimeric protein (approximately 207-kDa) composed of 34.5-kDa subunits was purified and found to be identical to trout serum amyloid P (SAP) by N-terminal sequence (DLQDLSGKVFV). A protein of 24-kDa, in reduced and non-reduced conditions, was isolated and had N-terminal sequence identity with a known C-reactive protein (CRP) homologue, C-polysaccharide-binding protein 2 (TCBP2) of rainbow trout. A novel calcium-dependent LPS-binding protein was purified and termed rainbow trout lectin 37 (RT-L37). This protein, composed of dimers, tetramers and pentamers of 37 kDa subunits (pI 5.50-6.10) with N-terminal sequence (IQE(D/N)GHAEAPGATTVLNEILR) showed no close homology to proteins known or predicted from cDNA sequences. These findings demonstrate that rainbow trout have several blood proteins with lectin properties for the LPS of A. salmonicida; the biological functions of these proteins in resistance to furunculosis are still unknown.
Production and Purification of Recombinant SUMOylated Proteins Using Engineered Bacteria.
Brockly, Frédérique; Piechaczyk, Marc; Bossis, Guillaume
2016-01-01
SUMO is a ubiquitin-like protein that is covalently conjugated to numerous cellular proteins to modify their function and fate. Although large progresses have been made in the identification of SUMOylated proteins, the molecular consequences of their SUMOylation are generally unknown. This is, most often, due to the low abundance of SUMOylated proteins in the cell, usually less than 1 % of a given protein being modified at steady state. To gain insights into the role of specific SUMOylation targets, SUMO conjugation can be reconstituted in vitro using purified proteins. However, for most substrates, the efficiency of in vitro SUMOylation is too low to obtain sufficient amounts of their SUMOylated forms for biochemical studies. Here, we describe a detailed protocol to purify large amounts of recombinant SUMOylated proteins using bacteria modified to express His-tagged SUMO as well as the SUMO-activating and -conjugating enzymes.
ERIC Educational Resources Information Center
Jirásek, Ivo; Turcova, Ivana
2017-01-01
While key personalities often connected with the roots of outdoor education and experiential learning, like Dewey, Seton, Hahn or Naess, are well known internationally, Jaroslav Foglar, a Czech outdoor and experiential educator, is mostly unknown to the international audience. The article adds to the literature related to Czech outdoor experience…
Hospital usage of marketing research over a ten year period.
Sanchez, P M
1995-01-01
The acceptance and use of marketing techniques and concepts in the health care area is a phenomenon well known to most marketers. Prior to 1979, marketing in the health care field was relatively unknown. Since that time, however, the growth of health care marketing has not been accompanied by commensurate growth in marketing research efforts.
30 CFR 250.504 - Hydrogen sulfide.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 30 Mineral Resources 2 2014-07-01 2014-07-01 false Hydrogen sulfide. 250.504 Section 250.504... § 250.504 Hydrogen sulfide. When a well-completion operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
30 CFR 250.604 - Hydrogen sulfide.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 30 Mineral Resources 2 2012-07-01 2012-07-01 false Hydrogen sulfide. 250.604 Section 250.604... § 250.604 Hydrogen sulfide. When a well-workover operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
30 CFR 250.504 - Hydrogen sulfide.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 30 Mineral Resources 2 2012-07-01 2012-07-01 false Hydrogen sulfide. 250.504 Section 250.504... § 250.504 Hydrogen sulfide. When a well-completion operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
30 CFR 250.504 - Hydrogen sulfide.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 2 2013-07-01 2013-07-01 false Hydrogen sulfide. 250.504 Section 250.504... § 250.504 Hydrogen sulfide. When a well-completion operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
30 CFR 250.604 - Hydrogen sulfide.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 30 Mineral Resources 2 2014-07-01 2014-07-01 false Hydrogen sulfide. 250.604 Section 250.604... § 250.604 Hydrogen sulfide. When a well-workover operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
30 CFR 250.604 - Hydrogen sulfide.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 2 2013-07-01 2013-07-01 false Hydrogen sulfide. 250.604 Section 250.604... § 250.604 Hydrogen sulfide. When a well-workover operation is conducted in zones known to contain hydrogen sulfide (H2S) or in zones where the presence of H2S is unknown (as defined in § 250.490 of this...
A Brush with Research: Teaching Grounded Theory in the Art and Design Classroom
ERIC Educational Resources Information Center
Compton, Mike; Barrett, Sean
2016-01-01
Grounded Theory is a systematic approach to social research that allows for new concepts and theories to emerge from gathered data, as opposed to relying on either established theory or personal conjecture to interpret social processes. Although Grounded Theory is a well-known method within social science literature, it is relatively unknown in…
The Global Increase in the Socioeconomic Achievement Gap, 1964-2015. CEPA Working Paper No. 17-04
ERIC Educational Resources Information Center
Chmielewski, Anna K.
2017-01-01
The existence of a "socioeconomic achievement gap"--a disparity in academic achievement between students from high- and low-socioeconomic status (SES) backgrounds--is well-known in educational research. The SES achievement gap has been documented across a wide range of countries. What is unknown in most countries is whether the SES…
USDA-ARS?s Scientific Manuscript database
The tropical plant Pouteria sapota (Jacq.) is known for its edible fruits that contain unique carotenoids, as well as for the fungitoxic, anti-inflamatory and anti-oxidant activity of extracts from its bark, leaves and roots, though its genetics is unknown. We did high-throughput sequencing of micr...
ERIC Educational Resources Information Center
Yoo, Si Ha
2012-01-01
The purpose of this qualitative study is to understand an unknown educational approach in Korean Confucianism's ethical education characterized as moral internalization, based on the study participants. A prevailed understanding of moral internalization of Confucianism is a strong imposed learning process, which is a well known Asian learning…
Biogenesis of cytosolic ribosomes requires the essential iron–sulphur protein Rli1p and mitochondria
Kispal, Gyula; Sipos, Katalin; Lange, Heike; Fekete, Zsuzsanna; Bedekovics, Tibor; Janáky, Tamás; Bassler, Jochen; Aguilar Netz, Daili J; Balk, Janneke; Rotte, Carmen; Lill, Roland
2005-01-01
Mitochondria perform a central function in the biogenesis of cellular iron–sulphur (Fe/S) proteins. It is unknown to date why this biosynthetic pathway is indispensable for life, the more so as no essential mitochondrial Fe/S proteins are known. Here, we show that the soluble ATP-binding cassette (ABC) protein Rli1p carries N-terminal Fe/S clusters that require the mitochondrial and cytosolic Fe/S protein biogenesis machineries for assembly. Mutations in critical cysteine residues of Rli1p abolish association with Fe/S clusters and lead to loss of cell viability. Hence, the essential character of Fe/S clusters in Rli1p explains the indispensable character of mitochondria in eukaryotes. We further report that Rli1p is associated with ribosomes and with Hcr1p, a protein involved in rRNA processing and translation initiation. Depletion of Rli1p causes a nuclear export defect of the small and large ribosomal subunits and subsequently a translational arrest. Thus, ribosome biogenesis and function are intimately linked to the crucial role of mitochondria in the maturation of the essential Fe/S protein Rli1p. PMID:15660134
Food allergy animal models: an overview.
Helm, Ricki M
2002-05-01
Specific food allergy is characterized by sensitization to innocuous food proteins with production of allergen-specific IgE that binds to receptors on basophils and mast cells. Upon recurrent exposure to the same allergen, an allergic response is induced by mediator release following cross-linking of cell-bound allergen-specific IgE. The determination of what makes an innocuous food protein an allergen in predisposed individuals is unknown; however, mechanistic and protein allergen predictive models are being actively investigated in a number of animal models. Currently, there is no animal model that will actively profile known food allergens, predict the allergic potential of novel food proteins, or demonstrate clinically the human food allergic sensitization/allergic response. Animal models under investigation include mice, rats, the guinea pig, atopic dog, and neonatal swine. These models are being assessed for production of IgE, clinical responses to re-exposure, and a ranking of food allergens (based on potency) including a nonfood allergen protein source. A selection of animal models actively being investigated that will contribute to our understanding of what makes a protein an allergen and future predictive models for assessing the allergenicity of novel proteins is presented in this review.
Mitotic MELK-eIF4B signaling controls protein synthesis and tumor cell survival
Wang, Yubao; Begley, Michael; Li, Qing; Huang, Hai-Tsang; Lako, Ana; Eck, Michael J.; Gray, Nathanael S.; Mitchison, Timothy J.; Cantley, Lewis C.; Zhao, Jean J.
2016-01-01
The protein kinase maternal and embryonic leucine zipper kinase (MELK) is critical for mitotic progression of cancer cells; however, its mechanisms of action remain largely unknown. By combined approaches of immunoprecipitation/mass spectrometry and peptide library profiling, we identified the eukaryotic translation initiation factor 4B (eIF4B) as a MELK-interacting protein during mitosis and a bona fide substrate of MELK. MELK phosphorylates eIF4B at Ser406, a modification found to be most robust in the mitotic phase of the cell cycle. We further show that the MELK–eIF4B signaling axis regulates protein synthesis during mitosis. Specifically, synthesis of myeloid cell leukemia 1 (MCL1), an antiapoptotic protein known to play a role in cancer cell survival during cell division, depends on the function of MELK-elF4B. Inactivation of MELK or eIF4B results in reduced protein synthesis of MCL1, which, in turn, induces apoptotic cell death of cancer cells. Our study thus defines a MELK–eIF4B signaling axis that regulates protein synthesis during mitosis, and consequently influences cancer cell survival. PMID:27528663
Cooperation of TOM and TIM23 complexes during translocation of proteins into mitochondria.
Waegemann, Karin; Popov-Čeleketić, Dušan; Neupert, Walter; Azem, Abdussalam; Mokranjac, Dejana
2015-03-13
Translocation of the majority of mitochondrial proteins from the cytosol into mitochondria requires the cooperation of TOM and TIM23 complexes in the outer and inner mitochondrial membranes. The molecular mechanisms underlying this cooperation remain largely unknown. Here, we present biochemical and genetic evidence that at least two contacts from the side of the TIM23 complex play an important role in TOM-TIM23 cooperation in vivo. Tim50, likely through its very C-terminal segment, interacts with Tom22. This interaction is stimulated by translocating proteins and is independent of any other TOM-TIM23 contact known so far. Furthermore, the exposure of Tim23 on the mitochondrial surface depends not only on its interaction with Tim50 but also on the dynamics of the TOM complex. Destabilization of the individual contacts reduces the efficiency of import of proteins into mitochondria and destabilization of both contacts simultaneously is not tolerated by yeast cells. We conclude that an intricate and coordinated network of protein-protein interactions involving primarily Tim50 and also Tim23 is required for efficient translocation of proteins across both mitochondrial membranes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Marré, Meghan L.; Piganelli, Jon D.
2017-01-01
Type 1 diabetes (T1D) is an autoimmune disease in which immune-mediated targeting and destruction of insulin-producing pancreatic islet β cells leads to chronic hyperglycemia. There are many β cell proteins that are targeted by autoreactive T cells in their native state. However, recent studies have demonstrated that many β cell proteins are recognized as neo-antigens following posttranslational modification (PTM). Although modified neo-antigens are well-established targets of pathology in other autoimmune diseases, the effects of neo-antigens in T1D progression and the mechanisms by which they are generated are not well understood. We have demonstrated that PTM occurs during endoplasmic reticulum (ER) stress, a process to which β cells are uniquely susceptible due to the high rate of insulin production in response to dynamic glucose sensing. In the context of genetic susceptibility to autoimmunity, presentation of these modified neo-antigens may activate autoreactive T cells and cause pathology. However, inherent β cell ER stress and protein PTM do not cause T1D in every genetically susceptible individual, suggesting the contribution of additional factors. Indeed, many environmental factors, such as viral infection, chemicals, or inflammatory cytokines, are associated with T1D onset, but the mechanisms by which these factors lead to disease onset remain unknown. Since these environmental factors also cause ER stress, exposure to these factors may enhance production of neo-antigens, therefore boosting β cell recognition by autoreactive T cells and exacerbating T1D pathogenesis. Therefore, the combined effects of physiological ER stress and the stress that is induced by environmental factors may lead to breaks in peripheral tolerance, contribute to antigen spread, and hasten disease onset. This Hypothesis and Theory article summarizes what is currently known about ER stress and protein PTM in autoimmune diseases including T1D and proposes a role for environmental factors in breaking immune tolerance to β cell antigens through neo-antigen formation. PMID:29033899
Xie, Zhongqiu; Jia, Yuemeng; Li, Hui
2017-01-01
The study of protein-protein interactions represents a key aspect of biological research. Identifying unknown protein binding partners using mass spectrometry (MS)-based proteomics has evolved into an indispensable strategy in drug discovery. The classic approach of immunoprecipitation with specific antibodies against the proteins of interest has limitations, such as the need for immunoprecipitation-qualified antibody. The biotin AP-tag pull-down system has the advantage of high specificity, ease of use, and no requirement for antibody. It is based on the high specificity, high affinity interaction between biotin and streptavidin. After pulldown, in-gel tryptic digestion and tandem mass spectrometry (MS/MS) analysis of sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) protein bands can be performed. In this work, we provide protocols that can be used for the identification of proteins that interact with FOXM1, a protein that has recently emerged as a potential biomarker and drug target in oncotherapy, as an example. We focus on the pull-down procedure and assess the efficacy of the pulldown with known FOXM1 interactors such as β-catenin. We use a high performance LTQ Orbitrap MSn system that combines rapid LTQ ion trap data acquisition with high mass accuracy Orbitrap analysis to identify the interacting proteins.
A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.
Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng
2018-08-01
Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.
Theoretical Study of the Initial Stages of Self-Assembly of a Carboxysome’s Facet
Mahalik, J. P.; Brown, Kirsten A.; Cheng, Xiaolin; ...
2016-02-24
Bacterial microcompartments, BMCs, are organelles that exist within wide variety of bacteria and act as nanofactories. Among the different types of known BMCs, the carboxysome has been studied the most. The carboxysome plays an important role in the light-independent part of the photosynthesis process, where its icosahedral-like proteinaceous shell acts as a membrane that controls the transport of metabolites. Although a structural model exists for the carboxysome shell, it remains largely unknown how the shell proteins self-assemble. Understanding the self-assembly process can provide insights into how the shell affects the carboxysome s function and how it can be modified tomore » create new functionalities, such as artificial nanoreactors and artificial protein membranes. Here, we explain a theoretical framework that employs Monte Carlo simulations with a coarse-grain potential that reproduces well the atomistic potential of mean force; employing this framework, we are able to capture the initial stages of the 2D self-assembly of CcmK2 hexamers, a major protein-shell component of the carboxysome's facet. The simulations reveal that CcmK2 hexamers self-assemble into clusters that resemble what was seen experimentally in 2D layers. Further analysis of the simulation results suggests that the 2D self-assembly of carboxysome s facets is driven by a nucleation growth process, which in turn could play an important role in the hierarchical self- assembly of BMC shells in general.« less
Zhao, Hong; Jin, Guangxu; Cui, Kemi; Ren, Ding; Liu, Timothy; Chen, Peikai; Wong, Solomon; Li, Fuhai; Fan, Yubo; Rodriguez, Angel; Chang, Jenny; Wong, Stephen T C
2013-10-15
A new type of signaling network element, called cancer signaling bridges (CSB), has been shown to have the potential for systematic and fast-tracked drug repositioning. On the basis of CSBs, we developed a computational model to derive specific downstream signaling pathways that reveal previously unknown target-disease connections and new mechanisms for specific cancer subtypes. The model enables us to reposition drugs based on available patient gene expression data. We applied this model to repurpose known or shelved drugs for brain, lung, and bone metastases of breast cancer with the hypothesis that cancer subtypes have their own specific signaling mechanisms. To test the hypothesis, we addressed specific CSBs for each metastasis that satisfy (i) CSB proteins are activated by the maximal number of enriched signaling pathways specific to a given metastasis, and (ii) CSB proteins are involved in the most differential expressed coding genes specific to each breast cancer metastasis. The identified signaling networks for the three types of breast cancer metastases contain 31, 15, and 18 proteins and are used to reposition 15, 9, and 2 drug candidates for the brain, lung, and bone metastases. We conducted both in vitro and in vivo preclinical experiments as well as analysis on patient tumor specimens to evaluate the targets and repositioned drugs. Of special note, we found that the Food and Drug Administration-approved drugs, sunitinib and dasatinib, prohibit brain metastases derived from breast cancer, addressing one particularly challenging aspect of this disease. ©2013 AACR.
Pimentel, Paula; Salvatierra, Ariel; Moya-León, María Alejandra; Herrera, Raúl
2010-09-15
Fragaria chiloensis, the native Chilean strawberry, is noted for its good fruit quality characters. However, it is a highly perishable fruit due to its rapid softening. With the aim to screen for genes differentially expressed during development and ripening of strawberry fruit, the subtractive suppressive hybridization (SSH) methodology was employed. Six libraries were generated contrasting transcripts from four different developmental stages. A set of 1807 genes was isolated and characterized. In our EST collection, approximately 90% of partial cDNAs showed significant similarity to proteins with known or unknown function registered in databases. Among them, proteins related to protein fate were identified in a large green fruit library and protein related with cellular transport, cell wall-related proteins, and transcription regulators were identified in a ripe fruit library. Thirteen genes were analyzed by qRT-PCR during development and ripening of the Chilean strawberry fruit. The information generated in this study provides new clues to aid the understanding of the ripening process in F. chiloensis fruit. Copyright 2010 Elsevier GmbH. All rights reserved.
Levetiracetam Reverses Synaptic Deficits Produced by Overexpression of SV2A
Yao, Jia; Bleckert, Adam; Hill, Jessica; Bajjalieh, Sandra M.
2011-01-01
Levetiracetam is an FDA-approved drug used to treat epilepsy and other disorders of the nervous system. Although it is known that levetiracetam binds the synaptic vesicle protein SV2A, how drug binding affects synaptic functioning remains unknown. Here we report that levetiracetam reverses the effects of excess SV2A in autaptic hippocampal neurons. Expression of an SV2A-EGFP fusion protein produced a ∼1.5-fold increase in synaptic levels of SV2, and resulted in reduced synaptic release probability. The overexpression phenotype parallels that seen in neurons from SV2 knockout mice, which experience severe seizures. Overexpression of SV2A also increased synaptic levels of the calcium-sensor protein synaptotagmin, an SV2-binding protein whose stability and trafficking are regulated by SV2. Treatment with levetiracetam rescued normal neurotransmission and restored normal levels of SV2 and synaptotagmin at the synapse. These results indicate that changes in SV2 expression in either direction impact neurotransmission, and suggest that levetiracetam may modulate SV2 protein interactions. PMID:22220214
Quantitation of heat-shock proteins in clinical samples using mass spectrometry.
Kaur, Punit; Asea, Alexzander
2011-01-01
Mass spectrometry (MS) is a powerful analytical tool for proteomics research and drug and biomarker discovery. MS enables identification and quantification of known and unknown compounds by revealing their structural and chemical properties. Proper sample preparation for MS-based analysis is a critical step in the proteomics workflow because the quality and reproducibility of sample extraction and preparation for downstream analysis significantly impact the separation and identification capabilities of mass spectrometers. The highly expressed proteins represent potential biomarkers that could aid in diagnosis, therapy, or drug development. Because the proteome is so complex, there is no one standard method for preparing protein samples for MS analysis. Protocols differ depending on the type of sample, source, experiment, and method of analysis. Molecular chaperones play significant roles in almost all biological functions due to their capacity for detecting intracellular denatured/unfolded proteins, initiating refolding or denaturation of such malfolded protein sequences and more recently for their role in the extracellular milieu as chaperokines. In this chapter, we describe the latest techniques for quantitating the expression of molecular chaperones in human clinical samples.
Recognition of functional sites in protein structures.
Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J
2004-06-04
Recognition of regions on the surface of one protein, that are similar to a binding site of another is crucial for the prediction of molecular interactions and for functional classifications. We first describe a novel method, SiteEngine, that assumes no sequence or fold similarities and is able to recognize proteins that have similar binding sites and may perform similar functions. We achieve high efficiency and speed by introducing a low-resolution surface representation via chemically important surface points, by hashing triangles of physico-chemical properties and by application of hierarchical scoring schemes for a thorough exploration of global and local similarities. We proceed to rigorously apply this method to functional site recognition in three possible ways: first, we search a given functional site on a large set of complete protein structures. Second, a potential functional site on a protein of interest is compared with known binding sites, to recognize similar features. Third, a complete protein structure is searched for the presence of an a priori unknown functional site, similar to known sites. Our method is robust and efficient enough to allow computationally demanding applications such as the first and the third. From the biological standpoint, the first application may identify secondary binding sites of drugs that may lead to side-effects. The third application finds new potential sites on the protein that may provide targets for drug design. Each of the three applications may aid in assigning a function and in classification of binding patterns. We highlight the advantages and disadvantages of each type of search, provide examples of large-scale searches of the entire Protein Data Base and make functional predictions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saelices, Lorena; Johnson, Lisa M.; Liang, Wilson Y.
The tetrameric thyroxine transport protein transthyretin (TTR) forms amyloid fibrils upon dissociation and monomer unfolding. The aggregation of transthyretin has been reported as the cause of the life-threatening transthyretin amyloidosis. The standard treatment of familial cases of TTR amyloidosis has been liver transplantation. Although aggregation-preventing strategies involving ligands are known, understanding the mechanism of TTR aggregation can lead to additional inhibition approaches. Several models of TTR amyloid fibrils have been proposed, but the segments that drive aggregation of the protein have remained unknown. Here we identify β-strands F and H as necessary for TTR aggregation. Based on the crystal structuresmore » of these segments, we designed two non-natural peptide inhibitors that block aggregation. Lastly, this work provides the first characterization of peptide inhibitors for TTR aggregation, establishing a novel therapeutic strategy.« less
Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng
2017-08-15
The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.
P41IDENTIFICATION OF GLIOMA SPECIFIC APTAMER TARGETS
Arora, Mohit; Alder, Jane; Lawrence, Clare; Davis, Charles; Dawson, Tim; Hall, Greg; Shaw, Lisa
2014-01-01
INTRODUCTION: Aptamers are in vitro generated DNA and RNA sequences which are randomly created as a library, with multiple permutations and combinations. These are then exposed to the target structure against which we want an aptamer ‘selected’ using Sequential Enumeration of Ligands by Exponential enrichment (SELEX). METHOD: Commercially available glioma and glial cell lines and in-house generated primary glioma cultures were used. Modified aptamers based on published sequences against glioma cell lines and newly generated sequences were used in the project to identify their binding targets. Cy3 or biotin- conjugated aptamers were incubated with live glioma cell cultures and imaged using confocal or light microscopy.To determine the target ligand, aptamers were then reacted with glial cell lysate and subjected to precipitation using streptavidin agarose beads and SDS polyacrylamide electrophoresis. Proteins were analysed by mass spectroscopy. RESULTS: Known and unknown aptamer protein ligands were co-precipitated. Ku70, Ku80 were precipitated along with nucleolin and related proteins. CONCLUSION: The aptamer has shown preferential binding to glioma cells and could act as a delivery system for therapeutic payloads. The aptamer targets Ku70 and Ku80, which are known to be over expressed in other forms of cancer but their role in gliomagenesis has not been fully elucidated. Other novel proteins have also been identified. Thus the aptamer co-precipitation technique has identified potential glioma biomarkers that may be of clinical significance.
Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay
Huang, Tao; Long, Mian; Huo, Bo
2010-01-01
Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379
Loiseau, Laurent; Fyfe, Cameron; Aussel, Laurent; Hajj Chehade, Mahmoud; Hernández, Sara B; Faivre, Bruno; Hamdane, Djemel; Mellot-Draznieks, Caroline; Rascalou, Bérengère; Pelosi, Ludovic; Velours, Christophe; Cornu, David; Lombard, Murielle; Casadesús, Josep; Pierrel, Fabien; Fontecave, Marc; Barras, Frédéric
2017-07-14
Ubiquinone (UQ), also referred to as coenzyme Q, is a widespread lipophilic molecule in both prokaryotes and eukaryotes in which it primarily acts as an electron carrier. Eleven proteins are known to participate in UQ biosynthesis in Escherichia coli , and we recently demonstrated that UQ biosynthesis requires additional, nonenzymatic factors, some of which are still unknown. Here, we report on the identification of a bacterial gene, yqiC , which is required for efficient UQ biosynthesis, and which we have renamed ubiK Using several methods, we demonstrated that the UbiK protein forms a complex with the C-terminal part of UbiJ, another UQ biogenesis factor we previously identified. We found that both proteins are likely to contribute to global UQ biosynthesis rather than to a specific biosynthetic step, because both ubiK and ubiJ mutants accumulated octaprenylphenol, an early intermediate of the UQ biosynthetic pathway. Interestingly, we found that both proteins are dispensable for UQ biosynthesis under anaerobiosis, even though they were expressed in the absence of oxygen. We also provide evidence that the UbiK-UbiJ complex interacts with palmitoleic acid, a major lipid in E. coli Last, in Salmonella enterica , ubiK was required for proliferation in macrophages and virulence in mice. We conclude that although the role of the UbiK-UbiJ complex remains unknown, our results support the hypothesis that UbiK is an accessory factor of Ubi enzymes and facilitates UQ biosynthesis by acting as an assembly factor, a targeting factor, or both. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Mowei; Yan, Jing; Romano, Christine A.
Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase Mnx from Bacillus sp. PL-12 has been successfully overexpressed in active form, unexpectedly, as a protein complex with a molecular weight of 211 kDa with no homology to known proteins in the database. We have recently used surface induced dissociation (SID) and ion mobility – mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data frommore » the native mass spectrometry experiment led to a plausible model of this unknown multicopper oxidase which has been difficult to study by conventional structural biology methods. However, because each subunit of Mnx binds copper ions as cofactor at varying ratios, there were remaining ambiguities in assigning some of the observed peaks to metal-binding species because of the sample heterogeneity and limited mass resolution. In this study, we performed SID in a modified Fourier transform – ion cyclotron resonance (FT-ICR) mass spectrometer for obtaining the ultimate resolution on the released subcomplexes of Mnx. The high mass accuracy and resolution unveiled unexpected artificial modifications in the protein that have been previously thought to be iron bound species based on lower resolution data. Additionally, most released subcomplexes were isotopically resolved for defining metal binding stoichiometry at each structural level. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes.« less
Moodley, Yoshan; Uhr, Markus; Stamer, Christiana; Vauterin, Marc; Suerbaum, Sebastian; Achtman, Mark
2010-01-01
The Helicobacter pylori cag pathogenicity island (cagPAI) encodes a type IV secretion system. Humans infected with cagPAI–carrying H. pylori are at increased risk for sequelae such as gastric cancer. Housekeeping genes in H. pylori show considerable genetic diversity; but the diversity of virulence factors such as the cagPAI, which transports the bacterial oncogene CagA into host cells, has not been systematically investigated. Here we compared the complete cagPAI sequences for 38 representative isolates from all known H. pylori biogeographic populations. Their gene content and gene order were highly conserved. The phylogeny of most cagPAI genes was similar to that of housekeeping genes, indicating that the cagPAI was probably acquired only once by H. pylori, and its genetic diversity reflects the isolation by distance that has shaped this bacterial species since modern humans migrated out of Africa. Most isolates induced IL-8 release in gastric epithelial cells, indicating that the function of the Cag secretion system has been conserved despite some genetic rearrangements. More than one third of cagPAI genes, in particular those encoding cell-surface exposed proteins, showed signatures of diversifying (Darwinian) selection at more than 5% of codons. Several unknown gene products predicted to be under Darwinian selection are also likely to be secreted proteins (e.g. HP0522, HP0535). One of these, HP0535, is predicted to code for either a new secreted candidate effector protein or a protein which interacts with CagA because it contains two genetic lineages, similar to cagA. Our study provides a resource that can guide future research on the biological roles and host interactions of cagPAI proteins, including several whose function is still unknown. PMID:20808891
Olbermann, Patrick; Josenhans, Christine; Moodley, Yoshan; Uhr, Markus; Stamer, Christiana; Vauterin, Marc; Suerbaum, Sebastian; Achtman, Mark; Linz, Bodo
2010-08-19
The Helicobacter pylori cag pathogenicity island (cagPAI) encodes a type IV secretion system. Humans infected with cagPAI-carrying H. pylori are at increased risk for sequelae such as gastric cancer. Housekeeping genes in H. pylori show considerable genetic diversity; but the diversity of virulence factors such as the cagPAI, which transports the bacterial oncogene CagA into host cells, has not been systematically investigated. Here we compared the complete cagPAI sequences for 38 representative isolates from all known H. pylori biogeographic populations. Their gene content and gene order were highly conserved. The phylogeny of most cagPAI genes was similar to that of housekeeping genes, indicating that the cagPAI was probably acquired only once by H. pylori, and its genetic diversity reflects the isolation by distance that has shaped this bacterial species since modern humans migrated out of Africa. Most isolates induced IL-8 release in gastric epithelial cells, indicating that the function of the Cag secretion system has been conserved despite some genetic rearrangements. More than one third of cagPAI genes, in particular those encoding cell-surface exposed proteins, showed signatures of diversifying (Darwinian) selection at more than 5% of codons. Several unknown gene products predicted to be under Darwinian selection are also likely to be secreted proteins (e.g. HP0522, HP0535). One of these, HP0535, is predicted to code for either a new secreted candidate effector protein or a protein which interacts with CagA because it contains two genetic lineages, similar to cagA. Our study provides a resource that can guide future research on the biological roles and host interactions of cagPAI proteins, including several whose function is still unknown.
The small heat shock protein Hsp31 cooperates with Hsp104 to modulate Sup35 prion aggregation.
Aslam, Kiran; Tsai, Chai-Jui; Hazbun, Tony R
2016-11-01
The yeast homolog of DJ-1, Hsp31, is a multifunctional protein that is involved in several cellular pathways including detoxification of the toxic metabolite methylglyoxal and as a protein deglycase. Prior studies ascribed Hsp31 as a molecular chaperone that can inhibit α-Syn aggregation in vitro and alleviate its toxicity in vivo. It was also shown that Hsp31 inhibits Sup35 aggregate formation in yeast, however, it is unknown if Hsp31 can modulate [PSI + ] phenotype and Sup35 prionogenesis. Other small heat shock proteins, Hsp26 and Hsp42 are known to be a part of a synergistic proteostasis network that inhibits Sup35 prion formation and promotes its disaggregation. Here, we establish that Hsp31 inhibits Sup35 [PSI + ] prion formation in collaboration with a well-known disaggregase, Hsp104. Hsp31 transiently prevents prion induction but does not suppress induction upon prolonged expression of Sup35 indicating that Hsp31 can be overcome by larger aggregates. In addition, elevated levels of Hsp31 do not cure [PSI + ] strains indicating that Hsp31 cannot intervene in a pre-existing prion oligomerization cycle. However, Hsp31 can modulate prion status in cooperation with Hsp104 because it inhibits Sup35 aggregate formation and potentiates [PSI + ] prion curing upon overexpression of Hsp104. The absence of Hsp31 reduces [PSI + ] prion curing by Hsp104 without influencing its ability to rescue cellular thermotolerance. Hsp31 did not synergize with Hsp42 to modulate the [PSI + ] phenotype suggesting that both proteins act on similar stages of the prion cycle. We also showed that Hsp31 physically interacts with Hsp104 and together they prevent Sup35 prion toxicity to greater extent than if they were expressed individually. These results elucidate a mechanism for Hsp31 on prion modulation that suggest it acts at a distinct step early in the Sup35 aggregation process that is different from Hsp104. This is the first demonstration of the modulation of [PSI + ] status by the chaperone action of Hsp31. The delineation of Hsp31's role in the chaperone cycle has implications for understanding the role of the DJ-1 superfamily in controlling misfolded proteins in neurodegenerative disease and cancer.
Yu, Xiang; Warme, Christopher; Lee, Dinah; Zhang, Jing; Zhong, Wendy
2013-10-01
An integrated online-offline platform was developed combining automated online LC-MS fraction collection, continuous accumulation of selected ions (CASI), and offline top-down electron capture dissociation (ECD) tandem mass spectrometry experiments to identify a low-level, unknown isomeric degradant in a formulated drug product during an accelerated stability study. By identifying the diagnostic ions of the isoaspartic acid (isoAsp), the top-down ECD experiment showed that the Asp9 in exenatide was converted to isoAsp9 to form the unknown isomeric degradant. The platform described here provides an accurate, straightforward, and low limit of detection method for the analysis of Asp isomerization as well as other potential low-level degradants in therapeutic polypeptides and proteins. It is especially useful for unstable and time-sensitive degradants and impurities.
Leandro de Jesus, Teresa Cristina; Calderano, Simone Guedes; Vitorino, Francisca Nathalia de Luna; Llanos, Ricardo Pariona; Lopes, Mariana de Camargo; de Araújo, Christiane Bezerra; Thiemann, Otavio Henrique; Reis, Marcelo da Silva; Elias, Maria Carolina; Chagas da Cunha, Julia Pinheiro
2017-01-01
Chromatin associated proteins are key regulators of many important processes in the cell. Trypanosoma cruzi, a protozoa flagellate that causes Chagas disease, alternates between replicative and nonreplicative forms accompanied by a shift on global transcription levels and by changes in its chromatin architecture. Here, we investigated the T. cruzi chromatin proteome using three different protocols and compared it between replicative (epimastigote) and nonreplicative (trypomastigote) forms by high-resolution mass spectrometry. More than 2000 proteins were identified and quantified both in chromatin and nonchromatin extracts. Besides histones and other known nuclear proteins, trypanosomes chromatin also contains metabolic (mainly from carbohydrate pathway), cytoskeleton and many other proteins with unknown functions. Strikingly, the two parasite forms differ greatly regarding their chromatin-associated factors composition and amount. Although the nucleosome content is the same for both life forms (as seen by MNase digestion), the remaining proteins were much less detected in nonreplicative forms, suggesting that they have a naked chromatin. Proteins associated to DNA proliferation, such as PCNA, RPA, and DNA topoisomerases were exclusively found in the chromatin of replicative stages. On the other hand, the nonreplicative stages have an enrichment of a histone H2B variant. Furthermore, almost 20% of replicative stages chromatin-associated proteins are expressed in nonreplicative forms, but located at nonchromatin space. We identified different classes of proteins including phosphatases and a Ran-binding protein, that may shuttle between chromatin and nonchromatin space during differentiation. Seven proteins, including those with unknown functions, were selected for further validation. We confirmed their location in chromatin and their differential expression, using Western blotting assays and chromatin immunoprecipitation (ChIP). Our results indicate that the replicative state in trypanosomes involves an increase of chromatin associated proteins content. We discuss in details, the qualitative and quantitative implication of this chromatin set in trypanosome chromatin biology. Because trypanosomes are early-branching organisms, this data can boost our understanding of chromatin-associated processes in other cell types. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Hirano, Satoshi; Uemura, Takefumi; Annoh, Hiromichi; Fujita, Naonobu; Waguri, Satoshi; Itoh, Takashi; Fukuda, Mitsunori
2016-01-01
MAP1LC3/LC3 (a mammalian ortholog family of yeast Atg8) is a ubiquitin-like protein that is essential for autophagosome formation. LC3 is conjugated to phosphatidylethanolamine on phagophores and ends up distributed both inside and outside the autophagosome membrane. One of the well-known functions of LC3 is as a binding partner for receptor proteins, which target polyubiquitinated organelles and proteins to the phagophore through direct interaction with LC3 in selective autophagy, and their LC3-binding ability is essential for degradation of the polyubiquitinated substances. Although a number of LC3-binding proteins have been identified, it is unknown whether they are substrates of autophagy or how their interaction with LC3 is regulated. We previously showed that one LC3-binding protein, TBC1D25/OATL1, plays an inhibitory role in the maturation step of autophagosomes and that this function depends on its binding to LC3. Interestingly, TBC1D25 seems not to be a substrate of autophagy, despite being present on the phagophore. In this study we investigated the molecular basis for the escape of TBC1D25 from autophagic degradation by performing a chimeric analysis between TBC1D25 and SQSTM1/p62 (sequestosome 1), and the results showed that mutant TBC1D25 with an intact LC3-binding site can become an autophagic substrate when TBC1D25 is forcibly oligomerized. In addition, an ultrastructural analysis showed that TBC1D25 is mainly localized outside autophagosomes, whereas an oligomerized TBC1D25 mutant rather uniformly resides both inside and outside the autophagosomes. Our findings indicate that oligomerization is a key factor in the degradation of LC3-binding proteins and suggest that lack of oligomerization ability of TBC1D25 results in its asymmetric localization at the outer autophagosome membrane.
Seung, David; Soyk, Sebastian; Coiro, Mario; Maier, Benjamin A.; Eicke, Simona; Zeeman, Samuel C.
2015-01-01
The domestication of starch crops underpinned the development of human civilisation, yet we still do not fully understand how plants make starch. Starch is composed of glucose polymers that are branched (amylopectin) or linear (amylose). The amount of amylose strongly influences the physico-chemical behaviour of starchy foods during cooking and of starch mixtures in non-food manufacturing processes. The GRANULE-BOUND STARCH SYNTHASE (GBSS) is the glucosyltransferase specifically responsible for elongating amylose polymers and was the only protein known to be required for its biosynthesis. Here, we demonstrate that PROTEIN TARGETING TO STARCH (PTST) is also specifically required for amylose synthesis in Arabidopsis. PTST is a plastidial protein possessing an N-terminal coiled coil domain and a C-terminal carbohydrate binding module (CBM). We discovered that Arabidopsis ptst mutants synthesise amylose-free starch and are phenotypically similar to mutants lacking GBSS. Analysis of granule-bound proteins showed a dramatic reduction of GBSS protein in ptst mutant starch granules. Pull-down assays with recombinant proteins in vitro, as well as immunoprecipitation assays in planta, revealed that GBSS physically interacts with PTST via a coiled coil. Furthermore, we show that the CBM domain of PTST, which mediates its interaction with starch granules, is also required for correct GBSS localisation. Fluorescently tagged Arabidopsis GBSS, expressed either in tobacco or Arabidopsis leaves, required the presence of Arabidopsis PTST to localise to starch granules. Mutation of the CBM of PTST caused GBSS to remain in the plastid stroma. PTST fulfils a previously unknown function in targeting GBSS to starch. This sheds new light on the importance of targeting biosynthetic enzymes to sub-cellular sites where their action is required. Importantly, PTST represents a promising new gene target for the biotechnological modification of starch composition, as it is exclusively involved in amylose synthesis. PMID:25710501
Smoot, L M; Smoot, J C; Graham, M R; Somerville, G A; Sturdevant, D E; Migliaccio, C A; Sylva, G L; Musser, J M
2001-08-28
Pathogens are exposed to different temperatures during an infection cycle and must regulate gene expression accordingly. However, the extent to which virulent bacteria alter gene expression in response to temperatures encountered in the host is unknown. Group A Streptococcus (GAS) is a human-specific pathogen that is responsible for illnesses ranging from superficial skin infections and pharyngitis to severe invasive infections such as necrotizing fasciitis and streptococcal toxic shock syndrome. GAS survives and multiplies at different temperatures during human infection. DNA microarray analysis was used to investigate the influence of temperature on global gene expression in a serotype M1 strain grown to exponential phase at 29 degrees C and 37 degrees C. Approximately 9% of genes were differentially expressed by at least 1.5-fold at 29 degrees C relative to 37 degrees C, including genes encoding transporter proteins, proteins involved in iron homeostasis, transcriptional regulators, phage-associated proteins, and proteins with no known homologue. Relatively few known virulence genes were differentially expressed at this threshold. However, transcription of 28 genes encoding proteins with predicted secretion signal sequences was altered, indicating that growth temperature substantially influences the extracellular proteome. TaqMan real-time reverse transcription-PCR assays confirmed the microarray data. We also discovered that transcription of genes encoding hemolysins, and proteins with inferred roles in iron regulation, transport, and homeostasis, was influenced by growth at 40 degrees C. Thus, GAS profoundly alters gene expression in response to temperature. The data delineate the spectrum of temperature-regulated gene expression in an important human pathogen and provide many unforeseen lines of pathogenesis investigation.
Perry, Jason; Kleckner, Nancy; Börner, G. Valentin
2005-01-01
Zip2 and Zip3 are meiosis-specific proteins that, in collaboration with several partners, act at the sites of crossover-designated, axis-associated recombinational interactions to mediate crossover/chiasma formation. Here, Spo22 (also called Zip4) is identified as a probable functional collaborator of Zip2/3. The molecular roles of Zip2, Zip3, and Spo22/Zip4 are unknown. All three proteins are part of a small evolutionary cohort comprising similar homologs in four related yeasts. Zip3 is shown to contain a RING finger whose structural features most closely match those of known ubiquitin E3s. Further, Zip3 exhibits major domainal homologies to Rad18, a known DNA-binding ubiquitin E3. Also described is an approach to the identification and mapping of repeated protein sequence motifs, Alignment Based Repeat Annotation (ABRA), that we have developed. When ABRA is applied to Zip2 and Spo22/Zip4, they emerge as a 14-blade WD40-like repeat protein and a 22-unit tetratricopeptide repeat protein, respectively. WD40 repeats of Cdc20, Cdh1, and Cdc16 and tetratricopeptide repeats of Cdc16, Cdc23, and Cdc27, all components of the anaphase-promoting complex, are also analyzed. These and other findings suggest that Zip2, Zip3, and Zip4 act together to mediate a process that involves Zip3-mediated ubiquitin labeling, potentially as a unique type of ubiquitin-conjugating complex. PMID:16314568
Big Events in Greece and HIV Infection Among People Who Inject Drugs
Nikolopoulos, Georgios K.; Sypsa, Vana; Bonovas, Stefanos; Paraskevis, Dimitrios; Malliori-Minerva, Melpomeni; Hatzakis, Angelos; Friedman, Samuel R.
2015-01-01
Big Events are processes like macroeconomic transitions that have lowered social well-being in various settings in the past. Greece has been hit by the global crisis and experienced an HIV outbreak among people who inject drugs. Since the crisis began (2008), Greece has seen population displacement, inter-communal violence, cuts in governmental expenditures, and social movements. These may have affected normative regulation, networks, and behaviors. However, most pathways to risk remain unknown or unmeasured. We use what is known and unknown about the Greek HIV outbreak to suggest modifications in Big Events models and the need for additional research. PMID:25723309
Mihelčić, Matej; Šimić, Goran; Babić Leko, Mirjana; Lavrač, Nada; Džeroski, Sašo; Šmuc, Tomislav
2017-01-01
Based on a set of subjects and a collection of attributes obtained from the Alzheimer's Disease Neuroimaging Initiative database, we used redescription mining to find interpretable rules revealing associations between those determinants that provide insights about the Alzheimer's disease (AD). We extended the CLUS-RM redescription mining algorithm to a constraint-based redescription mining (CBRM) setting, which enables several modes of targeted exploration of specific, user-constrained associations. Redescription mining enabled finding specific constructs of clinical and biological attributes that describe many groups of subjects of different size, homogeneity and levels of cognitive impairment. We confirmed some previously known findings. However, in some instances, as with the attributes: testosterone, ciliary neurotrophic factor, brain natriuretic peptide, Fas ligand, the imaging attribute Spatial Pattern of Abnormalities for Recognition of Early AD, as well as the levels of leptin and angiopoietin-2 in plasma, we corroborated previously debatable findings or provided additional information about these variables and their association with AD pathogenesis. Moreover, applying redescription mining on ADNI data resulted with the discovery of one largely unknown attribute: the Pregnancy-Associated Protein-A (PAPP-A), which we found highly associated with cognitive impairment in AD. Statistically significant correlations (p ≤ 0.01) were found between PAPP-A and clinical tests: Alzheimer's Disease Assessment Scale, Clinical Dementia Rating Sum of Boxes, Mini Mental State Examination, etc. The high importance of this finding lies in the fact that PAPP-A is a metalloproteinase, known to cleave insulin-like growth factor binding proteins. Since it also shares similar substrates with A Disintegrin and the Metalloproteinase family of enzymes that act as α-secretase to physiologically cleave amyloid precursor protein (APP) in the non-amyloidogenic pathway, it could be directly involved in the metabolism of APP very early during the disease course. Therefore, further studies should investigate the role of PAPP-A in the development of AD more thoroughly.
Mihelčić, Matej; Šimić, Goran; Babić Leko, Mirjana; Lavrač, Nada; Džeroski, Sašo; Šmuc, Tomislav
2017-01-01
Based on a set of subjects and a collection of attributes obtained from the Alzheimer’s Disease Neuroimaging Initiative database, we used redescription mining to find interpretable rules revealing associations between those determinants that provide insights about the Alzheimer’s disease (AD). We extended the CLUS-RM redescription mining algorithm to a constraint-based redescription mining (CBRM) setting, which enables several modes of targeted exploration of specific, user-constrained associations. Redescription mining enabled finding specific constructs of clinical and biological attributes that describe many groups of subjects of different size, homogeneity and levels of cognitive impairment. We confirmed some previously known findings. However, in some instances, as with the attributes: testosterone, ciliary neurotrophic factor, brain natriuretic peptide, Fas ligand, the imaging attribute Spatial Pattern of Abnormalities for Recognition of Early AD, as well as the levels of leptin and angiopoietin-2 in plasma, we corroborated previously debatable findings or provided additional information about these variables and their association with AD pathogenesis. Moreover, applying redescription mining on ADNI data resulted with the discovery of one largely unknown attribute: the Pregnancy-Associated Protein-A (PAPP-A), which we found highly associated with cognitive impairment in AD. Statistically significant correlations (p ≤ 0.01) were found between PAPP-A and clinical tests: Alzheimer’s Disease Assessment Scale, Clinical Dementia Rating Sum of Boxes, Mini Mental State Examination, etc. The high importance of this finding lies in the fact that PAPP-A is a metalloproteinase, known to cleave insulin-like growth factor binding proteins. Since it also shares similar substrates with A Disintegrin and the Metalloproteinase family of enzymes that act as α-secretase to physiologically cleave amyloid precursor protein (APP) in the non-amyloidogenic pathway, it could be directly involved in the metabolism of APP very early during the disease course. Therefore, further studies should investigate the role of PAPP-A in the development of AD more thoroughly. PMID:29088293
Ankyrin 3: genetic association with bipolar disorder and relevance to disease pathophysiology.
Leussis, Melanie P; Madison, Jon M; Petryshen, Tracey L
2012-10-01
Bipolar disorder (BD) is a multi-factorial disorder caused by genetic and environmental influences. It has a large genetic component, with heritability estimated between 59-93%. Recent genome-wide association studies (GWAS) using large BD patient populations have identified a number of genes with strong statistical evidence for association with susceptibility for BD. Among the most significant and replicated genes is ankyrin 3 (ANK3), a large gene that encodes multiple isoforms of the ankyrin G protein. This article reviews the current evidence for genetic association of ANK3 with BD, followed by a comprehensive overview of the known biology of the ankyrin G protein, focusing on its neural functions and their potential relevance to BD. Ankyrin G is a scaffold protein that is known to have many essential functions in the brain, although the mechanism by which it contributes to BD is unknown. These functions include organizational roles for subcellular domains in neurons including the axon initial segment and nodes of Ranvier, through which ankyrin G orchestrates the localization of key ion channels and GABAergic presynaptic terminals, as well as creating a diffusion barrier that limits transport into the axon and helps define axo-dendritic polarity. Ankyrin G is postulated to have similar structural and organizational roles at synaptic terminals. Finally, ankyrin G is implicated in both neurogenesis and neuroprotection. ANK3 and other BD risk genes participate in some of the same biological pathways and neural processes that highlight several mechanisms by which they may contribute to BD pathophysiology. Biological investigation in cellular and animal model systems will be critical for elucidating the mechanism through which ANK3 confers risk of BD. This knowledge is expected to lead to a better understanding of the brain abnormalities contributing to BD symptoms, and to potentially identify new targets for treatment and intervention approaches.
Structure and proposed mechanism of α-glycerophosphate oxidase from Mycoplasma pneumoniae
Elkhal, Callia K.; Kean, Kelsey M.; Parsonage, Derek; ...
2015-03-14
In this study, the formation of hydrogen peroxide (H₂O₂) by the FAD-dependent α-glycerophosphate oxidase (GlpO), is important for the pathogenesis of Streptococcus pneumoniae and Mycoplasma pneumoniae. The structurally known GlpO from Streptococcus sp. ( SspGlpO) is similar to the pneumococcal protein ( SpGlpO) and provides a guide for drug design against that target. However, M. pneumoniae GlpO ( MpGlpO), having <20% sequence identity with structurally known GlpOs, appears to represent a second type of GlpO we designate as Type II GlpOs. Here, the recombinant His-tagged MpGlpO structure is described at ~2.5 Å resolution, solved by molecular replacement using as amore » search model the Bordetella pertussis protein 3253 (Bp3253) a protein of unknown function solved by structural genomics efforts. Recombinant MpGlpO is an active oxidase with a turnover number of ~580 min⁻¹ while Bp3253 showed no GlpO activity. No substantial differences exist between the oxidized and dithionite-reduced MpGlpO structures. Although, no liganded structures were determined, a comparison with the tartrate-bound Bp3253 structure and consideration of residue conservation patterns guided the construction of a model for α-glycerophosphate (Glp) recognition and turnover by MpGlpO. The predicted binding mode also appears relevant for the type I GlpOs (such as SspGlpO) despite differences in substrate recognition residues, and it implicates a histidine conserved in type I and II Glp oxidases and dehydrogenases as the catalytic acid/base. This work provides a solid foundation for guiding further studies of the mitochondrial Glp dehydrogenases as well as for continued studies of M. pneumoniae and S. pneumoniae glycerol metabolism and the development of novel therapeutics targeting MpGlpO and SpGlpO.« less
Structure and proposed mechanism of α-glycerophosphate oxidase from Mycoplasma pneumoniae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elkhal, Callia K.; Kean, Kelsey M.; Parsonage, Derek
In this study, the formation of hydrogen peroxide (H₂O₂) by the FAD-dependent α-glycerophosphate oxidase (GlpO), is important for the pathogenesis of Streptococcus pneumoniae and Mycoplasma pneumoniae. The structurally known GlpO from Streptococcus sp. ( SspGlpO) is similar to the pneumococcal protein ( SpGlpO) and provides a guide for drug design against that target. However, M. pneumoniae GlpO ( MpGlpO), having <20% sequence identity with structurally known GlpOs, appears to represent a second type of GlpO we designate as Type II GlpOs. Here, the recombinant His-tagged MpGlpO structure is described at ~2.5 Å resolution, solved by molecular replacement using as amore » search model the Bordetella pertussis protein 3253 (Bp3253) a protein of unknown function solved by structural genomics efforts. Recombinant MpGlpO is an active oxidase with a turnover number of ~580 min⁻¹ while Bp3253 showed no GlpO activity. No substantial differences exist between the oxidized and dithionite-reduced MpGlpO structures. Although, no liganded structures were determined, a comparison with the tartrate-bound Bp3253 structure and consideration of residue conservation patterns guided the construction of a model for α-glycerophosphate (Glp) recognition and turnover by MpGlpO. The predicted binding mode also appears relevant for the type I GlpOs (such as SspGlpO) despite differences in substrate recognition residues, and it implicates a histidine conserved in type I and II Glp oxidases and dehydrogenases as the catalytic acid/base. This work provides a solid foundation for guiding further studies of the mitochondrial Glp dehydrogenases as well as for continued studies of M. pneumoniae and S. pneumoniae glycerol metabolism and the development of novel therapeutics targeting MpGlpO and SpGlpO.« less
Janis, Brett; Uversky, Vladimir N; Menze, Michael A
2017-10-23
Late embryogenesis abundant (LEA) proteins are a large group of anhydrobiosis-associated intrinsically disordered proteins, which are commonly found in plants and some animals. The brine shrimp Artemia franciscana is the only known animal that expresses LEA proteins from three, and not only one, different groups in its anhydrobiotic life stage. The reason for the higher complexity in the A. franciscana LEA proteome (LEAome), compared with other anhydrobiotic animals, remains mostly unknown. To address this issue, we have employed a suite of bioinformatics tools to evaluate the disorder status of the Artemia LEAome and to analyze the roles of intrinsic disorder in functioning of brine shrimp LEA proteins. We show here that A. franciscana LEA proteins from different groups are more similar to each other than one originally expected, while functional differences among members of group three are possibly larger than commonly anticipated. Our data show that although these proteins are characterized by a large variety of forms and possible functions, as a general strategy, A. franciscana utilizes glassy matrix forming LEAs concurrently with proteins that more readily interact with binding partners. It is likely that the function(s) of both types, the matrix-forming and partner-binding LEA proteins, are regulated by changing water availability during desiccation.
Knowns and unknowns of plasma membrane protein degradation in plants.
Liu, Chuanliang; Shen, Wenjin; Yang, Chao; Zeng, Lizhang; Gao, Caiji
2018-07-01
Plasma membrane (PM) not only creates a physical barrier to enclose the intracellular compartments but also mediates the direct communication between plants and the ever-changing environment. A tight control of PM protein homeostasis by selective degradation is thus crucial for proper plant development and plant-environment interactions. Accumulated evidences have shown that a number of plant PM proteins undergo clathrin-dependent or membrane microdomain-associated endocytic routes to vacuole for degradation in a cargo-ubiquitination dependent or independent manner. Besides, several trans-acting determinants involved in the regulation of endocytosis, recycling and multivesicular body-mediated vacuolar sorting have been identified in plants. More interestingly, recent findings have uncovered the participation of selective autophagy in PM protein turnover in plants. Although great progresses have been made to identify the PM proteins that undergo dynamic changes in subcellular localizations and to explore the factors that control the membrane protein trafficking, several questions remain to be answered regarding the molecular mechanisms of PM protein degradation in plants. In this short review article, we briefly summarize recent progress in our understanding of the internalization, sorting and degradation of plant PM proteins. More specifically, we focus on discussing the elusive aspects underlying the pathways of PM protein degradation in plants. Copyright © 2018 Elsevier B.V. All rights reserved.
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
Optimization of Statistical Methods Impact on Quantitative Proteomics Data.
Pursiheimo, Anna; Vehmas, Anni P; Afzal, Saira; Suomi, Tomi; Chand, Thaman; Strauss, Leena; Poutanen, Matti; Rokka, Anne; Corthals, Garry L; Elo, Laura L
2015-10-02
As tools for quantitative label-free mass spectrometry (MS) rapidly develop, a consensus about the best practices is not apparent. In the work described here we compared popular statistical methods for detecting differential protein expression from quantitative MS data using both controlled experiments with known quantitative differences for specific proteins used as standards as well as "real" experiments where differences in protein abundance are not known a priori. Our results suggest that data-driven reproducibility-optimization can consistently produce reliable differential expression rankings for label-free proteome tools and are straightforward in their application.
Optical Tweezers-Based Measurements of Forces and Dynamics at Microtubule Ends.
Baclayon, Marian; Kalisch, Svenja-Marei; Hendel, Ed; Laan, Liedewij; Husson, Julien; Munteanu, E Laura; Dogterom, Marileen
2017-01-01
Microtubules are dynamic cytoskeletal polymers that polymerize and depolymerize while interacting with different proteins and structures within the cell. The highly regulated dynamic properties as well as the pushing and pulling forces generated by dynamic microtubule ends play important roles in processes such as in cell division. For instance, microtubule end-binding proteins are known to affect dramatically the dynamic properties of microtubules, and cortical dyneins are known to mediate pulling forces on microtubule ends. We discuss in this chapter our efforts to reconstitute these systems in vitro and mimic their interactions with structures within the cell using micro-fabricated barriers. Using an optical tweezers setup, we investigate the dynamics and forces of microtubules growing against functionalized barriers in the absence and presence of end-binding proteins and barrier-attached motor proteins. This setup allows high-speed as well as nanometer and piconewton resolution measurements on dynamic microtubules.
Identifying protein kinase target preferences using mass spectrometry
Douglass, Jacqueline; Gunaratne, Ruwan; Bradford, Davis; Saeed, Fahad; Hoffert, Jason D.; Steinbach, Peter J.; Pisitkun, Trairak
2012-01-01
A general question in molecular physiology is how to identify candidate protein kinases corresponding to a known or hypothetical phosphorylation site in a protein of interest. It is generally recognized that the amino acid sequence surrounding the phosphorylation site provides information that is relevant to identification of the cognate protein kinase. Here, we present a mass spectrometry-based method for profiling the target specificity of a given protein kinase as well as a computational tool for the calculation and visualization of the target preferences. The mass spectrometry-based method identifies sites phosphorylated in response to in vitro incubation of protein mixtures with active recombinant protein kinases followed by standard phosphoproteomic methodologies. The computational tool, called “PhosphoLogo,” uses an information-theoretic algorithm to calculate position-specific amino acid preferences and anti-preferences from the mass-spectrometry data (http://helixweb.nih.gov/PhosphoLogo/). The method was tested using protein kinase A (catalytic subunit α), revealing the well-known preference for basic amino acids in positions −2 and −3 relative to the phosphorylated amino acid. It also provides evidence for a preference for amino acids with a branched aliphatic side chain in position +1, a finding compatible with known crystal structures of protein kinase A. The method was also employed to profile target preferences and anti-preferences for 15 additional protein kinases with potential roles in regulation of epithelial transport: CK2, p38, AKT1, SGK1, PKCδ, CaMK2δ, DAPK1, MAPKAPK2, PKD3, PIM1, OSR1, STK39/SPAK, GSK3β, Wnk1, and Wnk4. PMID:22723110
Chandrashekar, P M; Venkatesh, Y P
2009-07-30
Traditionally, garlic (Allium sativum L.; Alliaceae) has been known to boost the immune system. Aged garlic has more potent immunomodulatory effects than raw garlic. These effects have been attributed to the transformed organosulfur compounds; the identity of the immunomodulatory proteins in aged garlic extract (AGE) is not known. The major aims are to examine the changes occurring in the protein fraction during ageing of garlic and to identify the immunomodulatory proteins. Changes occurring in garlic during ageing have been examined by protein quantitation and gel electrophoresis. Purification and identification of the immunomodulatory proteins have been achieved by Q-Sepharose chromatography and mitogenic activity. Only two major proteins (12-14 kDa range by SDS-PAGE) are observed in AGE. The purified protein components QA-1, QA-2, and QA-3 display immunomodulatory and mannose-binding activity; QA-2 shows the highest mitogenic activity. The identity of QA-2 and QA-1 proteins with the garlic lectins ASA I and ASA II, respectively, has been confirmed by hemagglutination analysis. QA-3 exhibits mitogenic activity, but no hemagglutination activity. The immunomodulatory activity of AGE is also contributed by immunomodulatory proteins. The major immunomodulatory proteins have been identified as the well-known garlic lectins.
Ruiz, Natividad; Gronenberg, Luisa S.; Kahne, Daniel; Silhavy, Thomas J.
2008-01-01
The outer membrane (OM) of most Gram-negative bacteria contains lipopolysaccharide (LPS) in the outer leaflet. LPS, or endotoxin, is a molecule of important biological activities. In the host, LPS elicits a potent immune response, while in the bacterium, it plays a crucial role by establishing a barrier to limit entry of hydrophobic molecules. Before LPS is assembled at the OM, it must be synthesized at the inner membrane (IM) and transported across the aqueous periplasmic compartment. Much is known about the biosynthesis of LPS but, until recently, little was known about its transport and assembly. We applied a reductionist bioinformatic approach that takes advantage of the small size of the proteome of the Gram-negative endosymbiont Blochmannia floridanus to search for novel factors involved in OM biogenesis. This led to the discovery of two essential Escherichia coli IM proteins of unknown function, YjgP and YjgQ, which are required for the transport of LPS to the cell surface. We propose that these two proteins, which we have renamed LptF and LptG, respectively, are the missing transmembrane components of the ABC transporter that, together with LptB, functions to extract LPS from the IM en route to the OM. PMID:18375759
Ruiz, Natividad; Gronenberg, Luisa S; Kahne, Daniel; Silhavy, Thomas J
2008-04-08
The outer membrane (OM) of most Gram-negative bacteria contains lipopolysaccharide (LPS) in the outer leaflet. LPS, or endotoxin, is a molecule of important biological activities. In the host, LPS elicits a potent immune response, while in the bacterium, it plays a crucial role by establishing a barrier to limit entry of hydrophobic molecules. Before LPS is assembled at the OM, it must be synthesized at the inner membrane (IM) and transported across the aqueous periplasmic compartment. Much is known about the biosynthesis of LPS but, until recently, little was known about its transport and assembly. We applied a reductionist bioinformatic approach that takes advantage of the small size of the proteome of the Gram-negative endosymbiont Blochmannia floridanus to search for novel factors involved in OM biogenesis. This led to the discovery of two essential Escherichia coli IM proteins of unknown function, YjgP and YjgQ, which are required for the transport of LPS to the cell surface. We propose that these two proteins, which we have renamed LptF and LptG, respectively, are the missing transmembrane components of the ABC transporter that, together with LptB, functions to extract LPS from the IM en route to the OM.
Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke
2012-01-01
Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014
Surfactant protein D delays Fas- and TRAIL-mediated extrinsic pathway of apoptosis in T cells.
Djiadeu, Pascal; Kotra, Lakshmi P; Sweezey, Neil; Palaniyar, Nades
2017-05-01
Only a few extracellular soluble proteins are known to modulate apoptosis. We considered that surfactant-associated protein D (SP-D), an innate immune collectin present on many mucosal surfaces, could regulate apoptosis. Although SP-D is known to be important for immune cell homeostasis, whether SP-D affects apoptosis is unknown. In this study we aimed to determine the effects of SP-D on Jurkat T cells and human T cells dying by apoptosis. Here we show that SP-D binds to Jurkat T cells and delays the progression of Fas (CD95)-Fas ligand and TRAIL-TRAIL receptor induced, but not TNF-TNF receptor-mediated apoptosis. SP-D exerts its effects by reducing the activation of initiator caspase-8 and executioner caspase-3. SP-D also delays the surface exposure of phosphatidylserine. The effect of SP-D was ablated by the presence of caspase-8 inhibitor, but not by intrinsic pathway inhibitors. The binding ability of SP-D to dying cells decreases during the early stages of apoptosis, suggesting the release of apoptotic cell surface targets during apoptosis. SP-D also delays FasL-induced death of primary human T cells. SP-D delaying the progression of the extrinsic pathway of apoptosis could have important implications in regulating immune cell homeostasis at mucosal surfaces.
Intracellular Electric Field and pH Optimize Protein Localization and Movement
Cunningham, Jessica; Estrella, Veronica; Lloyd, Mark; Gillies, Robert; Frieden, B. Roy; Gatenby, Robert
2012-01-01
Mammalian cell function requires timely and accurate transmission of information from the cell membrane (CM) to the nucleus (N). These pathways have been intensively investigated and many critical components and interactions have been identified. However, the physical forces that control movement of these proteins have received scant attention. Thus, transduction pathways are typically presented schematically with little regard to spatial constraints that might affect the underlying dynamics necessary for protein-protein interactions and molecular movement from the CM to the N. We propose messenger protein localization and movements are highly regulated and governed by Coulomb interactions between: 1. A recently discovered, radially directed E-field from the NM into the CM and 2. Net protein charge determined by its isoelectric point, phosphorylation state, and the cytosolic pH. These interactions, which are widely applied in elecrophoresis, provide a previously unknown mechanism for localization of messenger proteins within the cytoplasm as well as rapid shuttling between the CM and N. Here we show these dynamics optimize the speed, accuracy and efficiency of transduction pathways even allowing measurement of the location and timing of ligand binding at the CM –previously unknown components of intracellular information flow that are, nevertheless, likely necessary for detecting spatial gradients and temporal fluctuations in ligand concentrations within the environment. The model has been applied to the RAF-MEK-ERK pathway and scaffolding protein KSR1 using computer simulations and in-vitro experiments. The computer simulations predicted distinct distributions of phosphorylated and unphosphorylated components of this transduction pathway which were experimentally confirmed in normal breast epithelial cells (HMEC). PMID:22623963
Ukleja, Marta; Valpuesta, José María; Dziembowski, Andrzej; Cuellar, Jorge
2016-10-01
Large protein assemblies are usually the effectors of major cellular processes. The intricate cell homeostasis network is divided into numerous interconnected pathways, each controlled by a set of protein machines. One of these master regulators is the CCR4-NOT complex, which ultimately controls protein expression levels. This multisubunit complex assembles around a scaffold platform, which enables a wide variety of well-studied functions from mRNA synthesis to transcript decay, as well as other tasks still being identified. Solving the structure of the entire CCR4-NOT complex will help to define the distribution of its functions. The recently published three-dimensional reconstruction of the complex, in combination with the known crystal structures of some of the components, has begun to address this. Methodological improvements in structural biology, especially in cryoelectron microscopy, encourage further structural and protein-protein interaction studies, which will advance our comprehension of the gene expression machinery. © 2016 WILEY Periodicals, Inc.
BLOC-1 Interacts with BLOC-2 and the AP-3 Complex to Facilitate Protein Trafficking on Endosomes
Di Pietro, Santiago M.; Falcón-Pérez, Juan M.; Tenza, Danièle; Setty, Subba R.G.; Marks, Michael S.; Raposo, Graça
2006-01-01
The adaptor protein (AP)-3 complex is a component of the cellular machinery that controls protein sorting from endosomes to lysosomes and specialized related organelles such as melanosomes. Mutations in an AP-3 subunit underlie a form of Hermansky-Pudlak syndrome (HPS), a disorder characterized by abnormalities in lysosome-related organelles. HPS in humans can also be caused by mutations in genes encoding subunits of three complexes of unclear function, named biogenesis of lysosome-related organelles complex (BLOC)-1, -2, and -3. Here, we report that BLOC-1 interacts physically and functionally with AP-3 to facilitate the trafficking of a known AP-3 cargo, CD63, and of tyrosinase-related protein 1 (Tyrp1), a melanosomal membrane protein previously thought to traffic only independently of AP-3. BLOC-1 also interacts with BLOC-2 to facilitate Tyrp1 trafficking by a mechanism apparently independent of AP-3 function. Both BLOC-1 and -2 localize mainly to early endosome-associated tubules as determined by immunoelectron microscopy. These findings support the idea that BLOC-1 and -2 represent hitherto unknown components of the endosomal protein trafficking machinery. PMID:16837549
The Clathrin-dependent Spindle Proteome*
Rao, Sushma R.; Flores-Rodriguez, Neftali; Page, Scott L.; Wong, Chin; Robinson, Phillip J.; Chircop, Megan
2016-01-01
The mitotic spindle is required for chromosome congression and subsequent equal segregation of sister chromatids. These processes involve a complex network of signaling molecules located at the spindle. The endocytic protein, clathrin, has a “moonlighting” role during mitosis, whereby it stabilizes the mitotic spindle. The signaling pathways that clathrin participates in to achieve mitotic spindle stability are unknown. Here, we assessed the mitotic spindle proteome and phosphoproteome in clathrin-depleted cells using quantitative MS/MS (data are available via ProteomeXchange with identifier PXD001603). We report a spindle proteome that consists of 3046 proteins and a spindle phosphoproteome consisting of 5157 phosphosites in 1641 phosphoproteins. Of these, 2908 (95.4%) proteins and 1636 (99.7%) phosphoproteins are known or predicted spindle-associated proteins. Clathrin-depletion from spindles resulted in dysregulation of 121 proteins and perturbed signaling to 47 phosphosites. The majority of these proteins increased in mitotic spindle abundance and six of these were validated by immunofluorescence microscopy. Functional pathway analysis confirmed the reported role of clathrin in mitotic spindle stabilization for chromosome alignment and highlighted possible new mechanisms of clathrin action. The data also revealed a novel second mitotic role for clathrin in bipolar spindle formation. PMID:27174698
The Clathrin-dependent Spindle Proteome.
Rao, Sushma R; Flores-Rodriguez, Neftali; Page, Scott L; Wong, Chin; Robinson, Phillip J; Chircop, Megan
2016-08-01
The mitotic spindle is required for chromosome congression and subsequent equal segregation of sister chromatids. These processes involve a complex network of signaling molecules located at the spindle. The endocytic protein, clathrin, has a "moonlighting" role during mitosis, whereby it stabilizes the mitotic spindle. The signaling pathways that clathrin participates in to achieve mitotic spindle stability are unknown. Here, we assessed the mitotic spindle proteome and phosphoproteome in clathrin-depleted cells using quantitative MS/MS (data are available via ProteomeXchange with identifier PXD001603). We report a spindle proteome that consists of 3046 proteins and a spindle phosphoproteome consisting of 5157 phosphosites in 1641 phosphoproteins. Of these, 2908 (95.4%) proteins and 1636 (99.7%) phosphoproteins are known or predicted spindle-associated proteins. Clathrin-depletion from spindles resulted in dysregulation of 121 proteins and perturbed signaling to 47 phosphosites. The majority of these proteins increased in mitotic spindle abundance and six of these were validated by immunofluorescence microscopy. Functional pathway analysis confirmed the reported role of clathrin in mitotic spindle stabilization for chromosome alignment and highlighted possible new mechanisms of clathrin action. The data also revealed a novel second mitotic role for clathrin in bipolar spindle formation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Rodríguez, Andrea E; López-Crisosto, Camila; Peña-Oyarzún, Daniel; Salas, Daniela; Parra, Valentina; Quiroga, Clara; Morawe, Tobias; Chiong, Mario; Behl, Christian; Lavandero, Sergio
2016-01-01
Autophagy is mainly regulated by post-translational and lipid modifications of ATG proteins. In some scenarios, the induction of autophagy is accompanied by increased levels of certain ATG mRNAs such as MAP1LC3B/LC3B, ATG5 or ATG12. However, little is known about the regulation of ATG protein synthesis at the translational level. The cochaperone of the HSP70 system BAG3 (BCL2-associated athanogene 3) has been associated to LC3B lipidation through an unknown mechanism. In the present work, we studied how BAG3 controls autophagy in HeLa and HEK293 cells. Our results showed that BAG3 regulates the basal amount of total cellular LC3B protein by controlling its mRNA translation. This effect was apparently specific to LC3B because other ATG protein levels were not affected. BAG3 knockdown did not affect LC3B lipidation induced by nutrient deprivation or proteasome inhibition. We concluded that BAG3 maintains the basal amount of LC3B protein by controlling the translation of its mRNA in HeLa and HEK293 cells.
Rodríguez, Andrea E.; López-Crisosto, Camila; Peña-Oyarzún, Daniel; Salas, Daniela; Parra, Valentina; Quiroga, Clara; Morawe, Tobias; Chiong, Mario; Behl, Christian; Lavandero, Sergio
2016-01-01
ABSTRACT Autophagy is mainly regulated by post-translational and lipid modifications of ATG proteins. In some scenarios, the induction of autophagy is accompanied by increased levels of certain ATG mRNAs such as MAP1LC3B/LC3B, ATG5 or ATG12. However, little is known about the regulation of ATG protein synthesis at the translational level. The cochaperone of the HSP70 system BAG3 (BCL2-associated athanogene 3) has been associated to LC3B lipidation through an unknown mechanism. In the present work, we studied how BAG3 controls autophagy in HeLa and HEK293 cells. Our results showed that BAG3 regulates the basal amount of total cellular LC3B protein by controlling its mRNA translation. This effect was apparently specific to LC3B because other ATG protein levels were not affected. BAG3 knockdown did not affect LC3B lipidation induced by nutrient deprivation or proteasome inhibition. We concluded that BAG3 maintains the basal amount of LC3B protein by controlling the translation of its mRNA in HeLa and HEK293 cells. PMID:26654586
GDAP: a web tool for genome-wide protein disulfide bond prediction.
O'Connor, Brian D; Yeates, Todd O
2004-07-01
The Genomic Disulfide Analysis Program (GDAP) provides web access to computationally predicted protein disulfide bonds for over one hundred microbial genomes, including both bacterial and achaeal species. In the GDAP process, sequences of unknown structure are mapped, when possible, to known homologous Protein Data Bank (PDB) structures, after which specific distance criteria are applied to predict disulfide bonds. GDAP also accepts user-supplied protein sequences and subsequently queries the PDB sequence database for the best matches, scans for possible disulfide bonds and returns the results to the client. These predictions are useful for a variety of applications and have previously been used to show a dramatic preference in certain thermophilic archaea and bacteria for disulfide bonds within intracellular proteins. Given the central role these stabilizing, covalent bonds play in such organisms, the predictions available from GDAP provide a rich data source for designing site-directed mutants with more stable thermal profiles. The GDAP web application is a gateway to this information and can be used to understand the role disulfide bonds play in protein stability both in these unusual organisms and in sequences of interest to the individual researcher. The prediction server can be accessed at http://www.doe-mbi.ucla.edu/Services/GDAP.
Park, Jung Ok; Choi, Do-Young; Choi, Dong-Sic; Kim, Hee Joung; Kang, Jeong Won; Jung, Jae Hun; Lee, Jeong Hwa; Kim, Jayoung; Freeman, Michael R; Lee, Kye Young; Gho, Yong Song; Kim, Kwang Pyo
2013-07-01
Microvesicles (MVs, also known as exosomes, ectosomes, microparticles) are released by various cancer cells, including lung, colorectal, and prostate carcinoma cells. MVs released from tumor cells and other sources accumulate in the circulation and in pleural effusion. Although recent studies have shown that MVs play multiple roles in tumor progression, the potential pathological roles of MV in pleural effusion, and their protein composition, are still unknown. In this study, we report the first global proteomic analysis of highly purified MVs derived from human nonsmall cell lung cancer (NSCLC) pleural effusion. Using nano-LC-MS/MS following 1D SDS-PAGE separation, we identified a total of 912 MV proteins with high confidence. Three independent experiments on three patients showed that MV proteins from PE were distinct from MV obtained from other malignancies. Bioinformatics analyses of the MS data identified pathologically relevant proteins and potential diagnostic makers for NSCLC, including lung-enriched surface antigens and proteins related to epidermal growth factor receptor signaling. These findings provide new insight into the diverse functions of MVs in cancer progression and will aid in the development of novel diagnostic tools for NSCLC. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Diet-Induced Thermogenesis in Insects: A Developing Concept in Nutritional Ecology
Terry M. Trier; William J. Mattson
2003-01-01
Diet-induced thermogenesis (DIT) is a concept that has been well known in one form or another for more than a century in vertebrate nutrition and physiological ecology. Yet, it is practically unknown in the physiology and nutritional ecology of insects. We suggest that DIT is a ubiquitous mechanism occurring in most if not all organisms and functions to maintain...
Glutamate mediates the function of melanocortin receptor 4 on sim1 neurons in body weight regulation
USDA-ARS?s Scientific Manuscript database
The melanocortin receptor 4 (MC4R) is a well-established mediator of body weight homeostasis. However, the neurotransmitter(s) that mediate MC4R function remain largely unknown; as a result, little is known about the second-order neurons of the MC4R neural pathway. Single-minded 1 (Sim1)-expressing ...
ERIC Educational Resources Information Center
Cassady, Joslyn
2008-01-01
Inuit myths, folklore, and material culture are filled with examples of people who turn into animals. Margaret Lantis, a well-known Eskimologist of the mid-twentieth century, once commented that human-animal transformation in Inuit mythology had an "immediacy and a reality" that was unknown in other parts of the world. It is hard to…
ERIC Educational Resources Information Center
Hodapp, Robert M.; Urbano, Richard C.; So, Stephanie A.
2006-01-01
In this paper, we utilise an approach drawn from the field of epidemiology to explore what is known and unknown about young children with Down syndrome and their families. After describing what we mean by an epidemiological approach, we review basic findings for children with intellectual disabilities, as well as challenges to performing such…
The Essentials of Protein Import in the Degenerate Mitochondrion of Entamoeba histolytica
Dolezal, Pavel; Dagley, Michael J.; Kono, Maya; Wolynec, Peter; Likić, Vladimir A.; Foo, Jung Hock; Sedinová, Miroslava; Tachezy, Jan; Bachmann, Anna; Bruchhaus, Iris; Lithgow, Trevor
2010-01-01
Several essential biochemical processes are situated in mitochondria. The metabolic transformation of mitochondria in distinct lineages of eukaryotes created proteomes ranging from thousands of proteins to what appear to be a much simpler scenario. In the case of Entamoeba histolytica, tiny mitochondria known as mitosomes have undergone extreme reduction. Only recently a single complete metabolic pathway of sulfate activation has been identified in these organelles. The E. histolytica mitosomes do not produce ATP needed for the sulfate activation pathway and for three molecular chaperones, Cpn60, Cpn10 and mtHsp70. The already characterized ADP/ATP carrier would thus be essential to provide cytosolic ATP for these processes, but how the equilibrium of inorganic phosphate could be maintained was unknown. Finally, how the mitosomal proteins are translocated to the mitosomes had remained unclear. We used a hidden Markov model (HMM) based search of the E. histolytica genome sequence to discover candidate (i) mitosomal phosphate carrier complementing the activity of the ADP/ATP carrier and (ii) membrane-located components of the protein import machinery that includes the outer membrane translocation channel Tom40 and membrane assembly protein Sam50. Using in vitro and in vivo systems we show that E. histolytica contains a minimalist set up of the core import components in order to accommodate a handful of mitosomal proteins. The anaerobic and parasitic lifestyle of E. histolytica has produced one of the simplest known mitochondrial compartments of all eukaryotes. Comparisons with mitochondria of another amoeba, Dictystelium discoideum, emphasize just how dramatic the reduction of the protein import apparatus was after the loss of archetypal mitochondrial functions in the mitosomes of E. histolytica. PMID:20333239
Genes encoding calmodulin-binding proteins in the Arabidopsis genome
NASA Technical Reports Server (NTRS)
Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.
2002-01-01
Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.