27 CFR 555.180 - Prohibitions relating to unmarked plastic explosives.

Code of Federal Regulations, 2010 CFR

2010-04-01

... unmarked plastic explosives. 555.180 Section 555.180 Alcohol, Tobacco Products, and Firearms BUREAU OF... Marking of Plastic Explosives § 555.180 Prohibitions relating to unmarked plastic explosives. (a) No person shall manufacture any plastic explosive that does not contain a detection agent. (b) No person...

Haemophilus ducreyi Hfq contributes to virulence gene regulation as cells enter stationary phase.

PubMed

Gangaiah, Dharanesh; Labandeira-Rey, Maria; Zhang, Xinjun; Fortney, Kate R; Ellinger, Sheila; Zwickl, Beth; Baker, Beth; Liu, Yunlong; Janowicz, Diane M; Katz, Barry P; Brautigam, Chad A; Munson, Robert S; Hansen, Eric J; Spinola, Stanley M

2014-02-11

To adapt to stresses encountered in stationary phase, Gram-negative bacteria utilize the alternative sigma factor RpoS. However, some species lack RpoS; thus, it is unclear how stationary-phase adaptation is regulated in these organisms. Here we defined the growth-phase-dependent transcriptomes of Haemophilus ducreyi, which lacks an RpoS homolog. Compared to mid-log-phase organisms, cells harvested from the stationary phase upregulated genes encoding several virulence determinants and a homolog of hfq. Insertional inactivation of hfq altered the expression of ~16% of the H. ducreyi genes. Importantly, there were a significant overlap and an inverse correlation in the transcript levels of genes differentially expressed in the hfq inactivation mutant relative to its parent and the genes differentially expressed in stationary phase relative to mid-log phase in the parent. Inactivation of hfq downregulated genes in the flp-tad and lspB-lspA2 operons, which encode several virulence determinants. To comply with FDA guidelines for human inoculation experiments, an unmarked hfq deletion mutant was constructed and was fully attenuated for virulence in humans. Inactivation or deletion of hfq downregulated Flp1 and impaired the ability of H. ducreyi to form microcolonies, downregulated DsrA and rendered H. ducreyi serum susceptible, and downregulated LspB and LspA2, which allow H. ducreyi to resist phagocytosis. We propose that, in the absence of an RpoS homolog, Hfq serves as a major contributor of H. ducreyi stationary-phase and virulence gene regulation. The contribution of Hfq to stationary-phase gene regulation may have broad implications for other organisms that lack an RpoS homolog. Pathogenic bacteria encounter a wide range of stresses in their hosts, including nutrient limitation; the ability to sense and respond to such stresses is crucial for bacterial pathogens to successfully establish an infection. Gram-negative bacteria frequently utilize the alternative sigma factor RpoS to adapt to stresses and stationary phase. However, homologs of RpoS are absent in some bacterial pathogens, including Haemophilus ducreyi, which causes chancroid and facilitates the acquisition and transmission of HIV-1. Here, we provide evidence that, in the absence of an RpoS homolog, Hfq serves as a major contributor of stationary-phase gene regulation and that Hfq is required for H. ducreyi to infect humans. To our knowledge, this is the first study describing Hfq as a major contributor of stationary-phase gene regulation in bacteria and the requirement of Hfq for the virulence of a bacterial pathogen in humans.

Analysis of Crossing Speed of the Pedestrians in Marked and Unmarked Crosswalks in the Signalized and Un-Signalized Intersections (Case Study: Rasht city)

NASA Astrophysics Data System (ADS)

Behbahani, Hamid; Najafi Moghaddam Gilani, Vahid; Jahangir Samet, Mehdi; Salehfard, Reza

2017-10-01

Pedestrians affect the traffic in the signalized and un-signalized intersections. Therefore, identifying the behavioural features of the pedestrians is of great importance and may result in better designing facilities for them. In this study, by shooting the four intersections in Rasht for 15 hours and inventory from 4568 pedestrians, crossing speed of the pedestrians in the marked crosswalks and unmarked crosswalks was evaluated and analysed. Results showed that pedestrians‧ crossing speed in the marked crosswalks is higher than their crossing speed in the unmarked crosswalks in both signalized and un-signalized intersections. Moreover, in the unmarked crosswalks in the signalized intersections, 15th percentile speed of male pedestrians, female pedestrians and group of pedestrians’ decrease 6.4%, 5.4% and 12.2%, respectively, compared with the 15th percentile speed in the marked crosswalks. Above-mentioned values in the unmarked crosswalks in the un-signalized intersections for male pedestrians, female pedestrians, and group of pedestrians decrease 1.2%, 3.8%, and 1.4%, respectively.

Mapping of bovine prolactin and rhodopsin genes in hybrid somatic cells.

PubMed

Hallerman, E M; Theilmann, J L; Beckmann, J S; Soller, M; Womack, J E

1988-01-01

The genes encoding bovine prolactin and rhodopsin were assigned to syntenic groups on the basis of hybridization of DNA from a panel of bovine-hamster hybrid somatic cell lines with cloned prolactin and rhodopsin gene probes. Prolactin was found to be syntenic with previously mapped glyoxalase, BoLA and 21-hydroxylase genes, establishing a syntenic conservation with human chromosome 6. The presence of bovine rhodopsin sequences among the various hybrid cell lines was not concordant with any gene previously assigned to one of the 23 defined autosomal syntenic groups. Thus, rhodopsin marks a new bovine syntenic group, U24, leaving only five cattle autosomes unmarked by at least one biochemical or molecular marker.

Effects of radiotransmitters on the reproductive performance of Cassin's auklets

USGS Publications Warehouse

Ackerman, Joshua T.; Adams, Josh; Takekawa, John Y.; Carter, Harry R.; Whitworth, Darrell L.; Newman, Scott H.; Golightly, Richard T.; Orthmeyer, Dennis L.

2004-01-01

We examined whether radiotransmitters adversely affected the reproductive performance of Cassin's auklets (Ptychoramphus aleuticus) breeding on the California Channel Islands during 1999-2001. We attached external radiotransmitters to 1 partner in 108 Cassin's auklet pairs after nest initiation and used 131 unmarked, but handled, pairs as controls. Compared to alpha chicks raised by radiomarked pairs, alpha chicks raised by unmarked pairs had faster mass growth rates (1.95 ± 0.30 g d−1 vs. 3.37 ± 0.53 g d−1, respectively), faster wing growth rates (2.46 ± 0.10 mm d−1 vs. 2.85 ± 0.05 mm d−1), greater peak fledging masses (118.9 ± 3.5 g vs. 148.3 ± 2.4 g), and higher fledging success (61% vs. 90%). Fledging success was reduced more when we radiomarked the male (50% fledged) rather than the female partner (77% fledged). After fledging an alpha chick, unmarked pairs were more likely to initiate a second clutch (radiomarked: 7%; unmarked: 39%) but did not hatch a second egg (radiomarked: 4%; unmarked: 25%) or fledge a second (beta) chick (radiomarked: 4%; unmarked: 18%) significantly more often than radiomarked pairs. We resighted 12 radiomarked individuals nesting during a subsequent breeding season; each bird had shed its transmitter and healed the site of attachment. We suggest caution in using telemetry to evaluate the reproductive performance of alcids, but marking only females may minimize adverse effects.

Abundance, stock origin, and length of marked and unmarked juvenile Chinook salmon in the surface waters of greater Puget Sound

USGS Publications Warehouse

Rice, C.A.; Greene, C.M.; Moran, P.; Teel, D.J.; Kuligowski, D.R.; Reisenbichler, R.R.; Beamer, E.M.; Karr, J.R.; Fresh, K.L.

2011-01-01

This study focuses on the use by juvenile Chinook salmon Oncorhynchus tshawytscha of the rarely studied neritic environment (surface waters overlaying the sublittoral zone) in greater Puget Sound. Juvenile Chinook salmon inhabit the sound from their late estuarine residence and early marine transition to their first year at sea. We measured the density, origin, and size of marked (known hatchery) and unmarked (majority naturally spawned) juveniles by means of monthly surface trawls at six river mouth estuaries in Puget Sound and the areas in between. Juvenile Chinook salmon were present in all months sampled (April-November). Unmarked fish in the northern portion of the study area showed broader seasonal distributions of density than did either marked fish in all areas or unmarked fish in the central and southern portions of the sound. Despite these temporal differences, the densities of marked fish appeared to drive most of the total density estimates across space and time. Genetic analysis and coded wire tag data provided us with documented individuals from at least 16 source populations and indicated that movement patterns and apparent residence time were, in part, a function of natal location and time passed since the release of these fish from hatcheries. Unmarked fish tended to be smaller than marked fish and had broader length frequency distributions. The lengths of unmarked fish were negatively related to the density of both marked and unmarked Chinook salmon, but those of marked fish were not. These results indicate more extensive use of estuarine environments by wild than by hatchery juvenile Chinook salmon as well as differential use (e.g., rearing and migration) of various geographic regions of greater Puget Sound by juvenile Chinook salmon in general. In addition, the results for hatchery-generated timing, density, and length differences have implications for the biological interactions between hatchery and wild fish throughout Puget Sound. ?? American Fisheries Society 2011.

Otolith analysis of pre-restoration habitat use by Chinook salmon in the delta-flats and nearshore regions of the Nisqually River Estuary

USGS Publications Warehouse

Lind-Null, Angie; Larsen, Kim

2010-01-01

The Nisqually Fall Chinook population is one of 27 salmon stocks in the Puget Sound (Washington) evolutionarily significant unit listed as threatened under the federal Endangered Species Act (ESA). Extensive restoration of the Nisqually River delta ecosystem is currently taking place to assist in recovery of the stock as juvenile Fall Chinook salmon are dependent on the estuary. A pre-restoration baseline that includes the characterization of life history strategies, estuary residence times, growth rates, and habitat use is needed to evaluate the potential response of hatchery and natural origin Chinook salmon to restoration efforts and to determine restoration success. Otolith analysis was selected as a tool to examine Chinook salmon life history, growth, and residence in the Nisqually River estuary. Previously funded work on samples collected in 2004 (marked and unmarked) and 2005 (unmarked only) partially established a juvenile baseline on growth rates and length of residence associated with various habitats (freshwater, forested riverine tidal, emergent forested transition, estuarine emergent marsh, delta-flats and nearshore). However, residence times and growth rates for the delta-flats (DF) and nearshore (NS) habitats have been minimally documented due to small sample sizes. The purpose of the current study is to incorporate otolith microstructural analysis using otoliths from fish collected within the DF and NS habitats during sampling years 2004-08 to increase sample size and further evaluate between-year variation in otolith microstructure. Our results from this analysis indicated the delta-flats check (DFCK) on unmarked and marked Chinook samples in 2005-08 varied slightly in appearance from that seen on samples previously analyzed only from 2004. A fry migrant life history was observed on otoliths of unmarked Chinook collected in 2005, 2007, and 2008. Generally, freshwater mean increment width of unmarked fish, on average, was smaller compared to marked Chinook followed by tidal delta and DF/NS portions respectively. On average, the complete tidal delta growth rate was higher for marked Chinook compared to unmarked Chinook. The DF/NS growth rate was highest for unmarked and marked Chinook during 2008 compared to all other sampling years. The average DF/NS growth rate on unmarked Chinook was consistently lower than marked Chinook during all years; however, sample sizes were small during some years. Unmarked Chinook, on average, spent longer in the tidal delta compared to marked Chinook. Our results from this report suggest that otolith microstructural analysis can be a valuable tool in establishing baseline information on the utilization of Nisqually River estuary habitats by juvenile Chinook salmon prior to the newly funded restoration efforts.

9 CFR 316.8 - Unmarked inspected products; moved between official establishments; moved in commerce.

Code of Federal Regulations, 2014 CFR

2014-01-01

... between official establishments; moved in commerce. 316.8 Section 316.8 Animals and Animal Products FOOD... commerce. (a) Unmarked products which have been inspected and passed but do not bear the official... from such closed container the product may not be further transported in commerce unless such removal...

9 CFR 316.8 - Unmarked inspected products; moved between official establishments; moved in commerce.

Code of Federal Regulations, 2012 CFR

2012-01-01

... between official establishments; moved in commerce. 316.8 Section 316.8 Animals and Animal Products FOOD... commerce. (a) Unmarked products which have been inspected and passed but do not bear the official... from such closed container the product may not be further transported in commerce unless such removal...

9 CFR 316.8 - Unmarked inspected products; moved between official establishments; moved in commerce.

Code of Federal Regulations, 2013 CFR

2013-01-01

... between official establishments; moved in commerce. 316.8 Section 316.8 Animals and Animal Products FOOD... commerce. (a) Unmarked products which have been inspected and passed but do not bear the official... from such closed container the product may not be further transported in commerce unless such removal...

9 CFR 325.5 - Unmarked inspected product transported under official seal between official establishments for...

Code of Federal Regulations, 2010 CFR

2010-01-01

... under official seal between official establishments for further processing; certificate. 325.5 Section... CERTIFICATION TRANSPORTATION § 325.5 Unmarked inspected product transported under official seal between official... other means of conveyance which is sealed by a Program employee with an official seal of the Department...

9 CFR 325.5 - Unmarked inspected product transported under official seal between official establishments for...

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Unmarked inspected product transported under official seal between official establishments for further processing; certificate. 325.5 Section 325.5 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY...

10 CFR 1045.45 - Review of unmarked documents with potential restricted data or formerly restricted data.

Code of Federal Regulations, 2010 CFR

2010-01-01

... under the automatic or systematic review provisions of E.O. 12958 may come upon documents that they... 10 Energy 4 2010-01-01 2010-01-01 false Review of unmarked documents with potential restricted... PROVISIONS) NUCLEAR CLASSIFICATION AND DECLASSIFICATION Generation and Review of Documents Containing...

10 CFR 1045.45 - Review of unmarked documents with potential restricted data or formerly restricted data.

Code of Federal Regulations, 2011 CFR

2011-01-01

... under the automatic or systematic review provisions of E.O. 12958 may come upon documents that they... 10 Energy 4 2011-01-01 2011-01-01 false Review of unmarked documents with potential restricted... PROVISIONS) NUCLEAR CLASSIFICATION AND DECLASSIFICATION Generation and Review of Documents Containing...

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat

PubMed Central

2010-01-01

Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819

9 CFR 316.8 - Unmarked inspected products; moved between official establishments; moved in commerce.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Unmarked inspected products; moved between official establishments; moved in commerce. 316.8 Section 316.8 Animals and Animal Products FOOD... closed container, if the railroad car, truck, or container is sealed with an official seal of the...

9 CFR 316.8 - Unmarked inspected products; moved between official establishments; moved in commerce.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Unmarked inspected products; moved between official establishments; moved in commerce. 316.8 Section 316.8 Animals and Animal Products FOOD... closed container, if the railroad car, truck, or container is sealed with an official seal of the...

Customizing elastic pressure bandages for reuse to a predetermined, sub-bandage pressure: A randomized controlled trial.

PubMed

Sermsathanasawadi, Nuttawut; Tarapongpun, Tanakorn; Pianchareonsin, Rattana; Puangpunngam, Nattawut; Wongwanit, Chumpol; Chinsakchai, Khamin; Mutirangura, Pramook; Ruangsetakit, Chanean

2017-01-01

Objective A randomized clinical trial was performed to compare the effectiveness of unmarked bandages and customized bandages with visual markers in reproducing the desired sub-bandage pressure during self-bandaging by patients. Method Ninety patients were randomly allocated to two groups ("customized bandages" and "unmarked bandages") and asked to perform self-bandaging three times. The achievement of a pressure between 35 and 45 mmHg in at least two of the three attempts was defined as adequate quality. Results Adequate quality was achieved by 33.0% when applying the unmarked bandages, and 60.0% when applying the customized bandages ( p = 0.02). Use of the customized bandage and previous experience of bandaging were independent predictors for the achievement of the predetermined sub-bandage pressure ( p = 0.005 and p = 0.021, respectively). Conclusion Customized bandages may achieve predetermined sub-bandage pressures more closely than standard, unmarked, compression bandages. Clinical trials registration ClinicalTrials.gov (NCT02729688). Effectiveness of a Pressure Indicator Guided and a Conventional Bandaging in Treatment of Venous Leg Ulcer. https://clinicaltrials.gov/ct2/show/NCT02729688.

Characterization in Helicobacter pylori of a Nickel Transporter Essential for Colonization That Was Acquired during Evolution by Gastric Helicobacter Species

PubMed Central

Turlin, Evelyne; Mancuso, Francesco; Michel, Valérie; Richaud, Pierre; Veyrier, Frédéric J.; De Reuse, Hilde; Vinella, Daniel

2016-01-01

Metal acquisition is crucial for all cells and for the virulence of many bacterial pathogens. In particular, nickel is a virulence determinant for the human gastric pathogen Helicobacter pylori as it is the cofactor of two enzymes essential for in vivo colonization, urease and a [NiFe] hydrogenase. To import nickel despite its scarcity in the human body, H. pylori requires efficient uptake mechanisms that are only partially defined. Indeed, alternative ways of nickel entry were predicted to exist in addition to the well-described NixA permease. Using a genetic screen, we identified an ABC transporter, that we designated NiuBDE, as a novel H. pylori nickel transport system. Unmarked mutants carrying deletions of nixA, niuD and/or niuB, were constructed and used to measure (i) tolerance to toxic nickel exposure, (ii) intracellular nickel content by ICP-OES, (iii) transport of radioactive nickel and (iv) expression of a reporter gene controlled by nickel concentration. We demonstrated that NiuBDE and NixA function separately and are the sole nickel transporters in H. pylori. NiuBDE, but not NixA, also transports cobalt and bismuth, a metal currently used in H. pylori eradication therapy. Both NiuBDE and NixA participate in nickel-dependent urease activation at pH 5 and survival under acidic conditions mimicking those encountered in the stomach. However, only NiuBDE is able to carry out this activity at neutral pH and is essential for colonization of the mouse stomach. Phylogenomic analyses indicated that both nixA and niuBDE genes have been acquired via horizontal gene transfer by the last common ancestor of the gastric Helicobacter species. Our work highlights the importance of this evolutionary event for the emergence of Helicobacter gastric species that are adapted to the hostile environment of the stomach where the capacity of Helicobacter to import nickel and thereby activate urease needs to be optimized. PMID:27923069

Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress

PubMed Central

Jensen, Sheila I.; Lennen, Rebecca M.; Herrgård, Markus J.; Nielsen, Alex T.

2015-01-01

Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days. PMID:26643270

[Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

PubMed

Cheng, L H; Liu, Y; Niu, T

2017-05-14

Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

Testicular expressed genes are missing in familial X-Linked Kallmann syndrome due to two large different deletions in daughter's X chromosomes.

PubMed

Hershkovitz, Eli; Loewenthal, Neta; Peretz, Asaf; Parvari, Ruti

2008-01-01

X-linked Kallmann syndrome (KS) is caused mainly by point mutations, in the KAL1 gene. Large deletions >1 Mb are rare events in the human population and commonly result in contiguous gene syndromes. A search for the mutation causing KS carried out on two pairs of first-degree cousins of 2 sisters. Two different apparently independent deletions were found. The deleted sequences encompass the KAL1 gene and four known additional genes exclusively expressed in testis. Two of these genes belong to the FAM9 gene family, which shares some homology with the SCYP3 gene, previously implicated in azoospermia. One of the events causing the deletion may have been mediated by an L1 transposition, the other by a non-homologous end joining. Such non-homologous recombinations have not yet been reported in the KAL genomic region and thus this area may be more prone to deletions than previously expected. This is the first report on genetic characterization of KS with a deletion of solely testis-expressed genes. The absence of these genes may have unfavorable implications for the patients regarding future fertility. (c) 2008 S. Karger AG, Basel

Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

PubMed

Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

2018-03-01

Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

Analytic Validation of a Clinical-Grade PTEN Immunohistochemistry Assay in Prostate Cancer by Comparison to PTEN FISH

PubMed Central

Lotan, Tamara L.; Wei, Wei; Ludkovski, Olga; Morais, Carlos L.; Guedes, Liana B.; Jamaspishvili, Tamara; Lopez, Karen; Hawley, Sarah T.; Feng, Ziding; Fazli, Ladan; Hurtado-Coll, Antonio; McKenney, Jesse K.; Simko, Jeffrey; Carroll, Peter R.; Gleave, Martin; Lin, Daniel W.; Nelson, Peter S.; Thompson, Ian M.; True, Lawrence D.; Brooks, James D.; Lance, Raymond; Troyer, Dean; Squire, Jeremy A.

2016-01-01

PTEN loss is a promising prognostic and predictive biomarker in prostate cancer. Because it occurs most commonly via PTEN gene deletion, we developed a clinical-grade, automated and inexpensive immunohistochemical assay to detect PTEN loss. We studied the sensitivity and specificity of PTEN immunohistochemistry relative to 4-color fluorescence in situ hybridization (FISH) for detection of PTEN gene deletion in a multi-institutional cohort of 731 primary prostate tumors. Intact PTEN immunostaining was 91% specific for absence of PTEN gene deletion, (549/602 tumors with 2 copies of the PTEN gene by FISH showed intact expression of PTEN by immunohistochemistry) and 97% sensitive for presence of homozygous PTEN gene deletion (absent PTEN protein expression by immunohistochemistry in 65/67 tumors with homozygous deletion). PTEN immunohistochemistry was 65% sensitive for presence of hemizygous PTEN gene deletion, with protein loss in 40/62 hemizygous tumors. We reviewed the 53 cases where immunohistochemistry showed PTEN protein loss and FISH showed 2 intact copies of the PTEN gene. On re-review, there was ambiguous immunohistochemistry loss in 6% (3/53) and failure to analyze the same tumor area by both methods in 34% (18/53). Of the remaining discordant cases, 41% (13/32) revealed hemizygous (n=8) or homozygous (n=5) PTEN gene deletion that was focal in most cases (11/13). The remaining 19 cases had 2 copies of the PTEN gene by FISH, representing truly discordant cases. Our automated PTEN immunohistochemistry assay is a sensitive method for detection of homozygous PTEN gene deletions. Immunohistochemistry screening is particularly useful to identify cases with heterogeneous PTEN gene deletion in a subset of tumor glands. Mutations, small insertions or deletions and/or epigenetic or microRNA-mediated mechanisms may lead to PTEN protein loss in tumors with normal or hemizygous PTEN gene copy number. PMID:27174589

unmarked: An R package for fitting hierarchical models of wildlife occurrence and abundance

USGS Publications Warehouse

Fiske, Ian J.; Chandler, Richard B.

2011-01-01

Ecological research uses data collection techniques that are prone to substantial and unique types of measurement error to address scientific questions about species abundance and distribution. These data collection schemes include a number of survey methods in which unmarked individuals are counted, or determined to be present, at spatially- referenced sites. Examples include site occupancy sampling, repeated counts, distance sampling, removal sampling, and double observer sampling. To appropriately analyze these data, hierarchical models have been developed to separately model explanatory variables of both a latent abundance or occurrence process and a conditional detection process. Because these models have a straightforward interpretation paralleling mechanisms under which the data arose, they have recently gained immense popularity. The common hierarchical structure of these models is well-suited for a unified modeling interface. The R package unmarked provides such a unified modeling framework, including tools for data exploration, model fitting, model criticism, post-hoc analysis, and model comparison.

Age-structured mark-recapture analysis: A virtual-population-analysis-based model for analyzing age-structured capture-recapture data

USGS Publications Warehouse

Coggins, L.G.; Pine, William E.; Walters, C.J.; Martell, S.J.D.

2006-01-01

We present a new model to estimate capture probabilities, survival, abundance, and recruitment using traditional Jolly-Seber capture-recapture methods within a standard fisheries virtual population analysis framework. This approach compares the numbers of marked and unmarked fish at age captured in each year of sampling with predictions based on estimated vulnerabilities and abundance in a likelihood function. Recruitment to the earliest age at which fish can be tagged is estimated by using a virtual population analysis method to back-calculate the expected numbers of unmarked fish at risk of capture. By using information from both marked and unmarked animals in a standard fisheries age structure framework, this approach is well suited to the sparse data situations common in long-term capture-recapture programs with variable sampling effort. ?? Copyright by the American Fisheries Society 2006.

Chronic lymphocytic leukemia cells with allelic deletions at 13q14 commonly have one intact RB1 gene: Evidence for a role of an adjacent locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leu, Y.; Grander, D.; Linder, S.

The authors have previously shown that 30% of patients with B-cell chronic lymphocytic leukemia (B-CLL) have hemizygous deletions of the retinoblastoma (RB1) gene at 13q14. RB1 gene deletions may thus participate in malignant transformation of B-CLL, but is it also possible that a neighboring gene on 13q is the relevant one. To answer this question the remaining RB1 allele of eight clones with hemizygous deletions was studied by reverse transcription-polymerase chain reaction (RT-PCR), single-strand conformation polymorphism (SSCP) analysis, and immunofluorescense techniques. Cells from 10 patients without RB1 gene deletions were also studied by these methods. Lack of RB1 mRNA andmore » RB protein expression was seen in leukemia cells from one of the patients. All other cases were found to be normal with regard to immunofluorescense, RT-PCR, and SSCP analysis, indicating at least one functional RB1 allele and supporting the importance of another gene in the 13q14 deletions. The authors then performed extended Southern blot analysis of the 13q region, using probes for 10 different loci. In 14 of 31 CLL clones (45%), deletions of a region telomeric to the RB1 gene (D13S25) were observed. In 4 of the cases the deletions were homozygous. Hemizygous deletions of the RB1 gene were observed in 11 of these patients and in one of the patients without D13S25 deletions. These data thus indicate that a gene(s) telomeric to RB1 is involved in the malignant transformation of CLL clones and that deletions of this region are a common event in this disease. 20 refs., 3 figs., 3 tabs.« less

Zoom‐in comparative genomic hybridisation arrays for the characterisation of variable breakpoint contiguous gene syndromes

PubMed Central

Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G

2007-01-01

Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889

Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes.

PubMed

Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

2014-04-01

Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader-Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion.

[Deletion of two genes from the genome of fission yeast Schizosaccharomyces pombe. Genetic manipulation and phenotype study].

PubMed

Petrescu, Elena; Voicu, Pia-Maneula; Poiţelea, M; Stoica, B; Stănescu, Raluca; Rusu, M

2005-01-01

The aim of this study was to delete two genes from the genome of the fission yeast S. pombe in order to search for their functions in the cell. These genes are SPAC869.02c (MRI) and SPBC21C3.19 (MR2) and previous studies reported their significant induction after gamma irradiation. We carried out the deletions of the two genes and we replaced them with the selection marker ura4. Among the phenotype characteristics we tested the viability, the sexual behaviour and the radiosensitivity to ultraviolet and gamma irradiation. Our results indicate that MR1-deleted strain is sensitive to both UV and gamma irradiation, while the survival of the irradiated MR2-deleted strain doesn't appear to be influenced by the deletion. This suggests an involvement of MR1 gene in the adaptive response triggered by these types of genotoxic aggression. The comparison of MR1-d and MR2-d with the double deleted strains containing the deletion of MR1 or MR2 combined with the deletion of sty1 or rad3 genes led to a surprising result: the double mutants MR1-d sty1-d and MR1-d rad3-d were more resistant to both UV and gamma irradiation than the simple deleted strains sty1-d and rad3-d, respectively. This suggests a possible contribution of MR1 gene to the lethal process taking place in irradiated cells.

Mucopolysaccharidosis type IVA: Common double deletion in the N-Acetylgalactosamine-6-sulfatase gene (GALNS)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Toshinori; Tomatsu, Shunji; Fukuda, Seiji

1995-04-10

Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine-6-sulfatase (GALNS). We found two separate deletions of nearly 8.0 and 6.0 kb in the GALNS gene, including some exons. There are Alu repetitive elements near the breakpoints of the 8.0-kb deletion, and this deletion resulted from an Alu-Alu recombination. The other 6.0-kb deletion involved illegitimate recombinational events between incomplete short direct repeats of 8 bp at deletion breakpoints. The same rearrangement has been observed in a heteroallelic state in four unrelated patients. This is the first documentation of a common double deletion a gene thatmore » is not a member of a gene cluster. 39 refs., 5 figs.« less

Identification of Genes Related to Fungicide Resistance in Fusarium fujikuroi

PubMed Central

Choi, Younghae; Jung, Boknam; Li, Taiying

2017-01-01

We identified two genes related to fungicide resistance in Fusarium fujikuroi through random mutagenesis. Targeted gene deletions showed that survival factor 1 deletion resulted in higher sensitivity to fungicides, while deletion of the gene encoding F-box/WD-repeat protein increased resistance, suggesting that the genes affect fungicide resistance in different ways. PMID:28781543

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

Carbon storage regulator A contributes to the virulence of Haemophilus ducreyi in humans by multiple mechanisms.

PubMed

Gangaiah, Dharanesh; Li, Wei; Fortney, Kate R; Janowicz, Diane M; Ellinger, Sheila; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M

2013-02-01

The carbon storage regulator A (CsrA) controls a wide variety of bacterial processes, including metabolism, adherence, stress responses, and virulence. Haemophilus ducreyi, the causative agent of chancroid, harbors a homolog of csrA. Here, we generated an unmarked, in-frame deletion mutant of csrA to assess its contribution to H. ducreyi pathogenesis. In human inoculation experiments, the csrA mutant was partially attenuated for pustule formation compared to its parent. Deletion of csrA resulted in decreased adherence of H. ducreyi to human foreskin fibroblasts (HFF); Flp1 and Flp2, the determinants of H. ducreyi adherence to HFF cells, were downregulated in the csrA mutant. Compared to its parent, the csrA mutant had a significantly reduced ability to tolerate oxidative stress and heat shock. The enhanced sensitivity of the mutant to oxidative stress was more pronounced in bacteria grown to stationary phase compared to that in bacteria grown to mid-log phase. The csrA mutant also had a significant survival defect within human macrophages when the bacteria were grown to stationary phase but not to mid-log phase. Complementation in trans partially or fully restored the mutant phenotypes. These data suggest that CsrA contributes to virulence by multiple mechanisms and that these contributions may be more profound in bacterial cell populations that are not rapidly dividing in the human host.

Salivary IgG subclasses in individuals with and without homozygous IGHG gene deletions.

PubMed Central

Engström, P E; Norhagen, G; Osipova, L; Helal, A; Wiebe, V; Brusco, A; Carbonara, A O; Lefranc, G; Lefranc, M P

1996-01-01

In this study, the levels of salivary IgG1, IgG2, IgG3 and IgG4 from individuals with and without homozygous immunoglobulin heavy chain constant gene deletions were quantified by enzyme-linked immunosorbent assay (ELISA). To analyse the restriction of salivary IgG subclasses, we used unstimulated whole saliva and sera collected at the same time from individuals with homozygous gene deletions, two with G1 deletion, one with G4 deletion, six with both G2 and G4 deletions and from eight individuals without IGHG gene deletions and expressing all four IgG subclasses. The median values of salivary IgG from individuals with homozygous G1, or G4, or both G2 and G4 deletions, and from individuals expressing all four subclasses were 24.2 mg/l and 23.4 mg/l, respectively. The median values of serum IgG were 13.7 g/l and 15.9 g/l, respectively. Our results show that the salivary and serum IgG levels were both within the normal range in individuals with homozygous gene deletions of either G1, or G4, or both G2 and G4. PMID:8943711

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

PubMed

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

PubMed

Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F

2014-01-01

Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

First Report of a Deletion Encompassing an Entire Exon in the Homogentisate 1,2-Dioxygenase Gene Causing Alkaptonuria

PubMed Central

Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.

2014-01-01

Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259

Defined single-gene and multi-gene deletion mutant collections in Salmonella enterica sv Typhimurium.

PubMed

Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael

2014-01-01

We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available.

A genome-wide resource of cell cycle and cell shape genes of fission yeast

PubMed Central

Hayles, Jacqueline; Wood, Valerie; Jeffery, Linda; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Salas-Pino, Silvia; Heichinger, Christian; Nurse, Paul

2013-01-01

To identify near complete sets of genes required for the cell cycle and cell shape, we have visually screened a genome-wide gene deletion library of 4843 fission yeast deletion mutants (95.7% of total protein encoding genes) for their effects on these processes. A total of 513 genes have been identified as being required for cell cycle progression, 276 of which have not been previously described as cell cycle genes. Deletions of a further 333 genes lead to specific alterations in cell shape and another 524 genes result in generally misshapen cells. Here, we provide the first eukaryotic resource of gene deletions, which describes a near genome-wide set of genes required for the cell cycle and cell shape. PMID:23697806

Deletions spanning the neurofibromatosis I gene: Identification and phenotype of five patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kayes, L.M.; Burke, W.; Bennett, R.

Neurofibromatosis type 1 (NF1) is an autosomal dominant disorder characterized by marked variation in clinical severity. To investigate the contribution to variability by genes either contiguous to or contained within the NF1 gene, the authors screened six NF1 patients with mild facial dysmorphology, mental retardation, and/or learning disabilities, for DNA rearrangement of the NF1 region. Five of the six patients had NF1 gene deletions on the basis of quantitative densitometry, locus hemizygosity, and analysis of somatic cell hybrid lines. Analysis of hybrid lines carrying each of the patient's chromosomes 17, with 15 regional DNA markers, demonstrated that each of themore » five patients carried a deletion >700 kb in size. Minimally, each of the deletions involved the entire 350-kb NF1 gene; the three genes - EVI2A, EVI2B, and OMG-that are contained within an NF1 intron; and considerable flanking DNA. For four of the patients, the deletions mapped to the same interval; the deletion in the fifth patient was larger, extending farther in both directions. The remaining NF1 allele presumably produced functional neurofibromin; no gene rearrangements were detected, and RNA-PCR demonstrated that it was transcribed. These data provide compelling evidence that the NF1 disorder results from haploid insufficiency of neurofibromin. Of the three documented de novo deletion cases, two involved the paternal NF1 allele and one the maternal allele. The parental origin of the single remaining expresses NF1 allele had no dramatic effect on patient phenotype. The deletion patients exhibited a variable number of physical anomalies that were not correlated with the extent of their deletion. All five patients with deletions were remarkable for exhibiting a large number of neurfibromas for their age, suggesting that deletion of an unknown gene in the NF1 region may affect tumor initiation or development. 69 refs., 5 figs., 1 tab.« less

Enhancement of astaxanthin production in Xanthophyllomyces dendrorhous by efficient method for the complete deletion of genes.

PubMed

Yamamoto, Keisuke; Hara, Kiyotaka Y; Morita, Toshihiko; Nishimura, Akira; Sasaki, Daisuke; Ishii, Jun; Ogino, Chiaki; Kizaki, Noriyuki; Kondo, Akihiko

2016-09-13

Red yeast, Xanthophyllomyces dendrorhous is the only yeast known to produce astaxanthin, an anti-oxidant isoprenoid (carotenoid) widely used in the aquaculture, food, pharmaceutical and cosmetic industries. The potential of this microorganism as a platform cell factory for isoprenoid production has been recognized because of high flux through its native terpene pathway. Recently, we developed a multiple gene expression system in X. dendrorhous and enhanced the mevalonate synthetic pathway to increase astaxanthin production. In contrast, the mevalonate synthetic pathway is suppressed by ergosterol through feedback inhibition. Therefore, releasing the mevalonate synthetic pathway from this inhibition through the deletion of genes involved in ergosterol synthesis is a promising strategy to improve isoprenoid production. An efficient method for deleting diploid genes in X. dendrorhous, however, has not yet been developed. Xanthophyllomyces dendrorhous was cultivated under gradually increasing concentrations of antibiotics following the introduction of antibiotic resistant genes to be replaced with target genes. Using this method, double CYP61 genes encoding C-22 sterol desaturases relating to ergosterol biosynthesis were deleted sequentially. This double CYP61 deleted strain showed decreased ergosterol biosynthesis compared with the parental strain and single CYP61 disrupted strain. Additionally, this double deletion of CYP61 genes showed increased astaxanthin production compared with the parental strain and the single CYP61 knockout strain. Finally, astaxanthin production was enhanced by 1.4-fold compared with the parental strain, although astaxanthin production was not affected in the single CYP61 knockout strain. In this study, we developed a system to completely delete target diploid genes in X. dendrorhous. Using this method, we deleted diploid CYP61 genes involved in the synthesis of ergosterol that inhibits the pathway for mevalonate, which is a common substrate for isoprenoid biosynthesis. The resulting decrease in ergosterol biosynthesis increased astaxanthin production. The efficient method for deleting diploid genes developed in this study has the potential to improve industrial production of various isoprenoids in X. dendrorhous.

A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

PubMed

Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

2001-11-01

A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

Targeted Gene Deletion in Cordyceps militaris Using the Split-Marker Approach.

PubMed

Lou, HaiWei; Ye, ZhiWei; Yun, Fan; Lin, JunFang; Guo, LiQiong; Chen, BaiXiong; Mu, ZhiXian

2018-05-01

The macrofungus Cordyceps militaris contains many kinds of bioactive ingredients that are regulated by functional genes, but the functions of many genes in C. militaris are still unknown. In this study, to improve the frequency of homologous integration, a genetic transformation system based on a split-marker approach was developed for the first time in C. militaris to knock out a gene encoding a terpenoid synthase (Tns). The linear and split-marker deletion cassettes were constructed and introduced into C. militaris protoplasts by PEG-mediated transformation. The transformation of split-marker fragments resulted in a higher efficiency of targeted gene disruption than the transformation of linear deletion cassettes did. The color phenotype of the Tns gene deletion mutants was different from that of wild-type C. militaris. Moreover, a PEG-mediated protoplast transformation system was established, and stable genetic transformants were obtained. This method of targeted gene deletion represents an important tool for investigating the role of C. militaris genes.

Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

PubMed Central

Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

2015-01-01

To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

PubMed

Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

2015-11-01

Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease

PubMed Central

Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

2018-01-01

Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT, and DLD genes. Among the wide range of disease-causing mutations in BCKDHB, only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient’s unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD. PMID:29740478

A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease.

PubMed

Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

2018-01-01

Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT , and DLD genes. Among the wide range of disease-causing mutations in BCKDHB , only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient's unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD.

Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes.

PubMed

Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M

2006-07-01

Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.

Avian behavior and mortality at power lines in coastal South Carolina

USGS Publications Warehouse

Savereno, A.J.; Savereno, L.A.; Boettcher, R.; Haig, S.M.

1996-01-01

We compared avian behavior and mortality associated with two 115-kV transmission lines on the central South Carolina coast during 3,392 hours of observation from May 1991 through May 1994. One line was marked with 30-cm-diameter yellow aviation markers. The second line was unmarked, but was similar in most other aspects. We conducted ground searches (n = 445) beneath each line year-round to document avian mortality due to power-line collisions. At marked lines, birds that approached at line height changed behavior more at unmarked lines (P< 0.001), and fewer crossed between static and conductor wires. Collision rate was 53% lower at marked than unmarked lines. Among collisions at both sites, 82% of birds collided with static wires. Based on observed collisions and carcass recoveries, wading birds particularly appeared to be at risk. We concluded that aviation markers were effective at increasing line visibility and reducing collisions and recommend marking static wires of power lines in potentially sensitive areas.

Effects of focus and definiteness on children's word order: evidence from German five-year-olds' reproductions of double object constructions.

PubMed

Höhle, Barbara; Hörnig, Robin; Weskott, Thomas; Knauf, Selene; Krüger, Agnes

2014-07-01

Two experiments tested how faithfully German children aged 4 ;5 to 5 ;6 reproduce ditransitive sentences that are unmarked or marked with respect to word order and focus (Exp1) or definiteness (Exp2). Adopting an optimality theory (OT) approach, it is assumed that in the German adult grammar word order is ranked lower than focus and definiteness. Faithfulness of children's reproductions decreased as markedness of inputs increased; unmarked structures were reproduced most faithfully and unfaithful outputs had most often an unmarked form. Consistent with the OT proposal, children were more tolerant against inputs marked for word order than for focus; in conflict with the proposal, children were less tolerant against inputs marked for word order than for definiteness. Our results suggest that the linearization of objects in German double object constructions is affected by focus and definiteness, but that prosodic principles may have an impact on the position of a focused constituent.

Unmarked: An R package for fitting hierarchical models of wildlife occurrence and abundance

USGS Publications Warehouse

Fiske, I.J.; Chandler, R.B.

2011-01-01

Ecological research uses data collection techniques that are prone to substantial and unique types of measurement error to address scientic questions about species abundance and distribution. These data collection schemes include a number of survey methods in which unmarked individuals are counted, or determined to be present, at spatially- referenced sites. Examples include site occupancy sampling, repeated counts, distance sampling, removal sampling, and double observer sampling. To appropriately analyze these data, hierarchical models have been developed to separately model explanatory variables of both a latent abundance or occurrence process and a conditional detection process. Because these models have a straightforward interpretation paralleling mecha- nisms under which the data arose, they have recently gained immense popularity. The common hierarchical structure of these models is well-suited for a unied modeling in- terface. The R package unmarked provides such a unied modeling framework, including tools for data exploration, model tting, model criticism, post-hoc analysis, and model comparison.

Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis

PubMed Central

D’Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; He, Hong; Li, Shibo; Hejtmancik, James F.; Sieving, Paul A.; Wang, Xinjing

2013-01-01

Purpose X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4–5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Methods Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Results Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5′ region of the RS1 gene (including the promoter) through intron 1 (c.(−35)-1723_c.51+2664del4472). The exon 4–5 deletion spans introns 3 to intron 5 (c.185–1020_c.522+1844del5764). Conclusions Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes. PMID:24227916

Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.

PubMed

D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing

2013-01-01

X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.

Encephalopathy and bilateral cataract in a boy with an interstitial deletion of Xp22 comprising the CDKL5 and NHS genes.

PubMed

Van Esch, Hilde; Jansen, Anna; Bauters, Marijke; Froyen, Guy; Fryns, Jean-Pierre

2007-02-15

We describe a male patient with a deletion at Xp22, detected by high resolution X-array CGH. The clinical phenotype present in this infant boy, consists of severe encephalopathy, congenital cataracts and tetralogy of Fallot and can be attributed to the deletion of the genes within the interval. Among these deleted genes are the gene for Nance-Horan syndrome and the cyclin-dependent kinase-like 5 gene (CDKL5), responsible for the early seizure variant of Rett syndrome. This is the first description of a male patient with a deletion of these genes, showing the involvement of CDKL5 in severe epileptic encephalopathy in males. Moreover it illustrates the added value of high resolution array-CGH in molecular diagnosis of mental retardation-multiple congenital anomaly cases. (c) 2007 Wiley-Liss, Inc.

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis.

PubMed

Nicoletti, Annalisa; Ziccardi, Lucia; Maltese, Paolo Enrico; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-02-01

X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by "home-made" MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene.

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

PubMed

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Application of the FLP/FRT system for conditional gene deletion in yeast Saccharomyces cerevisiae.

PubMed

Park, Yang-Nim; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

2011-09-01

The yeast Saccharomyces cerevisiae has proved to be an excellent model organism to study the function of proteins. One of the many advantages of yeast is the many genetic tools available to manipulate gene expression, but there are still limitations. To complement the many methods used to control gene expression in yeast, we have established a conditional gene deletion system by using the FLP/FRT system on yeast vectors to conditionally delete specific yeast genes. Expression of Flp recombinase, which is under the control of the GAL1 promoter, was induced by galactose, which in turn excised FRT sites flanked genes. The efficacy of this system was examined using the FRT site-flanked genes HSP104, URA3 and GFP. The pre-excision frequency of this system, which might be caused by the basal activity of the GAL1 promoter or by spontaneous recombination between FRT sites, was detected ca. 2% under the non-selecting condition. After inducing expression of Flp recombinase, the deletion efficiency achieved ca. 96% of cells in a population within 9 h. After conditional deletion of the specific gene, protein degradation and cell division then diluted out protein that was expressed from this gene prior to its excision. Most importantly, the specific protein to be deleted could be expressed under its own promoter, so that endogenous levels of protein expression were maintained prior to excision by the Flp recombinase. Therefore, this system provides a useful tool for the conditional deletion of genes in yeast. Published in 2011 by John Wiley & Sons, Ltd.

Rapid deletion production in fungi via Agrobacterium mediated transformation of OSCAR deletion contructs.

USDA-ARS?s Scientific Manuscript database

Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular gene’s function in the living organism. In this protocol we describe the OSCAR method of precise and rapid deletion plasmid construction. OSCAR relies on t...

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

Large Deletions of TSPAN12 Cause Familial Exudative Vitreoretinopathy (FEVR).

PubMed

Seo, Soo Hyun; Kim, Man Jin; Park, Sung Wook; Kim, Jeong Hun; Yu, Young Suk; Song, Ji Yun; Cho, Sung Im; Ahn, Joo Hyun; Oh, Yeon Hee; Lee, Jee-Soo; Lee, Seungjun; Seong, Moon-Woo; Park, Sung Sup; Kim, Ji Yeon

2016-12-01

Familial exudative vitreoretinopathy (FEVR) is a rare, hereditary visual disorder. The gene TSPAN12 is associated with autosomal dominant inheritance of FEVR. The prevalence and impact of large deletions/duplications of TSPAN12 on FEVR patients is unknown. To glean better insight of TSPAN12 on FEVR pathology, herein, we describe three FEVR patients with TSPAN12 deletions. Thirty-three Korean FEVR patients, who previously screened negative for TSPAN12 mutations, mutations in other FEVR-associated genes such as NDP, FZD4, LRP5, and large deletions and duplications of NDP, FZD4, and LRP5, were selected for TSPAN12 large deletion and duplication analyses. Semiquantitative multiplex PCR for TSPAN12 gene dosage analyses were performed, followed by droplet digital PCR (ddPCR) for validation. Among the 33 patients, three patients were confirmed to carry large TSPAN12 deletions. Two of them had whole-gene deletions of TSPAN12, and the other patient possessed a deletion of TSPAN12 in exon 4. FEVR severity detected in these patients was not more severe than in a patient with TSPAN12 point mutation. Regarding previously reported proportions of FEVR-associated genes contributing to the disorder's autosomal dominant inheritance pattern in Korea, we determined that patients with TSPAN12 large deletions were more common than patients with single nucleotide variants in TSPAN12. Evaluating TSPAN12 large deletions and duplications should be considered in FEVR screening and diagnosis as well as in routine genetic workups for FEVR patients.

Recurrent Deletions of Puroindoline Genes at the Grain Hardness Locus in Four Independent Lineages of Polyploid Wheat1[W][OA

PubMed Central

Li, Wanlong; Huang, Li; Gill, Bikram S.

2008-01-01

Polyploidy is known to induce numerous genetic and epigenetic changes but little is known about their physiological bases. In wheat, grain texture is mainly determined by the Hardness (Ha) locus consisting of genes Puroindoline a (Pina) and b (Pinb). These genes are conserved in diploid progenitors but were deleted from the A and B genomes of tetraploid Triticum turgidum (AB). We now report the recurrent deletions of Pina-Pinb in other lineages of polyploid wheat. We analyzed the Ha haplotype structure in 90 diploid and 300 polyploid accessions of Triticum and Aegilops spp. Pin genes were conserved in all diploid species and deletion haplotypes were detected in all polyploid Triticum and most of the polyploid Aegilops spp. Two Pina-Pinb deletion haplotypes were found in hexaploid wheat (Triticum aestivum; ABD). Pina and Pinb were eliminated from the G genome, but maintained in the A genome of tetraploid Triticum timopheevii (AG). Subsequently, Pina and Pinb were deleted from the A genome but retained in the Am genome of hexaploid Triticum zhukovskyi (AmAG). Comparison of deletion breakpoints demonstrated that the Pina-Pinb deletion occurred independently and recurrently in the four polyploid wheat species. The implications of Pina-Pinb deletions for polyploid-driven evolution of gene and genome and its possible physiological significance are discussed. PMID:18024553

Homozygous hereditary C3 deficiency due to a partial gene deletion.

PubMed Central

Botto, M; Fong, K Y; So, A K; Barlow, R; Routier, R; Morley, B J; Walport, M J

1992-01-01

The molecular mechanism of C3 deficiency in an Afrikaans patient with recurrent pyogenic infections was studied. Restriction enzyme analysis showed a gene deletion of 800 base pairs (bp) mapping to the alpha chain of C3. Amplification of genomic DNA, using the PCR, demonstrated that the deletion included exons 22 and 23 of the C3 gene. Truncated mRNA was shown in an Epstein-Barr virus-transformed B-cell line by PCR amplification of first-strand cDNA. A consequence of this deletion was that the RNA transcribed 3' to the deletion was out of frame, resulting in formation of a stop codon 19 bp downstream from the deletion. The molecular basis of the deletion was compatible with homologous recombination between two Alu sequences located in introns 21 and 23. An unrelated nonconsanguineous relative and two of a sample of 174 Afrikaans-speaking individuals were heterozygous carriers of the same gene deletion. The wide prevalence of this null allele in this population is probably due to the effects of a small founder population. The presence of this deletion in the C3 gene is not compatible with production of any functional C3, supporting the idea that study of such patients offers a valid model for understanding physiological activities of C3 in vivo in humans. Images PMID:1350678

Chromosomal DNA Deletions Explain Phenotypic Characteristics of Two Antigenic Variants, Phase II and RSA 514 (Crazy), of the Coxiella burnetii Nine Mile Strain†

PubMed Central

Hoover, T. A.; Culp, D. W.; Vodkin, M. H.; Williams, J. C.; Thompson, H. A.

2002-01-01

After repeated passages through embyronated eggs, the Nine Mile strain of Coxiella burnetii exhibits antigenic variation, a loss of virulence characteristics, and transition to a truncated lipopolysaccharide (LPS) structure. In two independently derived strains, Nine Mile phase II and RSA 514, these phenotypic changes were accompanied by a large chromosomal deletion (M. H. Vodkin and J. C. Williams, J. Gen. Microbiol. 132:2587-2594, 1986). In the work reported here, additional screening of a cosmid bank prepared from the wild-type strain was used to map the deletion termini of both mutant strains and to accumulate all the segments of DNA that comprise the two deletions. The corresponding DNAs were then sequenced and annotated. The Nine Mile phase II deletion was completely nested within the deletion of the RSA 514 strain. Basic alignment and homology studies indicated that a large group of LPS biosynthetic genes, arranged in an apparent O-antigen cluster, was deleted in both variants. Database homologies identified, in particular, mannose pathway genes and genes encoding sugar methylases and nucleotide sugar epimerase-dehydratase proteins. Candidate genes for addition of sugar units to the core oligosaccharide for synthesis of the rare sugar 6-deoxy-3-C-methylgulose (virenose) were identified in the deleted region. Repeats, redundancies, paralogous genes, and two regions with reduced G+C contents were found within the deletions. PMID:12438347

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

PubMed

Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

PubMed Central

Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shomrat, R.; Gluck, E.; Legum, C.

1994-02-15

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and themore » remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.« less

Development of a Markerless Genetic Exchange System in Desulfovibrio vulgaris Hildenborough and Its Use in Generating a Strain with Increased Transformation Efficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, Kimberly L.; Bender, Kelly S.; Wall, Judy D.

2009-07-21

In recent years, the genetic manipulation of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough has seen enormous progress. In spite of this progress, the current marker exchange deletion method does not allow for easy selection of multiple sequential gene deletions in a single strain because of the limited number of selectable markers available in D. vulgaris. To broaden the repertoire of genetic tools for manipulation, an in-frame, markerless deletion system has been developed. The counterselectable marker that makes this deletion system possible is the pyrimidine salvage enzyme, uracil phosphoribosyltransferase, encoded by upp. In wild-type D. vulgaris, growth was shown to bemore » inhibited by the toxic pyrimidine analog 5-fluorouracil (5-FU); whereas, a mutant bearing a deletion of the upp gene was resistant to 5-FU. When a plasmid containing the wild-type upp gene expressed constitutively from the aph(3')-II promoter (promoter for the kanamycin resistance gene in Tn5) was introduced into the upp deletion strain, sensitivity to 5-FU was restored. This observation allowed us to develop a two-step integration and excision strategy for the deletion of genes of interest. Since this inframe deletion strategy does not retain an antibiotic cassette, multiple deletions can be generated in a single strain without the accumulation of genes conferring antibiotic resistances. We used this strategy to generate a deletion strain lacking the endonuclease (hsdR, DVU1703) of a type I restriction-modification system, that we designated JW7035. The transformation efficiency of the JW7035 strain was found to be 100 to 1000 times greater than that of the wild-type strain when stable plasmids were introduced via electroporation.« less

Novel deletion of the E3A ubiquitin protein ligase gene detected by multiplex ligation-dependent probe amplification in a patient with Angelman syndrome

PubMed Central

Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio

2010-01-01

Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004

Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

PubMed

Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

2007-05-01

The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

PubMed

Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

2011-02-01

  This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

The location and translocation of ndh genes of chloroplast origin in the Orchidaceae family

PubMed Central

Lin, Choun-Sea; Chen, Jeremy J. W.; Huang, Yao-Ting; Chan, Ming-Tsair; Daniell, Henry; Chang, Wan-Jung; Hsu, Chen-Tran; Liao, De-Chih; Wu, Fu-Huei; Lin, Sheng-Yi; Liao, Chen-Fu; Deyholos, Michael K.; Wong, Gane Ka-Shu; Albert, Victor A.; Chou, Ming-Lun; Chen, Chun-Yi; Shih, Ming-Che

2015-01-01

The NAD(P)H dehydrogenase complex is encoded by 11 ndh genes in plant chloroplast (cp) genomes. However, ndh genes are truncated or deleted in some autotrophic Epidendroideae orchid cp genomes. To determine the evolutionary timing of the gene deletions and the genomic locations of the various ndh genes in orchids, the cp genomes of Vanilla planifolia, Paphiopedilum armeniacum, Paphiopedilum niveum, Cypripedium formosanum, Habenaria longidenticulata, Goodyera fumata and Masdevallia picturata were sequenced; these genomes represent Vanilloideae, Cypripedioideae, Orchidoideae and Epidendroideae subfamilies. Four orchid cp genome sequences were found to contain a complete set of ndh genes. In other genomes, ndh deletions did not correlate to known taxonomic or evolutionary relationships and deletions occurred independently after the orchid family split into different subfamilies. In orchids lacking cp encoded ndh genes, non cp localized ndh sequences were identified. In Erycina pusilla, at least 10 truncated ndh gene fragments were found transferred to the mitochondrial (mt) genome. The phenomenon of orchid ndh transfer to the mt genome existed in ndh-deleted orchids and also in ndh containing species. PMID:25761566

Homozygous diploid deletion strains of Saccharomyces cerevisiae that determine lag phase and dehydration tolerance.

PubMed

D'Elia, Riccardo; Allen, Patricia L; Johanson, Kelly; Nickerson, Cheryl A; Hammond, Timothy G

2005-06-01

This study identifies genes that determine length of lag phase, using the model eukaryotic organism, Saccharomyces cerevisiae. We report growth of a yeast deletion series following variations in the lag phase induced by variable storage times after drying-down yeast on filters. Using a homozygous diploid deletion pool, lag times ranging from 0 h to 90 h were associated with increased drop-out of mitochondrial genes and increased survival of nuclear genes. Simple linear regression (R2 analysis) shows that there are over 500 genes for which > 70% of the variation can be explained by lag alone. In the genes with a positive correlation, such that the gene abundance increases with lag and hence the deletion strain is suitable for survival during prolonged storage, there is a strong predominance of nucleonic genes. In the genes with a negative correlation, such that the gene abundance decreases with lag and hence the strain may be critical for getting yeast out of the lag phase, there is a strong predominance of glycoproteins and transmembrane proteins. This study identifies yeast deletion strains with survival advantage on prolonged storage and amplifies our understanding of the genes critical for getting out of the lag phase.

Homozygous diploid deletion strains of Saccharomyces cerevisiae that determine lag phase and dehydration tolerance

NASA Technical Reports Server (NTRS)

D'Elia, Riccardo; Allen, Patricia L.; Johanson, Kelly; Nickerson, Cheryl A.; Hammond, Timothy G.

2005-01-01

This study identifies genes that determine length of lag phase, using the model eukaryotic organism, Saccharomyces cerevisiae. We report growth of a yeast deletion series following variations in the lag phase induced by variable storage times after drying-down yeast on filters. Using a homozygous diploid deletion pool, lag times ranging from 0 h to 90 h were associated with increased drop-out of mitochondrial genes and increased survival of nuclear genes. Simple linear regression (R2 analysis) shows that there are over 500 genes for which > 70% of the variation can be explained by lag alone. In the genes with a positive correlation, such that the gene abundance increases with lag and hence the deletion strain is suitable for survival during prolonged storage, there is a strong predominance of nucleonic genes. In the genes with a negative correlation, such that the gene abundance decreases with lag and hence the strain may be critical for getting yeast out of the lag phase, there is a strong predominance of glycoproteins and transmembrane proteins. This study identifies yeast deletion strains with survival advantage on prolonged storage and amplifies our understanding of the genes critical for getting out of the lag phase.

Analysis of copy number variations in Holstein-Friesian cow genomes based on whole-genome sequence data.

PubMed

Mielczarek, M; Frąszczak, M; Giannico, R; Minozzi, G; Williams, John L; Wojdak-Maksymiec, K; Szyda, J

2017-07-01

Thirty-two whole genome DNA sequences of cows were analyzed to evaluate inter-individual variability in the distribution and length of copy number variations (CNV) and to functionally annotate CNV breakpoints. The total number of deletions per individual varied between 9,731 and 15,051, whereas the number of duplications was between 1,694 and 5,187. Most of the deletions (81%) and duplications (86%) were unique to a single cow. No relation between the pattern of variant sharing and a family relationship or disease status was found. The animal-averaged length of deletions was from 5,234 to 9,145 bp and the average length of duplications was between 7,254 and 8,843 bp. Highly significant inter-individual variation in length and number of CNV was detected for both deletions and duplications. The majority of deletion and duplication breakpoints were located in intergenic regions and introns, whereas fewer were identified in noncoding transcripts and splice regions. Only 1.35 and 0.79% of the deletion and duplication breakpoints were observed within coding regions. A gene with the highest number of deletion breakpoints codes for protein kinase cGMP-dependent type I, whereas the T-cell receptor α constant gene had the most duplication breakpoints. The functional annotation of genes with the largest incidence of deletion/duplication breakpoints identified 87/112 Kyoto Encyclopedia of Genes and Genomes pathways, but none of the pathways were significantly enriched or depleted with breakpoints. The analysis of Gene Ontology (GO) terms revealed that a cluster with the highest enrichment score among genes with many deletion breakpoints was represented by GO terms related to ion transport, whereas the GO term cluster mostly enriched among the genes with many duplication breakpoints was related to binding of macromolecules. Furthermore, when considering the number of deletion breakpoints per gene functional category, no significant differences were observed between the "housekeeping" and "strong selection" categories, but genes representing the "low selection pressure" group showed a significantly higher number of breakpoints. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Detection limit of intragenic deletions with targeted array comparative genomic hybridization

PubMed Central

2013-01-01

Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

An atypical case of fragile X syndrome caused by a deletion that includes the FMR1 gene.

PubMed Central

Quan, F; Zonana, J; Gunter, K; Peterson, K L; Magenis, R E; Popovich, B W

1995-01-01

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and > or = 9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure of RK's DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5'-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient's unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. Images Figure 5 Figure 2 Figure 4 Figure 6 Figure 7 PMID:7726157

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

PubMed

Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

2018-06-04

Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis

PubMed Central

Nicoletti, Annalisa; Ziccardi, Lucia; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-01-01

Aims: X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. Methods: We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by “home-made” MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Results: Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Conclusion: Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene. PMID:27997221

Single-cell RNA sequencing reveals an altered gene expression pattern as a result of CRISPR/cas9-mediated deletion of Gene 33/Mig6 and chronic exposure to hexavalent chromium in human lung epithelial cells.

PubMed

Park, Soyoung; Zhang, Xiaowen; Li, Cen; Yin, Changhong; Li, Jiangwei; Fallon, John T; Huang, Weihua; Xu, Dazhong

2017-09-01

Gene 33 (Mig6, ERRFI1) is an adaptor protein with multiple cellular functions. We recently reported that depletion of this protein promotes lung epithelial cell transformation induced by hexavalent chromium [Cr(VI)]. However, the early molecular events that mediate this process are not clear. In the present study, we used single-cell RNA sequencing to compare gene expression profiles between BEAS-2B lung epithelial cells chronically exposed to a sublethal dose of Cr(VI) with or without CRISPR/cas9-mediated deletion of Gene 33. Our data reveal 83 differentially expressed genes. The most notable changes are genes associated with cell adhesion, oxidative stresses, protein ubiquitination, epithelial-mesenchymal transition/metastasis, and WNT signaling. Up-regulation of some neuro-specific genes is also evident, particularly ubiquitin carboxyl-terminal hydrolase L1 (UCHL1), a deubiquitinase and potential biomarker for lung cancer. Gene 33 deletion and/or Cr(VI) exposure did not cause discernable changes in cell morphology. However, Gene 33 deletion led to a modest but significant reduction of cells in the G2/M phase of the cell cycle regardless of Cr(VI) exposure. Gene 33 deletion also significantly reduced cell proliferation. Interestingly, Cr(VI) exposure eliminated the difference in cell proliferation between the two genotypes. Gene 33 deletion also significantly elevated cell migration. Our data indicate that combined Gene 33 deletion and chronic Cr(VI) exposure produces a gene expression pattern and a phenotype resemble those of the transformed lung epithelial cells. Given the known association of UCHL1 with lung cancer, we propose that UCHL1 is an important player in the early stage of lung epithelial cell transformation and tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Location of Promoter and Operator Sites in the Biotin Gene Cluster of Escherichia coli

PubMed Central

Cleary, Paul P.; Campbell, Allan; Chang, Robin

1972-01-01

Biotin independence in E. coli requires five closely linked genes, bioA, bioB, bioF, bioC, and bioD. The residual gene activity of deletion mutants has been studied by complementation and enzyme assays. Deletion of the left end of the bioA gene does not impair expression of the remaining genes, but deletions from the left extending into bioB abolish all gene expression. Nonsense mutations in bioB reduce expression of bioC, bioF, and bioD. Therefore, the four genes, bioB, bioF, bioC, and bioD, are transcribed as a unit from left to right, from a promotor located between bioA and bioB. Expression of the bio genes is repressible by added biotin. Deletions removing the left end of bioA do not affect repressibility of bioD. Therefore the operator, as well as the promoter, lie to the right of bioA. One deletion that removes bioA, bioB, and bioF renders the bioD gene constitutive, presumably by fusion to an unknown operon. Therefore, the operator lies to the left of bioC. PMID:4559599

Detection of α-thalassemia-1 Southeast Asian and Thai Type Deletions and β-thalassemia 3.5-kb Deletion by Single-tube Multiplex Real-time PCR with SYBR Green1 and High-resolution Melting Analysis

PubMed Central

Wiengkum, Thanatcha; Srithep, Sarinee; Chainoi, Isarapong; Singboottra, Panthong; Wongwiwatthananukit, Sanchai

2011-01-01

Background Prevention and control of thalassemia requires simple, rapid, and accurate screening tests for carrier couples who are at risk of conceiving fetuses with severe thalassemia. Methods Single-tube multiplex real-time PCR with SYBR Green1 and high-resolution melting (HRM) analysis were used for the identification of α-thalassemia-1 Southeast Asian (SEA) and Thai type deletions and β-thalassemia 3.5-kb gene deletion. The results were compared with those obtained using conventional gap-PCR. DNA samples were derived from 28 normal individuals, 11 individuals with α-thalassemia-1 SEA type deletion, 2 with α-thalassemia-1 Thai type deletion, and 2 with heterozygous β-thalassemia 3.5-kb gene deletion. Results HRM analysis indicated that the amplified fragments from α-thalassemia-1 SEA type deletion, α-thalassemia-1 Thai type deletion, β-thalassemia 3.5-kb gene deletion, and the wild-type β-globin gene had specific peak heights at mean melting temperature (Tm) values of 86.89℃, 85.66℃, 77.24℃, and 74.92℃, respectively. The results obtained using single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis showed 100% consistency with those obtained using conventional gap-PCR. Conclusions Single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis is a potential alternative for routine clinical screening of the common types of α- and β-thalassemia large gene deletions, since it is simple, cost-effective, and highly accurate. PMID:21779184

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

Copy number variants in attention-deficit hyperactive disorder: identification of the 15q13 deletion and its functional role.

PubMed

Valbonesi, Stefano; Magri, Chiara; Traversa, Michele; Faraone, Stephen V; Cattaneo, Annamaria; Milanesi, Elena; Valenti, Vera; Gennarelli, Massimo; Scassellati, Catia

2015-04-01

Evidence has supported a role for rare copy number variants in the etiology of attention-deficit hyperactivity disorder (ADHD), in particular, the region 15q13, which is also a hot spot for several neuropsychiatric disorders. This region spans several genes, but their role and the biological implications remain unclear. We carried out, for the first time, an analysis of the 15q13 region in an Italian cohort of 117 ADHD patients and 77 controls using the MLPA method, confirmed by a genome single-nucleotide polymorphism array. In addition, we probed for downstream effects of the 15q13 deletions on gene expression by carrying out a transcriptomic analysis in blood. We found 15q13 deletions in two ADHD patients and identified 129 genes as significantly dysregulated in the blood of the two ADHD patients carrying 15q13 deletions compared with ADHD patients without 15q13 deletions. As expected, genes in the deleted region (KLF13, MTMR10) were downregulated in the two patients with deletions. Moreover, a pathway analysis identified apoptosis, oxidation reduction, and immune response as the mechanisms that were altered most significantly in the ADHD patients with 15q13 deletions. Interestingly, we showed that deletions in KLF13 and CHRNA7 influenced the expression of genes belonging to the same immune/inflammatory and oxidative stress signaling pathways. Our findings are consistent with the presence of 15q13 deletions in Italian ADHD patients. More interestingly, we show that pathways related to immune/inflammatory response and oxidative stress signaling are affected by the deletion of KFL13 and CHRNA7. Because the phenotypic effects of 15q13 are pleiotropic, our findings suggest that there are shared biologic pathways among multiple neuropsychiatric conditions.

Deletion mapping of chromosome 13q in head and neck squamous cell carcinoma in Indian patients: correlation with prognosis of the tumour

PubMed Central

Sabbir, Golam Md; Roy, Anup; Mandal, Syamsundar; Dam, Aniruddha; Roychoudhury, Susanta; Panda, Chinmay Kumar

2006-01-01

Deletions in chromosome (chr.) 13q occur frequently in head and neck squamous cell carcinoma (HNSCC). Previous studies failed to identify common deleted regions in chr.13q, though several candidate tumour suppressor genes (TSGs) loci, e.g. BRCA2, RB1 and BRCAX have been localized in this chromosome, as well as no prognostic significance of the deletion has been reported. Thus, in the present study, deletion mapping of chr. 13q has been done in 55 primary HNSCC samples of Indian patients using 11 highly polymorphic microsatellite markers of which three were intragenic to BRCA2 gene, one intragenic to RB1 gene and another from BRCAX locus. The deletion in chr.13q was significantly associated with progression of HNSCC. High frequencies (27–39%) of loss of heterozygosity were found in 13q13.1 (BRCA2), 13q14.2 (RB1), 13q21.2–22.1 (BRCAX) and 13q31.1 regions. Deletions in the BRCA2 and RB1 regions were significantly correlated. The four highly deleted regions were associated with clinical stage and histological grades of the tumour as well as poor patient outcome. Deletion in the 13q31.1 region was only found to be associated with HPV infection. High frequencies (11–23%) of microsatellite size alteration (MA) were seen to overlap with the highly deleted regions. Forty per cent of the samples showed rare biallelic alteration whereas loss of normal copy of chromosome 13q was seen in five tumours. Thus, it seems that the putative TSGs located in the BRCAX and 13q31.1 regions as well as the BRCA2 and RB1 genes may have some cumulative effect in progression and poor prognosis of HNSCC. Significant association between deletion in BRCA2 and RB1 gene loci may indicate functional relationship between the genes in this tumour progression. PMID:16623759

Deletion of 8.5 Mb, including the FMR1 gene, in a male with the fragile X syndrome phenotype and overgrowth.

PubMed

Parvari, R; Mumm, S; Galil, A; Manor, E; Bar-David, Y; Carmi, R

1999-04-02

A four-year-old boy with severe psychomotor retardation, facial appearance consistent with the fragile X syndrome, hypotonia, and overgrowth was found to have a deletion including the fragile X gene (FMR1). The breakpoints of the deletion were established between CDR1 and sWXD2905 (approximately 200 kb apart) at Xq27.1 (centromeric) and between DXS8318 (612-1078L) and DXS7847 (576-291L) (approximately 250 kb apart) at Xq28, about 500 kb telomeric to the FMR1 gene. The total length of the deletion is approximately 8.5 Mb. The propositus's mother, who was found to be a carrier of the deletion, showed very mild mental impairment. Except for mental retardation, which is a common finding in all cases reported with similar deletions of chromosome Xq, this patient had generalized overgrowth, exceeding the 97th centile for height and weight. Obesity and increased growth parameters have been reported in other patients with deletions either overlapping or within a distance of 0.5 Mb from the deletion in the present patient. Thus, it is suggested that a deletion of the 8-Mb fragment centromeric to the FMR1 gene might have an effect on growth.

A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

PubMed

Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

2014-01-01

Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small-eye and belly-spotting phenotypes.

PubMed

Favor, Jack; Bradley, Alan; Conte, Nathalie; Janik, Dirk; Pretsch, Walter; Reitmeir, Peter; Rosemann, Michael; Schmahl, Wolfgang; Wienberg, Johannes; Zaus, Irmgard

2009-08-01

In the mouse Pax6 function is critical in a dose-dependent manner for proper eye development. Pax6 contiguous gene deletions were shown to be homozygous lethal at an early embryonic stage. Heterozygotes express belly spotting and extreme microphthalmia. The eye phenotype is more severe than in heterozygous Pax6 intragenic null mutants, raising the possibility that deletions are functionally different from intragenic null mutations or that a region distinct from Pax6 included in the deletions affects eye phenotype. We recovered and identified the exact regions deleted in three new Pax6 deletions. All are homozygous lethal at an early embryonic stage. None express belly spotting. One expresses extreme microphthalmia and two express the milder eye phenotype similar to Pax6 intragenic null mutants. Analysis of Pax6 expression levels and the major isoforms excluded the hypothesis that the deletions expressing extreme microphthalmia are directly due to the action of Pax6 and functionally different from intragenic null mutations. A region distinct from Pax6 containing eight genes was identified for belly spotting. A second region containing one gene (Rcn1) was identified for the extreme microphthalmia phenotype. Rcn1 is a Ca(+2)-binding protein, resident in the endoplasmic reticulum, participates in the secretory pathway and expressed in the eye. Our results suggest that deletion of Rcn1 directly or indirectly contributes to the eye phenotype in Pax6 contiguous gene deletions.

Identification of single gene deletions at 15q13.3: further evidence that CHRNA7 causes the 15q13.3 microdeletion syndrome phenotype.

PubMed

Hoppman-Chaney, N; Wain, K; Seger, P R; Superneau, D W; Hodge, J C

2013-04-01

The 15q13.3 microdeletion syndrome (OMIM #612001) is characterized by a wide range of phenotypic features, including intellectual disability, seizures, autism, and psychiatric conditions. This deletion is inherited in approximately 75% of cases and has been found in mildly affected and normal parents, consistent with variable expressivity and incomplete penetrance. The common deletion is approximately 2 Mb and contains several genes; however, the gene(s) responsible for the resulting clinical features have not been clearly defined. Recently, four probands were reported with small deletions including only the CHRNA7 gene. These patients showed a wide range of phenotypic features similar to those associated with the larger 15q13.3 microdeletion. To further correlate genotype and phenotype, we queried our database of >15,000 patients tested in the Mayo Clinic Cytogenetics Laboratory from 2008 to 2011 and identified 19 individuals (10 probands and 9 family members) with isolated heterozygous CHRNA7 gene deletions. All but two infants displayed multiple features consistent with 15q13.3 microdeletion syndrome. We also identified the first de novo deletion confined to CHRNA7 as well as the second known case with homozygous deletion of CHRNA7 only. These results provide further evidence implicating CHRNA7 as the gene responsible for the clinical findings associated with 15q13.3 microdeletion. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.

PubMed

Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V

1992-12-01

Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the aniridia candidate gene (AN2) and the Wilms tumor predisposition gene (WT1). This is therefore a rare case of an inherited WAGR deletion. Wilms tumor has so far only been associated with sporadic de novo aniridia cases. We have shown that a cosmid probe for a candidate aniridia gene, homologous to the mouse Pax-6 gene, is deleted in cell lines from aniridia patients with previously characterized deletions at 11p13, while another cosmid marker mapping between two aniridia-associated translocation breakpoints (and hence a second candidate marker) is present on both chromosomes. These results support the Pax-6 homologue as a strong candidate for the AN2 gene. FISH with cosmid probes has proved to be a fast and reliable technique for the molecular analysis of deletions. It can be used with limited amounts of material and has strong potential for clinical applications.

Smaller and larger deletions of the Williams Beuren syndrome region implicate genes involved in mild facial phenotype, epilepsy and autistic traits.

PubMed

Fusco, Carmela; Micale, Lucia; Augello, Bartolomeo; Teresa Pellico, Maria; Menghini, Deny; Alfieri, Paolo; Cristina Digilio, Maria; Mandriani, Barbara; Carella, Massimo; Palumbo, Orazio; Vicari, Stefano; Merla, Giuseppe

2014-01-01

Williams Beuren syndrome (WBS) is a multisystemic disorder caused by a hemizygous deletion of 1.5 Mb on chromosome 7q11.23 spanning 28 genes. A few patients with larger and smaller WBS deletion have been reported. They show clinical features that vary between isolated SVAS to the full spectrum of WBS phenotype, associated with epilepsy or autism spectrum behavior. Here we describe four patients with atypical WBS 7q11.23 deletions. Two carry ~3.5 Mb larger deletion towards the telomere that includes Huntingtin-interacting protein 1 (HIP1) and tyrosine 3-monooxygenase/tryptophan 5-monooxigenase activation protein gamma (YWHAG) genes. Other two carry a shorter deletion of ~1.2 Mb at centromeric side that excludes the distal WBS genes BAZ1B and FZD9. Along with previously reported cases, genotype-phenotype correlation in the patients described here further suggests that haploinsufficiency of HIP1 and YWHAG might cause the severe neurological and neuropsychological deficits including epilepsy and autistic traits, and that the preservation of BAZ1B and FZD9 genes may be related to mild facial features and moderate neuropsychological deficits. This report highlights the importance to characterize additional patients with 7q11.23 atypical deletions comparing neuropsychological and clinical features between these individuals to shed light on the pathogenic role of genes within and flanking the WBS region.

Antiviral resistance due to deletion in the neuraminidase gene and defective interfering-like viral polymerase basic 2 RNA of influenza A virus subtype H3N2.

PubMed

Trebbien, Ramona; Christiansen, Claus Bohn; Fischer, Thea Kølsen

2018-05-01

Antiviral treatment of influenza virus infections can lead to drug resistance of virus. This study investigates a selection of mutations in the full genome of H3N2 influenza A virus isolated from a patient in treatment with oseltamivir. Respiratory samples from a patient were collected before, during, and after antiviral treatment. Whole genome sequencing of the influenza virus by next generation sequencing, and low-frequency-variant analysis was performed. Neuraminidase-inhibition tests were performed with oseltamivir and zanamivir, and viruses were propagated in sial-transferase gene transfected Madin-Darby Canine Kidney cells. A deletion at amino acid position 245-248 in the neuraminidase gene occurred after initiation of treatment with oseltamivir. The deleted virus had highly reduced inhibition against oseltamivir but was sensitive to zanamivir. Nine days after discontinuation of oseltamivir treatment the deleted H3N2 virus was still present in the patient. After three passages of the deleted virus in cell culture, the deletion was retained. Several variant mutations appeared in the other genes of the H3N2 virus, where most striking were two major out-of-frame deletions in the polymerase basic 2 (PB2) gene, indicating defective interfering-like viral RNA. The viruses harboring the 245-248 deletion in the neuraminidase gene were still present after discontinuation of oseltamivir treatment and passages in cell cultures, indicating a potential risk for transmission of the deleted virus. Full genome deep sequencing was useful to reveal variant mutations that might be selected due to antiviral treatment, and defective interfering-like viral PB2 RNA in the respiratory samples was detected. Copyright © 2018 Elsevier B.V. All rights reserved.

An interstitial 15q11-q14 deletion: expanded Prader-Willi syndrome phenotype.

PubMed

Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Cooley, Linda D; Yu, Shihui

2010-02-01

We present an infant girl with a de novo interstitial deletion of the chromosome 15q11-q14 region, larger than the typical deletion seen in Prader-Willi syndrome (PWS). She presented with features seen in PWS including hypotonia, a poor suck, feeding problems, and mild micrognathia. She also presented with features not typically seen in PWS such as preauricular ear tags, a high-arched palate, edematous feet, coarctation of the aorta, a PDA, and a bicuspid aortic valve. G-banded chromosome analysis showed a large de novo deletion of the proximal long arm of chromosome 15 confirmed using FISH probes (D15511 and GABRB3). Methylation testing was abnormal and consistent with the diagnosis of PWS. Because of the large appearing deletion by karyotype analysis, an array comparative genomic hybridization (aCGH) was performed. A 12.3 Mb deletion was found which involved the 15q11-q14 region containing approximately 60 protein coding genes. This rare deletion was approximately twice the size of the typical deletion seen in PWS and involved the proximal breakpoint BP1 and the distal breakpoint was located in the 15q14 band between previously recognized breakpoints BP5 and BP6. The deletion extended slightly distal to the AVEN gene including the neighboring CHRM5 gene. There is no evidence that the genes in the 15q14 band are imprinted; therefore, their potential contribution in this patient's expanded PWS phenotype must be a consequence of dosage sensitivity of the genes or due to altered expression of intact neighboring genes from a position effect. Copyright 2010 Wiley-Liss, Inc.

Highly efficient gene targeting in Aspergillus oryzae industrial strains under ligD mutation introduced by genome editing: Strain-specific differences in the effects of deleting EcdR, the negative regulator of sclerotia formation.

PubMed

Nakamura, Hidetoshi; Katayama, Takuya; Okabe, Tomoya; Iwashita, Kazuhiro; Fujii, Wataru; Kitamoto, Katsuhiko; Maruyama, Jun-Ichi

2017-07-11

Numerous strains of Aspergillus oryzae are industrially used for Japanese traditional fermentation and for the production of enzymes and heterologous proteins. In A. oryzae, deletion of the ku70 or ligD genes involved in non-homologous end joining (NHEJ) has allowed high gene targeting efficiency. However, this strategy has been mainly applied under the genetic background of the A. oryzae wild strain RIB40, and it would be laborious to delete the NHEJ genes in many A. oryzae industrial strains, probably due to their low gene targeting efficiency. In the present study, we generated ligD mutants from the A. oryzae industrial strains by employing the CRISPR/Cas9 system, which we previously developed as a genome editing method. Uridine/uracil auxotrophic strains were generated by deletion of the pyrG gene, which was subsequently used as a selective marker. We examined the gene targeting efficiency with the ecdR gene, of which deletion was reported to induce sclerotia formation under the genetic background of the strain RIB40. As expected, the deletion efficiencies were high, around 60~80%, in the ligD mutants of industrial strains. Intriguingly, the effects of the ecdR deletion on sclerotia formation varied depending on the strains, and we found sclerotia-like structures under the background of the industrial strains, which have never been reported to form sclerotia. The present study demonstrates that introducing ligD mutation by genome editing is an effective method allowing high gene targeting efficiency in A. oryzae industrial strains.

[Orthopoxvirus genes for kelch-like proteins. III. Construction of mousepox (ectromelia) virus variants with targeted gene deletions].

PubMed

Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N

2009-01-01

Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.

Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

PubMed

Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

2014-11-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

UCP2 and 3 deletion screening and distribution in 15 pig breeds.

PubMed

Li, Yanhua; Li, Hanjie; Zhao, Xingbo; Li, Ning; Wu, Changxin

2007-02-01

The uncoupling protein family is a mitochondrial anion carrier family. It plays an important role in the biological traits of animal body weight, basal metabolic rate and energy conversion. Using PCR and PCR-SSCP, we scanned the porcine uncoupling protein 2 gene (UCP2) and uncoupling protein 3 gene (UCP3) and found seven deletion sites, three in UCP2 and four in UCP3. The deletions in 15 pig breeds showed that deletion influenced weight. The genotype compounding of seven deletion sites in 15 pig breeds had significant effects on performance traits of the pig, such as body weight. We predicted the potential protein factor binding sites using the transcription factor analysis tool TFSearch version 1.3 online. Two deletions (1830 nt and 3219 nt) in UCP3 were found to change the transcriptional factor sites. The 16 bp deletion in 1830 nt added a SP1 site and a 6 bp deletion in 3219 nt removed two MZF1 sites. Seven deletion polymorphisms were covered in introns of linkage genes of UCP2 and UCP3, showing that UCPs have conservation and genetic reliability.

A large homozygous deletion in the SAMHD1 gene causes atypical Aicardi–Goutiéres syndrome associated with mtDNA deletions

PubMed Central

Leshinsky-Silver, Esther; Malinger, Gustavo; Ben-Sira, Liat; Kidron, Dvora; Cohen, Sarit; Inbar, Shani; Bezaleli, Tali; Levine, Arie; Vinkler, Chana; Lev, Dorit; Lerman-Sagie, Tally

2011-01-01

Aicardi–Goutiéres syndrome (AGS) is a genetic neurodegenerative disorder with clinical symptoms mimicking a congenital viral infection. Five causative genes have been described: three prime repair exonuclease1 (TREX1), ribonucleases H2A, B and C, and most recently SAM domain and HD domain 1 (SAMHD1). We performed a detailed clinical and molecular characterization of a family with autosomal recessive neurodegenerative disorder showing white matter destruction and calcifications, presenting in utero and associated with multiple mtDNA deletions. A muscle biopsy was normal and did not show any evidence of respiratory chain dysfunction. Southern blot analysis of tissue from a living child and affected fetuses demonstrated multiple mtDNA deletions. Molecular analysis of genes involved in mtDNA synthesis and maintenance (POLGα, POLGβ, Twinkle, ANT1, TK2, SUCLA1 and DGOUK) revealed normal sequences. Sequencing of TREX1 and ribonucleases H2A, B and C failed to reveal any mutations. Whole-genome homozygosity mapping revealed a candidate region containing the SAMHD1 gene. Sequencing of the gene in the affected child and two affected fetuses revealed a large deletion (9 kb), spanning the promoter, exon1 and intron 1. The parents were found to be heterozygous for this deletion. The identification of a homozygous large deletion in the SAMHD1 gene causing atypical AGS with multiple mtDNA deletions may add information regarding the involvement of mitochondria in self-activation of innate immunity by cell intrinsic components. PMID:21102625

Opposite Effects of GSTM1 – and GSTT1 – Gene Deletion Variants on Bone Mineral Density

PubMed Central

Mlakar, Simona Jurkovic; Osredkar, Josko; Prezelj, Janez; Marc, Janja

2011-01-01

Oxidative stress is associated with osteoporosis. The glutathione S-transferases form the major detoxifying group of enzymes responsible for eliminating products of oxidative stress. We have therefore proposed GSTM1 and GSTT1 genes as candidates for studying the genetics of osteoporosis. The aim of the present study was to examine possible association of GSTM1 and GSTT1 gene deletion polymorphisms, alone or in combination, with bone mineral density at femoral neck (BMD_fn), lumbar spine (BMD_ls) and total hip (BMD_th) in Slovenian elderly women and men. GSTM1 and GSTT1 gene deletion polymorphisms in 712 elderly people were analyzed using the triplex PCR method for the presence of GSTM1 and GSTT1 gene segments. BMD_fn, BMD_ls and BMD_th were measured by the dual-energy X-ray absorptiometry (DEXA) method. Results were analyzed using univariate statistic model adjusted for sex, body mass index (BMI) and age. Our results showed the significant differences in BMD_th, BMD_ls and BMD_fn values (p = 0.031, 0.017 and 0.023, respectively) in subgroups of GSTT1 gene deletion polymorphism. For GSTM1 gene deletion polymorphism borderline significant association was found with BMD_ls (p = 0.100). Furthermore, subjects with homozygous deletion of GSTT1 gene showed higher BMD values on all measured skeletal sites and, in contrast, subjects with homozygous deletion of GSTM1 gene showed lower BMD values. Moreover, a gene-gene interaction study showed significant association of GSTM1-null and GSTT1-null polymorphisms with BMD_ls values (p = 0.044). Carriers with a combination of the presence of GSTT1 gene and the homozygous absence of GSTM1 gene fragment were associated with the lower BMD values at all skeletal sites. The significant association of combination of GSTT1 gene presence and homozygous absence of GSTM1 gene with BMD was demonstrated, suggesting that it could be used, if validated in other studies, as genetic marker for low BMD. PMID:22048269

Opposite effects of GSTM1--and GSTT1: gene deletion variants on bone mineral density.

PubMed

Mlakar, Simona Jurkovic; Osredkar, Josko; Prezelj, Janez; Marc, Janja

2011-01-01

Oxidative stress is associated with osteoporosis. The glutathione S-transferases form the major detoxifying group of enzymes responsible for eliminating products of oxidative stress. We have therefore proposed GSTM1 and GSTT1 genes as candidates for studying the genetics of osteoporosis. The aim of the present study was to examine possible association of GSTM1 and GSTT1 gene deletion polymorphisms, alone or in combination, with bone mineral density at femoral neck (BMD_fn), lumbar spine (BMD_ls) and total hip (BMD_th) in Slovenian elderly women and men.GSTM1 and GSTT1 gene deletion polymorphisms in 712 elderly people were analyzed using the triplex PCR method for the presence of GSTM1 and GSTT1 gene segments. BMD_fn, BMD_ls and BMD_th were measured by the dual-energy X-ray absorptiometry (DEXA) method. Results were analyzed using univariate statistic model adjusted for sex, body mass index (BMI) and age. Our results showed the significant differences in BMD_th, BMD_ls and BMD_fn values (p=0.031, 0.017 and 0.023, respectively) in subgroups of GSTT1 gene deletion polymorphism. For GSTM1 gene deletion polymorphism borderline significant association was found with BMD_ls (p=0.100). Furthermore, subjects with homozygous deletion of GSTT1 gene showed higher BMD values on all measured skeletal sites and, in contrast, subjects with homozygous deletion of GSTM1 gene showed lower BMD values. Moreover, a gene-gene interaction study showed significant association of GSTM1-null and GSTT1-null polymorphisms with BMD_ls values (p=0.044). Carriers with a combination of the presence of GSTT1 gene and the homozygous absence of GSTM1 gene fragment were associated with the lower BMD values at all skeletal sites. The significant association of combination of GSTT1 gene presence and homozygous absence of GSTM1 gene with BMD was demonstrated, suggesting that it could be used, if validated in other studies, as genetic marker for low BMD.

Homozygous deletions at 3p12 in breast and lung cancer.

PubMed

Sundaresan, V; Chung, G; Heppell-Parton, A; Xiong, J; Grundy, C; Roberts, I; James, L; Cahn, A; Bench, A; Douglas, J; Minna, J; Sekido, Y; Lerman, M; Latif, F; Bergh, J; Li, H; Lowe, N; Ogilvie, D; Rabbitts, P

1998-10-01

We have constructed a physical map of the region homozygously deleted in the U2020 cell line at 3p12, including the location of putative CpG islands. Adjacent to one of these islands, we have identified and cloned a new gene (DUTT1) and used probes from this gene to detect two other homozygous deletions occurring in lung and breast carcinomas: the smallest deletion is within the gene itself and would result in a truncated protein. The DUTT1 gene is a member of the neural cell adhesion molecule family, although its widespread expression suggests it plays a less specialized role compared to other members of the family.

Pleiotropy in microdeletion syndromes: Neurologic and spermatogenic abnormalities in mice homozygous for the p{sup 6H} deletion are likely due to dysfunction of a single gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rinchik, E.M.; Carpenter, D.A.; Handel, M.A.

1995-07-03

Variability and complexity of phenotypes observed in microdeletion syndromes can be due to deletion of a single gene whose product participates in several aspects of development or can be due to the deletion of a number of tightly linked genes, each adding its own effect to the syndrome. The p{sup 6H} deletion in mouse chromosome 7 presents a good model with which to address this question of multigene vs. single-gene pleiotropy. Mice homozygous for the p{sup 6H} deletion are diluted in pigmentation, are smaller than their littermates, and manifest a nervous jerky-gait phenotype. Male homozygotes are sterile and exhibit profoundmore » abnormalities in spermiogenesis. By using N-ethyl-N-nitrosourea (EtNU) mutagenesis and a breeding protocol designed to recover recessive mutations expressed hemizygously opposite a large p-locus deletion, we have generated three noncomplementing mutations that map to the p{sup 6H} deletion. Each of these EtNU-induced mutations has adverse effects on the size, nervous behavior, and progression of spermiogenesis that characterize p{sup 6H} deletion homozygotes. Because etNU is thought to induce primarily intragenic (point) mutations in mouse stem-cell spermatogonia, we propose that the trio of phenotypes (runtiness, nervous jerky gait, and male sterility) expressed in p{sup 6H} deletion homozygotes is the result of deletion of a single highly pleiotropic gene. We also predict that a homologous single locus, quite possibly tightly linked and distal to the D15S12 (P) locus in human chromosome 15q11-q13, may be associated with similar developmental abnormalities in humans. 29 refs., 3 figs., 1 tab.« less

Molecular and clinical characterization of two patients with Prader-Willi syndrome and atypical deletions of proximal chromosome 15q.

PubMed

Calounova, Gabriela; Hedvicakova, Petra; Silhanova, Eva; Kreckova, Gabriela; Sedlacek, Zdenek

2008-08-01

Prader-Willi syndrome (PWS) is caused by the disturbed expression of genes from the imprinted region of 15q11-q13, but the specific contributions of individual genes remain unknown. Most paternal PWS deletions are bracketed by recurrent breakpoints BP1 or BP2 and BP3. Atypical deletions are very rare. In the present work, we describe the molecular analysis of two patients with atypical deletions using microsatellite analysis, methylation-specific MLPA, and microarray CGH. A deletion of about 2 Mb in Patient 1 started at BP2 and ended in the middle of the typically deleted region within the UBE3A gene. The deletion in Patient 2 started 1.3 Mb distal from BP2 within the C15ORF2 gene, extended over 9.5 Mb, and ended within the AVEN gene in proximal 15q14. In Patient 1 both deletion breakpoints involved repetitive regions, which precluded cloning of the junction and pointed to non-allelic homologous recombination as a possible mechanism of this rearrangement. The breakpoints in Patient 2 were sequenced, and their structure suggested non-homologous end joining as the most likely cause of this deletion. The phenotype of both patients did not depart significantly from the typical clinical picture of PWS, although some symptoms in Patient 2 were also reminiscent of the phenotype of individuals with the recently described 15q13.3 microdeletion syndrome. Our findings support previous observations of relatively mild phenotypic effects resulting from deletions that extend distally from the PWS region and observations of the modest effects of different types of genetic defects on the spectrum and severity of symptoms in PWS. Copyright 2008 Wiley-Liss, Inc.

Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene.

PubMed

Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng

2015-01-01

In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. © 2015 by the Association of Clinical Scientists, Inc.

Ninety-six haploid yeast strains with individual disruptions of open reading frames between YOR097C and YOR192C, constructed for the Saccharomyces genome deletion project, have an additional mutation in the mismatch repair gene MSH3.

PubMed

Lehner, Kevin R; Stone, Megan M; Farber, Rosann A; Petes, Thomas D

2007-11-01

As part of the Saccharomyces Genome Deletion Project, sets of presumably isogenic haploid and diploid strains that differed only by single gene deletions were constructed. We found that one set of 96 strains (containing deletions of ORFs located between YOR097C and YOR192C) in the collection, which was derived from the haploid BY4741, has an additional mutation in the MSH3 mismatch repair gene.

Rapid deletion plasmid construction methods for protoplast and Agrobacterium based fungal transformation systems

USDA-ARS?s Scientific Manuscript database

Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2014-01-07

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility

PubMed Central

Machev, N; Saut, N; Longepied, G; Terriou, P; Navarro, A; Levy, N; Guichaoua, M; Metzler-Guillemai..., C; Collignon, P; Frances, A; Belougne, J; Clemente, E; Chiaroni, J; Chevillard, C; Durand, C; Ducourneau, A; Pech, N; McElreavey, K; Mattei, M; Mitchell, M

2004-01-01

Background: Complete deletion of the complete AZFc interval of the Y chromosome is the most common known genetic cause of human male infertility. Two partial AZFc deletions (gr/gr and b1/b3) that remove some copies of all AZFc genes have recently been identified in infertile and fertile populations, and an association study indicates that the resulting gene dose reduction represents a risk factor for spermatogenic failure. Methods: To determine the incidence of various partial AZFc deletions and their effect on fertility, we combined quantitative and qualitative analyses of the AZFc interval at the DAZ and CDY1 loci in 300 infertile men and 399 control men. Results: We detected 34 partial AZFc deletions (32 gr/gr deletions), arising from at least 19 independent deletion events, and found gr/gr deletion in 6% of infertile and 3.5% of control men (p>0.05). Our data provide evidence for two large AZFc inversion polymorphisms, and for relative hot and cold spots of unequal crossing over within the blocks of homology that mediate gr/gr deletion. Using SFVs (sequence family variants), we discriminate DAZ1/2, DAZ3/4, CDY1a (proximal), and CDY1b (distal) and define four types of DAZ-CDY1 gr/gr deletion. Conclusions: The only deletion type to show an association with infertility was DAZ3/4-CDY1a (p = 0.042), suggesting that most gr/gr deletions are neutral variants. We see a stronger association, however, between loss of the CDY1a SFV and infertility (p = 0.002). Thus, loss of this SFV through deletion or gene conversion could be a major risk factor for male infertility. PMID:15520406

Deletion of a target gene in Indica rice via CRISPR/Cas9.

PubMed

Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

2017-08-01

Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

PubMed

Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

2017-01-01

More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia

PubMed Central

Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F.; Morton, Lindsay C.; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Barnwell, John W.

2017-01-01

More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region. PMID:28301474

Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

PubMed

Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

2009-09-01

We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

PubMed Central

Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

2014-01-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

[Detection of bcr/abl fusion gene and its derivative chromosome 9 deletions in CML by using home-made bcr/abl extra-signal probe].

PubMed

Lai, Yue-Yun; Feng, Lin; Wang, Zheng; Lü, Shan; Dang, Hui; Shi, Yan; He, Qi; Huang, Xiao-Jun

2010-02-01

This study was aimed to verify the efficacy of home-made LSI bcr/abl ES probe for detection of bcr/abl fusion gene and derivative chromosome 9 deletions in chronic myeloid leukemia (CML). Fluorescence in situ hybridization (FISH) was carried out with dual color bcr/abl extra signal (ES) probe in 97 cases of CML based on morphology and cytogenetic karyotype and 129 cases of non-hematological malignancies/non-myeloproliferative diseases with normal cytogenetic karyotype. For the patients with signals of 1R1G1F indicating der(9) deletions, FISH were done using ASS DNA probe. The results showed that 91 cases with standard t(9;22) and 6 cases with variant translocation of t(9;22) were detected by conventional G banding technique. All of the 97 patients displayed bcr/abl fusion gene by ES-FISH, including 16 cases with signal patterns of 1R1G1F showing der(9) deletions. Among the 16 cases with der(9) deletions, 13 cases were detected to have deletions of ASS gene. Meanwhile, none of the 129 cases of negative control showed bcr/abl fusion gene by ES-FISH. It is concluded that home-made LSI bcr/abl ES probe is effective to identify the bcr/abl fusion gene and der(9) deletions in CML, and the ES-FISH results are consistent with conventional cytogenetic karyotype.

A new deletion refines the boundaries of the murine Prader–Willi syndrome imprinting center

PubMed Central

DuBose, Amanda J.; Smith, Emily Y.; Yang, Thomas P.; Johnstone, Karen A.; Resnick, James L.

2011-01-01

The human chromosomal 15q11–15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader–Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality. PMID:21659337

A new deletion refines the boundaries of the murine Prader-Willi syndrome imprinting center.

PubMed

Dubose, Amanda J; Smith, Emily Y; Yang, Thomas P; Johnstone, Karen A; Resnick, James L

2011-09-01

The human chromosomal 15q11-15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader-Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality.

Effect of limbal marking prior to laser ablation on the magnitude of cyclotorsional error.

PubMed

Chen, Xiangjun; Stojanovic, Aleksandar; Stojanovic, Filip; Eidet, Jon Roger; Raeder, Sten; Øritsland, Haakon; Utheim, Tor Paaske

2012-05-01

To evaluate the residual registration error after limbal-marking-based manual adjustment in cyclotorsional tracker-controlled laser refractive surgery. Two hundred eyes undergoing custom surface ablation with the iVIS Suite (iVIS Technologies) were divided into limbal marked (marked) and non-limbal marked (unmarked) groups. Iris registration information was acquired preoperatively from all eyes. Preoperatively, the horizontal axis was recorded in the marked group for use in manual cyclotorsional alignment prior to surgical iris registration. During iris registration, the preoperative iris information was compared to the eye-tracker captured image. The magnitudes of the registration error angle and cyclotorsional movement during the subsequent laser ablation were recorded and analyzed. Mean magnitude of registration error angle (absolute value) was 1.82°±1.31° (range: 0.00° to 5.50°) and 2.90°±2.40° (range: 0.00° to 13.50°) for the marked and unmarked groups, respectively (P<.001). Mean magnitude of cyclotorsional movement during the laser ablation (absolute value) was 1.15°±1.34° (range: 0.00° to 7.00°) and 0.68°±0.97° (range: 0.00° to 6.00°) for the marked and unmarked groups, respectively (P=.005). Forty-six percent and 60% of eyes had registration error >2°, whereas 22% and 20% of eyes had cyclotorsional movement during ablation >2° in the marked and unmarked groups, respectively. Limbal-marking-based manual alignment prior to laser ablation significantly reduced cyclotorsional registration error. However, residual registration misalignment and cyclotorsional movements remained during ablation. Copyright 2012, SLACK Incorporated.

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

[Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

PubMed

Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

2016-08-01

To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia 1.

Lack of association between deletion polymorphism of BIM gene and in vitro drug sensitivity in B-cell precursor acute lymphoblastic leukemia.

PubMed

Huang, Meixian; Miyake, Kunio; Kagami, Keiko; Abe, Masako; Shinohara, Tamao; Watanabe, Atsushi; Somazu, Shinpei; Oshiro, Hiroko; Goi, Kumiko; Goto, Hiroaki; Minegishi, Masayoshi; Iwamoto, Shotaro; Kiyokawa, Nobutaka; Sugita, Kanji; Inukai, Takeshi

2017-09-01

A deletion polymorphism in the BIM gene was identified as an intrinsic mechanism for resistance to tyrosine kinase inhibitor in chronic myeloid leukemia patients in East Asia. BIM is also involved in the responses to glucocorticoid and chemotherapy in acute lymphoblastic leukemia (ALL), suggesting a possible association between deletion polymorphism of BIM and the chemosensitivity of ALL. Thus, we analyzed 72 B-cell precursor (BCP)-ALL cell lines established from Japanese patients. Indeed, higher BIM gene expression was associated with good in vitro sensitivities to glucocorticoid and chemotherapeutic agents used in induction therapy. We also analyzed the methylation status of the BIM gene promoter by next generation sequencing of genome bisulfite PCR products, since genetic polymorphism could be insignificant when epigenetically inactivated. Hypermethylation of the BIM gene promoter was associated with lower BIM gene expression and poorer sensitivity to vincristine. Of note, however, the prevalence of a deletion polymorphism was not associated with the BIM gene expression level or drug sensitivities in BCP-ALL cell lines, in which the BIM gene was unmethylated. These observations suggest that an association of a deletion polymorphism of BIM and the response to induction therapy in BCP-ALL may be clinically minimal. Copyright © 2017. Published by Elsevier Ltd.

Characterization of hemizygous deletions in Citrus using array-Comparative Genomic Hybridization and microsynteny comparisons with the poplar genome

PubMed Central

Ríos, Gabino; Naranjo, Miguel A; Iglesias, Domingo J; Ruiz-Rivero, Omar; Geraud, Marion; Usach, Antonio; Talón, Manuel

2008-01-01

Background Many fruit-tree species, including relevant Citrus spp varieties exhibit a reproductive biology that impairs breeding and strongly constrains genetic improvements. In citrus, juvenility increases the generation time while sexual sterility, inbreeding depression and self-incompatibility prevent the production of homozygous cultivars. Genomic technology may provide citrus researchers with a new set of tools to address these various restrictions. In this work, we report a valuable genomics-based protocol for the structural analysis of deletion mutations on an heterozygous background. Results Two independent fast neutron mutants of self-incompatible clementine (Citrus clementina Hort. Ex Tan. cv. Clemenules) were the subject of the study. Both mutants, named 39B3 and 39E7, were expected to carry DNA deletions in hemizygous dosage. Array-based Comparative Genomic Hybridization (array-CGH) using a Citrus cDNA microarray allowed the identification of underrepresented genes in these two mutants. Subsequent comparison of citrus deleted genes with annotated plant genomes, especially poplar, made possible to predict the presence of a large deletion in 39B3 of about 700 kb and at least two deletions of approximately 100 and 500 kb in 39E7. The deletion in 39B3 was further characterized by PCR on available Citrus BACs, which helped us to build a partial physical map of the deletion. Among the deleted genes, ClpC-like gene coding for a putative subunit of a multifunctional chloroplastic protease involved in the regulation of chlorophyll b synthesis was directly related to the mutated phenotype since the mutant showed a reduced chlorophyll a/b ratio in green tissues. Conclusion In this work, we report the use of array-CGH for the successful identification of genes included in a hemizygous deletion induced by fast neutron irradiation on Citrus clementina. The study of gene content and order into the 39B3 deletion also led to the unexpected conclusion that microsynteny and local gene colinearity in this species were higher with Populus trichocarpa than with the phylogenetically closer Arabidopsis thaliana. This work corroborates the potential of Citrus genomic resources to assist mutagenesis-based approaches for functional genetics, structural studies and comparative genomics, and hence to facilitate citrus variety improvement. PMID:18691431

Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

PubMed

Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

2011-03-28

A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis: a new X linked contiguous gene deletion syndrome?

PubMed Central

Jonsson, J J; Renieri, A; Gallagher, P G; Kashtan, C E; Cherniske, E M; Bruttini, M; Piccini, M; Vitelli, F; Ballabio, A; Pober, B R

1998-01-01

We describe a family with four members, a mother, two sons, and a daughter, who show clinical features consistent with X linked Alport syndrome. The two males presented with additional features including mental retardation, dysmorphic facies with marked midface hypoplasia, and elliptocytosis. The elliptocytosis was not associated with any detectable abnormalities in red cell membrane proteins; red cell membrane stability and rigidity was normal on ektacytometry. Molecular characterisation suggests a submicroscopic X chromosome deletion encompassing the entire COL4A5 gene. We propose that the additional abnormalities found in the affected males of this family are attributable to deletion or disruption of X linked recessive genes adjacent to the COL4A5 gene and that this constellation of findings may represent a new X linked contiguous gene deletion syndrome. Images PMID:9598718

Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

PubMed

Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

2015-10-01

Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2013-05-14

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2017-09-12

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2011-05-17

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2016-08-09

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Recurrence and variability of germline EPCAM deletions in Lynch syndrome.

PubMed

Kuiper, Roland P; Vissers, Lisenka E L M; Venkatachalam, Ramprasath; Bodmer, Danielle; Hoenselaar, Eveline; Goossens, Monique; Haufe, Aline; Kamping, Eveline; Niessen, Renée C; Hogervorst, Frans B L; Gille, Johan J P; Redeker, Bert; Tops, Carli M J; van Gijn, Marielle E; van den Ouweland, Ans M W; Rahner, Nils; Steinke, Verena; Kahl, Philip; Holinski-Feder, Elke; Morak, Monika; Kloor, Matthias; Stemmler, Susanne; Betz, Beate; Hutter, Pierre; Bunyan, David J; Syngal, Sapna; Culver, Julie O; Graham, Tracy; Chan, Tsun L; Nagtegaal, Iris D; van Krieken, J Han J M; Schackert, Hans K; Hoogerbrugge, Nicoline; van Kessel, Ad Geurts; Ligtenberg, Marjolijn J L

2011-04-01

Recently, we identified 3' end deletions in the EPCAM gene as a novel cause of Lynch syndrome. These truncating EPCAM deletions cause allele-specific epigenetic silencing of the neighboring DNA mismatch repair gene MSH2 in tissues expressing EPCAM. Here we screened a cohort of unexplained Lynch-like families for the presence of EPCAM deletions. We identified 27 novel independent MSH2-deficient families from multiple geographical origins with varying deletions all encompassing the 3' end of EPCAM, but leaving the MSH2 gene intact. Within The Netherlands and Germany, EPCAM deletions appeared to represent at least 2.8% and 1.1% of the confirmed Lynch syndrome families, respectively. MSH2 promoter methylation was observed in epithelial tissues of all deletion carriers tested, thus confirming silencing of MSH2 as the causative defect. In a total of 45 families, 19 different deletions were found, all including the last two exons and the transcription termination signal of EPCAM. All deletions appeared to originate from Alu-repeat mediated recombination events. In 17 cases regions of microhomology around the breakpoints were found, suggesting nonallelic homologous recombination as the most likely mechanism. We conclude that 3' end EPCAM deletions are a recurrent cause of Lynch syndrome, which should be implemented in routine Lynch syndrome diagnostics. © 2011 Wiley-Liss, Inc.

Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

PubMed

Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

2016-09-01

Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

PubMed

Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

2013-01-01

Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

PubMed

Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

2016-06-01

The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

Unique and atypical deletions in Prader–Willi syndrome reveal distinct phenotypes

PubMed Central

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-01-01

Prader–Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1–BP3 and BP2–BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions. PMID:22045295

Unique and atypical deletions in Prader-Willi syndrome reveal distinct phenotypes.

PubMed

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-03-01

Prader-Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1-BP3 and BP2-BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quan, F.; Zonana, J.; Gunter, K.

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and {ge}9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure ofmore » RK`s DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5{prime}-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient`s unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. 36 refs., 7 figs.« less

Lysis Delay and Burst Shrinkage of Coliphage T7 by Deletion of Terminator Tφ Reversed by Deletion of Early Genes

PubMed Central

Nguyen, Huong Minh

2014-01-01

ABSTRACT Bacteriophage T7 terminator Tφ is a class I intrinsic terminator coding for an RNA hairpin structure immediately followed by oligo(U), which has been extensively studied in terms of its transcription termination mechanism, but little is known about its physiological or regulatory functions. In this study, using a T7 mutant phage, where a 31-bp segment of Tφ was deleted from the genome, we discovered that deletion of Tφ from T7 reduces the phage burst size but delays lysis timing, both of which are disadvantageous for the phage. The burst downsizing could directly result from Tφ deletion-caused upregulation of gene 17.5, coding for holin, among other Tφ downstream genes, because infection of gp17.5-overproducing Escherichia coli by wild-type T7 phage showed similar burst downsizing. However, the lysis delay was not associated with cellular levels of holin or lysozyme or with rates of phage adsorption. Instead, when allowed to evolve spontaneously in five independent adaptation experiments, the Tφ-lacking mutant phage, after 27 or 29 passages, recovered both burst size and lysis time reproducibly by deleting early genes 0.5, 0.6, and 0.7 of class I, among other mutations. Deletion of genes 0.5 to 0.7 from the Tφ-lacking mutant phage decreased expression of several Tφ downstream genes to levels similar to that of the wild-type phage. Accordingly, phage T7 lysis timing is associated with cellular levels of Tφ downstream gene products. This suggests the involvement of unknown factor(s) besides the known lysis proteins, lysozyme and holin, and that Tφ plays a role of optimizing burst size and lysis time during T7 infection. IMPORTANCE E. coli PMID:24335287

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Identification and characterization of large DNA deletions affecting oil quality traits in soybean seeds through transcriptome sequencing analysis.

PubMed

Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles

2016-08-01

Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.

[Gene deletion and functional analysis of the heptyl glycosyltransferase (waaF) gene in Vibrio parahemolyticus O-antigen cluster].

PubMed

Zhao, Feng; Meng, Songsong; Zhou, Deqing

2016-02-04

To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.

Large deletions play a minor but essential role in congenital coagulation factor VII and X deficiencies.

PubMed

Rath, M; Najm, J; Sirb, H; Kentouche, K; Dufke, A; Pauli, S; Hackmann, K; Liehr, T; Hübner, C A; Felbor, U

2015-01-01

Congenital factor VII (FVII) and factor X (FX) deficiencies belong to the group of rare bleeding disorders which may occur in separate or combined forms since both the F7 and F10 genes are located in close proximity on the distal long arm of chromosome 13 (13q34). We here present data of 192 consecutive index cases with FVII and/or FX deficiency. 10 novel and 53 recurrent sequence alterations were identified in the F7 gene and 5 novel as well as 11 recurrent in the F10 gene including one homozygous 4.35 kb deletion within F7 (c.64+430_131-6delinsTCGTAA) and three large heterozygous deletions involving both the F7 and F10 genes. One of the latter proved to be cytogenetically visible as a chromosome 13q34 deletion and associated with agenesis of the corpus callosum and psychomotor retardation. Large deletions play a minor but essential role in the mutational spectrum of the F7 and F10 genes. Copy number analyses (e. g. MLPA) should be considered if sequencing cannot clarify the underlying reason of an observed coagulopathy. Of note, in cases of combined FVII/FX deficiency, a deletion of the two contiguous genes might be part of a larger chromosomal rearrangement.

Molecular Inversion Probe Analysis of Gene Copy Alterations Reveals Distinct Categories of Colorectal Carcinoma

PubMed Central

Ji, Hanlee; Kumm, Jochen; Zhang, Michael; Farnam, Kyle; Salari, Keyan; Faham, Malek; Ford, James M.; Davis, Ronald W.

2006-01-01

Genomic instability is a major feature of neoplastic development in colorectal carcinoma and other cancers. Specific genomic instability events, such as deletions in chromosomes and other alterations in gene copy number, have potential utility as biologically relevant prognostic biomarkers. For example, genomic deletions on chromosome arm 18q are an indicator of colorectal carcinoma behavior and potentially useful as a prognostic indicator. Adapting a novel genomic technology called molecular inversion probes which can determine gene copy alterations, such as genomic deletions, we designed a set of probes to interrogate several hundred individual exons of >200 cancer genes with an overall distribution covering all chromosome arms. In addition, >100 probes were designed in close proximity of microsatellite markers on chromosome arm 18q. We analyzed a set of colorectal carcinoma cell lines and primary colorectal tumor samples for gene copy alterations and deletion mutations in exons. Based on clustering analysis, we distinguished the different categories of genomic instability among the colorectal cancer cell lines. Our analysis of primary tumors uncovered several distinct categories of colorectal carcinoma, each with specific patterns of 18q deletions and deletion mutations in specific genes. This finding has potential clinical ramifications given the application of 18q loss of heterozygosity events as a potential indicator for adjuvant treatment in stage II colorectal carcinoma. PMID:16912164

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Inference about density and temporary emigration in unmarked populations

USGS Publications Warehouse

Chandler, Richard B.; Royle, J. Andrew; King, David I.

2011-01-01

Few species are distributed uniformly in space, and populations of mobile organisms are rarely closed with respect to movement, yet many models of density rely upon these assumptions. We present a hierarchical model allowing inference about the density of unmarked populations subject to temporary emigration and imperfect detection. The model can be fit to data collected using a variety of standard survey methods such as repeated point counts in which removal sampling, double-observer sampling, or distance sampling is used during each count. Simulation studies demonstrated that parameter estimators are unbiased when temporary emigration is either "completely random" or is determined by the size and location of home ranges relative to survey points. We also applied the model to repeated removal sampling data collected on Chestnut-sided Warblers (Dendroica pensylvancia) in the White Mountain National Forest, USA. The density estimate from our model, 1.09 birds/ha, was similar to an estimate of 1.11 birds/ha produced by an intensive spot-mapping effort. Our model is also applicable when processes other than temporary emigration affect the probability of being available for detection, such as in studies using cue counts. Functions to implement the model have been added to the R package unmarked.

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

Radiation-induced total-deletion mutations in the human hprt gene: a biophysical model based on random walk interphase chromatin geometry

NASA Technical Reports Server (NTRS)

Wu, H.; Sachs, R. K.; Yang, T. C.

1998-01-01

PURPOSE: To develop a biophysical model that explains the sizes of radiation-induced hprt deletions. METHODS: Key assumptions: (1) Deletions are produced by two DSB that are closer than an interaction distance at the time of DSB induction; (2) Interphase chromatin is modelled by a biphasic random walk distribution; and (3) Misrejoining of DSB from two separate tracks dominates at low-LET and misrejoining of DSB from a single track dominates at high-LET. RESULTS: The size spectra for radiation-induced total deletions of the hprt gene are calculated. Comparing with the results of Yamada and coworkers for gamma-irradiated human fibroblasts the study finds that an interaction distance of 0.75 microm will fit both the absolute frequency and the size spectrum of the total deletions. It is also shown that high-LET radiations produce, relatively, more total deletions of sizes below 0.5 Mb. The model predicts an essential gene to be located between 2 and 3 Mb from the hprt locus towards the centromere. Using the same assumptions and parameters as for evaluating mutation frequencies, a frequency of intra-arm chromosome deletions is calculated that is in agreement with experimental data. CONCLUSIONS: Radiation-induced total-deletion mutations of the human hprt gene and intrachange chromosome aberrations share a common mechanism for their induction.

A Genetic System for Clostridium ljungdahlii: a Chassis for Autotrophic Production of Biocommodities and a Model Homoacetogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leang, C; Ueki, T; Nevin, KP

Methods for genetic manipulation of Clostridium ljungdahlii are of interest because of the potential for production of fuels and other biocommodities from carbon dioxide via microbial electrosynthesis or more traditional modes of autotrophy with hydrogen or carbon monoxide as the electron donor. Furthermore, acetogenesis plays an important role in the global carbon cycle. Gene deletion strategies required for physiological studies of C. ljungdahlii have not previously been demonstrated. An electroporation procedure for introducing plasmids was optimized, and four different replicative origins for plasmid propagation in C. ljungdahlii were identified. Chromosomal gene deletion via double-crossover homologous recombination with a suicide vectormore » was demonstrated initially with deletion of the gene for FliA, a putative sigma factor involved in flagellar biogenesis and motility in C. ljungdahlii. Deletion of fliA yielded a strain that lacked flagella and was not motile. To evaluate the potential utility of gene deletions for functional genomic studies and to redirect carbon and electron flow, the genes for the putative bifunctional aldehyde/alcohol dehydrogenases, adhE1 and adhE2, were deleted individually or together. Deletion of adhE1, but not adhE2, diminished ethanol production with a corresponding carbon recovery in acetate. The double deletion mutant had a phenotype similar to that of the adhE1-deficient strain. Expression of adhE1 in trans partially restored the capacity for ethanol production. These results demonstrate the feasibility of genetic investigations of acetogen physiology and the potential for genetic manipulation of C. ljungdahlii to optimize autotrophic biocommodity production.« less

Bacterial genome reduction using the progressive clustering of deletions via yeast sexual cycling

DOE PAGES

Suzuki, Yo; Assad-Garcia, Nacyra; Kostylev, Maxim; ...

2015-02-05

The availability of genetically tractable organisms with simple genomes is critical for the rapid, systems-level understanding of basic biological processes. Mycoplasma bacteria, with the smallest known genomes among free-living cellular organisms, are ideal models for this purpose, but the natural versions of these cells have genome complexities still too great to offer a comprehensive view of a fundamental life form. Here in this paper we describe an efficient method for reducing genomes from these organisms by identifying individually deletable regions using transposon mutagenesis and progressively clustering deleted genomic segments using meiotic recombination between the bacterial genomes harbored in yeast. Mycoplasmalmore » genomes subjected to this process and transplanted into recipient cells yielded two mycoplasma strains. The first simultaneously lacked eight singly deletable regions of the genome, representing a total of 91 genes and ~10%of the original genome. The second strain lacked seven of the eight regions, representing 84 genes. Growth assay data revealed an absence of genetic interactions among the 91 genes under tested conditions. Despite predicted effects of the deletions on sugar metabolism and the proteome, growth rates were unaffected by the gene deletions in the seven-deletion strain. These results support the feasibility of using single-gene disruption data to design and construct viable genomes lacking multiple genes, paving the way toward genome minimization. The progressive clustering method is expected to be effective for the reorganization of any mega-sized DNA molecules cloned in yeast, facilitating the construction of designer genomes in microbes as well as genomic fragments for genetic engineering of higher eukaryotes.« less

Bacterial genome reduction using the progressive clustering of deletions via yeast sexual cycling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Yo; Assad-Garcia, Nacyra; Kostylev, Maxim

The availability of genetically tractable organisms with simple genomes is critical for the rapid, systems-level understanding of basic biological processes. Mycoplasma bacteria, with the smallest known genomes among free-living cellular organisms, are ideal models for this purpose, but the natural versions of these cells have genome complexities still too great to offer a comprehensive view of a fundamental life form. Here in this paper we describe an efficient method for reducing genomes from these organisms by identifying individually deletable regions using transposon mutagenesis and progressively clustering deleted genomic segments using meiotic recombination between the bacterial genomes harbored in yeast. Mycoplasmalmore » genomes subjected to this process and transplanted into recipient cells yielded two mycoplasma strains. The first simultaneously lacked eight singly deletable regions of the genome, representing a total of 91 genes and ~10%of the original genome. The second strain lacked seven of the eight regions, representing 84 genes. Growth assay data revealed an absence of genetic interactions among the 91 genes under tested conditions. Despite predicted effects of the deletions on sugar metabolism and the proteome, growth rates were unaffected by the gene deletions in the seven-deletion strain. These results support the feasibility of using single-gene disruption data to design and construct viable genomes lacking multiple genes, paving the way toward genome minimization. The progressive clustering method is expected to be effective for the reorganization of any mega-sized DNA molecules cloned in yeast, facilitating the construction of designer genomes in microbes as well as genomic fragments for genetic engineering of higher eukaryotes.« less

Mutation spectrum of Chinese patients with Bartter syndrome.

PubMed

Han, Yue; Lin, Yi; Sun, Qing; Wang, Shujuan; Gao, Yanxia; Shao, Leping

2017-11-24

Bartter syndrome (BS) has been rarely reported in Chinese population except for a few case reports. This investigation was aimed to analyze the mutations of the causal genes in sixteen Chinese patients with BS, and review their followup and treatment. Identify mutations by the next generation sequencing and the multiplex ligation-dependent probe amplification (MLPA). Clinical characteristics and biochemical findings at the first presentation as well as follow-up were reviewed. 15 different CLCNKB gene mutations were identified in fourteen patients with BS, including 11 novel ones. A novel missense mutation and a novel small deletion were found from SLC12A1 gene. A novel gross deletion was found in CLCNKA gene. A recurrent missense mutation was identified from BSND gene. We found that the whole gene deletion mutation of CLCNKB gene was the most frequent mutation (32%), and the rate of gross deletion was up to 50 percent in this group of Chinese patients. The present study has found 19 mutations, including 14 novel ones, which would enrich the human gene mutation database (HGMD) and provide valuable references to the genetic counseling and diagnosis of the Chinese population.

Chassis organism from Corynebacterium glutamicum--a top-down approach to identify and delete irrelevant gene clusters.

PubMed

Unthan, Simon; Baumgart, Meike; Radek, Andreas; Herbst, Marius; Siebert, Daniel; Brühl, Natalie; Bartsch, Anna; Bott, Michael; Wiechert, Wolfgang; Marin, Kay; Hans, Stephan; Krämer, Reinhard; Seibold, Gerd; Frunzke, Julia; Kalinowski, Jörn; Rückert, Christian; Wendisch, Volker F; Noack, Stephan

2015-02-01

For synthetic biology applications, a robust structural basis is required, which can be constructed either from scratch or in a top-down approach starting from any existing organism. In this study, we initiated the top-down construction of a chassis organism from Corynebacterium glutamicum ATCC 13032, aiming for the relevant gene set to maintain its fast growth on defined medium. We evaluated each native gene for its essentiality considering expression levels, phylogenetic conservation, and knockout data. Based on this classification, we determined 41 gene clusters ranging from 3.7 to 49.7 kbp as target sites for deletion. 36 deletions were successful and 10 genome-reduced strains showed impaired growth rates, indicating that genes were hit, which are relevant to maintain biological fitness at wild-type level. In contrast, 26 deleted clusters were found to include exclusively irrelevant genes for growth on defined medium. A combinatory deletion of all irrelevant gene clusters would, in a prophage-free strain, decrease the size of the native genome by about 722 kbp (22%) to 2561 kbp. Finally, five combinatory deletions of irrelevant gene clusters were investigated. The study introduces the novel concept of relevant genes and demonstrates general strategies to construct a chassis suitable for biotechnological application. © 2014 The Authors. Biotechnology Journal published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. This is an open access article under the terms of the Creative Commons Attribution-Non-Commercial-NoDerivs Licence, which permits use and distribution in any medium, provided the original work is properly cited, the use is non- commercial and no modifications or adaptations are made.

[Preimplantation genetic diagnosis of Duchenne muscular dystrophy by single cell triplex PCR].

PubMed

Wu, Yue-Li; Wu, Ling-Qian; Li, Yan-Ping; Liu, Dong-E; Zeng, Qiao; Zhu, Hai-Yan; Pan, Qian; Liang, De-Sheng; Hu, Hao; Long, Zhi-Gao; Li, Juan; Dai, He-Ping; Xia, Kun; Xia, Jia-Hui

2007-04-01

To detect two exons of Duchenne muscular dystrophy (DMD) gene and a gender discrimination locus amelogenin gene by single cell triplex PCR, and to evaluate the possibility of this technique for preimplantation genetic diagnosis (PGD) in DMD family with DMD deletion mutation. Single lymphocytes from a normal male, a normal female, two DMD patients (exon 8 and 47 deleted, respectively) and single blastomeres from the couples treated by the in vitro fertilization pre-embryo transfer (IVF-ET) and without family history of DMD were obtained. Exons 8 and 47 of DMD gene were amplified by a triplex PCR assay, the amelogenin gene on X and Y chromosomes were co-amplified to analyze the correlation between embryo gender and deletion status. In the normal single lymphocytes, the amplification rate of exons 8 and 47 of DMD and amelogenin gene were 93.8%, 93.8%, and 95.3% respectively. The false positive rate was 3.3%. In the exon 8 deleted DMD patient, the amplification rate of exon 47 of DMD and amelogenin gene was 95.8%, and the false positive rate was 3.3%. In the exon 47 deleted DMD patient, the amplification rate of exon 8 of DMD and amelogenin gene was 95.8%, and the false positive rate was 0. In the single blastomeres, the amplification rate of exons 8 and 47 of DMD and amelogenin gene was 82.5%, 80.0% and 77.5%, respectively, and the false positive rate was 0. The single cell triplex PCR protocol for the detection of DMD and amelogenin gene is highly sensitive, specific and reliable, and can be used for PGD in those DMD families with DMD deletion mutation.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

High frequency of EBV association and 30-bp deletion in the LMP-1 gene in CD56 lymphomas of the upper aerodigestive tract.

PubMed

Tai, Yan-Chin; Kim, Lian-Hua; Peh, Suat-Cheng

2004-03-01

Natural killer (NK)/T-cell lymphomas are frequently associated with Epstein-Barr virus (EBV), and usually lack TCR gene rearrangement. Studies from Asia have reported frequent deletion in the LMP-1 gene in EBV-associated nasopharyngeal carcinoma (NPC). The present study aims to investigate LMP-1 and TCRgamma gene status in upper aerodigestive tract lymphomas. A total of 43 cases were classified into T-, B-, and NK/T-cell tumors based on the phenotype expressions of CD3(+)/CD20(-)/CD56(-), CD3(-)/CD20(+)/CD56(-), and CD3(+)/CD20(-)/CD56(+), respectively. The presence of EBV in the tumor was confirmed by EBV early RNA-in situ hybridization. LMP-1 gene deletion and TCR gamma gene rearrangement were analyzed by polymerase chain reaction on paraffin-embedded tissues. There were 20 NK/T-, eight T-, and 15 B-cell phenotype lymphomas in the present series, and EBV was detected in 19 (95%), two (25%), and three (20%) cases in the respective groups. All EBV+ cases carried 30-bp deletion in the LMP-1 gene, and two of the NK/T-cell cases were infected by both the wild type and deleted strains. Five (25%) of the NK/T-cell phenotype lymphomas showed rearranged TCR gamma gene. The present study revealed a high frequency of EBV association, and a high frequency of 30-bp deletion in the LMP-1 gene in the virus in the present series of lymphoma. The NK/T-phenotype lymphomas are comprised of both NK-cell and cytotoxic T-lymphocyte-derived tumors.

Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia.

PubMed

Tischkowitz, M D; Morgan, N V; Grimwade, D; Eddy, C; Ball, S; Vorechovsky, I; Langabeer, S; Stöger, R; Hodgson, S V; Mathew, C G

2004-03-01

Fanconi anemia (FA) is an autosomal recessive chromosomal instability disorder caused by mutations in one of seven known genes (FANCA,C,D2,E,F,G and BRCA2). Mutations in the FANCA gene are the most prevalent, accounting for two-thirds of FA cases. Affected individuals have greatly increased risks of acute myeloid leukemia (AML). This raises the question as to whether inherited or acquired mutations in FA genes might be involved in the development of sporadic AML. Quantitative fluorescent PCR was used to screen archival DNA from sporadic AML cases for FANCA deletions, which account for 40% of FANCA mutations in FA homozygotes. Four heterozygous deletions were found in 101 samples screened, which is 35-fold higher than the expected population frequency for germline FANCA deletions (P<0.0001). Sequencing FANCA in the AML samples with FANCA deletions did not detect mutations in the second allele and there was no evidence of epigenetic silencing by hypermethylation. However, real-time quantitative PCR analysis in these samples showed reduced expression of FANCA compared to nondeleted AML samples and to controls. These findings suggest that gene deletions and reduced expression of FANCA may be involved in the promotion of genetic instability in a subset of cases of sporadic AML.

Genomic interval engineering of mice identified a novel modulator of triglyceride production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Y.; Jong, M.C.; Frazer, K.A.

1999-10-01

To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

PubMed

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

Prader-Willi syndrome: intellectual abilities and behavioural features by genetic subtype.

PubMed

Milner, Katja M; Craig, Ellen E; Thompson, Russell J; Veltman, Marijcke W M; Thomas, N Simon; Roberts, Sian; Bellamy, Margaret; Curran, Sarah R; Sporikou, Caroline M J; Bolton, Patrick F

2005-10-01

Studies of chromosome 15 abnormality have implicated over-expression of paternally imprinted genes in the 15q11-13 region in the aetiology of autism. To test this hypothesis we compared individuals with Prader-Willi syndrome (PWS) due to uniparental disomy (UPD--where paternally imprinted genes are over-expressed) to individuals with the 15q11-13 deletion form of the syndrome (where paternally imprinted genes are not over-expressed). We also tested reports that PWS cases due to the larger type I (TI) form of deletion show differences to cases with the smaller type II (TII) deletion. Ninety-six individuals with PWS were recruited from genetic centres and the PWS association. Forty-nine individuals were confirmed as having maternal UPD of chromosome 15 and were age and sex matched to 47 individuals with a deletion involving 15q11-13 (32 had the shorter (T II) deletion, and 14 had the longer (TI) deletion). Behavioural assessments were carried out blind to genetic status, using the Autism Diagnostic Observation Schedule (ADOS), the Autism Diagnostic Interview (ADI), the Autism Screening Questionnaire (ASQ), the Children's Yale-Brown Obsessive-Compulsive Scale (CY-BOCS), the Vineland Adaptive Behaviour Scales (VABS), and measurements of intellectual ability, including the Wechsler and Mullen Scales and Raven's Matrices. UPD cases exhibited significantly more autistic-like impairments in reciprocal social interaction on questionnaire, interview and standardised observational measures. Comparison of TI and TII deletion cases revealed few differences, but ability levels tended to be lower in the TI deletion cases. Findings from a large study comparing deletion and UPD forms of Prader-Willi syndrome were consistent with other evidence in indicating that paternally imprinted genes in the 15q11-13 region constitute a genetic risk factor for aspects of autistic symptomatology. These genes may therefore play a role in the aetiology of autism. By contrast with another report, there was no clear-cut relationship between the size of the deletion and the form of cognitive and behavioural phenotype.

Characterization of contiguous gene deletions in COL4A6 and COL4A5 in Alport syndrome-diffuse leiomyomatosis.

PubMed

Nozu, Kandai; Minamikawa, Shogo; Yamada, Shiro; Oka, Masafumi; Yanagita, Motoko; Morisada, Naoya; Fujinaga, Shuichiro; Nagano, China; Gotoh, Yoshimitsu; Takahashi, Eihiko; Morishita, Takahiro; Yamamura, Tomohiko; Ninchoji, Takeshi; Kaito, Hiroshi; Morioka, Ichiro; Nakanishi, Koichi; Vorechovsky, Igor; Iijima, Kazumoto

2017-07-01

Alport syndrome-diffuse leiomyomatosis (AS-DL, OMIM: 308940) is a rare variant of the X-linked Alport syndrome that shows overgrowth of visceral smooth muscles in the gastrointestinal, respiratory and female reproductive tracts in addition to renal symptoms. AS-DL results from deletions that encompass the 5' ends of the COL4A5 and COL4A6 genes, but deletion breakpoints between COL4A5 and COL4A6 have been determined in only four cases. Here, we characterize deletion breakpoints in five AS-DL patients and show a contiguous COL4A6/COL4A5 deletion in each case. We also demonstrate that eight out of nine deletion alleles involved sequences homologous between COL4A5 and COL4A6. Most breakpoints took place in recognizable transposed elements, including long and short interspersed repeats, DNA transposons and long-terminal repeat retrotransposons. Because deletions involved the bidirectional promoter region in each case, we suggest that the occurrence of leiomyomatosis in AS-DL requires inactivation of both genes. Altogether, our study highlights the importance of homologous recombination involving multiple transposed elements for the development of this continuous gene syndrome and other atypical loss-of-function phenotypes.

Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability

PubMed Central

Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

2014-01-01

Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome. PMID:23695276

Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability.

PubMed

Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

2014-01-01

Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome.

Selection of recombinant MVA by rescue of the essential D4R gene.

PubMed

Ricci, Patricia S; Schäfer, Birgit; Kreil, Thomas R; Falkner, Falko G; Holzer, Georg W

2011-12-12

Modified vaccinia virus Ankara (MVA) has become a promising vaccine vector due to its immunogenicity and its proven safety in humans. As a general approach for stringent and rapid selection of recombinant MVA, we assessed marker rescue of the essential viral D4R gene in an engineered deletion mutant that is fully replication defective in wild-type cells. Recombinant, replicating virus was obtained by re-introduction of the deleted viral gene as a dominant selection marker into the deletion mutant.

Prenatal diagnosis of two fetuses with deletions of 8p23.1, critical region for congenital diaphragmatic hernia and heart defects.

PubMed

Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba

2013-07-01

Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.

Haploid deletion strains of Saccharomyces cerevisiae that determine survival during space flight

NASA Astrophysics Data System (ADS)

Johanson, Kelly; Allen, Patricia L.; Gonzalez-Villalobos, Romer A.; Nesbit, Jacqueline; Nickerson, Cheryl A.; Höner zu Bentrup, Kerstin; Wilson, James W.; Ramamurthy, Rajee; D'Elia, Riccardo; Muse, Kenneth E.; Hammond, Jeffrey; Freeman, Jake; Stodieck, Louis S.; Hammond, Timothy G.

2007-02-01

This study identifies genes that determine survival during a space flight, using the model eukaryotic organism, Saccharomyces cerevisiae. Select strains of a haploid yeast deletion series grew during storage in distilled water in space, but not in ground based static or clinorotation controls. The survival advantages in space in distilled water include a 133-fold advantage for the deletion of PEX19, a chaperone and import receptor for newly- synthesized class I peroxisomal membrane proteins, to 77-40 fold for deletion strains lacking elements of aerobic respiration, isocitrate metabolism, and mitochondrial electron transport. Following automated addition of rich growth media, the space flight was associated with a marked survival advantage of strains with deletions in catalytically active genes including hydrolases, oxidoreductases and transferases. When compared to static controls, space flight was associated with a marked survival disadvantage of deletion strains lacking transporter, antioxidant and catalytic activity. This study identifies yeast deletion strains with a survival advantage during storage in distilled water and space flight, and amplifies our understanding of the genes critical for survival in space.

Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

PubMed

Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

2015-11-04

Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all encode metabolism- and growth-related proteins, not the known virulence proteins, indicating that the metabolism- and growth-related genes are important for the pathogenesis of S. agalactiae.

Cardiac Med1 deletion promotes early lethality, cardiac remodeling, and transcriptional reprogramming

PubMed Central

Spitler, Kathryn M.; Ponce, Jessica M.; Oudit, Gavin Y.; Hall, Duane D.

2017-01-01

The mediator complex, a multisubunit nuclear complex, plays an integral role in regulating gene expression by acting as a bridge between transcription factors and RNA polymerase II. Genetic deletion of mediator subunit 1 (Med1) results in embryonic lethality, due in large part to impaired cardiac development. We first established that Med1 is dynamically expressed in cardiac development and disease, with marked upregulation of Med1 in both human and murine failing hearts. To determine if Med1 deficiency protects against cardiac stress, we generated two cardiac-specific Med1 knockout mouse models in which Med1 is conditionally deleted (Med1cKO mice) or inducibly deleted in adult mice (Med1cKO-MCM mice). In both models, cardiac deletion of Med1 resulted in early lethality accompanied by pronounced changes in cardiac function, including left ventricular dilation, decreased ejection fraction, and pathological structural remodeling. We next defined how Med1 deficiency alters the cardiac transcriptional profile using RNA-sequencing analysis. Med1cKO mice demonstrated significant dysregulation of genes related to cardiac metabolism, in particular genes that are coordinated by the transcription factors Pgc1α, Pparα, and Errα. Consistent with the roles of these transcription factors in regulation of mitochondrial genes, we observed significant alterations in mitochondrial size, mitochondrial gene expression, complex activity, and electron transport chain expression under Med1 deficiency. Taken together, these data identify Med1 as an important regulator of vital cardiac gene expression and maintenance of normal heart function. NEW & NOTEWORTHY Disruption of transcriptional gene expression is a hallmark of dilated cardiomyopathy; however, its etiology is not well understood. Cardiac-specific deletion of the transcriptional coactivator mediator subunit 1 (Med1) results in dilated cardiomyopathy, decreased cardiac function, and lethality. Med1 deletion disrupted cardiac mitochondrial and metabolic gene expression patterns. PMID:28159809

Deletion of the "OPHN1" Gene Detected by aCGH

ERIC Educational Resources Information Center

Madrigal, I.; Rodriguez-Revenga, L.; Badenas, C.; Sanchez, A.; Mila, M.

2008-01-01

Background: The oligophrenin 1 gene ("OPHN1") is an Rho-GTPase-activating protein involved in the regulation of the G-protein cycle required for dendritic spine morphogenesis. Mutations in this gene are implicated in X-linked mental retardation (XLMR). Methods: We report a deletion spanning exons 21 and 22 of the "OPHN1" gene identified by a…

Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

PubMed

Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam

2015-01-21

Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however continued monitoring of parasite population will be useful to detect any parasites with deletions of pfhrp2.

Microdeletion syndromes, balanced translocations, and gene mapping.

PubMed Central

Schinzel, A

1988-01-01

High resolution prometaphase chromosome banding has allowed the detection of discrete chromosome aberrations which escaped earlier metaphase examinations. Consistent tiny deletions have been detected in some well established malformation syndromes: an interstitial deletion in 15q11/12 in the majority of patients with the Prader-Willi syndrome and in a minority of patients with the Angelman (happy puppet) syndrome; a terminal deletion of 17p13.3 in most patients examined with the Miller-Dieker syndrome; an interstitial deletion of 8q23.3/24.1 in a large majority of patients with the Giedion-Langer syndrome; an interstitial deletion of 11p13 in virtually all patients with the WAGR (Wilms' tumour-aniridia-gonadoblastoma-retardation) syndrome; and an interstitial deletion in 22q11 in about one third of patients with the DiGeorge sequence. In addition, a combination of chromosome prometaphase banding and DNA marker studies has allowed the localisation of the genes for retinoblastoma and for Wilms' tumour and the clarification of both the autosomal recessive nature of the mutation and the possible somatic mutations by which the normal allele can be lost in retina and kidney cells. After a number of X linked genes had been mapped, discrete deletions in the X chromosome were detected by prometaphase banding with specific attention paid to the sites of the gene(s) in males who had from one to up to four different X linked disorders plus mental retardation. Furthermore, the detection of balanced translocations in probands with disorders caused by autosomal dominant or X linked genes has allowed a better insight into the localisation of these genes. In some females with X linked disorders, balanced X; autosomal translocations have allowed the localisation of X linked genes at the breakpoint on the X chromosome. Balanced autosome; autosome translocations segregating with autosomal dominant conditions have provided some clues to the gene location of these conditions. In two conditions, Greig cephalopolysyndactyly and dominant aniridia, two translocation families with one common breakpoint have allowed quite a confident location of the genes at the common breakpoint at 7p13 and 11p13, respectively. PMID:3050093

Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.

PubMed

Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong

2017-02-01

Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P < 0.05). For instance, deletion of pks35, led to an increase of pestalotiollide B by 887%. We inferred that these nine PKSs possibly lead to branch pathways that compete for precursors with pestalotiollide B, or that convert the product. Deletion of some other PKS genes such as pks8 led to a significant decrease of pestalotiollide B, suggesting they are responsible for its biosynthesis. Our data demonstrated that improvement of pestalotiollide B production can be achieved by eliminating competing polyketides.

Cryptic intragenic deletion of the SHOX gene in a family with Léri-Weill dyschondrosteosis detected by Multiplex Ligation-Dependent Probe Amplification (MLPA).

PubMed

Funari, Mariana F A; Jorge, Alexander A L; Pinto, Emilia M; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

2008-11-01

LWD is associated to SHOX haploinsufficiency, in most cases, due to gene deletion. Generally FISH and microsatellite analysis are used to identify SHOX deletion. MLPA is a new method of detecting gene copy variation, allowing simultaneous analysis of several regions. Here we describe the presence of a SHOX intragenic deletion in a family with LWD, analyzed through different methodologies. Genomic DNA of 11 subjects from one family were studied by microsatellite analysis, direct sequencing and MLPA. FISH was performed in two affected individuals. Microsatellite analysis showed that all affected members shared the same haplotype suggesting the involvement of SHOX. MLPA detected an intragenic deletion involving exons IV-VIa, which was not detected by FISH and microsatellite analysis. In conclusion, the MLPA technique was proved to be the best solution on detecting this small deletion, it has the advantage of being less laborious also allowing the analysis of several regions simultaneously.

The gene for replication factor C subunit 2 (RFC2) is within the 7q11.23 Williams syndrome deletion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peoples, R.; Perez-Jurado, L.; Francke, U.

1996-06-01

Williams syndrome (WS) is a developmental disorder with multiple system manifestations, including supraval var aortic stenosis (SVAS), peripheral pulmonic stenosis, connective tissue abnormalities, short stature, characteristic personality profile and cognitive deficits, and variable hypercalcemia in infancy. It is caused by heterozygosity for a chromosomal deletion of part of band 7q11.23 including the elastin locus (ELN). Since disruption of the ELN gene causes autosomal dominant SVAS, it is assumed that ELN haploinsufficiency is responsible for the cardiovascular features of WS. The deletion that extends from the ELN locus in both directions is {ge}200 kb in size, although estimates of {ge}2 Mbmore » are suggested by high-resolution chromosome banding and physical mapping studies. We have searched for additional dosage-sensitive genes within the deletion that may be responsible for the noncardiovascular features. We report here that the gene for replication factor C subunit 2 (RFC2) maps within the WS deletion region and was found to be deleted in all of 18 WS patients studied. The protein product of RFC2 is part of a multimeric complex involved in DNA elongation during replication. 14 refs., 3 figs.« less

VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David

2013-05-20

Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heartmore » failure.« less

Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

PubMed Central

Bornemann-Kolatzki, Kirsten; Neumann, Stephan; Escobar, Hugo Murua; Nolte, Ingo; Hammer, Susanne Conradine; Hewicker-Trautwein, Marion; Junginger, Johannes; Kaup, Franz-Josef; Brenig, Bertram; Schütz, Ekkehard

2015-01-01

Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Methods Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32). Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ≤ -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry. Results The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9) showed the highest frequency of the deletion (67%) and those malignomas without microscopical high fraction of benign tissue (n = 71) had a 32% frequency (p<0.01 vs. benign samples). The Ki-67 score was found to be significantly higher (p<0.05) in the PFDN5-deleted group compared to malignant tumors without the deletion. Conclusions A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer-driver gene. PMID:26132936

Rare Genome-Wide Copy Number Variation and Expression of Schizophrenia in 22q11.2 Deletion Syndrome.

PubMed

Bassett, Anne S; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; van Amelsvoort, Therese; McDonald-McGinn, Donna; Gur, Raquel E; Swillen, Ann; Van den Bree, Marianne; Murphy, Kieran; Gothelf, Doron; Bearden, Carrie E; Eliez, Stephan; Kates, Wendy; Philip, Nicole; Sashi, Vandana; Campbell, Linda; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M; Simon, Tony; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R; Owen, Michael; Murphy, Clodagh; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J; Scherer, Stephen W; Emanuel, Beverly S; Guo, Tingwei; Morrow, Bernice E; Marshall, Christian R

2017-11-01

Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this study was to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Through an international consortium, the authors obtained DNA samples from 329 psychiatrically phenotyped subjects with 22q11.2DS. Using a high-resolution microarray platform and established methods to assess copy number variation (CNV), the authors compared the genome-wide burden of rare autosomal CNV, outside of the 22q11.2 deletion region, between two groups: a schizophrenia group and those with no psychotic disorder at age ≥25 years. The authors assessed whether genes overlapped by rare CNVs were overrepresented in functional pathways relevant to schizophrenia. Rare CNVs overlapping one or more protein-coding genes revealed significant between-group differences. For rare exonic duplications, six of 19 gene sets tested were enriched in the schizophrenia group; genes associated with abnormal nervous system phenotypes remained significant in a stepwise logistic regression model and showed significant interactions with 22q11.2 deletion region genes in a connectivity analysis. For rare exonic deletions, the schizophrenia group had, on average, more genes overlapped. The additional rare CNVs implicated known (e.g., GRM7, 15q13.3, 16p12.2) and novel schizophrenia risk genes and loci. The results suggest that additional rare CNVs overlapping genes outside of the 22q11.2 deletion region contribute to schizophrenia risk in 22q11.2DS, supporting a multigenic hypothesis for schizophrenia. The findings have implications for understanding expression of psychotic illness and herald the importance of whole-genome sequencing to appreciate the overall genomic architecture of schizophrenia.

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Homozygous deletion of six genes including corneodesmosin on chromosome 6p21.3 is associated with generalized peeling skin disease.

PubMed

Teye, Kwesi; Hamada, Takahiro; Krol, Rafal P; Numata, Sanae; Ishii, Norito; Matsuda, Mitsuhiro; Ohata, Chika; Furumura, Minao; Hashimoto, Takashi

2014-07-01

Peeling skin syndrome (PSS) is a rare autosomal recessive form of ichthyosis showing skin exfoliation. PSS is divided into acral and generalized PSS, and the latter is further classified into non-inflammatory type (PSS type A) and inflammatory type (PSS type B). PSS type B is now called peeling skin disease (PSD). Different loss-of-function mutations in the corneodesmosin (CDSN) gene have been reported to cause PSD. The aim of this study was to determine genetic basis of disease in a 14-year-old Japanese patient with PSD. Immunohistochemical study showed lack of corneodesmosin (CDSN) in the skin, and standard PCR for genomic DNA failed to amplify CDSN product, suggesting CDSN defect. Multiplex ligation-dependent probe amplification and genomic quantitative real-time PCR analyses detected large homozygous deletion of 59,184bp extending from 40.6kb upstream to 13.2kb downstream of CDSN, which included 6 genes (TCF19, CCHCR1, PSORS1C2, PSORS1C1, CDSN and C6orf15). The continuous gene lost did not result in additional clinical features. Inverted repeats with 85% similarity flanking the deletion breakpoint were considered to mediate the deletion by non-homologous end joining or fork stalling and template switching/microhomology-mediated break-induced replication. Parents were clinically unaffected and were heterozygote carriers of the same deletion, which was absent in 284 ethnically matched control alleles. We also developed simple PCR method, which is useful for detection of this deletion. Although 5 other genes were also deleted, homozygous deletion of CDSN was considered to be responsible for this PSD. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

A Population of Deletion Mutants and an Integrated Mapping and Exome-seq Pipeline for Gene Discovery in Maize

PubMed Central

Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David

2016-01-01

To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000

A large deletion of PROP1 gene in patients with combined pituitary hormone deficiency from two unrelated Chinese pedigrees.

PubMed

Zhang, Huiwen; Wang, Yi; Han, Lianshu; Gu, Xuefan; Shi, Dingping

2010-01-01

Familial combined pituitary hormone deficiency (CPHD) appears to have a genetic cause, PROP1 gene mutations being the most common one. We investigated whether PROP1 plays a role in two Chinese familial cases of CPHD. PROP1 gene and adjacent sequences from genomic samples from two unrelated families were amplified to investigate molecular variations and define the extension of a potential deletion. A quantitative real-time polymerase chain reaction was conducted to analyze the copy number of PROP1 gene in the probands' mothers. The relationship of the two distantly located families was further analyzed using microsatellite markers. A segment of about 53.2 kilobases (kb) comprehending PROP1 and another gene encoding a hypothetical protein Q6ZTH3 was deleted in both pedigrees. The mother of one of the probands was hemizygous for this large deletion, which confirmed the assumption that the affected children inherited the deletion allele from their consanguineous parents. The difference of three microsatellites surrounding the absent segment indicated that the two pedigrees were genetically unrelated. We report the largest genomic deletion including PROP1 gene associated with CPHD. Q6ZTH3 is unlikely to exert an indispensable function during embryogenesis or organogenesis. The 7.7-kb segment upstream of the transcription of PROP1 probably harbors a fragile site that favors the occurrence of breakpoints. Copyright (c) 2010 S. Karger AG, Basel.

R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cervenakova, L.; Brown, P.; Nagle, J.

1994-09-01

There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two hadmore » a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.« less

Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility.

PubMed

An, Hongyan; Lim, Chai; Guillemin, Gilles J; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

2016-01-01

Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker.

Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

PubMed

Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

2015-01-20

In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

PubMed Central

Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

2016-01-01

Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

PubMed Central

Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

2016-01-01

Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

Mutation spectrum of Chinese patients with Bartter syndrome

PubMed Central

Han, Yue; Lin, Yi; Sun, Qing; Wang, Shujuan; Gao, Yanxia; Shao, Leping

2017-01-01

Objective Bartter syndrome (BS) has been rarely reported in Chinese population except for a few case reports. This investigation was aimed to analyze the mutations of the causal genes in sixteen Chinese patients with BS, and review their followup and treatment. Methods Identify mutations by the next generation sequencing and the multiplex ligation-dependent probe amplification (MLPA). Clinical characteristics and biochemical findings at the first presentation as well as follow-up were reviewed. Results 15 different CLCNKB gene mutations were identified in fourteen patients with BS, including 11 novel ones. A novel missense mutation and a novel small deletion were found from SLC12A1 gene. A novel gross deletion was found in CLCNKA gene. A recurrent missense mutation was identified from BSND gene. We found that the whole gene deletion mutation of CLCNKB gene was the most frequent mutation (32%), and the rate of gross deletion was up to 50 percent in this group of Chinese patients. Conclusion The present study has found 19 mutations, including 14 novel ones, which would enrich the human gene mutation database (HGMD) and provide valuable references to the genetic counseling and diagnosis of the Chinese population. PMID:29254190

The 2p21 deletion syndrome: characterization of the transcription content.

PubMed

Parvari, Ruti; Gonen, Yael; Alshafee, Ismael; Buriakovsky, Sophia; Regev, Kfir; Hershkovitz, Eli

2005-08-01

The vast majority of small-deletion syndromes are caused by haploinsufficiency of one or several genes and are transmitted as dominant traits. We have previously identified a homozygous deletion of 179,311 bp on chromosome 2p21 as the cause of a unique syndrome, inherited in a recessive mode, consisting of cystinuria, neonatal seizures, hypotonia, severe somatic and developmental delay, facial dysmorphism, and reduced activity of all the respiratory chain enzymatic complexes that are encoded in the mitochondria. We now present the transcription content of this region: Multiple splicing variants of the genes protein phosphatase 1B (formerly 2C) magnesium-dependent, beta isoform (PPM1B), SLC3A1, and KIAA0436 (approved gene symbol PREPL) were identified and their patterns of expression analyzed. The spliced variants are predicted to have additional functions compared to the known variants and their patterns of expression fit the tissues affected by the syndrome. The first exon of an additional gene (C2orf34) is encoded in the deleted region and the gene is not expressed in the patients. In addition several transcripts with very short open reading frames are also encoded in the deletion. The identification of all transcripts encoded in the region deleted in the patients is the first step in the study of the genotype-phenotype correlation of the 2p21 patients.

NBCe1 expression is required for normal renal ammonia metabolism

PubMed Central

Handlogten, Mary E.; Osis, Gunars; Lee, Hyun-Wook; Romero, Michael F.; Verlander, Jill W.

2015-01-01

The mechanisms regulating proximal tubule ammonia metabolism are incompletely understood. The present study addressed the role of the proximal tubule basolateral electrogenic Na+-coupled bicarbonate cotransporter (NBCe1; Slc4a4) in renal ammonia metabolism. We used mice with heterozygous and homozygous NBCe1 gene deletion and compared these mice with their wild-type littermates. Because homozygous NBCe1 gene deletion causes 100% mortality before day 25, we studied mice at day 8 (±1 day). Both heterozygous and homozygous gene deletion caused a gene dose-related decrease in serum bicarbonate. The ability to lower urinary pH was intact, and even accentuated, with NBCe1 deletion. However, in contrast to the well-known effect of metabolic acidosis to increase urinary ammonia excretion, NBCe1 deletion caused a gene dose-related decrease in ammonia excretion. There was no identifiable change in proximal tubule structure by light microscopy. Examination of proteins involved in renal ammonia metabolism showed decreased expression of phosphate-dependent glutaminase and phosphoenolpyruvate carboxykinase, key enzymes in proximal tubule ammonia generation, and increased expression of glutamine synthetase, which recycles intrarenal ammonia and regenerates glutamine. Expression of key proteins involved in ammonia transport outside of the proximal tubule (rhesus B glycoprotein and rhesus C glycoprotein) was not significantly changed by NBCe1 deletion. We conclude from these findings that NBCe1 expression is necessary for normal proximal tubule ammonia metabolism. PMID:26224717

A resource for functional profiling of noncoding RNA in the yeast Saccharomyces cerevisiae.

PubMed

Parker, Steven; Fraczek, Marcin G; Wu, Jian; Shamsah, Sara; Manousaki, Alkisti; Dungrattanalert, Kobchai; de Almeida, Rogerio Alves; Estrada-Rivadeneyra, Diego; Omara, Walid; Delneri, Daniela; O'Keefe, Raymond T

2017-08-01

Eukaryotic genomes are extensively transcribed, generating many different RNAs with no known function. We have constructed 1502 molecular barcoded ncRNA gene deletion strains encompassing 443 ncRNAs in the yeast Saccharomyces cerevisiae as tools for ncRNA functional analysis. This resource includes deletions of small nuclear RNAs (snRNAs), transfer RNAs (tRNAs), small nucleolar RNAs (snoRNAs), and other annotated ncRNAs as well as the more recently identified stable unannotated transcripts (SUTs) and cryptic unstable transcripts (CUTs) whose functions are largely unknown. Specifically, deletions have been constructed for ncRNAs found in the intergenic regions, not overlapping genes or their promoters (i.e., at least 200 bp minimum distance from the closest gene start codon). The deletion strains carry molecular barcodes designed to be complementary with the protein gene deletion collection enabling parallel analysis experiments. These strains will be useful for the numerous genomic and molecular techniques that utilize deletion strains, including genome-wide phenotypic screens under different growth conditions, pooled chemogenomic screens with drugs or chemicals, synthetic genetic array analysis to uncover novel genetic interactions, and synthetic dosage lethality screens to analyze gene dosage. Overall, we created a valuable resource for the RNA community and for future ncRNA research. © 2017 Parker et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

An Indel Polymorphism in the MtnA 3' Untranslated Region Is Associated with Gene Expression Variation and Local Adaptation in Drosophila melanogaster

PubMed Central

Glaser-Schmitt, Amanda; Duchen, Pablo; Parsch, John

2016-01-01

Insertions and deletions (indels) are a major source of genetic variation within species and may result in functional changes to coding or regulatory sequences. In this study we report that an indel polymorphism in the 3’ untranslated region (UTR) of the metallothionein gene MtnA is associated with gene expression variation in natural populations of Drosophila melanogaster. A derived allele of MtnA with a 49-bp deletion in the 3' UTR segregates at high frequency in populations outside of sub-Saharan Africa. The frequency of the deletion increases with latitude across multiple continents and approaches 100% in northern Europe. Flies with the deletion have more than 4-fold higher MtnA expression than flies with the ancestral sequence. Using reporter gene constructs in transgenic flies, we show that the 3' UTR deletion significantly contributes to the observed expression difference. Population genetic analyses uncovered signatures of a selective sweep in the MtnA region within populations from northern Europe. We also find that the 3’ UTR deletion is associated with increased oxidative stress tolerance. These results suggest that the 3' UTR deletion has been a target of selection for its ability to confer increased levels of MtnA expression in northern European populations, likely due to a local adaptive advantage of increased oxidative stress tolerance. PMID:27120580

The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

PubMed

Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

2017-03-01

Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

TBR1 is the candidate gene for intellectual disability in patients with a 2q24.2 interstitial deletion.

PubMed

Palumbo, Orazio; Fichera, Marco; Palumbo, Pietro; Rizzo, Renata; Mazzolla, Elisabetta; Cocuzza, Donatella Maria; Carella, Massimo; Mattina, Teresa

2014-03-01

Interstitial deletion of 2q24.2 is a rarely described cytogenetic aberration in patients with intellectual disability (ID). Previously reported genotype-phenotype correlation identified a minimum deleted region of 2.65 Mb including 15 genes. Recently, a patient with a de novo 2q24.2 microdeletion of 0.4 Mb encompassing only three genes was described. However, the precise relationship between most deleted genes and the clinical features remains unclear. Here we describe a 12-year-old male patient diagnosed with growth retardation and ID. He also showed microcephaly, right palpebral ptosis, scapular winging, and pectus excavatum. Single nucleotide polymorphisms (SNP) array analysis showed a de novo interstitial deletion of 0.122 Mb at 2q24.2 region harboring only TBR1 (T-box, brain, 1; OMIM: 604616), which encodes a T-box family transcription factor expressed in post-mitotic projection neurons and functionally significant in embryologic corticogenesis. This is the first case of a deletion at 2q24.2 involving only TBR1. This finding narrows the smallest region of overlap (SRO) for deletions in this region and strengthens the previously suggested hypothesis that this gene is a strong candidate for the ID phenotype. The identification of TBR1 as candidate for ID encourages further molecular studies to identify novel mutations to understand the pathogenic effects of its haploinsufficiency. Finally, this report provides a review on 10 2q24.2 microdeletion patients. © 2014 Wiley Periodicals, Inc.

Expression of endogenous and foreign ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) genes in a RubisCO deletion mutant of Rhodobacter sphaeroides.

PubMed Central

Falcone, D L; Tabita, F R

1991-01-01

A Rhodobacter sphaeroides ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) deletion strain was constructed that was complemented by plasmids containing either the form I or form II CO2 fixation gene cluster. This strain was also complemented by genes encoding foreign RubisCO enzymes expressed from a Rhodospirillum rubrum RubisCO promoter. In R. sphaeroides, the R. rubrum promoter was regulated, resulting in variable levels of disparate RubisCO molecules under different growth conditions. Photosynthetic growth of the R. sphaeroides deletion strain complemented with cyanobacterial RubisCO revealed physiological properties reflective of the unique cellular environment of the cyanobacterial enzyme. The R. sphaeroides RubisCO deletion strain and R. rubrum promoter system may be used to assess the properties of mutagenized proteins in vivo, as well as provide a potential means to select for altered RubisCO molecules after random mutagenesis of entire genes or gene regions encoding RubisCO enzymes. Images PMID:1900508

Engineering electron metabolism to increase ethanol production in Clostridium thermocellum

DOE PAGES

Lo, Jonathan; Olson, Daniel G.; Murphy, Sean Jean-Loup; ...

2016-10-28

Here, the NfnAB (NADH-dependent reduced ferredoxin:NADP + oxidoreductase) and Rnf ( Rhodobacter nitrogen fixation) complexes are thought to catalyze electron transfer between reduced ferredoxin and NAD(P) +. Efficient electron flux is critical for engineering fuel production pathways, but little is known about the relative importance of these enzymes in vivo. In this study we investigate the importance of the NfnAB and Rnf complexes in Clostridium thermocellum for growth on cellobiose and Avicel using gene deletion, enzyme assays, and fermentation product analysis. The NfnAB complex does not seem to play a major role in metabolism, since deletion of nfnAB genes hadmore » little effect on the distribution of fermentation products. By contrast, the Rnf complex appears to play an important role in ethanol formation. Deletion of rnf genes resulted in a decrease in ethanol formation. Overexpression of rnf genes resulted in an increase in ethanol production of about 30%, but only in strains where the hydG hydrogenase maturation gene was also deleted.« less

Engineering electron metabolism to increase ethanol production in Clostridium thermocellum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, Jonathan; Olson, Daniel G.; Murphy, Sean Jean-Loup

Here, the NfnAB (NADH-dependent reduced ferredoxin:NADP + oxidoreductase) and Rnf ( Rhodobacter nitrogen fixation) complexes are thought to catalyze electron transfer between reduced ferredoxin and NAD(P) +. Efficient electron flux is critical for engineering fuel production pathways, but little is known about the relative importance of these enzymes in vivo. In this study we investigate the importance of the NfnAB and Rnf complexes in Clostridium thermocellum for growth on cellobiose and Avicel using gene deletion, enzyme assays, and fermentation product analysis. The NfnAB complex does not seem to play a major role in metabolism, since deletion of nfnAB genes hadmore » little effect on the distribution of fermentation products. By contrast, the Rnf complex appears to play an important role in ethanol formation. Deletion of rnf genes resulted in a decrease in ethanol formation. Overexpression of rnf genes resulted in an increase in ethanol production of about 30%, but only in strains where the hydG hydrogenase maturation gene was also deleted.« less

Legionella pneumophila OxyR Is a Redundant Transcriptional Regulator That Contributes to Expression Control of the Two-Component CpxRA System.

PubMed

Tanner, Jennifer R; Patel, Palak G; Hellinga, Jacqueline R; Donald, Lynda J; Jimenez, Celine; LeBlanc, Jason J; Brassinga, Ann Karen C

2017-03-01

Nominally an environmental organism, Legionella pneumophila is an intracellular parasite of protozoa but is also the causative agent of the pneumonia termed Legionnaires' disease, which results from inhalation of aerosolized bacteria by susceptible humans. Coordination of gene expression by a number of identified regulatory factors, including OxyR, assists L. pneumophila in adapting to the stresses of changing environments. L. pneumophila OxyR (OxyR Lp ) is an ortholog of Escherichia coli OxyR; however, OxyR Lp was shown elsewhere to be functionally divergent, such that it acts as a transcription regulator independently of the oxidative stress response. In this study, the use of improved gene deletion methods has enabled us to generate an unmarked in-frame deletion of oxyR in L. pneumophila Lack of OxyR Lp did not affect in vitro growth or intracellular growth in Acanthamoeba castellanii protozoa and U937-derived macrophages. The expression of OxyR Lp does not appear to be regulated by CpxR, even though purified recombinant CpxR bound a DNA sequence similar to that reported for CpxR elsewhere. Surprisingly, a lack of OxyR Lp resulted in elevated activity of the promoters located upstream of icmR and the lpg1441-cpxA operon, and OxyR Lp directly bound to these promoter regions, suggesting that OxyR Lp is a direct repressor. Interestingly, a strain overexpressing OxyR Lp demonstrated reduced intracellular growth in A. castellanii but not in U937-derived macrophages, suggesting that balanced expression control of the two-component CpxRA system is necessary for survival in protozoa. Taken together, this study suggests that OxyR Lp is a functionally redundant transcriptional regulator in L. pneumophila under the conditions evaluated herein. IMPORTANCE Legionella pneumophila is an environmental pathogen, with its transmission to the human host dependent upon its ability to replicate in protozoa and survive within its aquatic niche. Understanding the genetic factors that contribute to L. pneumophila survival within each of these unique environments will be key to limiting future point-source outbreaks of Legionnaires' disease. The transcriptional regulator L. pneumophila OxyR (OxyR Lp ) has been previously identified as a potential regulator of virulence traits warranting further investigation. This study demonstrated that oxyR is nonessential for L. pneumophila survival in vitro and in vivo via mutational analysis. While the mechanisms of how OxyR Lp expression is regulated remain elusive, this study shows that OxyR Lp negatively regulates the expression of the cpxRA two-component system necessary for intracellular survival in protozoa. Copyright © 2017 American Society for Microbiology.

Is NF-1 gene deletion the molecular mechanism of neurofibromatosis type 1 with destinctive facies?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leppig, K.A.; Stephens, K.G.; Viskochill, D.

We have studied a patient with neurofibromatosis type 1 and unusual facial features using fluorescence in situ hybridization (FISH) and found that the patient had a deletion that minimially encompasses exon 2-11 of the NF-1 gene. The patient was one of two individuals initially described by Kaplan and Rosenblatt who suggested that another condition aside from neurofibromatosis type 1 may account for the unusual facial features observed in these patients with neurofibromatosis type 1. FISH studies were performed using a P1 clone probe, P1-9, which contains exons 2-11 of the NF-1 gene on chromosomes prepared from the patients. In allmore » 20 metaphase cells analyzed, one of the chromosome 17 homologues was deleted for the P1-9 probe. Therefore, this patient had neurofibromatosis type 1 and unusual facial features as the result of a deletion which minimally includes exons 2-11 of the NF-1 gene. The extent of the deletion is being mapped by FISH and somatic cell hybrid analysis. The patient studied was a 7-year-old male with mild developmental delays, normal growth parameters, and physical findings consistent with neurofibromatosis type 1, including multiple cafe au lait spots, several curaneous neurofibroma, and speckling of the irises. In addition, his unusual facial features consisted of telecanthus, antimongoloid slant of the palpebral fissures, a broad base of the nose, low set and mildly posteriorly rotated ears, thick helices, high arched palate, short and pointed chin, and low posterior hairline. We propose that deletions of the NF-1 gene and/or contiguous genes are the etiology of neurofibromatosis type 1 and unusual facial features. This particular facial appearance was inherited from the patient`s mother and has been described in other individuals with neurofibromatosis type 1. We are using FISH to rapidly screen patients with this phenotype for large deletions involving the NF-1 gene and flanking DNA sequences.« less

Loss-of-function variants in NFIA provide further support that NFIA is a critical gene in 1p32-p31 deletion syndrome: A four patient series.

PubMed

Revah-Politi, Anya; Ganapathi, Mythily; Bier, Louise; Cho, Megan T; Goldstein, David B; Hemati, Parisa; Iglesias, Alejandro; Juusola, Jane; Pappas, John; Petrovski, Slavé; Wilson, Ashley L; Aggarwal, Vimla S; Anyane-Yeboa, Kwame

2017-12-01

The association between 1p32-p31 contiguous gene deletions and a distinct phenotype that includes anomalies of the corpus callosum, ventriculomegaly, developmental delay, seizures, and dysmorphic features has been long recognized and described. Recently, the observation of overlapping phenotypes in patients with chromosome translocations that disrupt NFIA (Nuclear factor I/A), a gene within this deleted region, and NFIA intragenic deletions has led to the hypothesis that NFIA is a critical gene within this region. The wide application and increasing accessibility of whole exome sequencing (WES) has helped identify new cases to support this hypothesis. Here, we describe four patients with loss-of-function variants in the NFIA gene identified through WES. The clinical presentation of these patients significantly overlaps with the phenotype described in previously reported cases of 1p32-p31 deletion syndrome, NFIA gene disruptions and intragenic NFIA deletions. Our cohort includes a mother and daughter as well as an unrelated individual who share the same nonsense variant (c.205C>T, p.Arg69Ter; NM_001145512.1). We also report a patient with a frameshift NFIA variant (c.159_160dupCC, p.Gln54ProfsTer49). We have compared published cases of 1p32-p31 microdeletion syndrome, translocations resulting in NFIA gene disruption, intragenic deletions, and loss-of-function mutations (including our four patients) to reveal that abnormalities of the corpus callosum, ventriculomegaly/hydrocephalus, macrocephaly, Chiari I malformation, dysmorphic features, developmental delay, hypotonia, and urinary tract defects are common findings. The consistent overlap in clinical presentation provides further evidence of the critical role of NFIA haploinsufficiency in the development of the 1p32-p31 microdeletion syndrome phenotype. © 2017 Wiley Periodicals, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Louie, E.; Dietz, L.; Shafer, F.

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

Genome-wide mapping of large deletions and their population-genetic properties in dairy cattle

PubMed Central

Mesbah-Uddin, Md; Guldbrandtsen, Bernt; Iso-Touru, Terhi; Vilkki, Johanna; De Koning, Dirk-Jan; Boichard, Didier; Lund, Mogens Sandø; Sahana, Goutam

2018-01-01

Abstract Large genomic deletions are potential candidate for loss-of-function, which could be lethal as homozygote. Analysing whole genome data of 175 cattle, we report 8,480 large deletions (199 bp–773 KB) with an overall false discovery rate of 8.8%; 82% of which are novel compared with deletions in the dbVar database. Breakpoint sequence analyses revealed that majority (24 of 29 tested) of the deletions contain microhomology/homology at breakpoint, and therefore, most likely generated by microhomology-mediated end joining. We observed higher differentiation among breeds for deletions in some genic-regions, such as ABCA12, TTC1, VWA3B, TSHR, DST/BPAG1, and CD1D. The genes overlapping deletions are on average evolutionarily less conserved compared with known mouse lethal genes (P-value = 2.3 × 10−6). We report 167 natural gene knockouts in cattle that are apparently nonessential as live homozygote individuals are observed. These genes are functionally enriched for immunoglobulin domains, olfactory receptors, and MHC classes (FDR = 2.06 × 10−22, 2.06 × 10−22, 7.01 × 10−6, respectively). We also demonstrate that deletions are enriched for health and fertility related quantitative trait loci (2-and 1.5-fold enrichment, Fisher’s P-value = 8.91 × 10−10 and 7.4 × 10−11, respectively). Finally, we identified and confirmed the breakpoint of a ∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8), causing stillbirth in Nordic Red Cattle. PMID:28985340

UGT2B17 gene deletion associated with an increase in bone mineral density similar to the effect of hormone replacement in postmenopausal women.

PubMed

Giroux, S; Bussières, J; Bureau, A; Rousseau, F

2012-03-01

UGT2B17 is one of the most important enzymes for androgen metabolism. In addition, the UGT2B17 gene is one of the most commonly deleted regions of the human genome. The deletion was previously found associated with higher femoral bone density in men and women, and we replicated this association in a sample of postmenopausal who never used hormone therapy. Deletion of the UGT2B17 gene was previously shown to be associated with a higher hip bone mineral density (BMD). Using a PCR assay, we tried to replicate the association among a large group of 2,379 women. We examined the effect of the deletion on femoral neck BMD and lumbar spine BMD according to the menopausal status and hormone replacement therapy (HRT). We used a high-throughput PCR assay to identify the gene and the deletion in a population of well-characterized women. Two additional polymorphisms, UGT2B28 deletion and UGT2B15 rs1902023 G > T were also investigated. Only UGT2B17 deletion was associated with LS and FN BMD. Furthermore, the association was seen only among postmenopausal women who had never used hormone replacement as in the first reported association. We confirmed the association between UGT2B17 deletion and a higher LS and FN BMD. In addition, we show that the association is observed among postmenopausal women who never used HRT consistent with the enzymatic function of UGT2B17. The analysis shows that those having one or two UGT2B17 alleles benefit from HRT, which is not the case for null carriers.

A proof of the DBRF-MEGN method, an algorithm for deducing minimum equivalent gene networks

PubMed Central

2011-01-01

Background We previously developed the DBRF-MEGN (difference-based regulation finding-minimum equivalent gene network) method, which deduces the most parsimonious signed directed graphs (SDGs) consistent with expression profiles of single-gene deletion mutants. However, until the present study, we have not presented the details of the method's algorithm or a proof of the algorithm. Results We describe in detail the algorithm of the DBRF-MEGN method and prove that the algorithm deduces all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. Conclusions The DBRF-MEGN method provides all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. PMID:21699737

Retrieval and Encoding Interference: Cross-Linguistic Evidence from Anaphor Processing

PubMed Central

Laurinavichyute, Anna; Jäger, Lena A.; Akinina, Yulia; Roß, Jennifer; Dragoy, Olga

2017-01-01

The main goal of this paper was to disentangle encoding and retrieval interference effects in anaphor processing and thus to evaluate the hypothesis predicting that structurally inaccessible nouns (distractors) are not considered to be potential anaphor antecedents during language processing (Nicol and Swinney, 1989). Three self-paced reading experiments were conducted: one in German, comparing gender-unmarked reflexives and gender-marked pronouns, and two in Russian, comparing gender-marked and -unmarked reflexives. In the German experiment, no interference effects were found. In the first experiment in Russian, an unexpected reading times pattern emerged: in the condition where the distractor matched the gender of the reflexive's antecedent, reading of the gender-unmarked, but not the gender-marked reflexives was slowed down. The same reading times pattern was replicated in a second experiment in Russian where the order of the reflexive and the main verb was inverted. We conclude that the results of the two experiments in Russian are inconsistent with the retrieval interference account, but can be explained by encoding interference and additional semantic processing efforts associated with the processing of gender-marked reflexives. In sum, we found no evidence that would allow us to reject the syntax as an early filer account (Nicol and Swinney, 1989). PMID:28649216

Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion.

PubMed

Lin, Mingyan; Pedrosa, Erika; Hrabovsky, Anastasia; Chen, Jian; Puliafito, Benjamin R; Gilbert, Stephanie R; Zheng, Deyou; Lachman, Herbert M

2016-11-15

Individuals with 22q11.2 Deletion Syndrome (22q11.2 DS) are a specific high-risk group for developing schizophrenia (SZ), schizoaffective disorder (SAD) and autism spectrum disorders (ASD). Several genes in the deleted region have been implicated in the development of SZ, e.g., PRODH and DGCR8. However, the mechanistic connection between these genes and the neuropsychiatric phenotype remains unclear. To elucidate the molecular consequences of 22q11.2 deletion in early neural development, we carried out RNA-seq analysis to investigate gene expression in early differentiating human neurons derived from induced pluripotent stem cells (iPSCs) of 22q11.2 DS SZ and SAD patients. Eight cases (ten iPSC-neuron samples in total including duplicate clones) and seven controls (nine in total including duplicate clones) were subjected to RNA sequencing. Using a systems level analysis, differentially expressed genes/gene-modules and pathway of interests were identified. Lastly, we related our findings from in vitro neuronal cultures to brain development by mapping differentially expressed genes to BrainSpan transcriptomes. We observed ~2-fold reduction in expression of almost all genes in the 22q11.2 region in SZ (37 genes reached p-value < 0.05, 36 of which reached a false discovery rate < 0.05). Outside of the deleted region, 745 genes showed significant differences in expression between SZ and control neurons (p < 0.05). Function enrichment and network analysis of the differentially expressed genes uncovered converging evidence on abnormal expression in key functional pathways, such as apoptosis, cell cycle and survival, and MAPK signaling in the SZ and SAD samples. By leveraging transcriptome profiles of normal human brain tissues across human development into adulthood, we showed that the differentially expressed genes converge on a sub-network mediated by CDC45 and the cell cycle, which would be disrupted by the 22q11.2 deletion during embryonic brain development, and another sub-network modulated by PRODH, which could contribute to disruption of brain function during adolescence. This study has provided evidence for disruption of potential molecular events in SZ patient with 22q11.2 deletion and related our findings from in vitro neuronal cultures to functional perturbations that can occur during brain development in SZ.

A large deletion in the succinate dehydrogenase B gene (SDHB) in a Japanese patient with abdominal paraganglioma and concomitant metastasis.

PubMed

Kodama, Hitomi; Iihara, Masatoshi; Nissato, Sumiko; Isobe, Kazumasa; Kawakami, Yasushi; Okamoto, Takahiro; Takekoshi, Kazuhiro

2010-01-01

Recently, mutations in nuclear genes encoding two mitochondrial complex II subunit proteins, Succinate dehydrogenase D (SDHD) and SDHB, have been found to be associated with the development of familial pheochromocytomas and paragangliomas (hereditary pheochromocytoma/paraganglioma syndrome: HPPS). Growing evidence suggests that the mutation of SDHB is highly associated with abdominal paraganglioma and the following distant metastasis (malignant paraganglioma). In the present study, we used multiplex ligation dependent probe amplification (MLPA) analysis to identify a large heterozygous SDHB gene deletion encompassing sequences corresponding to the promoter region, in addition to exon 1 and exon 2 malignant paraganglioma patient in whom previously characterized SDHB mutations were undetectable. This is the first Japanese case report of malignant paraganglioma, with a large SDHB deletions. Our present findings strongly support the notion that large deletions in the SDHB gene should be considered in patients lacking characterized SDHB mutations.

An atypical 7q11.23 deletion in a normal IQ Williams–Beuren syndrome patient

PubMed Central

Ferrero, Giovanni Battista; Howald, Cédric; Micale, Lucia; Biamino, Elisa; Augello, Bartolomeo; Fusco, Carmela; Turturo, Maria Giuseppina; Forzano, Serena; Reymond, Alexandre; Merla, Giuseppe

2010-01-01

Williams–Beuren syndrome (WBS; OMIM no. 194050) is a multisystemic neurodevelopmental disorder caused by a hemizygous deletion of 1.55 Mb on chromosome 7q11.23 spanning 28 genes. Haploinsufficiency of the ELN gene was shown to be responsible for supravalvular aortic stenosis and generalized arteriopathy, whereas LIMK1, CLIP2, GTF2IRD1 and GTF2I genes were suggested to be linked to the specific cognitive profile and craniofacial features. These insights for genotype–phenotype correlations came from the molecular and clinical analysis of patients with atypical deletions and mice models. Here we report a patient showing mild WBS physical phenotype and normal IQ, who carries a shorter 1 Mb atypical deletion. This rearrangement does not include the GTF2IRD1 and GTF2I genes and only partially the BAZ1B gene. Our results are consistent with the hypothesis that hemizygosity of the GTF2IRD1 and GTF2I genes might be involved in the facial dysmorphisms and in the specific motor and cognitive deficits observed in WBS patients. PMID:19568270

Reduction of Aspergillus niger Virulence in Apple Fruits by Deletion of the Catalase Gene cpeB.

PubMed

Zhang, Meng-Ke; Tang, Jun; Huang, Zhong-Qin; Hu, Kang-Di; Li, Yan-Hong; Han, Zhuo; Chen, Xiao-Yan; Hu, Lan-Ying; Yao, Gai-Fang; Zhang, Hua

2018-05-30

Aspergillus niger, a common saprophytic fungus, causes rot in many fruits. We studied the role of a putative catalase-peroxidase-encoding gene, cpeB, in oxidative stress and virulence in fruit. The cpeB gene was deleted in A. niger by homologous recombination, and the Δ cpeB mutant showed decreased CAT activity compared with that of the wild type. The cpeB gene deletion caused increased sensitivity to H 2 O 2 stress, and spore germination was significantly reduced; in addition, the reactive-oxygen-species (ROS) metabolites superoxide anions (·O 2 - ), hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) accumulated in the Δ cpeB mutant during H 2 O 2 stress. Furthermore, ROS metabolism in A. niger infected apples was determined, and our results showed that the Δ cpeB mutant induced an attenuated response in apple fruit during the fruit-pathogen interaction; the cpeB gene deletion significantly reduced the development of lesions, suggesting that the cpeB gene in A. niger is essential for full virulence in apples.

Contiguous deletion of the NDP, MAOA, MAOB, and EFHC2 genes in a patient with Norrie disease, severe psychomotor retardation and myoclonic epilepsy.

PubMed

Rodriguez-Revenga, L; Madrigal, I; Alkhalidi, L S; Armengol, L; González, E; Badenas, C; Estivill, X; Milà, M

2007-05-01

Norrie disease (ND) is an X-linked disorder, inherited as a recessive trait that, therefore, mostly affects males. The gene responsible for ND, called NDP, maps to the short arm of chromosome X (Xp11.4-p11.3). We report here an atypical case of ND, consisting of a patient harboring a large submicroscopic deletion affecting not only the NDP gene but also the MAOA, MAOB, and EFHC2 genes. Microarray comparative genomic hybridization (CGH) analysis showed that 11 consecutive bacterial artificial chromosome (BAC) clones, mapping around the NDP gene, were deleted. These clones span a region of about 1 Mb on Xp11.3. The deletion was ascertained by fluorescent in situ hybridization (FISH) analysis with different BAC clones located within the region. Clinical features of the proband include bilateral retinal detachment, microcephaly, severe psychomotor retardation without verbal language skills acquired, and epilepsy. The identification and molecular characterization of this case reinforces the idea of a new contiguous gene syndrome that would explain the complex phenotype shared by atypical ND patients.

Inflammatory peeling skin syndrome caused by homozygous genomic deletion in the PSORS1 region encompassing the CDSN gene.

PubMed

Ishida-Yamamoto, Akemi; Furio, Laetitia; Igawa, Satomi; Honma, Masaru; Tron, Elodie; Malan, Valerie; Murakami, Masamoto; Hovnanian, Alain

2014-01-01

Peeling skin syndrome (PSS) type B is a rare recessive genodermatosis characterized by lifelong widespread, reddish peeling of the skin with pruritus. The disease is caused by small-scale mutations in the Corneodesmosin gene (CDSN) leading to premature termination codons. We report for the first time a Japanese case resulting from complete deletion of CDSN. Corneodesmosin was undetectable in the epidermis, and CDSN was unamplifiable by PCR. QMPSF analysis demonstrated deletion of CDSN exons inherited from each parent. Deletion mapping using microsatellite haplotyping, CGH array and PCR analysis established that the genomic deletion spanned 49-72 kb between HCG22 and TCF19, removing CDSN as well as five other genes within the psoriasis susceptibility region 1 (PSORS1) on 6p21.33. This observation widens the spectrum of molecular defects underlying PSS type B and shows that loss of these five genes from the PSORS1 region does not result in an additional cutaneous phenotype. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion.

PubMed

Gladitz, Josef; Klink, Barbara; Seifert, Michael

2018-06-11

Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups. Our in-depth computational study contributes to a better understanding of the pathology of the 1p/19q co-deletion and other chromosomal arm mutations. This might open opportunities for functional validations and new therapeutic strategies.

MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus.

PubMed

Saito, Mari; Yamagata, Takanori; Matsumoto, Ayumi; Shiba, Yusuke; Nagashima, Masako; Taniguchi, Shuhei; Jimbo, Eriko; Momoi, Mariko Y

2014-01-01

Deletion of the monoamine oxidase (MAO)-A and MAO-B was detected in two male siblings and in their mother. The approximately 800-kb deletion, extending from about 43.0MB to 43.8MB, was detected by array comparative genomic hybridization analysis. The MAOA and MAOB genes were included in the deletion, but the adjacent Norrie disease gene, NDP, was not deleted. The boys had short stature, hypotonia, severe developmental delays, episodes of sudden loss of muscle tone, exiting behavior, lip-smacking and autistic features. The serotonin levels in their cerebrospinal fluid were extremely elevated. Another set of siblings with this deletion was reported previously. We propose recognition of MAOA/B deletion syndrome as a distinct disorder. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

PubMed Central

Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

2017-01-01

Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

PubMed

Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

2004-01-01

Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

A recessive contiguous gene deletion of chromosome 2p16 associated with cystinuria and a mitochondrial disease.

PubMed

Parvari, R; Brodyansky, I; Elpeleg, O; Moses, S; Landau, D; Hershkovitz, E

2001-10-01

Deletions ranging from 100 Kb to 1 Mb--too small to be detected under the microscope--may still involve dozens of genes, thus causing microdeletion syndromes. The vast majority of these syndromes are caused by haploinsufficiency of one or several genes and are transmitted as dominant traits. We identified seven patients originating from an extended family and presenting with a unique syndrome, inherited in a recessive mode, consisting of cystinuria, neonatal seizures, hypotonia, severe somatic and developmental delay, facial dysmorphism, and lactic acidemia. Reduced activity of all the respiratory chain enzymatic complexes that are encoded in the mitochondria was found in muscle biopsy specimens of the patients examined. The molecular basis of this disorder is a homozygous deletion of 179,311 bp on chromosome 2p16, which includes the type I cystinuria gene (SLC3A1), the protein phosphatase 2Cbeta gene (PP2Cbeta), an unidentified gene (KIAA0436), and several expressed sequence tags. The extent of the deletion suggests that this unique syndrome is related to the complete absence of these genes' products, one of which may be essential for the synthesis of mitochondrial encoded proteins.

Genetics Home Reference: piebaldism

MedlinePlus

... and deletions of the KIT (steel factor receptor) gene in human piebaldism. Am J Hum Genet. 1995 Jan;56( ... Sánchez-García I. Deletion of the SLUG (SNAI2) gene results in human piebaldism. Am J Med Genet A. 2003 Oct ...

Identification of essential genes and synthetic lethal gene combinations in Escherichia coli K-12.

PubMed

Mori, Hirotada; Baba, Tomoya; Yokoyama, Katsushi; Takeuchi, Rikiya; Nomura, Wataru; Makishi, Kazuichi; Otsuka, Yuta; Dose, Hitomi; Wanner, Barry L

2015-01-01

Here we describe the systematic identification of single genes and gene pairs, whose knockout causes lethality in Escherichia coli K-12. During construction of precise single-gene knockout library of E. coli K-12, we identified 328 essential gene candidates for growth in complex (LB) medium. Upon establishment of the Keio single-gene deletion library, we undertook the development of the ASKA single-gene deletion library carrying a different antibiotic resistance. In addition, we developed tools for identification of synthetic lethal gene combinations by systematic construction of double-gene knockout mutants. We introduce these methods herein.

High-LET Patterns of DSBs in DNA Loops, the HPRT Gene and Phosphorylation Foci

NASA Technical Reports Server (NTRS)

Ponomarev, Artem L.; Huff, Janice L.; Cucinotta, Francis A.

2007-01-01

We present new results obtained with our model based on the track structure and chromatin geometry that predicts the DSB spatial and genomic distributions in a cell nucleus with the full genome represented. The model generates stochastic patterns of DSBs in the physical space of the nucleus filled with the realistic configuration of human chromosomes. The model was re-used to find the distribution of DSBs in a physical volume corresponding to a visible phosphorylation focus believed to be associated with a DSB. The data shows whether there must more than one DSB per foci due to finite size of the visible focus, even if a single DSB is radiochemically responsible for the phosphorylation of DNA in its vicinity. The same model can predict patterns of closely located DSBs in a given gene, or in a DNA loop, one of the large-scale chromatin structures. We demonstrated for the example of the HPRT gene, how different sorts of radiation lead to proximity effect in DSB locations, which is important for modeling gene deletions. The spectrum of intron deletions and total gene deletions was simulated for the HPRT gene. The same proximity effect of DSBs in a loop can hinder DSB restitutions, as parts of the loop between DSBs is deleted with a higher likelihood. The distributions of DSBs and deletions of DNA in a loop are presented.

Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

PubMed Central

Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

2010-01-01

We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

A neurogenic tumor containing a low-grade malignant peripheral nerve sheath tumor (MPNST) component with loss of p16 expression and homozygous deletion of CDKN2A/p16: a case report showing progression from a neurofibroma to a high-grade MPNST.

PubMed

Tajima, Shogo; Koda, Kenji

2015-01-01

Development of malignant peripheral nerve sheath tumors (MPNSTs) is a stepwise process that involves the alteration of many cell cycle regulators and the double inactivation of the NF1 gene. Inactivation of the TP53 gene and deletion of the CDKN2A/p16 gene are known to play an important role in the process. Herein, we present a 19-year-old man with a familial history of neurofibromatosis type 1, in whom the tumor arose from the intercostal nerve and showed 3 components: a neurofibroma, a low-grade MPNST, and a high-grade MPNST. Loss of p16 expression and homozygous deletion of the CDKN2A/p16 gene were observed in both the low-grade and the high-grade MPNST. In contrast to low-grade MPNSTs, high-grade MPNSTs generally tend to lose expression of p16 and harbor homozygous deletion of the CDKN2A/p16 gene. Loss of p16 expression and homozygous deletion of the CDKN2A/p16 gene in low-grade MPNST in our case might be related to its progression to high-grade MPNST. To the best of our knowledge, this is the first study correlating the p16 expression status and CDKN2A/p16 gene alteration in low-grade MPNSTs.

Deletion of the steroid-binding domain of the human androgen receptor gene in one family with complete androgen insensitivity syndrome: Evidence for further genetic heterogeneity in this syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, T.R.; Lubahn, D.B.; Wilson, E.M.

1988-11-01

The cloning of a cDNA for the human androgen receptor gene has resulted in the availability for cDNA probes that span various parts of the gene, including the entire steroid-binding domain and part of the DNA-binding domain, as well as part of the 5' region of the gene. The radiolabeled probes were used to screen for androgen receptor mutations on Southern blots prepared by restriction endonuclease digestion of genomic DNA from human subjects with complete androgen insensitivity syndrome (AIS). In this investigation, the authors considered only patients presenting complete AIS and with the androgen receptor (-) form as the mostmore » probably subjects to show a gene deletion. One subject from each of six unrelated families with the receptor (-) form of complete AIS and 10 normal subjects were studied. In the 10 normal subjects and in 5 of the 6 patients, identical DNA restriction fragment patterns were observed with EcoRI and BamHI. Analysis of other members of this family confirmed the apparent gene deletion. The data provide direct proof that complete AIS in some families can result from a deletion of the androgen receptor structural gene. However, other families do not demonstrate such a deletion, suggesting that point mutations may also result in the receptor (-) form of complete AIS, adding further to the genetic heterogeneity of this syndrome.« less

Novel Sfp1 Transcriptional Regulation of Saccharomyces cerevisiae Gene Expression Changes During Spaceflight

NASA Astrophysics Data System (ADS)

Coleman, Chasity B.; Allen, Patricia L.; Rupert, Mark; Goulart, Carla; Hoehn, Alexander; Stodieck, Louis S.; Hammond, Timothy G.

2008-12-01

This study identifies transcriptional regulation of stress response element (STRE) genes in space in the model eukaryotic organism, Saccharomyces cerevisiae. To determine transcription-factor dependence, gene expression changes in space were examined in strains bearing green fluorescent protein tagged (GFP-tagged) reporters for YIL052C (Sfp1 dependent with stress), YST-2 (Sfp1/Rap1 dependent with stress), or SSA4 (Msn4 dependent with stress), along with strains of SSA4-GFP and YIL052C-GFP with individual deletions of the Msn4 or Sfp1. When compared to parallel ground controls, spaceflight induces significant gene expression changes in SSA4 (35% decrease) and YIL052C (45% decrease), while expression of YST-2 (0.08% decrease) did not change. In space, deletion of Sfp1 reversed the SSA4 gene expression effect (0.00% change), but Msn4 deletion yielded a similar decrease in SSA4 expression (34% change), which indicates that SSA4 gene expression is dependent on the Sfp1 transcription factor in space, unlike other stresses. For YIL052C, deletion of Sfp1 reversed the effect (0.01% change), and the Msn4 deletion maintained the decrease in expression (30% change), which indicates that expression of YIL052C is also dependent on Sfp1 in space. Spaceflight has selective and specific effects on SSA4 and YIL052C gene expression, indicated by novel dependence on Sfp1.

Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy.

PubMed

Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo

2010-04-01

Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.

A novel contiguous deletion involving NDP, MAOB and EFHC2 gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits.

PubMed

Jia, Bei; Huang, Liping; Chen, Yaoyu; Liu, Siping; Chen, Cuihua; Xiong, Ke; Song, Lanlin; Zhou, Yulai; Yang, Xinping; Zhong, Mei

2017-12-01

Contiguous microdeletions of the Norrie disease pseudoglioma (NDP) region on chromosome Xp11.3 have been widely confirmed as contributing to the typical clinical features of Norrie disease (ND). However, the precise relation between genotype and phenotype could vary. The contiguous deletion of NDP and its neighbouring genes, MAOA/B and EFHC2, reportedly leads to syndromic clinical features such as microcephaly, intellectual disability, and epilepsy. Herewe report a novel contiguous microdeletion of the NDP region containing the MAOB and EFHC2 genes,which causes eye defects but no cognitive disability.We detected a deletion of 494.6 kb atXp11.3 in both the proband and carrier mother. This deletionwas then used as the molecular marker in prenatal diagnosis for two subsequent pregnancies. The deletion was absent in one of the foetuses, who remain without any abnormalities at 2 years of age. The proband shows the typical ocular clinical features of ND including bilateral retinal detachment, microphthalmia, atrophic irides, corneal opacification, and cataracts, but no symptoms of microcephaly, intellectual disability, and epilepsy. This familial study demonstrates that a deficiency in one of two MAO genes may not lead to psychomotor delay, and deletion of EFHC2 may not cause epilepsy. Our observations provide new information on the genotype-phenotype relations of MAOA/B and EFHC2 genes involved in the contiguous deletions of ND.

Role of the CipA Scaffoldin Protein in Cellulose Solubilization, as Determined by Targeted Gene Deletion and Complementation in Clostridium thermocellum

PubMed Central

Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.

2013-01-01

The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

PubMed Central

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

2016-01-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

PubMed

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

2016-08-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

Deletion analysis of male sterility effects of t-haplotypes in the mouse.

PubMed

Bennett, D; Artzt, K

1990-01-01

We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.

[Clinical features of patients with Becker muscular dystrophy and deletions of the rod domain of dystrophin gene].

PubMed

Wang, Yanyun; Zhu, Yuling; Yang, Juan; Li, Yaqin; Sun, Jiangwen; Zhan, Yixin; Zhang, Cheng

2018-02-10

OBJECTIVE To explore the clinical features of patients carrying deletions of the rod domain of the dystrophin gene. METHODS Clinical data of 12 Chinese patients with Becker muscular dystrophy (BMD) and such deletions was reviewed. RESULTS Most patients complained of muscle weakness of lower limbs. Two patients had muscle cramps, one had increased creatine kinase (CK) level, and one had dilated cardiomyopathy. CONCLUSION Compared with DMD, the clinical features of BMD are much more variable, particularly for those carrying deletions of the rod domain of the dystrophin gene. Muscular weakness may not be the sole complaint of BMD. The diagnosis of BMD cannot be excluded by moderately elevated CK. For male patients with dilated cardiomyopathy, the possibility of BMD should be considered.

Deletion of the SHOX gene in patients with short stature of unknown cause.

PubMed

Morizio, E; Stuppia, L; Gatta, V; Fantasia, D; Guanciali Franchi, P; Rinaldi, M M; Scarano, G; Concolino, D; Giannotti, A; Verrotti, A; Chiarelli, F; Calabrese, G; Palka, G

2003-06-15

A fluorescence in situ hybridization (FISH) study was performed in 56 patients with short stature of unknown cause in order to establish the role of deletion of the SHOX gene in this population. FISH analysis was carried out on metaphase spreads and interphase lymphocytes from blood smears using a probe specific for the SHOX gene. Deletion of SHOX was found in four patients (7.1%). No skeletal abnormalities were detected in these patients either at the physical examination or at X-rays of the upper and lower limbs. Present results indicate that SHOX plays an important role also in short stature of unknown cause, and FISH analysis appears as an easy, appropriate, and inexpensive method for the detection of SHOX deletion. Copyright 2003 Wiley-Liss, Inc.

The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

PubMed

Tanaka, J; Fink, G R

1985-01-01

The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

Detection of pseudorabies virus by duplex droplet digital PCR assay.

PubMed

Ren, Meishen; Lin, Hua; Chen, Shijie; Yang, Miao; An, Wei; Wang, Yin; Xue, Changhua; Sun, Yinjie; Yan, Yubao; Hu, Juan

2018-01-01

Aujeszky's disease, caused by pseudorabies virus (PRV), has damaged the economy of the Chinese swine industry. A large number of PRV gene-deleted vaccines have been constructed based on deletion of the glycoprotein E ( gE) gene combined with other virulence-related gene deletions, such as thymidine kinase ( TK), whereas PRV wild-type strains contain an intact gE gene. We developed a sensitive duplex droplet digital PCR (ddPCR) assay to rapidly detect PRV wild-type isolates and gE gene-deleted viral vaccines. We compared this assay with a TaqMan real-time PCR (qPCR) using the same primers and probes. Both assays exhibited good linearity and repeatability; however, ddPCR maintained linearity at extremely low concentrations, whereas qPCR did not. Based on positive results for both gE and gB, the detection limit of ddPCR was found to be 4.75 copies/µL in contrast of 76 copies/µL for qPCR, showing that ddPCR provided a 16-fold improvement in sensitivity. In addition, no nonspecific amplification was shown in specificity testing, and the PRV wild-type was distinguished from a gE-deleted strain. The ddPCR was more sensitive when analyzing clinical serum samples. Thus, ddPCR may become an appropriate detection platform for PRV.

MinGenome: An In Silico Top-Down Approach for the Synthesis of Minimized Genomes.

PubMed

Wang, Lin; Maranas, Costas D

2018-02-16

Genome minimized strains offer advantages as production chassis by reducing transcriptional cost, eliminating competing functions and limiting unwanted regulatory interactions. Existing approaches for identifying stretches of DNA to remove are largely ad hoc based on information on presumably dispensable regions through experimentally determined nonessential genes and comparative genomics. Here we introduce a versatile genome reduction algorithm MinGenome that implements a mixed-integer linear programming (MILP) algorithm to identify in size descending order all dispensable contiguous sequences without affecting the organism's growth or other desirable traits. Known essential genes or genes that cause significant fitness or performance loss can be flagged and their deletion can be prohibited. MinGenome also preserves needed transcription factors and promoter regions ensuring that retained genes will be properly transcribed while also avoiding the simultaneous deletion of synthetic lethal pairs. The potential benefit of removing even larger contiguous stretches of DNA if only one or two essential genes (to be reinserted elsewhere) are within the deleted sequence is explored. We applied the algorithm to design a minimized E. coli strain and found that we were able to recapitulate the long deletions identified in previous experimental studies and discover alternative combinations of deletions that have not yet been explored in vivo.

Lysis delay and burst shrinkage of coliphage T7 by deletion of terminator Tφ reversed by deletion of early genes.

PubMed

Nguyen, Huong Minh; Kang, Changwon

2014-02-01

Bacteriophage T7 terminator Tϕ is a class I intrinsic terminator coding for an RNA hairpin structure immediately followed by oligo(U), which has been extensively studied in terms of its transcription termination mechanism, but little is known about its physiological or regulatory functions. In this study, using a T7 mutant phage, where a 31-bp segment of Tϕ was deleted from the genome, we discovered that deletion of Tϕ from T7 reduces the phage burst size but delays lysis timing, both of which are disadvantageous for the phage. The burst downsizing could directly result from Tϕ deletion-caused upregulation of gene 17.5, coding for holin, among other Tϕ downstream genes, because infection of gp17.5-overproducing Escherichia coli by wild-type T7 phage showed similar burst downsizing. However, the lysis delay was not associated with cellular levels of holin or lysozyme or with rates of phage adsorption. Instead, when allowed to evolve spontaneously in five independent adaptation experiments, the Tϕ-lacking mutant phage, after 27 or 29 passages, recovered both burst size and lysis time reproducibly by deleting early genes 0.5, 0.6, and 0.7 of class I, among other mutations. Deletion of genes 0.5 to 0.7 from the Tϕ-lacking mutant phage decreased expression of several Tϕ downstream genes to levels similar to that of the wild-type phage. Accordingly, phage T7 lysis timing is associated with cellular levels of Tϕ downstream gene products. This suggests the involvement of unknown factor(s) besides the known lysis proteins, lysozyme and holin, and that Tϕ plays a role of optimizing burst size and lysis time during T7 infection. IMPORTANCE Bacteriophages are bacterium-infecting viruses. After producing numerous progenies inside bacteria, phages lyse bacteria using their lysis protein(s) to get out and start a new infection cycle. Normally, lysis is tightly controlled to ensure phage progenies are maximally produced and released at an optimal time. Here, we have discovered that phage T7, besides employing its known lysis proteins, additionally uses its transcription terminator Tϕ to guarantee the optimal lysis of the E. coli host. Tϕ, positioned in the middle of the T7 genome, must be inactivated at least partially to allow for transcription-driven translocation of T7 DNA into hosts and expression of Tϕ downstream but promoter-lacking genes. What role is played by Tϕ before inactivation? Without Tϕ, not only was lysis time delayed but also the number of progenies was reduced in this study. Furthermore, T7 can overcome Tϕ deletion by further deleting some genes, highlighting that a phage has multiple strategies for optimizing lysis.

Speckle-type POZ (pox virus and zinc finger protein) protein gene deletion in ovarian cancer: Fluorescence in situ hybridization analysis of a tissue microarray.

PubMed

Hu, Xiaoyu; Yang, Zhu; Zeng, Manman; Liu, Y I; Yang, Xiaotao; Li, Yanan; Li, X U; Yu, Qiubo

2016-07-01

The aim of the present study was to investigate the status of speckle-type POZ (pox virus and zinc finger protein) protein (SPOP) gene located on chromosome 17q21 in ovarian cancer (OC). The present study evaluated a tissue microarray, which contained 90 samples of ovarian cancer and 10 samples of normal ovarian tissue, using fluorescence in situ hybridization (FISH). FISH is a method where a SPOP-specific DNA red fluorescence probe was used for the experimental group and a centromere-specific DNA green fluorescence probe for chromosome 17 was used for the control group. The present study demonstrated that a deletion of the SPOP gene was observed in 52.27% (46/88) of the ovarian cancer tissues, but was not identified in normal ovarian tissues. Simultaneously, monosomy 17 was frequently identified in the ovarian cancer tissues, but not in the normal ovarian tissues. Furthermore, the present data revealed that the ovarian cancer histological subtype and grade were significantly associated with a deletion of the SPOP gene, which was assessed by the appearance of monosomy 17 in the ovarian cancer samples; the deletion of the SPOP gene was observed in a large proportion of serous epithelial ovarian cancer (41/61; 67.21%), particularly in grade 3 (31/37; 83.78%). In conclusion, deletion of the SPOP gene on chromosome 17 in ovarian cancer samples, which results from monosomy 17, indicates that the SPOP gene may serve as a tumor suppressor gene in ovarian cancer.

Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

PubMed

Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

2000-03-01

Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

Identification of a novel large deletion in a patient with severe factor V deficiency using an in-house F5 MLPA assay.

PubMed

Nuzzo, F; Paraboschi, E M; Straniero, L; Pavlova, A; Duga, S; Castoldi, E

2015-01-01

Factor V (FV) deficiency is a rare autosomal recessive bleeding disorder caused by mutations in the F5 gene. FV-deficient patients in whom no mutation or only one mutation is found may harbour large gene rearrangements, which are not detected by conventional mutation screening strategies. The aim of this study was to develop and validate a multiplex ligation-dependent probe amplification (MLPA) assay for the detection of large deletions and duplications in the F5 gene. Twenty-two MLPA probes targeting 19 of the 25 exons and the upstream and downstream regions of the F5 gene were designed and tested in 10 normal controls, a patient with a known heterozygous deletion of F5 exons 1-7 (positive control) and 14 genetically unexplained FV-deficient patients. MLPA results were confirmed by digital PCR on a QuantStudio(™) 3D Digital PCR System. The F5-specific probes yielded a reproducible peak profile in normal controls, correctly detected the known deletion in the positive control and suggested the presence of a novel deletion of exons 9-10 in a patient with undetectable FV levels and only one identified mutation. Follow-up by chip-based digital PCR, long-range PCR and direct sequencing confirmed that this patient carried a heterozygous F5 deletion of 1823 bp extending from intron 8 to intron 10. Bioinformatics sequence analysis pinpointed repetitive elements that might have originated the deletion. In conclusion, we have developed and validated an MLPA assay for the detection of gross F5 gene rearrangements. This assay may represent a valuable tool for the molecular diagnosis of FV deficiency. © 2014 John Wiley & Sons Ltd.

Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

PubMed

Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

2013-06-01

Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Various 30 and 69 bp deletion variants of the Epstein-Barr virus LMP1 may arise by homologous recombination in nasopharyngeal carcinoma of Tunisian patients.

PubMed

Hadhri-Guiga, Boutheina; Khabir, Abdel-Majid; Mokdad-Gargouri, Raja; Ghorbel, Abdel-Monem; Drira, Mohamed; Daoud, Jamel; Frikha, Mounir; Jlidi, Rachid; Gargouri, Ali

2006-01-01

Nasopharyngeal carcinoma (NPC) occurs with a striking geographic distribution, it is endemic in certain areas of Southeast Asia and North Africa. NPC is tightly linked to Epstein-Barr virus (EBV), however, only a small subset of EBV genes are expressed, among them the latent membrane protein 1 (LMP1). LMP1 is considered as the main EBV oncoprotein and its 30 bp deleted-variant has been reported to be more prevalent in biopsies of NPC. We have assessed the 30 bp deletion and the XhoI polymorphisms of the BNLF1 gene in 30 peripheral bloods of NPC patients and 62 nasopharyngeal biopsies, 42 being confirmed as undifferentiated nasopharyngeal carcinoma and 20 are normal nasopharyngeal epithelium cells. Our results show that 100% of individuals retained the XhoI restriction site. A rare NPC variant, having a 69 bp deletion in the C-terminus region of the BNLF1 gene, covering the 30 bp deletion, was found in two NPC biopsies. The deleted 30 and 69 bp deleted-variants are significantly (p = 0.006) more frequent in NPC (71.42%) than in control biopsies (52%). In peripheral blood of NPC patients, the deleted-variants (47%) are also lower than in tumor tissues (p = 0.0004), suggesting that the deletion could be associated with a risk of tumor genesis. Direct repeats, located at the extremities of the 30 and 69 bp deletions, should be involved in this process. We propose that other deletions could be found since another similar direct repeat is present at the vicinity of the former ones.

Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

PubMed Central

Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

2018-01-01

Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

Increased production of biomass-degrading enzymes by double deletion of creA and creB genes involved in carbon catabolite repression in Aspergillus oryzae.

PubMed

Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

2018-02-01

In a previous study, we reported that a double gene deletion mutant for CreA and CreB, which constitute the regulatory machinery involved in carbon catabolite repression, exhibited improved production of α-amylase compared with the wild-type strain and single creA or creB deletion mutants in Aspergillus oryzae. Because A. oryzae can also produce biomass-degrading enzymes, such as xylolytic and cellulolytic enzymes, we examined the production levels of those enzymes in deletion mutants in this study. Xylanase and β-glucosidase activities in the wild-type were hardly detected in submerged culture containing xylose as the carbon source, whereas those enzyme activities were significantly increased in the single creA deletion (ΔcreA) and double creA and creB deletion (ΔcreAΔcreB) mutants. In particular, the ΔcreAΔcreB mutant exhibited >100-fold higher xylanase and β-glucosidase activities than the wild-type. Moreover, in solid-state culture, the β-glucosidase activity of the double deletion mutant was >7-fold higher than in the wild-type. These results suggested that deletion of both creA and creB genes could also efficiently improve the production levels of biomass-degrading enzymes in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lachiewicz, A.; Rao, K.; Aylsworth, A.

A 2-year-old boy with Martin-Bell syndrome was referred for molecular testing and found to have a large deletion of FMRI. His mother was found to have two FMR-1 alleles in the normal range for CGG repeats. DNA probes located both proximal and distal to FRAXA were used to delineate the approximation location of the deletion endpoints. Proximal to the fragile site, DXS312 (pX135) was absent but DXS98 (4D8) was present. Distal to the fragile site, DXS296 (VK21) was absent but DXS304 (U6.2) was present. Our patient does not appear to have clinical findings other than those typically associated with fragilemore » X syndrome suggesting that the deletion does not remove other contiguous genes, e.g., IDS. The deletion in this patient is larger than the patient reported by Gedeon et al., in whom approximately 2.5 megabases were estimated to be deleted. Using the physical map of Schlessinger et al., the physical extent of the deletion can be estimated to be at least 3 megabases. This patient may be useful in physical mapping of the chromosomal region near FMR-1. Continued long-term evaluation of this patient may uncover clinical findings suggestive that the deletion removes other genes near to FMR-1 or, alternatively, no findings atypical of the fragile X syndrome suggesting that no other genes lie in the deletion interval.« less

Delimitation of the Earliness per se D1 (Eps-D1) flowering gene to a subtelomeric chromosomal deletion in bread wheat (Triticum aestivum).

PubMed

Zikhali, Meluleki; Wingen, Luzie U; Griffiths, Simon

2016-01-01

Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A (m) 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A (m) 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Prevalence and Spectrum of Large Deletions or Duplications in the Major Long QT Syndrome-Susceptibility Genes and Implications for Long QT Syndrome Genetic Testing

PubMed Central

Tester, David J.; Benton, Amber J.; Train, Laura; Deal, Barbara; Baudhuin, Linnea M.; Ackerman, Michael J.

2010-01-01

Long QT Syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for three cardiac ion channel alpha-subunits (LQT1-3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. Here, we set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes among unrelated patients who were mutation-negative following point mutation analysis of LQT1-12-susceptibility genes. Forty-two unrelated clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification (MLPA), a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA-MLPA LQTS Kit from MRC-Holland was used to analyze the three major LQTS-associated genes: KCNQ1, KCNH2, and SCN5A and the two minor genes: KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2/42 (4.8%, CI, 1.7–11%) unrelated patients. A deletion of KCNQ1 exon 3 was identified in a 10 year-old Caucasian boy with a QTc of 660 milliseconds (ms), a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17 year-old Caucasian girl with a QTc of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, since nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. PMID:20920651

Construction of a psb C deletion strain in Synechocystis 6803.

PubMed

Goldfarb, N; Knoepfle, N; Putnam-Evans, C

1997-01-01

Synechocystis 6803 is a cyanobacterium that carries out-oxygenic photosynthesis. We are interested in the introduction of mutations in the large extrinsic loop region of the CP43 protein of Photosystem II (PSII). CP43 appears to be required for the stable assembly of the PSII complex and also appears to play a role in photosynthetic oxygen evolution. Deletion of short segments of the large extrinsic loop results in mutants incapable of evolving oxygen. Alterations in psbC, the gene encoding CP43, are introduced into Synechocystis 6803 by transformation and homologous recombination. Specifically, plasmid constructs bearing the site-directed mutations are introduced into a deletion strain where the portion of the gene encoding the area of mutation has been deleted and replaced by a gene conferring antibiotic resistance. We have constructed a deletion strain of Synechocystis appropriate for the introduction of mutations in the large extrinsic loop of CP43 and have used it successfully to produce site-directed mutants.

Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

PubMed

Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

2014-10-01

Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

Deletion of acetate transporter gene ADY2 improved tolerance of Saccharomyces cerevisiae against multiple stresses and enhanced ethanol production in the presence of acetic acid.

PubMed

Zhang, Mingming; Zhang, Keyu; Mehmood, Muhammad Aamer; Zhao, Zongbao Kent; Bai, Fengwu; Zhao, Xinqing

2017-12-01

The aim of this work was to study the effects of deleting acetate transporter gene ADY2 on growth and fermentation of Saccharomyces cerevisiae in the presence of inhibitors. Comparative transcriptome analysis revealed that three genes encoding plasma membrane carboxylic acid transporters, especially ADY2, were significantly downregulated under the zinc sulfate addition condition in the presence of acetic acid stress, and the deletion of ADY2 improved growth of S. cerevisiae under acetic acid, ethanol and hydrogen peroxide stresses. Consistently, a concomitant increase in ethanol production by 14.7% in the presence of 3.6g/L acetic acid was observed in the ADY2 deletion mutant of S. cerevisiae BY4741. Decreased intracellular acetic acid, ROS accumulation, and plasma membrane permeability were observed in the ADY2 deletion mutant. These findings would be useful for developing robust yeast strains for efficient ethanol production. Copyright © 2017 Elsevier Ltd. All rights reserved.

LMOf2365_0442 Encoding for a Fructose Specific PTS Permease IIA May Be Required for Virulence in L. monocytogenes Strain F2365

PubMed Central

Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418

The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

PubMed

Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

2017-09-25

Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

Engineering electron metabolism to increase ethanol production in Clostridium thermocellum.

PubMed

Lo, Jonathan; Olson, Daniel G; Murphy, Sean Jean-Loup; Tian, Liang; Hon, Shuen; Lanahan, Anthony; Guss, Adam M; Lynd, Lee R

2017-01-01

The NfnAB (NADH-dependent reduced ferredoxin: NADP + oxidoreductase) and Rnf (ion-translocating reduced ferredoxin: NAD + oxidoreductase) complexes are thought to catalyze electron transfer between reduced ferredoxin and NAD(P) + . Efficient electron flux is critical for engineering fuel production pathways, but little is known about the relative importance of these enzymes in vivo. In this study we investigate the importance of the NfnAB and Rnf complexes in Clostridium thermocellum for growth on cellobiose and Avicel using gene deletion, enzyme assays, and fermentation product analysis. The NfnAB complex does not seem to play a major role in metabolism, since deletion of nfnAB genes had little effect on the distribution of fermentation products. By contrast, the Rnf complex appears to play an important role in ethanol formation. Deletion of rnf genes resulted in a decrease in ethanol formation. Overexpression of rnf genes resulted in an increase in ethanol production of about 30%, but only in strains where the hydG hydrogenase maturation gene was also deleted. Copyright © 2016 International Metabolic Engineering Society. All rights reserved.

SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature.

PubMed

Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

2014-03-01

SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3-15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS.

SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

PubMed Central

Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

2014-01-01

SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

PubMed

Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

2007-11-01

Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

Isolated chromosome 8p23.2‑pter deletion: Novel evidence for developmental delay, intellectual disability, microcephaly and neurobehavioral disorders.

PubMed

Shi, Shanshan; Lin, Shaobin; Chen, Baojiang; Zhou, Yi

2017-11-01

The current study presents a patient carrying a de novo ~6 Mb deletion of the isolated chromosome 8p23.2‑pter that was identified with a single‑nucleotide polymorphism array. The patient was characterized by developmental delay (DD)/intellectual disability (ID), microcephaly, autism spectrum disorder, attention‑deficit/hyperactivity disorders and mildly dysmorphic features. The location, size and gene content of the deletion observed in this patient were compared with those in 7 patients with isolated 8p23.2 to 8pter deletions reported in previous studies (4 patients) or recorded in the Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources (DECIPHER) database (3 patients). The deletions reported in previous studies were assessed using a chromosomal microarray analysis. The 8p23.2‑pter deletion was a distinct microdeletion syndrome, as similar phenotypes were observed in patients with this deletion. Furthermore, following a detailed review of the potential associations between the genes located from 8p23.2 to 8pter and their clinical significance, it was hypothesized that DLG associated protein 2, ceroid‑lipofuscinosis neuronal 8, Rho guanine nucleotide exchange factor 10 and CUB and sushi multiple domains 1 may be candidate genes for DD/ID, microcephaly and neurobehavioral disorders. However, firm evidence should be accumulated from high‑resolution studies of patients with small, isolated, overlapping and interstitial deletions involving the region from 8p23.2 to 8pter. These studies will allow determination of genotype‑phenotype associations for the specific genes crucial to 8p23.2‑pter.

Molecular and clinical characterization of a patient with a chromosome 4p deletion, Wolf-Hirschhorn syndrome, and congenital glaucoma.

PubMed

Finzi, S; Pinto, C F; Wiggs, J L

2001-03-01

Wolf-Hirschhorn syndrome is a developmental disorder associated with hemizygous deletion of the distal short arm of chromosome 4. We have identified a patient affected with Wolf-Hirschhorn syndrome and early onset glaucoma. Five other patients with Wolf-Hirschhorn syndrome and early onset glaucoma or ocular anomalies associated with early onset glaucoma have been previously described, suggesting that the association with Wolf-Hirschhorn syndrome is not coincidental. The infrequent association of early onset glaucoma suggests that the chromosomal region commonly deleted in Wolf-Hirschhorn patients does not contain genes responsible for early onset glaucoma. In this study, we performed a molecular characterization of the deleted chromosome 4 to determine the extent of the deletion in an attempt to begin to identify the chromosomal region responsible for the associated glaucoma. Using microsatellite repeat markers located on 4p, we determined that the deletion spanned a 60-cM region including the minimal Wolf-Hirschhorn region. The proximal breakpoint occurred between markers D4S3045 and D4S2974. These results support the hypothesis that patients with Wolf-Hirschhorn syndrome and early onset glaucoma may have large deletions of 4p that include a gene(s) that may be responsible for a dominant form of congenital glaucoma.

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis

PubMed Central

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-01-01

Background Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, ~4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. Results As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. Conclusion We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s). PMID:19055778

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis.

PubMed

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-12-03

Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, approximately 4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s).

A nonimprinted Prader-Willi Syndrome (PWS)-region gene regulates a different chromosomal domain in trans but the imprinted pws loci do not alter genome-wide mRNA levels.

PubMed

Stefan, Mihaela; Portis, Toni; Longnecker, Richard; Nicholls, Robert D

2005-05-01

Prader-Willi syndrome (PWS) is a complex neurobehavioral disorder that results from loss of function of 10 clustered, paternally expressed genes in a 1.5-Mb region of chromosome 15q11-q13. Many of the primary PWS region genes appear to have nuclear RNA regulatory functions, suggesting that multiple genetic pathways could be secondarily affected in PWS. Using a transgenic mouse model of PWS (TgPWS) with an approximately 4-Mb chromosome 7C deletion of paternal origin that models the neonatal phenotype of the human syndrome we compared by oligonucleotide microarrays expression levels of approximately 12,000 genes and ESTs in TgPWS and wild-type brain. Hybridization data were processed with two distinct statistical algorithms and revealed a dramatically reduced expression of 4 imprinted genes within the deletion region in TgPWS mice, with 2 nonimprinted, codeleted genes reduced twofold. However, only 3 genes outside the deletion were significantly altered in TgPWS mouse brain, with approximately 1.5-fold up-regulation of mRNA levels. Remarkably, these genes map to a single chromosome domain (18B3), and by quantitative RT-PCR we show that 8 genes in this domain are up-regulated in TgPWS brain. These 18B3 genes were up-regulated in an equivalent manner in Angelman syndrome mouse (TgAS) brain, which has the same deletion but of maternal origin. Therefore, the trans-regulation of the chromosome 18B3 domain is due to decreased expression of a nonimprinted gene within the TgPWS/AS mouse deletion in mouse chromosome 7C. Most surprisingly, since 48-60% of the genome was screened, it appears that the imprinted mouse PWS loci do not widely regulate mRNA levels of other genes and may regulate RNA structure.

Extreme MHC class I diversity in the sedge warbler (Acrocephalus schoenobaenus); selection patterns and allelic divergence suggest that different genes have different functions.

PubMed

Biedrzycka, Aleksandra; O'Connor, Emily; Sebastian, Alvaro; Migalska, Magdalena; Radwan, Jacek; Zając, Tadeusz; Bielański, Wojciech; Solarz, Wojciech; Ćmiel, Adam; Westerdahl, Helena

2017-07-05

Recent work suggests that gene duplications may play an important role in the evolution of immunity genes. Passerine birds, and in particular Sylvioidea warblers, have highly duplicated major histocompatibility complex (MHC) genes, which are key in immunity, compared to other vertebrates. However, reasons for this high MHC gene copy number are yet unclear. High-throughput sequencing (HTS) allows MHC genotyping even in individuals with extremely duplicated genes. This HTS data can reveal evidence of selection, which may help to unravel the putative functions of different gene copies, i.e. neofunctionalization. We performed exhaustive genotyping of MHC class I in a Sylvioidea warbler, the sedge warbler, Acrocephalus schoenobaenus, using the Illumina MiSeq technique on individuals from a wild study population. The MHC diversity in 863 genotyped individuals by far exceeds that of any other bird species described to date. A single individual could carry up to 65 different alleles, a large proportion of which are expressed (transcribed). The MHC alleles were of three different lengths differing in evidence of selection, diversity and divergence within our study population. Alleles without any deletions and alleles containing a 6 bp deletion showed characteristics of classical MHC genes, with evidence of multiple sites subject to positive selection and high sequence divergence. In contrast, alleles containing a 3 bp deletion had no sites subject to positive selection and had low divergence. Our results suggest that sedge warbler MHC alleles that either have no deletion, or contain a 6 bp deletion, encode classical antigen presenting MHC molecules. In contrast, MHC alleles containing a 3 bp deletion may encode molecules with a different function. This study demonstrates that highly duplicated MHC genes can be characterised with HTS and that selection patterns can be useful for revealing neofunctionalization. Importantly, our results highlight the need to consider the putative function of different MHC genes in future studies of MHC in relation to disease resistance and fitness.

Universal fluorescent multiplex PCR and capillary electrophoresis for evaluation of gene conversion between SMN1 and SMN2 in spinal muscular atrophy.

PubMed

Wang, Chun-Chi; Jong, Yuh-Jyh; Chang, Jan-Gowth; Chen, Yen-Ling; Wu, Shou-Mei

2010-07-01

We have developed a capillary electrophoresis (CE) method with universal fluorescent multiplex PCR to simultaneously detect the SMN1 and SMN2 genes in exons 7 and 8. Spinal muscular atrophy (SMA) is a very frequent inherited disease caused by the absence of the SMN1 gene in approximately 94% of patients. Those patients have deletion of the SMN1 gene or gene conversion between SMN1 and SMN2. However, most methods only focus on the analysis of whole gene deletion, and ignore gene conversion. Simultaneous quantification of SMN1 and SMN2 in exons 7 and 8 is a good strategy for estimating SMN1 deletion or SMN1 to SMN2 gene conversion. This study established a CE separation allowing differentiation of all copy ratios of SMN1 to SMN2 in exons 7 and 8. Among 212 detected individuals, there were 23 SMA patients, 45 carriers, and 144 normal subjects. Three individuals had different ratios of SMN1 to SMN2 in two exons, including an SMA patient having two SMN2 copies in exon 7 but one SMN1 copy in exon 8. This method could provide more information about SMN1 deletion or SMN1 to SMN2 gene conversion for SMA genotyping and diagnosis.

[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

PubMed

Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

2003-12-01

To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

Seventeen {alpha}-hydroxylase deficiency with one base pair deletion of the cytochrome P450c17 (CYP17) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio

1995-08-01

Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less

A Recessive Contiguous Gene Deletion of Chromosome 2p16 Associated with Cystinuria and a Mitochondrial Disease

PubMed Central

Parvari, Ruti; Brodyansky, Irena; Elpeleg, Orly; Moses, Shimon; Landau, Daniel; Hershkovitz, Eli

2001-01-01

Deletions ranging from 100 Kb to 1 Mb—too small to be detected under the microscope—may still involve dozens of genes, thus causing microdeletion syndromes. The vast majority of these syndromes are caused by haploinsufficiency of one or several genes and are transmitted as dominant traits. We identified seven patients originating from an extended family and presenting with a unique syndrome, inherited in a recessive mode, consisting of cystinuria, neonatal seizures, hypotonia, severe somatic and developmental delay, facial dysmorphism, and lactic acidemia. Reduced activity of all the respiratory chain enzymatic complexes that are encoded in the mitochondria was found in muscle biopsy specimens of the patients examined. The molecular basis of this disorder is a homozygous deletion of 179,311 bp on chromosome 2p16, which includes the type I cystinuria gene (SLC3A1), the protein phosphatase 2Cβ gene (PP2Cβ), an unidentified gene (KIAA0436), and several expressed sequence tags. The extent of the deletion suggests that this unique syndrome is related to the complete absence of these genes’ products, one of which may be essential for the synthesis of mitochondrial encoded proteins. PMID:11524703

Convergent Loss of ABC Transporter Genes From Clostridioides difficile Genomes Is Associated With Impaired Tyrosine Uptake and p-Cresol Production.

PubMed

Steglich, Matthias; Hofmann, Julia D; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich

2018-01-01

We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p -cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile , with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile , we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291.

Convergent Loss of ABC Transporter Genes From Clostridioides difficile Genomes Is Associated With Impaired Tyrosine Uptake and p-Cresol Production

PubMed Central

Steglich, Matthias; Hofmann, Julia D.; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich

2018-01-01

We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p-cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile, with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile, we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291. PMID:29867812

A new case of interstitial 6q16.2 deletion in a patient with Prader-Willi-like phenotype and investigation of SIM1 gene deletion in 87 patients with syndromic obesity.

PubMed

Varela, Monica C; Simões-Sato, Alex Y; Kim, Chong A; Bertola, Débora R; De Castro, Claudia I E; Koiffmann, Celia P

2006-01-01

The association of obesity, phenotypic abnormalities and mental retardation characterizes syndromic obesity. Its most common form is the Prader-Willi syndrome (PWS-- neonatal hypotonia, poor sucking, delayed psychomotor development, hyperphagia, severe obesity, short stature, small hands and feet, hypogonadism, mild to moderate mental retardation and behavioral disorders). A PWS-like phenotype has been described in patients with chromosome abnormalities involving the chromosome region 6q16.2 that includes the SIM1 gene. Herein we report cytogenetic and gene studies including a screening for the SIM1 gene deletion, performed on 87 patients with PWS-like phenotype, and describe the fifth case of syndromic obesity with an interstitial deletion of the chromosome segment 6q16-q21 and suggest that mutational analysis and further studies of the parental origin of chromosome alterations of 6q16.2 in patients with and without PWS-like phenotype are needed to evaluate possible imprinting effects of SIM1 gene and establish the contribution that alterations in this gene makes to the etiology of syndromic and non-syndromic obesity.

Deletion of a Single-Copy Trna Affects Microtubule Function in Saccharomyces Cerevisiae

PubMed Central

Reijo, R. A.; Cho, D. S.; Huffaker, T. C.

1993-01-01

rts1-1 was identified as an extragenic suppressor of tub2-104, a cold-sensitive allele of the sole gene encoding β-tubulin in the yeast, Saccharomyces cerevisiae. In addition, rts1-1 cells are heat sensitive and resistant to the microtubule-destabilizing drug, benomyl. The rts1-1 mutation is a deletion of approximately 5 kb of genomic DNA on chromosome X that includes one open reading frame and three tRNA genes. Dissection of this region shows that heat sensitivity is due to deletion of the open reading frame (HIT1). Suppression and benomyl resistance are caused by deletion of the gene encoding a tRNA(AGG)(Arg) (HSX1). Northern analysis of rts1-1 cells indicates that HSX1 is the only gene encoding this tRNA. Deletion of HSX1 does not suppress the tub2-104 mutation by misreading at the AGG codons in TUB2. It also does not suppress by interfering with the protein arginylation that targets certain proteins for degradation. These results leave open the prospect that this tRNA(AGG)(Arg) plays a novel role in the cell. PMID:8307335

A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

PubMed

Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

2015-01-01

Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

Identification of a novel AluSx-mediated deletion of exon 3 in the SBDS gene in a patient with Shwachman-Diamond syndrome.

PubMed

Costa, Elísio; Duque, Frederico; Oliveira, Jorge; Garcia, Paula; Gonçalves, Isabel; Diogo, Luísa; Santos, Rosário

2007-01-01

Shwachman-Diamond syndrome (SDS) is caused by mutations in the SBDS gene, most of which are the result of gene conversion events involving its highly homologous pseudogene SBDSP. Here we describe the molecular characterization of the first documented gross deletion in the SBDS gene, in a 4-year-old Portuguese girl with SDS. The clinical diagnosis was based on the presence of hematological symptoms (severe anemia and cyclic neutropenia), pancreatic exocrine insufficiency and skeletal abnormalities. Routine molecular screening revealed heterozygosity for the common splicing mutation c.258+2T>C, and a further step-wise approach led to the detection of a large deletion encompassing exon 3, the endpoints of which were subsequently delineated at the gDNA level. This novel mutation (c.258+374_459+250del), predictably giving rise to an internally deleted polypeptide (p.Ile87_Gln153del), appears to have arisen from an excision event mediated by AluSx elements which are present in introns 2 and 3. Our case illustrates the importance of including gross deletion screening in the SDS diagnostic setting, especially in cases where only one deleterious mutation is detected by routine screening methods. In particular, deletional rearrangements involving exon 3 should be considered, since Alu sequences are known to be an important cause of recurrent mutations.

Protein Kinase Inhibitor γ reciprocally regulates osteoblast and adipocyte differentiation by downregulating Leukemia Inhibitory Factor

PubMed Central

Chen, Xin; Hausman, Bryan S.; Luo, Guangbin; Zhou, Guang; Murakami, Shunichi; Rubin, Janet; Greenfield, Edward M.

2013-01-01

The Protein Kinase Inhibitor (Pki) gene family inactivates nuclear PKA and terminates PKA-induced gene expression. We previously showed that Pkig is the primary family member expressed in osteoblasts and that Pkig knockdown increases the effects of parathyroid hormone and isoproterenol on PKA activation, gene expression, and inhibition of apoptosis. Here, we determined whether endogenous levels of Pkig regulate osteoblast differentiation. Pkig is the primary family member in MEFs, murine marrow-derived mesenchymal stem cells, and human mesenchymal stem cells. Pkig deletion increased forskolin-dependent nuclear PKA activation and gene expression and Pkig deletion or knockdown increased osteoblast differentiation. PKA signaling is known to stimulate adipogenesis; however, adipogenesis and osteogenesis are often reciprocally regulated. We found that the reciprocal regulation predominates over the direct effects of PKA since adipogenesis was decreased by Pkig deletion or knockdown. Pkig deletion or knockdown simultaneously increased osteogenesis and decreased adipogenesis in mixed osteogenic/adipogenic medium. Pkig deletion increased PKA-induced expression of Leukemia Inhibitory Factor (Lif) mRNA and LIF protein. LIF neutralizing antibodies inhibited the effects on osteogenesis and adipogenesis of either Pkig deletion in MEFs or PKIγ knockdown in both murine and human mesenchymal stem cells. Collectively, our results show that endogenous levels of Pkig reciprocally regulate osteoblast and adipocyte differentiation and that this reciprocal regulation is mediated in part by LIF. PMID:23963683

Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.

PubMed

Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J

2011-09-01

Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.

Severe visual impairment and retinal changes in a boy with a deletion of the gene for Nance-Horan syndrome.

PubMed

Mathys, R; Deconinck, H; Keymolen, K; Jansen, A; Van Esch, H

2007-01-01

We present the ophthalmologic findings in a boy with a deletion of Xp22 comprising the gene for Nance-Horan syndrome. Different mechanisms underlying the visual impairment in Nance-Horan syndrome are discussed.

Whole-Genome Sequences of Variants of Bacillus anthracis Sterne and Their Toxin Gene Deletion Mutants

PubMed Central

Staab, A.; Plaut, R. D.; Pratt, C.; Lovett, S. P.; Wiley, M. R.; Biggs, T. D.; Bernhards, R. C.; Beck, L. C.; Palacios, G. F.; Stibitz, S.; Jones, K. L.; Goodwin, B. G.; Smith, M. A.

2017-01-01

ABSTRACT Here, we report the draft genome sequences of three laboratory variants of Bacillus anthracis Sterne and their double (Δlef Δcya) and triple (Δpag Δlef Δcya) toxin gene deletion derivatives. PMID:29122874

A comprehensive analysis of replicative lifespan in 4,698 single-gene deletion strains uncovers conserved mechanisms of aging

PubMed Central

McCormick, Mark A.; Delaney, Joe R.; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; Shemorry, Anna; Sim, Sylvia; Chou, Annie Chia-Zong; Ahmed, Umema; Carr, Daniel; Murakami, Christopher J.; Schleit, Jennifer; Sutphin, George L.; Wasko, Brian M.; Bennett, Christopher F.; Wang, Adrienne M.; Olsen, Brady; Beyer, Richard P.; Bammler, Theodor K.; Prunkard, Donna; Johnson, Simon C.; Pennypacker, Juniper K.; An, Elroy; Anies, Arieanna; Castanza, Anthony S.; Choi, Eunice; Dang, Nick; Enerio, Shiena; Fletcher, Marissa; Fox, Lindsay; Goswami, Sarani; Higgins, Sean A.; Holmberg, Molly A.; Hu, Di; Hui, Jessica; Jelic, Monika; Jeong, Ki-Soo; Johnston, Elijah; Kerr, Emily O.; Kim, Jin; Kim, Diana; Kirkland, Katie; Klum, Shannon; Kotireddy, Soumya; Liao, Eric; Lim, Michael; Lin, Michael S.; Lo, Winston C.; Lockshon, Dan; Miller, Hillary A.; Moller, Richard M.; Muller, Brian; Oakes, Jonathan; Pak, Diana N.; Peng, Zhao Jun; Pham, Kim M.; Pollard, Tom G.; Pradeep, Prarthana; Pruett, Dillon; Rai, Dilreet; Robison, Brett; Rodriguez, Ariana A.; Ros, Bopharoth; Sage, Michael; Singh, Manpreet K.; Smith, Erica D.; Snead, Katie; Solanky, Amrita; Spector, Benjamin L.; Steffen, Kristan K.; Tchao, Bie Nga; Ting, Marc K.; Wende, Helen Vander; Wang, Dennis; Welton, K. Linnea; Westman, Eric A.; Brem, Rachel B.; Liu, Xin-guang; Suh, Yousin; Zhou, Zhongjun; Kaeberlein, Matt; Kennedy, Brian K.

2015-01-01

SUMMARY Many genes that affect replicative lifespan (RLS) in the budding yeast Saccharomyces cerevisiae also affect aging in other organisms such as C. elegans and M. musculus. We performed a systematic analysis of yeast RLS in a set of 4,698 viable single-gene deletion strains. Multiple functional gene clusters were identified, and full genome-to-genome comparison demonstrated a significant conservation in longevity pathways between yeast and C. elegans. Among the mechanisms of aging identified, deletion of tRNA exporter LOS1 robustly extended lifespan. Dietary restriction (DR) and inhibition of mechanistic Target of Rapamycin (mTOR) exclude Los1 from the nucleus in a Rad53-dependent manner. Moreover, lifespan extension from deletion of LOS1 is non-additive with DR or mTOR inhibition, and results in Gcn4 transcription factor activation. Thus, the DNA damage response and mTOR converge on Los1-mediated nuclear tRNA export to regulate Gcn4 activity and aging. PMID:26456335

Monoamine oxidase deficiency in males with an X chromosome deletion.

PubMed

Sims, K B; de la Chapelle, A; Norio, R; Sankila, E M; Hsu, Y P; Rinehart, W B; Corey, T J; Ozelius, L; Powell, J F; Bruns, G

1989-01-01

Mapping of the human MAOA gene to chromosomal region Xp21-p11 prompted our study of two affected males in a family previously reported to have Norrie disease resulting from a submicroscopic deletion in this chromosomal region. In this investigation we demonstrate in these cousins deletion of the MAOA gene, undetectable levels of MAO-A and MAO-B activities in their fibroblasts and platelets, respectively, loss of mRNA for MAO-A in fibroblasts, and substantial alterations in urinary catecholamine metabolites. The present study documents that a marked deficiency of MAO activity is compatible with life and that genes for MAO-A and MAO-B are near each other in this Xp chromosomal region. Some of the clinical features of these MAO deletion patients may help to identify X-linked MAO deficiency diseases in humans.

A Reduction in Age-Enhanced Gluconeogenesis Extends Lifespan

PubMed Central

Hachinohe, Mayumi; Yamane, Midori; Akazawa, Daiki; Ohsawa, Kazuhiro; Ohno, Mayumi; Terashita, Yuzu; Masumoto, Hiroshi

2013-01-01

The regulation of energy metabolism, such as calorie restriction (CR), is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan. PMID:23342062

A reduction in age-enhanced gluconeogenesis extends lifespan.

PubMed

Hachinohe, Mayumi; Yamane, Midori; Akazawa, Daiki; Ohsawa, Kazuhiro; Ohno, Mayumi; Terashita, Yuzu; Masumoto, Hiroshi

2013-01-01

The regulation of energy metabolism, such as calorie restriction (CR), is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan.

Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

PubMed

Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

2013-09-01

Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

PubMed

Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

2016-07-01

A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

FOXP2 gene deletion and infant feeding difficulties: a case report.

PubMed

Zimmerman, Emily; Maron, Jill L

2016-01-01

Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech-language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression.

Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

PubMed

Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

2000-12-15

Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

Monitoring of Dual CRISPR/Cas9-Mediated Steroidogenic Acute Regulatory Protein Gene Deletion and Cholesterol Accumulation Using High-Resolution Fluorescence In Situ Hybridization in a Single Cell

PubMed Central

Lee, Jinwoo; Jefcoate, Colin

2017-01-01

Recent advances in fluorescence microscopy, coupled with CRISPR/Cas9 gene editing technology, provide opportunities for understanding gene regulation at the single-cell level. The application of direct imaging shown here provides an in situ side-by-side comparison of CRISPR/Cas9-edited cells and adjacent unedited cells. We apply this methodology to the steroidogenic acute regulatory protein (StAR) gene in Y-1 adrenal cells and MA-10 testis cells. StAR is a gatekeeper protein that controls the access of cholesterol from the cytoplasm to the inner mitochondria. The loss of this mitochondrial cholesterol transfer mediator rapidly increases lipid droplets in cells, as seen in StAR−/− mice. Here, we describe a dual CRISPR/Cas9 strategy marked by GFP/mCherry expression that deletes StAR activity within 12 h. We used single-molecule fluorescence in situ hybridization (sm-FISH) imaging to directly monitor the time course of gene editing in single cells. We achieved StAR gene deletion at high efficiency dual gRNA targeting to the proximal promoter and exon 2. Seventy percent of transfected cells showed a slow DNA deletion as measured by PCR, and loss of Br-cAMP stimulated transcription. This DNA deletion was seen by sm-FISH in both loci of individual cells relative to non-target Cyp11a1 and StAR exon 7. sm-FISH also distinguishes two effects on stimulated StAR expression without this deletion. Br-cAMP stimulation of primary and spliced StAR RNA at the gene loci were removed within 4 h in this dual CRISPR/Cas9 strategy before any effect on cytoplasmic mRNA and protein occurred. StAR mRNA disappeared between 12 and 24 h in parallel with this deletion, while cholesterol ester droplets increased fourfold. These alternative changes match distinct StAR expression processes. This dual gRNA and sm-FISH approach to CRISPR/Cas9 editing facilitates rapid testing of editing strategies and immediate assessment of single-cell adaptation responses without the perturbation of clonal expansion procedures. PMID:29118738

Pattern of deletions of the dystrophin gene in Mexican Duchenne/Becker muscular dystrophy patients: the use of new designed primers for the analysis of the major deletion "hot spot" region.

PubMed

Coral-Vazquez, R; Arenas, D; Cisneros, B; Peñaloza, L; Salamanca, F; Kofman, S; Mercado, R; Montañez, C

1997-06-13

We have analyzed 59 unrelated Mexican Duchenne/Becker muscular dystrophy patients (DMD/BMD) using PCR analysis of the 2 prone deletion regions in the DMD gene. Thirty one (52%) of the patients had a deletion of one or several of the exons. Most of the alterations (87%) were clustered in exons 44-52, this being the highest percentage reported until now. In order to improve the molecular diagnosis in the Mexican population, we designed a new multiplex assay to PCR amplify exons 44-52. This assay allowed for the identification of a greater number of deletions in this region compared with the 9 and 5-plex assays previously described and to determine most of the deletion end boundaries. This is a reliable alternative for the initial screening of the DMD patients in the Mexican population.

Schizophrenia and chromosomal deletions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Baldini, A.; Morris, M. A.

Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized.more » These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.« less

Novel mutation in the 5' splice site of exon 4 of the TCOF1 gene in the patient with Treacher Collins syndrome.

PubMed

Marszalek, Bozena; Wisniewski, Slawomir A; Wojcicki, Piotr; Kobus, Kazimierz; Trzeciak, Wieslaw H

2003-12-01

Treacher Collins syndrome (TCS) is caused by mutations in the TCOF1 gene. This gene encodes a serine/alanine-rich protein called treacle. The structure of the entire TCOF1 gene was investigated in a patient with TCS. We detected a novel deletion (376delAAGGTGAGTGGGACTGCC) spanning 3 bp of exon 4 and 15 bp of the adjacent intronic sequence. This mutation causes premature termination of translation, resulting in a truncated protein devoid of nucleolar localization signal, and potential phosphorylation sites. Real-time PCR analysis showed different melting temperatures of the amplified fragment containing normal allele and that harboring the 18 bp deletion, thus providing a rapid screening assay for this and other deletions of the TCOF1 gene. Copyright 2003 Wiley-Liss, Inc.

Genome-wide screen of Saccharomyces cerevisiae for killer toxin HM-1 resistance.

PubMed

Miyamoto, Masahiko; Furuichi, Yasuhiro; Komiyama, Tadazumi

2011-01-01

We screened a set of Saccharomyces cerevisiae deletion mutants for resistance to killer toxin HM-1, which kills susceptible yeasts through inhibiting 1,3-beta-glucan synthase. By using HM-1 plate assay, we found that eight gene-deletion mutants had higher HM-1-resistance compared with the wild-type. Among these eight genes, five--ALG3, CAX4, MNS1, OST6 and YBL083C--were associated with N-glycan formation and maturation. The ALG3 gene has been shown before to be highly resistant to HM-1. The YBL083C gene may be a dubious open reading frame that overlaps partially the ALG3 gene. The deletion mutant of the MNS1 gene that encodes 1,2-alpha-mannosidase showed with a 13-fold higher HM-1 resistance compared with the wild-type. By HM-1 binding assay, the yeast plasma membrane fraction of alg3 and mns1 cells had less binding ability compared with wild-type cells. These results indicate that the presence of the terminal 1,3-alpha-linked mannose residue of the B-chain of the N-glycan structure is essential for interaction with HM-1. A deletion mutant of aquaglyceroporin Fps1p also showed increased HM-1 resistance. A deletion mutant of osmoregulatory mitogen-activated protein kinase Hog1p was more sensitive to HM-1, suggesting that high-osmolarity glycerol pathways plays an important role in the compensatory response to HM-1 action. Copyright © 2010 John Wiley & Sons, Ltd.

Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.

PubMed

Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio

2014-07-23

SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.

Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region

PubMed Central

2014-01-01

Background SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients. Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. Case presentation All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Conclusions Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region. PMID:25056248

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

High frequency of TTTY2-like gene-related deletions in patients with idiopathic oligozoospermia and azoospermia.

PubMed

Yapijakis, C; Serefoglou, Z; Papadimitriou, K; Makrinou, E

2015-06-01

Genes located on Y chromosome and expressed in testis are likely to be involved in spermatogenesis. TTTY2 is a Y-linked multicopy gene family of unknown function that includes TTTY2L2A and TTTY2L12A at Yq11 and Yp11 loci respectively. Using PCR amplification, we screened for TTTY2L2A- and TTTY2L12A-associated deletions, in 94 Greek men with fertility problems. Patients were divided into three groups as following: group A (n = 28) included men with idiopathic moderate oligozoospermia, group B (n = 34) with idiopathic severe oligozoospermia and azoospermia, and group C (n = 32) with oligo- and azoospermia of various known etiologies. No deletions were detected in group C patients and 50 fertile controls. However, two patients from group A had deletions in TTTY2L2A (7.1%) and six in TTTY2L12A (21.4%), whereas from group B, four patients had deletions in TTTY2L2A (11.8%) and 10 in TTTY2L12A (29.4%). In addition, five patients from both groups A and B (8%) appeared to have deletions in both studied TTTY2 genes, although these are located very far apart. These results indicate that the TTTY2 gene family may play a significant role in spermatogenesis and suggest a possible mechanism of nonhomologous recombinational events that may cause genomic instability and ultimately lead to male infertility. © 2014 Blackwell Verlag GmbH.

Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area

PubMed Central

Li, Peipei; Xing, Hua; Zhao, Zhenjun; Yang, Zhaoqing; Cao, Yaming; Yan, Guiyun; Sattabongkot, Jetsumon; Cui, Liwang; Fan, Qi

2016-01-01

Deletion of the Plasmodium falciparum histidine-rich protein 2 (pfhrp2) gene may affect the performance of PfHRP2-based rapid diagnostic tests (RDTs). Here we investigated the genetic diversity of the pfhrp2 gene in clinical parasite isolates collected in recent years from the China-Myanmar border area. Deletion of pfhrp2 has been identified in 4 out of 97 parasite isolates. Sequencing of the pfhrp2 exon 2 from 67 isolates revealed a high level of genetic diversity in pfhrp2, which is reflected in the presence of many repeat types and their variants, as well as variable copy numbers and different arrangements of these repeats in parasite isolates. In addition, we observed pfhrp3 deletion in three of the four parasites harboring pfhrp2 deletion, suggesting of double deletions of both genes in these three isolates. Analysis of two cases, which were P. falciparum-positive by microscopy and PCR but failed by two PfHRP2-based RDTs, did not find pfhrp2 deletion. Further correlational studies of pfhrp2 polymorphisms with detection sensitivity are needed to identify factors influencing the performance of RDTs in malaria-endemic areas. PMID:26297799

[Changes of biological behavioral of E. coli K1 after ppk1 gene deletion].

PubMed

Peng, Liang; Pan, Jiayun; Luo, Su; Yang, Zhenghui; Huang, Mufang; Cao, Hong

2014-06-01

To study the changes in biological behaviors of meningitis E. coli K1 strain E44 after deletion of polyphosphate kinase 1 (ppk1) gene and explore the role of ppk1 in the pathogenesis of E. coli K1-induced meningitis. The wild-type strain E. coli K1 and ppk1 deletion mutant were exposed to heat at 56 degrees celsius; for 6 min, and their survival rates were determined. The adhesion and invasion of the bacteria to human brain microvascular endothelial cells (HBMECs) were observed using electron microscopy and quantitative tests. HBMECs were co-incubated with wild-type strain or ppk1 deletion mutant, and the cytoskeleton rearrangement was observed under laser scanning confocal microscope. The survival rate of the ppk1 deletion mutant was significantly lower than that of the wild-type strain after heat exposure. The ppk1 deletion mutant also showed lowered cell adhesion and invasion abilities and weakened ability to induce cytoskeleton rearrangement in HBMECs. ppk1 gene is important for E.coli K1 for heat resistance, cell adhesion and invasion, and for inducing cytoskeletal rearrangement in HBMECs.

The Putative C2H2 Transcription Factor MtfA Is a Novel Regulator of Secondary Metabolism and Morphogenesis in Aspergillus nidulans

PubMed Central

Ramamoorthy, Vellaisamy; Dhingra, Sourabh; Kincaid, Alexander; Shantappa, Sourabha; Feng, Xuehuan; Calvo, Ana M.

2013-01-01

Secondary metabolism in the model fungus Aspergillus nidulans is controlled by the conserved global regulator VeA, which also governs morphological differentiation. Among the secondary metabolites regulated by VeA is the mycotoxin sterigmatocystin (ST). The presence of VeA is necessary for the biosynthesis of this carcinogenic compound. We identified a revertant mutant able to synthesize ST intermediates in the absence of VeA. The point mutation occurred at the coding region of a gene encoding a novel putative C2H2 zinc finger domain transcription factor that we denominated mtfA. The A. nidulans mtfA gene product localizes at nuclei independently of the illumination regime. Deletion of the mtfA gene restores mycotoxin biosynthesis in the absence of veA, but drastically reduced mycotoxin production when mtfA gene expression was altered, by deletion or overexpression, in A. nidulans strains with a veA wild-type allele. Our study revealed that mtfA regulates ST production by affecting the expression of the specific ST gene cluster activator aflR. Importantly, mtfA is also a regulator of other secondary metabolism gene clusters, such as genes responsible for the synthesis of terrequinone and penicillin. As in the case of ST, deletion or overexpression of mtfA was also detrimental for the expression of terrequinone genes. Deletion of mtfA also decreased the expression of the genes in the penicillin gene cluster, reducing penicillin production. However, in this case, over-expression of mtfA enhanced the transcription of penicillin genes, increasing penicillin production more than 5 fold with respect to the control. Importantly, in addition to its effect on secondary metabolism, mtfA also affects asexual and sexual development in A. nidulans. Deletion of mtfA results in a reduction of conidiation and sexual stage. We found mtfA putative orthologs conserved in other fungal species. PMID:24066102

Sublexical and lexico-syntactic factors in gender access in Spanish.

PubMed

Afonso, Olivia; Domínguez, Alberto; Alvarez, Carlos J; Morales, David

2014-02-01

The influence of sublexical and lexico-syntactic factors during the grammatical gender assignment process in Spanish was studied in two experiments using the gender decision task. In Experiment 1, the regularity of the ending of gender-marked nouns (masculine nouns ended in -o and feminine nouns ended in -a) and of nouns with gender-correlated but unmarked word-endings (e.g., -ad) was manipulated. The results showed that regularity affected reaction times and error rates only in the case of gender-marked nouns, suggesting that the mere statistical distribution of a word-ending across genders is not responsible for the regularity effect. In Experiment 2, gender-marked nouns and gender-unmarked nouns were preceded by a masked prime which could be a definite article (which provides information about the gender of the noun) or a possessive pronoun (which does not contain gender information). The presentation of the definite article led to shorter reaction times and less errors only when the word-ending was different from -o or -a. Taken together, these results indicate that gender assignment in Spanish is carried out through different processes depending on the noun ending: gender decisions for gender-marked nouns are based on the gender-to-ending distribution. Meanwhile, gender decisions for unmarked nouns seem to require the retrieval of the corresponding definite grammatical article, regardless of the statistical distribution of the noun ending across genders.

Limb Girdle Muscular Dystrophy Type 2E Due to a Novel Large Deletion in SGCB Gene.

PubMed

Ghafouri-Fard, Soudeh; Hashemi-Gorji, Feyzollah; Fardaei, Majid; Miryounesi, Mohammad

2017-01-01

Autosomal recessive limb-girdle muscular dystrophies (LGMD type 2) are a group of clinically and genetically heterogeneous diseases with the main characteristics of weakness and wasting of the pelvic and shoulder girdle muscles. Among them are sarcoglycanopathies caused by mutations in at least four genes named SGCA, SGCB, SGCG and SGCD. Here we report a consanguineous Iranian family with two children affected with LGMD type 2E. Mutation analysis revealed a novel homozygous exon 2 deletion of SGCB gene in the patients with the parents being heterozygous for this deletion. This result presents a novel underlying genetic mechanism for LGMD type 2E.

The impact of trisomy 12, retinoblastoma gene and P53 in prognosis of B-cell chronic lymphocytic leukemia.

PubMed

AbdelSalam, M; El Sissy, A; Samra, M A; Ibrahim, S; El Markaby, D; Gadallah, F

2008-06-01

Routine cytogenetic analysis frequently fails to identify an abnormal clone in B-cell lymphocytic leukaemia (B-CLL) due to poor response to mitogen stimulation. Fluorescence in situ hybridization (FISH) suggest that chromosomal abnormalities occur more frequently, most commonly trisomy 12, retinoblastoma gene deletion (Rb1 gene) and P53 gene deletion. 30 patients with B-CLL were enrolled in the trial from two centers in Cairo, Egypt during the period May 2000 to January 2002. Karyotyping and FISH assessment for possible chromosomal abnormalities (trisomy 12, Rb1 gene and P53 gene) were done at initial diagnosis. Results of cytogenetic abnormalities were correlated with clinical picture and survival. The median age was 57.4 years (range 40-75). Karyotyping technique showed that no metaphase could be detected in 30%, metaphase with normal karyotyping was observed in 63% and cytogenetic abnormalities were detected in two cases (one trisomy 12 and one deletion in chromosome 13). FISH examination of interphase and metaphase nuclei revealed cytogenetic abnormalities in 15 cases (50%), trisomy 12 in 9 (30%), Rb1 gene deletion in 5 (17%) and P53 gene deletion in 3. At diagnosis, patients with trisomy 12 were significantly associated with advanced stage and absolute lymphocyte count of >or=30,000/mm(3). Univariate analysis showed that absolute lymphocyte count >or=30,000/mm(3) (p=0.004) and trisomy 12 (p=0.024) were associated with poor progression free survival. Interphase and metaphase FISH studies improve the cytogenetic diagnosis of chromosomal abnormalities in B-CLL. Lymphocytosis and trisomy 12 may be a good indicator of poor prognosis.

Epilepsy is a possible feature in Williams-Beuren syndrome patients harboring typical deletions of the 7q11.23 critical region.

PubMed

Nicita, Francesco; Garone, Giacomo; Spalice, Alberto; Savasta, Salvatore; Striano, Pasquale; Pantaleoni, Chiara; Spartà, Maria Valentina; Kluger, Gerhard; Capovilla, Giuseppe; Pruna, Dario; Freri, Elena; D'Arrigo, Stefano; Verrotti, Alberto

2016-01-01

Seizures are rarely reported in Williams-Beuren syndrome (WBS)--a contiguous-gene-deletion disorder caused by a 7q11.23 heterozygous deletion of 1.5-1.8 Mb--and no previous study evaluated electro-clinical features of epilepsy in this syndrome. Furthermore, it has been hypothesized that atypical deletion (e.g., larger than 1.8 Mb) may be responsible for a more pronounced neurological phenotypes, especially including seizures. Our objectives are to describe the electro-clinical features in WBS and to correlate the epileptic phenotype with deletion of the 7q11.23 critical region. We evaluate the electro-clinical features in one case of distal 7q11.23 deletion syndrome and in eight epileptic WBS (eWBS) patients. Additionally, we compare the deletion size-and deleted genes-of four epileptic WBS (eWBS) with that of four non-epileptic WBS (neWBS) patients. Infantile spasms, focal (e.g., motor and dyscognitive with autonomic features) and generalized (e.g., tonic-clonic, tonic, clonic, myoclonic) seizures were encountered. Drug-resistance was observed in one patient. Neuroimaging discovered one case of focal cortical dysplasia, one case of fronto-temporal cortical atrophy and one case of periventricular nodular heterotopia. Comparison of deletion size between eWBS and neWBS patients did not reveal candidate genes potentially underlying epilepsy. This is the largest series describing electro-clinical features of epilepsy in WBS. In WBS, epilepsy should be considered both in case of typical and atypical deletions, which do not involve HIP1, YWHAG or MAGI2. © 2015 Wiley Periodicals, Inc.

Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

PubMed

Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

1996-03-01

In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

Positive selection of mutants with deletions of the gal-chl region of the Salmonella chromosome as a screening procedure for mutagens that cause deletions.

PubMed Central

Alper, M D; Ames, B N

1975-01-01

We have developed a convenient and specific positive selection for long deletions through the gal region of the chromosomes of Salmonella typhimurium and Escherichia coli. Through simultaneous selection for mutations in the two closely linked genes, gal and chlA, a variety of deletions of varying length, some extending through as much as 1 min of the chromosome, could be readily obtained. Many of these deletions resulted in the loss of a gene, which we named dhb, concerned with the ability of the bacterium to synthesize the iron chelating agent enterobactin. The selection was adapted for the screening of mutagens for their ability to generate long deletions in the bacterial deoxyribonucleic acid. Forty agents were screened for this capability. Nitrous acid, previously reported to be an efficient mutagen for this purpose, increased the frequency of deletion mutations 50-fold in our system. Three others, nitrogen mustard, mitomycin C, and fast neutrons, were shown to increase the frequency of long deletions between five- and eightfold. The remainder were found to be incapable of generating these deletions. PMID:1090571

Two novel types of contiguous gene deletion of the AVPR2 and ARHGAP4 genes in unrelated Japanese kindreds with nephrogenic diabetes insipidus.

PubMed

Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi

2002-01-01

Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.

Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

PubMed

Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B

2006-09-01

PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.

PubMed

Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun

2010-01-01

Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects.

GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomycescerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo

2011-04-01

Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependentmore » induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest reduced activity of the GABA-metabolizing enzymes extends lifespan by shifting carbon metabolism toward respiration, as calorie restriction does.« less

Functional genomics of commercial baker's yeasts that have different abilities for sugar utilization and high-sucrose tolerance under different sugar conditions.

PubMed

Tanaka-Tsuno, Fumiko; Mizukami-Murata, Satomi; Murata, Yoshinori; Nakamura, Toshihide; Ando, Akira; Takagi, Hiroshi; Shima, Jun

2007-10-01

In the modern baking industry, high-sucrose-tolerant (HS) and maltose-utilizing (LS) yeast were developed using breeding techniques and are now used commercially. Sugar utilization and high-sucrose tolerance differ significantly between HS and LS yeasts. We analysed the gene expression profiles of HS and LS yeasts under different sucrose conditions in order to determine their basic physiology. Two-way hierarchical clustering was performed to obtain the overall patterns of gene expression. The clustering clearly showed that the gene expression patterns of LS yeast differed from those of HS yeast. Quality threshold clustering was used to identify the gene clusters containing upregulated genes (cluster 1) and downregulated genes (cluster 2) under high-sucrose conditions. Clusters 1 and 2 contained numerous genes involved in carbon and nitrogen metabolism, respectively. The expression level of the genes involved in the metabolism of glycerol and trehalose, which are known to be osmoprotectants, in LS yeast was higher than that in HS yeast under sucrose concentrations of 5-40%. No clear correlation was found between the expression level of the genes involved in the biosynthesis of the osmoprotectants and the intracellular contents of the osmoprotectants. The present gene expression data were compared with data previously reported in a comprehensive analysis of a gene deletion strain collection. Welch's t-test for this comparison showed that the relative growth rates of the deletion strains whose deletion occurred in genes belonging to cluster 1 were significantly higher than the average growth rates of all deletion strains. Copyright 2007 John Wiley & Sons, Ltd.

[Construction and characterization of enterohemorrhagic Escherichia coli O157:H7 ppk- deleted strain].

PubMed

Han, Peng; Sun, Qi; Zhao, Suhui; Zhang, Qiwei; Wan, Chengsong

2014-06-01

To construct enterohemorrhagic Escherichia coli (EHEC) O157: H7 ppk gene deletion strains and study its biological characteristics. The gene fragment of kanamycin resistance was amplified using a pair of homologous arm primers whose 5' and 3' ends were homologous with ppk gene and kanamycin resistance gene, respectively. EHEC O157: H7 EDL933w competent strains were prepared and transformed via electroporation with the amplification products. The ppk gene was replaced by kanamycin resistance gene using pKD46-mediated Red recombination system. The recombinant strain was confirmed by PCR and sequencing, and its morphology, growth ability and adhesion were assessed using Gram staining, OD600 value and Giemsa staining. We established a ppk-deleted EHEC O157:H7 EDL933w strain with kanamycin resistance and compared the biological characteristics of the wild-type and mutant strains, which may facilitate further study of the regulatory mechanism of ppk gene.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Pearson syndrome in a Diamond-Blackfan anemia cohort.

PubMed

Alter, Blanche P

2014-07-17

In this issue of Blood, Gagne et al describe a cohort of 362 patients clinically classified as having Diamond-Blackfan anemia (DBA), in which 175 (48%) were found to have mutations and deletions in ribosomal protein genes or GATA1, and 8 of the remaining patients (2.2% overall) had mitochondrial gene deletions consistent with Pearson marrow-pancreas syndrome (PS). The authors propose that all patients with presumptive DBA should be tested for mitochondrial DNA (mtDNA) deletion during their initial genetic evaluation.

The 22q13.3 Deletion Syndrome (Phelan-McDermid Syndrome)

PubMed Central

Phelan, K.; McDermid, H.E.

2012-01-01

The 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome, is a contiguous gene disorder resulting from deletion of the distal long arm of chromosome 22. In addition to normal growth and a constellation of minor dysmorphic features, this syndrome is characterized by neurological deficits which include global developmental delay, moderate to severe intellectual impairment, absent or severely delayed speech, and neonatal hypotonia. In addition, more than 50% of patients show autism or autistic-like behavior, and therefore it can be classified as a syndromic form of autism spectrum disorders (ASD). The differential diagnosis includes Angelman syndrome, velocardiofacial syndrome, fragile X syndrome, and FG syndrome. Over 600 cases of 22q13.3 deletion syndrome have been documented. Most are terminal deletions of ∼100 kb to >9 Mb, resulting from simple deletions, ring chromosomes, and unbalanced translocations. Almost all of these deletions include the gene SHANK3 which encodes a scaffold protein in the postsynaptic densities of excitatory synapses, connecting membrane-bound receptors to the actin cytoskeleton. Two mouse knockout models and cell culture experiments show that SHANK3 is involved in the structure and function of synapses and support the hypothesis that the majority of 22q13.3 deletion syndrome neurological defects are due to haploinsufficiency of SHANK3, although other genes in the region may also play a role in the syndrome. The molecular connection to ASD suggests that potential future treatments may involve modulation of metabotropic glutamate receptors. PMID:22670140

An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

PubMed Central

Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

2007-01-01

Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

Behavioral differences among subjects with Prader-Willi syndrome and type I or type II deletion and maternal disomy.

PubMed

Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Talebizadeh, Zohreh; Thompson, Travis

2004-03-01

To determine whether phenotypic differences exist among individuals with Prader-Willi syndrome with either type I or type II deletions of chromosome 15 or maternal disomy 15 leading to a better understanding of cause and pathophysiology of this classical genetic syndrome. We analyzed clinical, anthropometric, and behavioral data in 12 individuals (5 men, 7 women; mean age: 25.9 +/- 8.8 years) with PWS and a type I (TI) deletion, 14 individuals (6 men, 8 women; mean age: 19.6 +/- 6.5 years) with PWS and a type II (TII) deletion, and 21 individuals (10 men, 11 women; mean age: 23.6 +/- 9.2 years) with PWS and maternal disomy 15 (UPD). The deletion type was determined by genotyping of DNA markers between proximal chromosome 15 breakpoints BP1 and BP2. TI deletions are approximately 500 kb larger than TII deletions. Several validated psychological and behavioral tests were used to assess phenotypic characteristics of individuals with PWS representing the 3 genetic subtypes. Significant differences were found between the 2 deletion groups and those with UPD in multiple psychological and behavioral tests, but no differences were observed in other clinical or anthropometric data studied. Adaptive behavior scores were generally worse in individuals with PWS and the TI deletion, and specific obsessive-compulsive behaviors were more evident in the TI individuals compared with those with UPD. Individuals with PWS with TI deletions also had poorer reading and math skills as well as visual-motor integration. Our study indicates that individuals with TI deletion generally have more behavioral and psychological problems than individuals with the TII deletion or UPD. Four recently identified genes have been identified in the chromosome region between BP1 and BP2 with 1 of the genes (NIPA-1) expressed in mouse brain tissue but not thought to be imprinted. It may be important for brain development or function. These genes are deleted in individuals with TI deletion and are implicated in compulsive behavior and lower intellectual ability in individuals with TI versus TII.

Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

USDA-ARS?s Scientific Manuscript database

Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

PubMed

Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

2015-10-01

Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Deletion Mapping of zwf, the Gene for a Constitutive Enzyme, Glucose 6-Phosphate Dehydrogenase in ESCHERICHIA COLI

PubMed Central

Fraenkel, D. G.; Banerjee, Santimoy

1972-01-01

Genes for three enzymes of intermediary sugar metabolism in E. coli, zwf (glucose 6-phosphate dehydrogenase, constitutive), edd (gluconate 6-phosphate dehydrase, inducible), and eda (2-keto-3-deoxygluconate 6-phosphate aldolase, differently inducible) are closely linked on the E. coli genetic map, the overall gene order being man... old... eda. edd. zwf... cheB... uvrC... his. One class of apparent revertants of an eda mutant strain contains a secondary mutation in edd, and some of these mutations are deletions extending into zwf. We have used a series of spontaneous edd-zwf deletions to map a series of point mutants in zwf and thus report the first fine structure map of a gene for a constitutive enzyme (zwf). PMID:4560065

Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.

PubMed

Ribeiro, Carolina; do Carmo Macário, Maria; Viegas, Ana Teresa; Pratas, João; Santos, Maria João; Simões, Marta; Mendes, Cândida; Bacalhau, Mafalda; Garcia, Paula; Diogo, Luísa; Grazina, Manuela

2016-11-01

Leigh syndrome (LS) is a rare, progressive neurodegenerative mitochondrial disorder of infancy. It is a genetically heterogeneous disease. The mutations in SURF1 gene are the most frequently known cause. Here two cases of LS likely caused by SURF1 gene variants are reported: a 39-year-old male patient with a novel homozygous deletion (c.-11_13del), and a case of a 6-year-old boy with the same deletion and a nonsense mutation (c.868dupT), both in heterozygosity. Blue native PAGE showed absence of assembled complex IV. This is the first report of a variant that may abolish the SURF1 gene initiation codon in two LS patients. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

Detection of large scale 3′ deletions in the PMS2 gene amongst Colon-CFR participants – have we been missing anything?

PubMed Central

Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N.; Lindor, Noralane; Potter, John D.; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L.; Jenkins, Mark A.; Rosty, Christophe; Young, Joanne P.; Buchanan, Daniel D.

2013-01-01

Current screening practices have been able to identify PMS2 mutations in 78% of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3′ end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22% (n = 16) of CRC-affected probands for mutations in the 3′ end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3′ deletions in PMS2 are not a frequent occurrence in such families. PMID:23288611

Enhancers and super-enhancers have an equivalent regulatory role in embryonic stem cells through regulation of single or multiple genes

PubMed Central

Moorthy, Sakthi D.; Davidson, Scott; Shchuka, Virlana M.; Singh, Gurdeep; Malek-Gilani, Nakisa; Langroudi, Lida; Martchenko, Alexandre; So, Vincent; Macpherson, Neil N.; Mitchell, Jennifer A.

2017-01-01

Transcriptional enhancers are critical for maintaining cell-type–specific gene expression and driving cell fate changes during development. Highly transcribed genes are often associated with a cluster of individual enhancers such as those found in locus control regions. Recently, these have been termed stretch enhancers or super-enhancers, which have been predicted to regulate critical cell identity genes. We employed a CRISPR/Cas9-mediated deletion approach to study the function of several enhancer clusters (ECs) and isolated enhancers in mouse embryonic stem (ES) cells. Our results reveal that the effect of deleting ECs, also classified as ES cell super-enhancers, is highly variable, resulting in target gene expression reductions ranging from 12% to as much as 92%. Partial deletions of these ECs which removed only one enhancer or a subcluster of enhancers revealed partially redundant control of the regulated gene by multiple enhancers within the larger cluster. Many highly transcribed genes in ES cells are not associated with a super-enhancer; furthermore, super-enhancer predictions ignore 81% of the potentially active regulatory elements predicted by cobinding of five or more pluripotency-associated transcription factors. Deletion of these additional enhancer regions revealed their robust regulatory role in gene transcription. In addition, select super-enhancers and enhancers were identified that regulated clusters of paralogous genes. We conclude that, whereas robust transcriptional output can be achieved by an isolated enhancer, clusters of enhancers acting on a common target gene act in a partially redundant manner to fine tune transcriptional output of their target genes. PMID:27895109

High resolution melting: improvements in the genetic diagnosis of hypertrophic cardiomyopathy in a Portuguese cohort

PubMed Central

2012-01-01

Background Hypertrophic Cardiomyopathy (HCM) is a complex myocardial disorder with a recognized genetic heterogeneity. The elevated number of genes and mutations involved in HCM limits a gene-based diagnosis that should be considered of most importance for basic research and clinical medicine. Methodology In this report, we evaluated High Resolution Melting (HRM) robustness, regarding HCM genetic testing, by means of analyzing 28 HCM-associated genes, including the most frequent 4 HCM-associated sarcomere genes, as well as 24 genes with lower reported HCM-phenotype association. We analyzed 80 Portuguese individuals with clinical phenotype of HCM allowing simultaneously a better characterization of this disease in the Portuguese population. Results HRM technology allowed us to identify 60 mutated alleles in 72 HCM patients: 49 missense mutations, 3 nonsense mutations, one 1-bp deletion, one 5-bp deletion, one in frame 3-bp deletion, one insertion/deletion, 3 splice mutations, one 5'UTR mutation in MYH7, MYBPC3, TNNT2, TNNI3, CSRP3, MYH6 and MYL2 genes. Significantly 22 are novel gene mutations. Conclusions HRM was proven to be a technique with high sensitivity and a low false positive ratio allowing a rapid, innovative and low cost genotyping of HCM. In a short return, HRM as a gene scanning technique could be a cost-effective gene-based diagnosis for an accurate HCM genetic diagnosis and hopefully providing new insights into genotype/phenotype correlations. PMID:22429680

Studying Functions of All Yeast Genes Simultaneously

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

2006-01-01

A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite

PubMed Central

Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.

2016-01-01

Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412

The detection of large deletions or duplications in genomic DNA.

PubMed

Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

2002-11-01

While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

Genomic Basis of Prostate Cancer Health Disparity Among African-American Men

DTIC Science & Technology

2013-07-01

amplification and deletion) in a limited repertoire of genes Is highly predictive of prostate cancer metastasis. This signature is present in primary...laboratory has demonstrated that the specific genes within metastatic prostate cancers have been altered by amplification (increase in the copy number...or deletion (decrease in the copy number) (3). These genes appeared to have been selected by the advantages that they conveyed to tumors, such as

Gross deletions in TCOF1 are a cause of Treacher–Collins–Franceschetti syndrome

PubMed Central

Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy

2012-01-01

Treacher–Collins–Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5′ end of the gene were identified. The partial gene deletions of different sizes represent ∼5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected. PMID:22317976

Gross deletions in TCOF1 are a cause of Treacher-Collins-Franceschetti syndrome.

PubMed

Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy

2012-07-01

Treacher-Collins-Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5' end of the gene were identified. The partial gene deletions of different sizes represent ~5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected.

Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.

PubMed

Cox-Paulson, Elisabeth A; Grana, Theresa M; Harris, Michelle A; Batzli, Janet M

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms.

Studying Human Disease Genes in Caenorhabditis elegans: A Molecular Genetics Laboratory Project

PubMed Central

Cox-Paulson, Elisabeth A.; Grana, Theresa M.; Harris, Michelle A.; Batzli, Janet M.

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms. PMID:22665589

Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting, autophagy, biosynthetic, and tRNA methylation genes involved in life span regulation.

PubMed

Fabrizio, Paola; Hoon, Shawn; Shamalnasab, Mehrnaz; Galbani, Abdulaye; Wei, Min; Giaever, Guri; Nislow, Corey; Longo, Valter D

2010-07-15

The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.

The protein transportation pathway from Golgi to vacuoles via endosomes plays a role in enhancement of methylmercury toxicity

NASA Astrophysics Data System (ADS)

Hwang, Gi-Wook; Murai, Yasutaka; Takahashi, Tsutomu; Naganuma, Akira

2014-07-01

Methylmercury causes serious damage to the central nervous system, but the molecular mechanisms of methylmercury toxicity are only marginally understood. In this study, we used a gene-deletion mutant library of budding yeast to conduct genome-wide screening for gene knockouts affecting the sensitivity of methylmercury toxicity. We successfully identified 31 genes whose deletions confer resistance to methylmercury in yeast, and 18 genes whose deletions confer hypersensitivity to methylmercury. Yeast genes whose deletions conferred resistance to methylmercury included many gene encoding factors involved in protein transport to vacuoles. Detailed examination of the relationship between the factors involved in this transport system and methylmercury toxicity revealed that mutants with loss of the factors involved in the transportation pathway from the trans-Golgi network (TGN) to the endosome, protein uptake into the endosome, and endosome-vacuole fusion showed higher methylmercury resistance than did wild-type yeast. The results of our genetic engineering study suggest that this vesicle transport system (proteins moving from the TGN to vacuole via endosome) is responsible for enhancing methylmercury toxicity due to the interrelationship between the pathways. There is a possibility that there may be proteins in the cell that enhance methylmercury toxicity through the protein transport system.

Dmpk gene deletion or antisense knockdown does not compromise cardiac or skeletal muscle function in mice

PubMed Central

Carrell, Samuel T.; Carrell, Ellie M.; Auerbach, David; Pandey, Sanjay K.; Bennett, C. Frank; Dirksen, Robert T.; Thornton, Charles A.

2016-01-01

Myotonic dystrophy type 1 (DM1) is a genetic disorder in which dominant-active DM protein kinase (DMPK) transcripts accumulate in nuclear foci, leading to abnormal regulation of RNA processing. A leading approach to treat DM1 uses DMPK-targeting antisense oligonucleotides (ASOs) to reduce levels of toxic RNA. However, basal levels of DMPK protein are reduced by half in DM1 patients. This raises concern that intolerance for further DMPK loss may limit ASO therapy, especially since mice with Dmpk gene deletion reportedly show cardiac defects and skeletal myopathy. We re-examined cardiac and muscle function in mice with Dmpk gene deletion, and studied post-maturity knockdown using Dmpk-targeting ASOs in mice with heterozygous deletion. Contrary to previous reports, we found no effect of Dmpk gene deletion on cardiac or muscle function, when studied on two genetic backgrounds. In heterozygous knockouts, the administration of ASOs reduced Dmpk expression in cardiac and skeletal muscle by > 90%, yet survival, electrocardiogram intervals, cardiac ejection fraction and muscle strength remained normal. The imposition of cardiac stress by pressure overload, or muscle stress by myotonia, did not unmask a requirement for DMPK. Our results support the feasibility and safety of using ASOs for post-transcriptional silencing of DMPK in muscle and heart. PMID:27522499

Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report.

PubMed

de la Houssaye, Guillaume; Bieche, Ivan; Roche, Olivier; Vieira, Véronique; Laurendeau, Ingrid; Arbogast, Laurence; Zeghidi, Hatem; Rapp, Philippe; Halimi, Philippe; Vidaud, Michel; Dufier, Jean-Louis; Menasche, Maurice; Abitbol, Marc

2006-11-29

Axenfeld-Rieger syndrome (ARS) is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Two members of this family (father and daughter) presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI) detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments.

Tackling the issue of environmental survival of live Salmonella Typhimurium vaccines: deletion of the lon gene.

PubMed

Leyman, Bregje; Boyen, Filip; Van Parys, Alexander; Verbrugghe, Elin; Haesebrouck, Freddy; Pasmans, Frank

2012-12-01

Vaccination is an important measure to control Salmonella contamination in the meat production chain. A previous study showed that both the ΔrfaJ and ΔrfaL strains are suitable markers and allow serological differentiation of infected and vaccinated animals. The aim of this study was to verify whether deletion of the lon gene in a Salmonella Typhimurium ΔrfaJ marker strain resulted in decreased environmental survival. Our results indicate that deletion of the lon gene in the ΔrfaJ strain did not affect invasiveness in IPEC-J2 cells and resulted in an increased susceptibility to UV, disinfectants (such as hydrogen peroxide and tosylchloramide sodium) and citric acid. Immunization of pigs with inactivated ΔrfaJ or ΔlonΔrfaJ vaccines allowed differentiation of infected and vaccinated pigs. Furthermore, deletion of the lon gene did not reduce the protection conferred by live wild type or ΔrfaJ vaccines against subsequent challenge with a virulent Salmonella Typhimurium strain in BALB/c mice. Based on our results in mice, we conclude that deletion of lon in ΔrfaJ contributes to environmental safety of the ΔrfaJ DIVA strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

Genomic anatomy of the Tyrp1 (brown) deletion complex

PubMed Central

Smyth, Ian M.; Wilming, Laurens; Lee, Angela W.; Taylor, Martin S.; Gautier, Phillipe; Barlow, Karen; Wallis, Justine; Martin, Sancha; Glithero, Rebecca; Phillimore, Ben; Pelan, Sarah; Andrew, Rob; Holt, Karen; Taylor, Ruth; McLaren, Stuart; Burton, John; Bailey, Jonathon; Sims, Sarah; Squares, Jan; Plumb, Bob; Joy, Ann; Gibson, Richard; Gilbert, James; Hart, Elizabeth; Laird, Gavin; Loveland, Jane; Mudge, Jonathan; Steward, Charlie; Swarbreck, David; Harrow, Jennifer; North, Philip; Leaves, Nicholas; Greystrong, John; Coppola, Maria; Manjunath, Shilpa; Campbell, Mark; Smith, Mark; Strachan, Gregory; Tofts, Calli; Boal, Esther; Cobley, Victoria; Hunter, Giselle; Kimberley, Christopher; Thomas, Daniel; Cave-Berry, Lee; Weston, Paul; Botcherby, Marc R. M.; White, Sharon; Edgar, Ruth; Cross, Sally H.; Irvani, Marjan; Hummerich, Holger; Simpson, Eleanor H.; Johnson, Dabney; Hunsicker, Patricia R.; Little, Peter F. R.; Hubbard, Tim; Campbell, R. Duncan; Rogers, Jane; Jackson, Ian J.

2006-01-01

Chromosome deletions in the mouse have proven invaluable in the dissection of gene function. The brown deletion complex comprises >28 independent genome rearrangements, which have been used to identify several functional loci on chromosome 4 required for normal embryonic and postnatal development. We have constructed a 172-bacterial artificial chromosome contig that spans this 22-megabase (Mb) interval and have produced a contiguous, finished, and manually annotated sequence from these clones. The deletion complex is strikingly gene-poor, containing only 52 protein-coding genes (of which only 39 are supported by human homologues) and has several further notable genomic features, including several segments of >1 Mb, apparently devoid of a coding sequence. We have used sequence polymorphisms to finely map the deletion breakpoints and identify strong candidate genes for the known phenotypes that map to this region, including three lethal loci (l4Rn1, l4Rn2, and l4Rn3) and the fitness mutant brown-associated fitness (baf). We have also characterized misexpression of the basonuclin homologue, Bnc2, associated with the inversion-mediated coat color mutant white-based brown (Bw). This study provides a molecular insight into the basis of several characterized mouse mutants, which will allow further dissection of this region by targeted or chemical mutagenesis. PMID:16505357

Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

PubMed

Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

2016-04-01

The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

PubMed

Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

2000-09-01

Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

Improved triacylglycerol production in Acinetobacter baylyi ADP1 by metabolic engineering.

PubMed

Santala, Suvi; Efimova, Elena; Kivinen, Virpi; Larjo, Antti; Aho, Tommi; Karp, Matti; Santala, Ville

2011-05-18

Triacylglycerols are used in various purposes including food applications, cosmetics, oleochemicals and biofuels. Currently the main sources for triacylglycerol are vegetable oils, and microbial triacylglycerol has been suggested as an alternative for these. Due to the low production rates and yields of microbial processes, the role of metabolic engineering has become more significant. As a robust model organism for genetic and metabolic studies, and for the natural capability to produce triacylglycerol, Acinetobacter baylyi ADP1 serves as an excellent organism for modelling the effects of metabolic engineering for energy molecule biosynthesis. Beneficial gene deletions regarding triacylglycerol production were screened by computational means exploiting the metabolic model of ADP1. Four deletions, acr1, poxB, dgkA, and a triacylglycerol lipase were chosen to be studied experimentally both separately and concurrently by constructing a knock-out strain (MT) with three of the deletions. Improvements in triacylglycerol production were observed: the strain MT produced 5.6 fold more triacylglycerol (mg/g cell dry weight) compared to the wild type strain, and the proportion of triacylglycerol in total lipids was increased by 8-fold. In silico predictions of beneficial gene deletions were verified experimentally. The chosen single and multiple gene deletions affected beneficially the natural triacylglycerol metabolism of A. baylyi ADP1. This study demonstrates the importance of single gene deletions in triacylglycerol metabolism, and proposes Acinetobacter sp. ADP1 as a model system for bioenergetic studies regarding metabolic engineering.

PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

PubMed

Drozniewska, Malgorzata; Haus, Olga

2014-01-01

Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype.

Subtelomeric Deletion of Chromosome 10p15.3: Clinical Findings and Molecular Cytogenetic Characterization

PubMed Central

DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H.; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia AL; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B.A.; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

2012-01-01

We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11,), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM# 608668) and DIP2C (OMIM# 611380) (UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. PMID:22847950

Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

PubMed

DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

2012-09-01

We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

PTEN genomic deletion predicts prostate cancer recurrence and is associated with low AR expression and transcriptional activity

PubMed Central

2012-01-01

Background Prostate cancer (PCa), a leading cause of cancer death in North American men, displays a broad range of clinical outcome from relatively indolent to lethal metastatic disease. Several genomic alterations have been identified in PCa which may serve as predictors of progression. PTEN, (10q23.3), is a negative regulator of the phosphatidylinositol 3-kinase (PIK3)/AKT survival pathway and a tumor suppressor frequently deleted in PCa. The androgen receptor (AR) signalling pathway is known to play an important role in PCa and its blockade constitutes a commonly used treatment modality. In this study, we assessed the deletion status of PTEN along with AR expression levels in 43 primary PCa specimens with clinical follow-up. Methods Fluorescence In Situ Hybridization (FISH) was done on formalin fixed paraffin embedded (FFPE) PCa samples to examine the deletion status of PTEN. AR expression levels were determined using immunohistochemistry (IHC). Results Using FISH, we found 18 cases of PTEN deletion. Kaplan-Meier analysis showed an association with disease recurrence (P=0.03). Concurrently, IHC staining for AR found significantly lower levels of AR expression within those tumors deleted for PTEN (P<0.05). To validate these observations we interrogated a copy number alteration and gene expression profiling dataset of 64 PCa samples, 17 of which were PTEN deleted. We confirmed the predictive value of PTEN deletion in disease recurrence (P=0.03). PTEN deletion was also linked to diminished expression of PTEN (P<0.01) and AR (P=0.02). Furthermore, gene set enrichment analysis revealed a diminished expression of genes downstream of AR signalling in PTEN deleted tumors. Conclusions Altogether, our data suggest that PTEN deleted tumors expressing low levels of AR may represent a worse prognostic subset of PCa establishing a challenge for therapeutic management. PMID:23171135

Fluorescence in situ hybridization analyses of hematologic malignancies reveal frequent cytogenetically unrecognized 12p rearrangements.

PubMed

Andreasson, P; Johansson, B; Billström, R; Garwicz, S; Mitelman, F; Höglund, M

1998-03-01

Thirty-two hematologic malignancies--nine with cytogenetically identified 12p abnormalities and 23 with whole or partial losses of chromosome 12--were selected for fluorescence in situ hybridization (FISH) investigations of 12p. These analyses revealed structural 12p changes, such as translocations, deletions, insertions, inversions and amplification, in 20 cases. ETV6 rearrangements were detected in three acute leukemias. One acute undifferentiated leukemia had t(4;12)(q12;p13) as the sole anomaly. The second case, an acute myeloid leukemia (AML), displayed complex abnormalities involving, among others, chromosomes 9 and 12. The third case, also an AML, had an insertion of the distal part of ETV6 into chromosome arm 11q and into multiple ring chromosomes, which also contained chromosome 11 material, resulting in an amplification of a possible fusion gene. The fusion partners in these cases remain to be identified. Thirty-one additional breakpoints on 12p could be characterized in detail. The majority of these breaks were shown to result in interchromosomal rearrangements, possibly indicating the location of hitherto unrecognized genes of importance in the pathogenesis of hematologic malignancies. The FISH analyses disclosed terminal or interstitial 12p deletions in 18 cases. Seven myeloid malignancies showed deletions restricted to a region, including ETV6 and CDKN1B, which has been reported to be frequently lost in leukemias. In four cases, the deletions involved both these genes, whereas two AML displayed loss of CDKN1B but not ETV6, supporting previously reported findings indicating a region of deletion not including this gene. However, one myelodysplastic syndrome lacked one copy of ETV6 but not CDKN1B. Hence, we suggest a minimal region of deletion on 12p located between the ETV6 and CDKN1B genes.

Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

PubMed

Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

2011-11-01

Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geller, A.I.; Keyomarsi, K.; Bryan, J.

1990-11-01

The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less

Human homologue sequences to the Drosophila dishevelled segment-polarity gene are deleted in the DiGeorge syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pizzuti, A.; Ratti, A.; Penso, D.

DiGeorge syndrome (DGS) is a developmental defect of some of the neural crest derivatives. Most DGS patients show haploinsufficiency due to interstitial deletions of the proximal long arm of chromosome 22. Deletions of 22q11 have also been reported in patients with the velo-cardio-facial syndrome and familial conotruncal heart defects. It has been suggested that the wide phenotype spectrum associated with 22q11 monosomy is a consequence of contiguous-gene deletions. We report the isolation of human cDNAs homologous to the Drosophila dishevelled (dsh) segment-polarity gene. Sequences homologous to the 3{prime} UTR of these transcripts (DVL-22) were positioned within the DGS critical regionmore » and were found to be deleted in DGS patients. Human DVL mRNAs are expressed in several fetal and adult tissues, including the thymus and, at high levels, the heart. Two transcripts, 3.2 and 5 kb, were detected, in Northern blot analysis, with different expression patterns in the surveyed tissues when different cDNAs were used. The isolated cDNAs exhibit high amino acid homology with the mouse and Xenopus Dvl-1 gene, the only other vertebrate dsh homologues so far isolated. The pivotal role of dsh in fly development suggests an analogous key function in vertebrate embryogenesis of its homologue genes. Since DGS may be due to perturbation of differentiation mechanisms at decisive embryological stages, a Dsh-like gene in the small-region overlap (SRO) might be a candidate for the pathogenesis of this disorder. 52 refs., 3 figs.« less

Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

PubMed Central

Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

1995-01-01

Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

Haploinsufficiency of HDAC4 Causes Brachydactyly Mental Retardation Syndrome, with Brachydactyly Type E, Developmental Delays, and Behavioral Problems

PubMed Central

Williams, Stephen R.; Aldred, Micheala A.; Der Kaloustian, Vazken M.; Halal, Fahed; Gowans, Gordon; McLeod, D. Ross; Zondag, Sara; Toriello, Helga V.; Magenis, R. Ellen; Elsea, Sarah H.

2010-01-01

Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4−/− mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome. PMID:20691407

Analysis of the Functions of Recombination-Related Genes in the Generation of Large Chromosomal Deletions by Loop-Out Recombination in Aspergillus oryzae

PubMed Central

Ogawa, Masahiro; Koyama, Yasuji

2012-01-01

Loop-out-type recombination is a type of intrachromosomal recombination followed by the excision of a chromosomal region. The detailed mechanism underlying this recombination and the genes involved in loop-out recombination remain unknown. In the present study, we investigated the functions of ku70, ligD, rad52, rad54, and rdh54 in the construction of large chromosomal deletions via loop-out recombination and the effect of the position of the targeted chromosomal region on the efficiency of loop-out recombination in Aspergillus oryzae. The efficiency of generation of large chromosomal deletions in the near-telomeric region of chromosome 3, including the aflatoxin gene cluster, was compared with that in the near-centromeric region of chromosome 8, including the tannase gene. In the Δku70 and Δku70-rdh54 strains, only precise loop-out recombination occurred in the near-telomeric region. In contrast, in the ΔligD, Δku70-rad52, and Δku70-rad54 strains, unintended chromosomal deletions by illegitimate loop-out recombination occurred in the near-telomeric region. In addition, large chromosomal deletions via loop-out recombination were efficiently achieved in the near-telomeric region, but barely achieved in the near-centromeric region, in the Δku70 strain. Induction of DNA double-strand breaks by I-SceI endonuclease facilitated large chromosomal deletions in the near-centromeric region. These results indicate that ligD, rad52, and rad54 play a role in the generation of large chromosomal deletions via precise loop-out-type recombination in the near-telomeric region and that loop-out recombination between distant sites is restricted in the near-centromeric region by chromosomal structure. PMID:22286092

Haploinsufficiency of HDAC4 causes brachydactyly mental retardation syndrome, with brachydactyly type E, developmental delays, and behavioral problems.

PubMed

Williams, Stephen R; Aldred, Micheala A; Der Kaloustian, Vazken M; Halal, Fahed; Gowans, Gordon; McLeod, D Ross; Zondag, Sara; Toriello, Helga V; Magenis, R Ellen; Elsea, Sarah H

2010-08-13

Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4(-/-) mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome.

MLPA based detection of mutations in the dystrophin gene of 180 Polish families with Duchenne/Becker muscular dystrophy.

PubMed

Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek

2014-01-01

Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

TPH2 polymorphisms and expression in Prader-Willi syndrome subjects with differing genetic subtypes.

PubMed

Henkhaus, Rebecca S; Bittel, Douglas C; Butler, Merlin G

2010-09-01

Prader-Willi syndrome (PWS) is a genetic imprinting disease that causes developmental and behavioral disturbances resulting from loss of expression of genes from the paternal chromosome 15q11-q13 region. In about 70% of subjects, this portion of the paternal chromosome is deleted, while 25% have two copies of the maternal chromosome 15, or uniparental maternal disomy (UPD; the remaining subjects have imprinting center defects. There are several documented physical and behavioral differences between the two major PWS genetic subtypes (deletion and UPD) indicating the genetic subtype plays a role in clinical presentation. Serotonin is known to be disturbed in PWS and affects both eating behavior and compulsion, which are reported to be abnormal in PWS. We investigated the tryptophan hydroxylase gene (TPH2), the rate-limiting enzyme in the production of brain serotonin, by analyzing three different TPH2 gene polymorphisms, transcript expression, and correlation with PWS genetic subtype. DNA and RNA from lymphoblastoid cell lines derived from 12 PWS and 12 comparison subjects were used for the determination of genetic subtype, TPH2 polymorphisms and quantitative RT-PCR analysis. A similar frequency of TPH2 polymorphisms was seen in the PWS and comparison subjects with PWS deletion subjects showing increased expression with one or more TPH2 polymorphism. Both PWS deletion and PWS UPD subjects had significantly lower TPH2 expression than control subjects and PWS deletion subjects had significantly lower TPH2 expression compared with PWS UPD subjects. PWS subjects with 15q11-q13 deletions had lower TPH2 expression compared with PWS UPD or control subjects, requiring replication and further studies to identify the cause including identification of disturbed gene interactions resulting from the deletion process.

Two unrelated children with overlapping 6q25.3 deletions, motor speech disorders, and language delays.

PubMed

Peter, Beate; Lancaster, Hope; Vose, Caitlin; Fares, Amna; Schrauwen, Isabelle; Huentelman, Matthew

2017-10-01

Interstitial and terminal 6q25 deletions are associated with developmental delays, hypotonia, eye pathologies, craniofacial dysmorphologies, and structural brain anomalies. In most cases, speech and language deficits are not described in detail. We report on a case (Patient 1, age 7 years) with a de novo 6q25.3-qter deletion, 11.1 Mb long and encompassing 108 genes, and a case (Patient 2, age 5 years) with an inherited interstitial 6q25.3 deletion, located within Patient 1's deletion region and 403 kb long, the smallest 6q25 deletion reported to date. Both children have hypotonia, motor speech disorders, and expressive language delays. Patient 1's speech was characterized by childhood apraxia of speech (CAS) and dysarthria. Other findings include developmental delay, ataxic cerebral palsy, optic nerve dysplagia, and atypical brain morphologies regarding the corpus callosum and gyration patterns, a clinical profile that closely matches a previously reported case with a nearly identical deletion. Patient 2 had speech characterized by CAS and typical nonverbal processing abilities. His father, a carrier, had typical speech and language but showed difficulties with complex motor speech and hand motor tasks, similar to other adults with residual signs of CAS. The small deletion in this family contains the IGF2R-AIRN-SLC22A2-SLC22A3 gene cluster, which is associated with imprinting and maternal-specific expression of Igf2R, Slc22a2, and Slc22a3 in mice, whereas imprinting in humans is a polymorphic trait. The shared phenotypes in the two patients might be associated with the deletion of the gene cluster. © 2017 Wiley Periodicals, Inc.

Molecular analysis and comparison of radiation-induced large deletions of the HPRT locus in primary human skin fibroblasts

NASA Technical Reports Server (NTRS)

Yamada, Y.; Park, M. S.; Okinaka, R. T.; Chen, D. J.

1996-01-01

Genetic alterations in gamma-ray- and alpha-particle-induced HPRT mutants were examined by multiplex polymerase chain reaction (PCR) analysis. A total of 39-63% of gamma-ray-induced and 31-57% of alpha-particle-induced mutants had partial or total deletions of the HPRT gene. The proportion of these deletion events was dependent on radiation dose, and at the resolution limits employed there were no significant differences between the spectra induced by equitoxic doses of alpha particles (0.2-0.4 Gy) and gamma rays (3 Gy). The molecular nature of the deletions was analyzed by the use of sequence tagged site (STS) primers and PCR amplification as a "probe" for specific regions of the human X chromosome within the Xq26 region. These STSs were closely linked and spanned regions approximately 1.7 Mbp from the telomeric side and 1.7 Mbp from the centromeric side of the HPRT gene. These markers include: DXS53, 299R, DXS79, yH3L, 3/19, PR1, PR25, H2, yH3R, 1/44, 1/67, 1/1, DXS86, D8C6, DXS10 and DXS144. STS analyses indicated that the maximum size of total deletions in radiation-induced HPRT mutants can be greater than 2.7 Mbp and deletion size appears to be dependent on radiation dose. There were no apparent differences in the sizes of the deletions induced by alpha particles or gamma rays. On the other hand, deletions containing portions of the HPRT gene were observed to be 800 kbp or less, and the pattern of the partial deletion induced by alpha particles appeared to be different from that induced by gamma rays.

Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

PubMed

Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

2010-10-15

Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

USDA-ARS?s Scientific Manuscript database

In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

A Comprehensive Analysis of Replicative Lifespan in 4,698 Single-Gene Deletion Strains Uncovers Conserved Mechanisms of Aging.

PubMed

McCormick, Mark A; Delaney, Joe R; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; Shemorry, Anna; Sim, Sylvia; Chou, Annie Chia-Zong; Ahmed, Umema; Carr, Daniel; Murakami, Christopher J; Schleit, Jennifer; Sutphin, George L; Wasko, Brian M; Bennett, Christopher F; Wang, Adrienne M; Olsen, Brady; Beyer, Richard P; Bammler, Theodor K; Prunkard, Donna; Johnson, Simon C; Pennypacker, Juniper K; An, Elroy; Anies, Arieanna; Castanza, Anthony S; Choi, Eunice; Dang, Nick; Enerio, Shiena; Fletcher, Marissa; Fox, Lindsay; Goswami, Sarani; Higgins, Sean A; Holmberg, Molly A; Hu, Di; Hui, Jessica; Jelic, Monika; Jeong, Ki-Soo; Johnston, Elijah; Kerr, Emily O; Kim, Jin; Kim, Diana; Kirkland, Katie; Klum, Shannon; Kotireddy, Soumya; Liao, Eric; Lim, Michael; Lin, Michael S; Lo, Winston C; Lockshon, Dan; Miller, Hillary A; Moller, Richard M; Muller, Brian; Oakes, Jonathan; Pak, Diana N; Peng, Zhao Jun; Pham, Kim M; Pollard, Tom G; Pradeep, Prarthana; Pruett, Dillon; Rai, Dilreet; Robison, Brett; Rodriguez, Ariana A; Ros, Bopharoth; Sage, Michael; Singh, Manpreet K; Smith, Erica D; Snead, Katie; Solanky, Amrita; Spector, Benjamin L; Steffen, Kristan K; Tchao, Bie Nga; Ting, Marc K; Vander Wende, Helen; Wang, Dennis; Welton, K Linnea; Westman, Eric A; Brem, Rachel B; Liu, Xin-Guang; Suh, Yousin; Zhou, Zhongjun; Kaeberlein, Matt; Kennedy, Brian K

2015-11-03

Many genes that affect replicative lifespan (RLS) in the budding yeast Saccharomyces cerevisiae also affect aging in other organisms such as C. elegans and M. musculus. We performed a systematic analysis of yeast RLS in a set of 4,698 viable single-gene deletion strains. Multiple functional gene clusters were identified, and full genome-to-genome comparison demonstrated a significant conservation in longevity pathways between yeast and C. elegans. Among the mechanisms of aging identified, deletion of tRNA exporter LOS1 robustly extended lifespan. Dietary restriction (DR) and inhibition of mechanistic Target of Rapamycin (mTOR) exclude Los1 from the nucleus in a Rad53-dependent manner. Moreover, lifespan extension from deletion of LOS1 is nonadditive with DR or mTOR inhibition, and results in Gcn4 transcription factor activation. Thus, the DNA damage response and mTOR converge on Los1-mediated nuclear tRNA export to regulate Gcn4 activity and aging. Copyright © 2015 Elsevier Inc. All rights reserved.

Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

PubMed

He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

2017-11-01

Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

Psi- vectors: murine leukemia virus-based self-inactivating and self-activating retroviral vectors.

PubMed Central

Delviks, K A; Hu, W S; Pathak, V K

1997-01-01

We have developed murine leukemia virus (MLV)-based self-inactivating and self-activating vectors to show that the previously demonstrated high-frequency direct repeat deletions are not unique to spleen necrosis virus (SNV) or the neomycin drug resistance gene. Retroviral vectors pKD-HTTK and pKD-HTpTK containing direct repeats composed of segments of the herpes simplex virus type 1 thymidine kinase (HTK) gene were constructed; in pKD-HTpTK, the direct repeat flanked the MLV packaging signal. The generation of hypoxanthine-aminopterin-thymidine-resistant colonies after one cycle of retroviral replication demonstrated functional reconstitution of the HTK gene. Quantitative Southern analysis indicated that direct repeat deletions occurred in 57 and 91% of the KD-HTTK and KD-HTpTK proviruses, respectively. These results demonstrate that (i) deletion of direct repeats occurs at similar high frequencies in SNV and MLV vectors, (ii) MLV psi can be efficiently deleted by using direct repeats, (iii) suicide genes can be functionally reconstituted during reverse transcription, and (iv) the psi region may be a hot spot for reverse transcriptase template switching events. PMID:9223521

Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

PubMed Central

Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

2017-01-01

Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.

PubMed

Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih

2017-01-01

Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.

Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

PubMed

Bai, Ying; Chen, Yibing; Kong, Xiangdong

2018-02-02

It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

A 590 kb deletion caused by non-allelic homologous recombination between two LINE-1 elements in a patient with mesomelia-synostosis syndrome.

PubMed

Kohmoto, Tomohiro; Naruto, Takuya; Watanabe, Miki; Fujita, Yuji; Ujiro, Sae; Okamoto, Nana; Horikawa, Hideaki; Masuda, Kiyoshi; Imoto, Issei

2017-04-01

Mesomelia-synostoses syndrome (MSS) is a rare, autosomal-dominant, syndromal osteochondrodysplasia characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations due to a non-recurrent deletion at 8q13 that always encompasses two coding-genes, SULF1 and SLCO5A1. To date, five unrelated patients have been reported worldwide, and MMS was previously proposed to not be a genomic disorder associated with deletions recurring from non-allelic homologous recombination (NAHR) in at least two analyzed cases. We conducted targeted gene panel sequencing and subsequent array-based copy number analysis in an 11-year-old undiagnosed Japanese female patient with multiple congenital anomalies that included mesomelic limb shortening and detected a novel 590 Kb deletion at 8q13 encompassing the same gene set as reported previously, resulting in the diagnosis of MSS. Breakpoint sequences of the deleted region in our case demonstrated the first LINE-1s (L1s)-mediated unequal NAHR event utilizing two distant L1 elements as homology substrates in this disease, which may represent a novel causative mechanism of the 8q13 deletion, expanding the range of mechanisms involved in the chromosomal rearrangements responsible for MSS. © 2017 Wiley Periodicals, Inc.

Increased frequency of DNA deletions in pink-eyed unstable mice carrying a mutation in the Werner syndrome gene homologue.

PubMed

Lebel, Michel

2002-01-01

Werner syndrome (WS) is a rare autosomal recessive disorder characterized by genomic instability and the premature onset of a number of age-related diseases, including cancers. Accumulating evidence indicates that the WS gene product is involved in resolving aberrant DNA structures that may arise during the process of DNA replication and/or transcription. To estimate the frequency of DNA deletions directly in the skin of mouse embryos, mice with a deletion of part of the murine WRN helicase domain were created. These mutant mice were then crossed to the pink-eyed unstable animals, which have a 70 kb internal duplication at the pink-eyed dilution (p) gene. This report indicates that the frequency of deletion of the duplicated sequence at the p locus is elevated in mice with a mutation in the WRN allele when compared with wild-type mice. In addition, the inhibitor of topoisomerase I camptothecin also increases the frequency of deletion at the p locus. This frequency is even more elevated in WRN mutant mice treated with camptothecin. In contrast, while the inhibition of poly(ADP-ribose) polymerase (PARP) activity by 3-aminobenzamide increases the frequency of DNA deletion, mutant WRN mice are not significantly more sensitive to the inhibition of PARP activity than wild-type animals.

Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.

PubMed

Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu

2017-11-14

Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.

In vivo functional analysis of L-rhamnose metabolic pathway in Aspergillus niger: a tool to identify the potential inducer of RhaR.

PubMed

Khosravi, Claire; Kun, Roland Sándor; Visser, Jaap; Aguilar-Pontes, María Victoria; de Vries, Ronald P; Battaglia, Evy

2017-11-06

The genes of the non-phosphorylative L-rhamnose catabolic pathway have been identified for several yeast species. In Schefferomyces stipitis, all L-rhamnose pathway genes are organized in a cluster, which is conserved in Aspergillus niger, except for the lra-4 ortholog (lraD). The A. niger cluster also contains the gene encoding the L-rhamnose responsive transcription factor (RhaR) that has been shown to control the expression of genes involved in L-rhamnose release and catabolism. In this paper, we confirmed the function of the first three putative L-rhamnose utilisation genes from A. niger through gene deletion. We explored the identity of the inducer of the pathway regulator (RhaR) through expression analysis of the deletion mutants grown in transfer experiments to L-rhamnose and L-rhamnonate. Reduced expression of L-rhamnose-induced genes on L-rhamnose in lraA and lraB deletion strains, but not on L-rhamnonate (the product of LraB), demonstrate that the inducer of the pathway is of L-rhamnonate or a compound downstream of it. Reduced expression of these genes in the lraC deletion strain on L-rhamnonate show that it is in fact a downstream product of L-rhamnonate. This work showed that the inducer of RhaR is beyond L-rhamnonate dehydratase (LraC) and is likely to be the 2-keto-3-L-deoxyrhamnonate.

Deletions at the SOX10 gene locus cause Waardenburg syndrome types 2 and 4.

PubMed

Bondurand, Nadege; Dastot-Le Moal, Florence; Stanchina, Laure; Collot, Nathalie; Baral, Viviane; Marlin, Sandrine; Attie-Bitach, Tania; Giurgea, Irina; Skopinski, Laurent; Reardon, William; Toutain, Annick; Sarda, Pierre; Echaieb, Anis; Lackmy-Port-Lis, Marilyn; Touraine, Renaud; Amiel, Jeanne; Goossens, Michel; Pingault, Veronique

2007-12-01

Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.

Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions.

PubMed

Ferraris, Alessandro; Bernardini, Laura; Sabolic Avramovska, Vesna; Zanni, Ginevra; Loddo, Sara; Sukarova-Angelovska, Elena; Parisi, Valentina; Capalbo, Anna; Tumini, Stefano; Travaglini, Lorena; Mancini, Francesca; Duma, Filip; Barresi, Sabina; Novelli, Antonio; Mercuri, Eugenio; Tarani, Luigi; Bertini, Enrico; Dallapiccola, Bruno; Valente, Enza Maria

2013-05-16

The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS.

Genes commonly deleted in childhood B-cell precursor acute lymphoblastic leukemia: association with cytogenetics and clinical features

PubMed Central

Schwab, Claire J.; Chilton, Lucy; Morrison, Heather; Jones, Lisa; Al-Shehhi, Halima; Erhorn, Amy; Russell, Lisa J.; Moorman, Anthony V.; Harrison, Christine J.

2013-01-01

In childhood B-cell precursor acute lymphoblastic leukemia, cytogenetics is important in diagnosis and as an indicator of response to therapy, thus playing a key role in risk stratification of patients for treatment. Little is known of the relationship between different cytogenetic subtypes in B-cell precursor acute lymphoblastic leukemia and the recently reported copy number abnormalities affecting significant leukemia associated genes. In a consecutive series of 1427 childhood B-cell precursor acute lymphoblastic leukemia patients, we have determined the incidence and type of copy number abnormalities using multiplex ligation-dependent probe amplification. We have shown strong links between certain deletions and cytogenetic subtypes, including the novel association between RB1 deletions and intrachromosomal amplification of chromosome 21. In this study, we characterized the different copy number abnormalities and show heterogeneity of PAX5 and IKZF1 deletions and the recurrent nature of RB1 deletions. Whole gene losses are often indicative of larger deletions, visible by conventional cytogenetics. An increased number of copy number abnormalities is associated with NCI high risk, specifically deletions of IKZF1 and CDKN2A/B, which occur more frequently among these patients. IKZF1 deletions and rearrangements of CRLF2 among patients with undefined karyotypes may point to the poor risk BCR-ABL1-like group. In conclusion, this study has demonstrated in a large representative cohort of children with B-cell precursor acute lymphoblastic leukemia that the pattern of copy number abnormalities is highly variable according to the primary genetic abnormality. PMID:23508010

Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions

PubMed Central

2013-01-01

Background The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Methods and results Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Conclusions Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS. PMID:23679990

Survival of a bacterioferritin deletion mutant of Brucella melitensis 16M in human monocyte-derived macrophages.

PubMed Central

Denoel, P A; Crawford, R M; Zygmunt, M S; Tibor, A; Weynants, V E; Godfroid, F; Hoover, D L; Letesson, J J

1997-01-01

A bacterioferritin (BFR) deletion mutant of Brucella melitensis 16M was generated by gene replacement. The deletion was complemented with a broad-host-range vector carrying the wild-type bfr gene, pBBR-bfr. The survival and growth of the mutant, B. melitensis PAD 2-78, were similar to those of its parental strain in human monocyte-derived macrophages (MDM). These results suggest that BFR is not essential for the intracellular survival of B. melitensis in human MDM. PMID:9317046

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

29 CFR 452.106 - Preservation of records.

Code of Federal Regulations, 2010 CFR

2010-07-01

... unmarked, must be preserved. Independent certification as to the number and kind of ballots destroyed may... they were received late or because they were cast for an ineligible candidate, must also be preserved...

Population size and stopover duration estimation using mark–resight data and Bayesian analysis of a superpopulation model

USGS Publications Warehouse

Lyons, James E.; Kendall, William L.; Royle, J. Andrew; Converse, Sarah J.; Andres, Brad A.; Buchanan, Joseph B.

2016-01-01

We present a novel formulation of a mark–recapture–resight model that allows estimation of population size, stopover duration, and arrival and departure schedules at migration areas. Estimation is based on encounter histories of uniquely marked individuals and relative counts of marked and unmarked animals. We use a Bayesian analysis of a state–space formulation of the Jolly–Seber mark–recapture model, integrated with a binomial model for counts of unmarked animals, to derive estimates of population size and arrival and departure probabilities. We also provide a novel estimator for stopover duration that is derived from the latent state variable representing the interim between arrival and departure in the state–space model. We conduct a simulation study of field sampling protocols to understand the impact of superpopulation size, proportion marked, and number of animals sampled on bias and precision of estimates. Simulation results indicate that relative bias of estimates of the proportion of the population with marks was low for all sampling scenarios and never exceeded 2%. Our approach does not require enumeration of all unmarked animals detected or direct knowledge of the number of marked animals in the population at the time of the study. This provides flexibility and potential application in a variety of sampling situations (e.g., migratory birds, breeding seabirds, sea turtles, fish, pinnipeds, etc.). Application of the methods is demonstrated with data from a study of migratory sandpipers.

Pedestrians' crossing behaviors and safety at unmarked roadway in China.

PubMed

Zhuang, Xiangling; Wu, Changxu

2011-11-01

Pedestrians' crossing out of crosswalks (unmarked roadway) contributed to many traffic accidents, but existing pedestrian studies mainly focus on crosswalk crossing in developed countries specifically. Field observation of 254 pedestrians at unmarked roadway in China showed that 65.7% of them did not look for vehicles after arriving at the curb. Those who did look and pay attention to the traffic did so for duration of time that followed an exponential distribution. Pedestrians preferred crossing actively in tentative ways rather than waiting passively. The waiting time at the curb, at the median, and at the roadway all followed exponential distributions. During crossing, all pedestrians looked at the oncoming vehicles. When interacting with these vehicles, 31.9% of them ran and 11.4% stepped backwards. Running pedestrians usually began running at the borderline rather than within the lanes. Pedestrians preferred safe to short paths and they crossed second half of the road with significantly higher speed. These behavioral patterns were rechecked at an additional site with 105 pedestrians and the results showed much accordance. In terms of safety, pedestrians who were middle aged, involved in bigger groups, looked at vehicles more often before crossing or interacted with buses rather than cars were safer while those running were more dangerous. Potential applications of these findings, including building accurate simulation models of pedestrians and education of drivers and pedestrians in developing countries were also discussed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Identification and characterization of six glycosyltransferases involved in the biosynthesis of a new bacterial exopolysaccharide in Paenibacillus elgii.

PubMed

Ou, Li; Ang, Li; Chujun, Zhang; Jingyu, Huang; Yongli, Meng; Shenjing, Yuan; Junhua, Huang; Xu, Gao; Yulong, Yao; Rui, Yin; Jinpan, Hu; Bin, Ding; Xiufang, Hu

2018-02-01

Paenibacillus elgii B69 produces a new xylose-containing exopolysaccharide (EPS) that effectively removes the pollutants from wastewater through flocculation. However, information about the biosynthesis of this EPS is limited. In this study, sequence analysis showed six putative glycosyltransferases (GTs) genes in polysaccharide gene clusters involved in glycosidic linkages of repeating units. Each gene was deleted and phenotypes were examined to understand the functions of these genes. Two of the genes were deleted successfully to encode a priming glucose GT and a side-chain xylose GT, but other genes were unsuccessfully deleted because of the accumulation of toxic intermediate products. The six genes were cloned and expressed in Escherichia coli, and the corresponding enzymes were purified. The activity of GTs was analyzed through mass spectrometry by using the purified membrane fraction as a lipid carrier receptor after a hexasaccharide repeated unit was reconstructed in vitro. The specificities of six different GTs and the building order of the hexasaccharide were characterized. This study provided a basis for future research on the biosynthetic pathway of EPS in Paenibacillus or other genera.

Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

PubMed Central

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

Plasmid-encoded tetracycline efflux pump protein alters bacterial stress responses and ecological fitness of Acinetobacter oleivorans.

PubMed

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.

Deletion of the S component inverted repeat sequence c' and the nonessential genes U(S)1 through U(S)5 from the herpes simplex virus type 1 genome substantially impairs productive viral infection in cell culture and pathogenesis in the rat central nervous system.

PubMed

Rasty, S; Poliani, P L; Fink, D J; Glorioso, J C

1997-08-01

A distinctive feature of the genetic make-up of herpes simplex virus type 1 (HSV-1), a human neurotropic virus, is that approximately half of the 81 known viral genes are not absolutely required for productive infection in Vero cells, and most can be individually deleted without substantially impairing viral replication in cell culture. If large blocks of contiguous viral genes could be replaced with foreign DNA sequences, it would be possible to engineer highly attenuated recombinant HSV-1 gene transfer vectors capable of carrying large cellular genes or multiple genes having related functions. We report the isolation and characterization of an HSV-1 mutant, designated d311, containing a 12 kb deletion of viral DNA located between the L-S Junction a sequence and the U(S)6 gene, spanning the S component inverted repeat sequence c' and the nonessential genes U(S)1 through U(S)5. Replication of d311 was totally inhibited in rat B103 and mouse Neuro-2A neuroblastoma cell lines, and was reduced by over three orders of magnitude in human SK-N-SH neuroblastoma cells compared to wild-type (wt) HSV-1 KOS. This suggested that the deleted genes, while nonessential for replication in Vero cells, play an important role in HSV replication in neuronal cells, particularly those of rodent origin. Unlike wt KOS which replicated locally and spread to other regions of brain following stereotactic inoculation into rat hippocampus, d311 was unable to replicate and spread within the brain, and did not cause any apparent local neuronal cell damage. These results demonstrate that d311 is highly attenuated for the rat central nervous system. d311 and other mutants of HSV containing major deletions of the nonessential genes within U(S) have the potential to serve as useful tools for gene transfer applications to brain.

Multiplexed quantitative real-time PCR to detect 22q11.2 deletion in patients with congenital heart disease

PubMed Central

Mahnke, Donna K.; Larson, Joshua M.; Ghanta, Sujana; Feng, Ying; Simpson, Pippa M.; Broeckel, Ulrich; Duffy, Kelly; Tweddell, James S.; Grossman, William J.; Routes, John M.; Mitchell, Michael E.

2010-01-01

22q11.2 Deletion syndrome (22q11.2 DS) [DiGeorge syndrome type 1 (DGS1)] occurs in ∼1:3,000 live births; 75% of children with DGS1 have severe congenital heart disease requiring early intervention. The gold standard for detection of DGS1 is fluorescence in situ hybridization (FISH) with a probe at the TUPLE1 gene. However, FISH is costly and is typically ordered in conjunction with a karyotype analysis that takes several days. Therefore, FISH is underutilized and the diagnosis of 22q11.2 DS is frequently delayed, often resulting in profound clinical consequences. Our goal was to determine whether multiplexed, quantitative real-time PCR (MQPCR) could be used to detect the haploinsufficiency characteristic of 22q11.2 DS. A retrospective blinded study was performed on 382 subjects who had undergone congenital heart surgery. MQPCR was performed with a probe localized to the TBX1 gene on human chromosome 22, a gene typically deleted in 22q11.2 DS. Cycle threshold (Ct) was used to calculate the relative gene copy number (rGCN). Confirmation analysis was performed with the Affymetrix 6.0 Genome-Wide SNP Array. With MQPCR, 361 subjects were identified as nondeleted with an rGCN near 1.0 and 21 subjects were identified as deleted with an rGCN near 0.5, indicative of a hemizygous deletion. The sensitivity (21/21) and specificity (361/361) of MQPCR to detect 22q11.2 deletions was 100% at an rGCN value drawn at 0.7. One of 21 subjects with a prior clinical (not genetically confirmed) DGS1 diagnosis was found not to carry the deletion, while another subject, not previously identified as DGS1, was detected as deleted and subsequently confirmed via microarray. The MQPCR assay is a rapid, inexpensive, sensitive, and specific assay that can be used to screen for 22q11.2 deletion syndrome. The assay is readily adaptable to high throughput. PMID:20551144

Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

PubMed Central

Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

2015-01-01

ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

PubMed

Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

2016-05-10

Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

PubMed

Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

2015-04-01

We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

Osteopoikilosis, short stature and mental retardation as key features of a new microdeletion syndrome on 12q14.

PubMed

Menten, Björn; Buysse, Karen; Zahir, Farah; Hellemans, Jan; Hamilton, Sara J; Costa, Teresa; Fagerstrom, Carrie; Anadiotis, George; Kingsbury, Daniel; McGillivray, Barbara C; Marra, Marco A; Friedman, Jan M; Speleman, Frank; Mortier, Geert

2007-04-01

This report presents the detection of a heterozygous deletion at chromosome 12q14 in three unrelated patients with a similar phenotype consisting of mild mental retardation, failure to thrive in infancy, proportionate short stature and osteopoikilosis as the most characteristic features. In each case, this interstitial deletion was found using molecular karyotyping. The deletion occurred as a de novo event and varied between 3.44 and 6 megabases (Mb) in size with a 3.44 Mb common deleted region. The deleted interval was not flanked by low-copy repeats or segmental duplications. It contains 13 RefSeq genes, including LEMD3, which was previously shown to be the causal gene for osteopoikilosis. The observation of osteopoikilosis lesions should facilitate recognition of this new microdeletion syndrome among children with failure to thrive, short stature and learning disabilities.

Confirmation that a deletion in the POMC gene is associated with body weight of Labrador Retriever dogs.

PubMed

Mankowska, M; Krzeminska, P; Graczyk, M; Switonski, M

2017-06-01

A 14-bp deletion present in the proopiomelanocortin (POMC) gene of Labrador and Flat Coat Retrievers (FCR), but absent in POMC of other breeds, disrupts the β-MSH and β-endorphin coding sequences. This deletion was recently reported as strongly associated with increased body weight and obesity. We searched for this mutation in a cohort of 272 dogs, representing four breeds with a known predisposition to obesity (Labrador and Golden Retrievers, Beagle, and Cocker Spaniel) and, as expected, we found it only in Labradors. Further, we confirmed the association between the deletion variant and body weight of Labradors but not with a 5-point body condition score (BCS). We suspect that the deletion variant in our cohort may act as a recessive allele, unlike the previous study, which suggested its additive effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion

PubMed Central

Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

2017-01-01

We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early. PMID:28720553

Cryptic chromosome 9q34 deletion generates TAF-Ialpha/CAN and TAF-Ibeta/CAN fusion transcripts in acute myeloid leukemia.

PubMed

Rosati, Roberto; La Starza, Roberta; Barba, Gianluca; Gorello, Paolo; Pierini, Valentina; Matteucci, Caterina; Roti, Giovanni; Crescenzi, Barbara; Aloisi, Teresa; Aversa, Franco; Martelli, Massimo Fabrizio; Mecucci, Cristina

2007-02-01

In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5' TAF-I to the 3' CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-Ialpha or TAF-Ibeta moieties. We set up molecular assays to monitor the chimeric TAF-Ialpha/CAN and TAF-Ibeta/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.

Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion.

PubMed

Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

2017-12-15

We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early.

YAC contigs covering an 8-megabase region of 3p deleted in the small-cell lung cancer cell line U2020

DOE Office of Scientific and Technical Information (OSTI.GOV)

Todd, S.; Bolin, R.; Drabkin, H.A.

1995-01-01

Somatic deletions of chromosome 3p occur at high frequencies in cancers of kidney, breast, cervix, head and neck, nasopharynx, and lung. The frequency of 3p deletion in lung cancer approaches 100% among small cell lesions and 70 to 80% in non-small cell lesions. This evidence strongly implies that one or more tumor suppressor genes of potentially widespread significance reside within the deleted region(s). Precise definition of the deleted target region(s) has been difficult due to the extensive area(s) lost and use of markers with low informativeness. However, improved definition remains essential to permit isolation of putative tumor suppressor genes frommore » 3p. The identification of several small, homozygous 3p deletions in lung cancer cell lines has provided a critical resource that will assist this search. The U2020 cell line contains a small homozygous deletion that maps to a very proximal region of 3p and includes the marker D3S3. We previously identified a subset of DNA markers located within the deleted region and determined their relative order by pulsed-field gel mapping studies. In the present report, we describe the development of YAC contigs that span the majority of the deleted region and link up to flanking markers on both sides. The centromere proximal portion of the contig crosses the breakpoint from an X;3 translocation located within 3p12 providing both location and orientation to the map. PCR-based (CA){sub n} microsatellite polymorphisms have been localized within and flanking the deletion region. These markers should greatly facilitate loss-of-heterozygosity studies of this region in human cancer. The contig provides a direct means for isolation of putative tumor suppressor genes from this segment of 3p. 51 refs., 3 figs., 3 tabs.« less

Molecular Genetic and Crystal Structural Analysis of 1-(4-Hydroxyphenyl)-Ethanol Dehydrogenase from 'Aromatoleum aromaticum' EbN1.

PubMed

Büsing, Imke; Höffken, H Wolfgang; Breuer, Michael; Wöhlbrand, Lars; Hauer, Bernhard; Rabus, Ralf

2015-01-01

The dehydrogenation of 1-(4-hydroxyphenyl)-ethanol to 4-hydroxyacetophenone represents the second reaction step during anaerobic degradation of p-ethylphenol in the denitrifying bacterium 'Aromatoleum aromaticum' EbN1. Previous proteogenomic studies identified two different proteins (ChnA and EbA309) as possible candidates for catalyzing this reaction [Wöhlbrand et al: J Bacteriol 2008;190:5699-5709]. Physiological-molecular characterization of newly generated unmarked in-frame deletion and complementation mutants allowed defining ChnA (renamed here as Hped) as the enzyme responsible for 1-(4-hydroxyphenyl)-ethanol oxidation. Hped [1-(4-hydroxyphenyl)-ethanol dehydrogenase] belongs to the 'classical' family within the short-chain alcohol dehydrogenase/reductase (SDR) superfamily. Hped was overproduced in Escherichia coli, purified and crystallized. The X-ray structures of the apo- and NAD(+)-soaked form were resolved at 1.5 and 1.1 Å, respectively, and revealed Hped as a typical homotetrameric SDR. Modeling of the substrate 4-hydroxyacetophenone (reductive direction of Hped) into the active site revealed the structural determinants of the strict (R)-specificity of Hped (Phe(187)), contrasting the (S)-specificity of previously reported 1-phenylethanol dehydrogenase (Ped; Tyr(93)) from strain EbN1 [Höffken et al: Biochemistry 2006;45:82-93]. © 2015 S. Karger AG, Basel.

Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

PubMed

Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

2016-06-01

Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Mosaic compound heterozygosity of SHOX resulting in Leri-Weill dyschondrosteosis with marked short stature: implications for disease mechanisms and recurrence risks.

PubMed

Reish, Orit; Huber, Céline; Altarescu, Gheona; Chapman-Shimshoni, Daphne; Levy-Lahad, Ephrat; Renbaum, Paul; Mashevich, Maya; Munnich, Arnold; Cormier-Daire, Valérie

2010-09-01

Mutations or deletions in the SHOX gene cause Leri-Weill dyschondrosteosis (LWD) and Langer mesomelic dysplasia (LMD) when present in heterozygous or homozygous form, respectively. A new class of enhancer deletions was identified 30-250 kb downstream of SHOX. We identified a female patient with marked short stature, mosaic for monosomy X in 31% of her lymphocytes, and findings consistent with LWD. Additional molecular studies demonstrated segregation of 17 polymorphic markers flanking and including the SHOX locus, spanning 328 kb of pseudoautosomal region 1 (PAR1) region. A deletion up to 10 kb residing 197 kb downstream of SHOX gene was detected, which was germinally transmitted from her clinically unaffected father. This was associated with post-zygotic mosaic loss of the normal maternal X-chromosome, evidenced by fluorescent fragment analysis. Since most patients with LMD with deletions downstream of SHOX gene also have SHOX mutations in trans, it may suggest these deletions are associated with a milder phenotype. Further studies are required to elucidate the role of the former region in disease etiology. Mutations should be sought in clinically non-affected family members because of the variable expressivity in hemizygous carriers, and cytogenetic evaluation should be considered to detect possible X-chromosome rearrangements underlying the haploinsufficiency for the PAR1 when deletion is detected by molecular analysis. Similarly, when LWD and marked short stature occur in a patient with mosaic Turner syndrome, the possibility of mutations in SHOX and the downstream of SHOX gene should be considered. Copyright 2010 Wiley-Liss, Inc.

A rapid NGS strategy for comprehensive molecular diagnosis of Birt-Hogg-Dubé syndrome in patients with primary spontaneous pneumothorax.

PubMed

Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long

2016-05-27

Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.

High-density array-CGH with targeted NGS unmask multiple noncontiguous minute deletions on chromosome 3p21 in mesothelioma.

PubMed

Yoshikawa, Yoshie; Emi, Mitsuru; Hashimoto-Tamaoki, Tomoko; Ohmuraya, Masaki; Sato, Ayuko; Tsujimura, Tohru; Hasegawa, Seiki; Nakano, Takashi; Nasu, Masaki; Pastorino, Sandra; Szymiczek, Agata; Bononi, Angela; Tanji, Mika; Pagano, Ian; Gaudino, Giovanni; Napolitano, Andrea; Goparaju, Chandra; Pass, Harvey I; Yang, Haining; Carbone, Michele

2016-11-22

We used a custom-made comparative genomic hybridization array (aCGH; average probe interval 254 bp) to screen 33 malignant mesothelioma (MM) biopsies for somatic copy number loss throughout the 3p21 region (10.7 Mb) that harbors 251 genes, including BRCA1 (breast cancer 1)-associated protein 1 (BAP1), the most commonly mutated gene in MM. We identified frequent minute biallelic deletions (<3 kb) in 46 of 251 genes: four were cancer-associated genes: SETD2 (SET domain-containing protein 2) (7 of 33), BAP1 (8 of 33), PBRM1 (polybromo 1) (3 of 33), and SMARCC1 (switch/sucrose nonfermentable- SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily c, member 1) (2 of 33). These four genes were further investigated by targeted next-generation sequencing (tNGS), which revealed sequence-level mutations causing biallelic inactivation. Combined high-density aCGH and tNGS revealed biallelic gene inactivation in SETD2 (9 of 33, 27%), BAP1 (16 of 33, 48%), PBRM1 (5 of 33, 15%), and SMARCC1 (2 of 33, 6%). The incidence of genetic alterations detected is much higher than reported in the literature because minute deletions are not detected by NGS or commercial aCGH. Many of these minute deletions were not contiguous, but rather alternated with segments showing oscillating copy number changes along the 3p21 region. In summary, we found that in MM: (i) multiple minute simultaneous biallelic deletions are frequent in chromosome 3p21, where they occur as distinct events involving multiple genes; (ii) in addition to BAP1, mutations of SETD2, PBRM1, and SMARCC1 are frequent in MM; and (iii) our results suggest that high-density aCGH combined with tNGS provides a more precise estimate of the frequency and types of genes inactivated in human cancer than approaches based exclusively on NGS strategy.

DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects

PubMed Central

Gao, Wenming; Higaki, Takashi; Eguchi-Ishimae, Minenori; Iwabuki, Hidehiko; Wu, Zhouying; Yamamoto, Eiichi; Takata, Hidemi; Ohta, Masaaki; Imoto, Issei; Ishii, Eiichi; Eguchi, Mariko

2015-01-01

Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects. PMID:27081520

Recombination–deletion between homologous cassettes in retrovirus is suppressed via a strategy of degenerate codon substitution

PubMed Central

Im, Eung Jun; Bais, Anthony J; Yang, Wen; Ma, Qiangzhong; Guo, Xiuyang; Sepe, Steven M; Junghans, Richard P

2014-01-01

Transduction and expression procedures in gene therapy protocols may optimally transfer more than a single gene to correct a defect and/or transmit new functions to recipient cells or organisms. This may be accomplished by transduction with two (or more) vectors, or, more efficiently, in a single vector. Occasionally, it may be useful to coexpress homologous genes or chimeric proteins with regions of shared homology. Retroviridae include the dominant vector systems for gene transfer (e.g., gamma-retro and lentiviruses) and are capable of such multigene expression. However, these same viruses are known for efficient recombination–deletion when domains are duplicated within the viral genome. This problem can be averted by resorting to two-vector strategies (two-chain two-vector), but at a penalty to cost, convenience, and efficiency. Employing a chimeric antigen receptor system as an example, we confirm that coexpression of two genes with homologous domains in a single gamma-retroviral vector (two-chain single-vector) leads to recombination–deletion between repeated sequences, excising the equivalent of one of the chimeric antigen receptors. Here, we show that a degenerate codon substitution strategy in the two-chain single-vector format efficiently suppressed intravector deletional loss with rescue of balanced gene coexpression by minimizing sequence homology between repeated domains and preserving the final protein sequence. PMID:25419532

A 11.7-kb deletion triggers intersexuality and polledness in goats.

PubMed

Pailhoux, E; Vigier, B; Chaffaux, S; Servel, N; Taourit, S; Furet, J P; Fellous, M; Grosclaude, F; Cribiu, E P; Cotinot, C; Vaiman, D

2001-12-01

Mammalian sex determination is governed by the presence of the sex determining region Y gene (SRY) on the Y chromosome. Familial cases of SRY-negative XX sex reversal are rare in humans, often hampering the discovery of new sex-determining genes. The mouse model is also insufficient to correctly apprehend the sex-determination cascade, as the human pathway is much more sensitive to gene dosage. Other species might therefore be considered in this respect. In goats, the polled intersex syndrome (PIS) mutation associates polledness and intersexuality. The sex reversal affects exclusively the XX individuals in a recessive manner, whereas the absence of horns is dominant in both sexes. The syndrome is caused by an autosomal gene located at chromosome band 1q43 (ref. 9), shown to be homologous to human chromosome band 3q23 (ref. 10). Through a positional cloning approach, we demonstrate that the mutation underlying PIS is the deletion of a critical 11.7-kb DNA element containing mainly repetitive sequences. This deletion affects the transcription of at least two genes: PISRT1, encoding a 1.5-kb mRNA devoid of open reading frame (ORF), and FOXL2, recently shown to be responsible for blepharophimosis ptosis epicanthus inversus syndrome (BPES) in humans. These two genes are located 20 and 200 kb telomeric from the deletion, respectively.

Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population.

PubMed

Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki

2004-12-01

Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.

The emerging role of genomics in the diagnosis and workup of congenital urinary tract defects: a novel deletion syndrome on chromosome 3q13.31-22.1

PubMed Central

Materna-Kiryluk, Anna; Kiryluk, Krzysztof; Burgess, Katelyn E; Bieleninik, Arkadiusz; Sanna-Cherchi, Simone; Gharavi, Ali G.; Latos-Bielenska, Anna

2014-01-01

Background Copy number variants (CNVs) are increasingly recognized as an important cause of congenital malformations and likely explain over 16% cases of CAKUT. Here, we illustrate how a molecular diagnosis of CNV can inform the clinical management of a pediatric patient presenting with CAKUT and other organ defects. Methods We describe a 14 year-old girl with a large de novo deletion of chromosome 3q13.31-22.1 that disrupts 101 known genes and manifests with CAKUT, neurodevelopmental delay, agenesis of corpus callosum (ACC), cardiac malformations, electrolyte and endocrine disorders, skeletal abnormalities and dysmorphic features. We perform extensive annotation of the deleted region to prioritize genes for specific phenotypes and to predict future disease risk. Results Our case defined new minimal chromosomal candidate regions for both CAKUT and ACC. Moreover, the presence of the CASR gene in the deleted interval predicted a diagnosis of hypocalciuric hypercalcemia, which was confirmed by serum and urine chemistries. Our gene annotation explained clinical hypothyroidism and predicted that the index case is at increased risk of thoracic aortic aneurysm, renal cell carcinoma and myeloproliferative disorder. Conclusions Extended annotation of CNV regions refines diagnosis and uncovers previously unrecognized phenotypic features. This approach enables personalized treatment and prevention strategies in patients harboring genomic deletions. PMID:24292865

Deletion of a 760 kb region at 4p16 determines the prenatal and postnatal growth retardation characteristic of Wolf-Hirschhorn syndrome.

PubMed

Concolino, Daniela; Rossi, Elena; Strisciuglio, Pietro; Iembo, Maria Antonietta; Giorda, Roberto; Ciccone, Roberto; Tenconi, Romano; Zuffardi, Orsetta

2007-10-01

Recently the genotype/phenotype map of Wolf-Hirschhorn syndrome (WHS) has been refined, using small 4p deletions covering or flanking the critical region in patients showing only some of the WHS malformations. Accordingly, prenatal-onset growth retardation and failure to thrive have been found to result from haploinsufficiency for a 4p gene located between 0.4 and 1.3 Mb, whereas microcephaly results from haploinsufficiency of at least two different 4p regions, one of 2.2-2.38 Mb and a second one of 1.9-1.28 Mb. We defined the deletion size of a ring chromosome (r(4)) in a girl with prenatal onset growth retardation, severe failure to thrive and true microcephaly but without the WHS facial gestalt and mental retardation. A high-resolution comparative genome hybridisation array revealed a 760 kb 4p terminal deletion. This case, together with a familial 4p deletion involving the distal 400 kb reported in normal women, may narrow the critical region for short stature on 4p to 360-760 kb. This region is also likely to contain a gene for microcephaly. "In silico" analysis of all genes within the critical region failed to reveal any strikingly suggestive expression pattern; all genes remain candidates for short stature and microcephaly.

Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report

PubMed Central

de la Houssaye, Guillaume; Bieche, Ivan; Roche, Olivier; Vieira, Véronique; Laurendeau, Ingrid; Arbogast, Laurence; Zeghidi, Hatem; Rapp, Philippe; Halimi, Philippe; Vidaud, Michel; Dufier, Jean-Louis; Menasche, Maurice; Abitbol, Marc

2006-01-01

Background Axenfeld-Rieger syndrome (ARS) is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Case presentation Two members of this family (father and daughter) presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI) detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Conclusion Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments. PMID:17134502

Next-Generation Sequencing to Detect Deletion of RB1 and ERBB4 Genes in Chromophobe Renal Cell Carcinoma: A Potential Role in Distinguishing Chromophobe Renal Cell Carcinoma from Renal Oncocytoma.

PubMed

Liu, Qingqing; Cornejo, Kristine M; Cheng, Liang; Hutchinson, Lloyd; Wang, Mingsheng; Zhang, Shaobo; Tomaszewicz, Keith; Cosar, Ediz F; Woda, Bruce A; Jiang, Zhong

2018-04-01

Overlapping morphologic, immunohistochemical, and ultrastructural features make it difficult to diagnose chromophobe renal cell carcinoma (ChRCC) and renal oncocytoma (RO). Because ChRCC is a malignant tumor, whereas RO is a tumor with benign behavior, it is important to distinguish these two entities. We aimed to identify genetic markers that distinguish ChRCC from RO by using next-generation sequencing (NGS). NGS for hotspot mutations or gene copy number changes was performed on 12 renal neoplasms, including seven ChRCC and five RO cases. Matched normal tissues from the same patients were used to exclude germline variants. Rare hotspot mutations were found in cancer-critical genes (TP53 and PIK3CA) in ChRCC but not RO. The NGS gene copy number analysis revealed multiple abnormalities. The two most common deletions were tumor-suppressor genes RB1 and ERBB4 in ChRCC but not RO. Fluorescence in situ hybridization was performed on 65 cases (ChRCC, n = 33; RO, n = 32) to verify hemizygous deletion of RB1 (17/33, 52%) or ERBB4 (11/33, 33%) in ChRCC, but not in RO (0/32, 0%). In total, ChRCCs (23/33, 70%) carry either a hemizygous deletion of RB1 or ERBB4. The combined use of RB1 and ERBB4 fluorescence in situ hybridization to detect deletion of these genes may offer a highly sensitive and specific assay to distinguish ChRCC from RO. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Overexpression of ppc or deletion of mdh for improving production of γ-aminobutyric acid in recombinant Corynebacterium glutamicum.

PubMed

Shi, Feng; Zhang, Ming; Li, Yongfu

2017-06-01

L-Glutamate decarboxylase (GAD) transforms L-glutamate into γ-aminobutyric acid (GABA). Corynebacterium glutamicum that expresses exogenous GAD gene(s) can synthesize GABA from its own produced L-glutamate. To enhance GABA production in recombinant C. glutamicum strain SH, metabolic engineering strategies were used to improve the supply of the GABA precursor, L-glutamate. Five new strains were constructed here. First, the ppc gene was coexpressed with two GAD genes (gadB1 and gadB2). Then, the mdh gene was deleted in C. glutamicum SH. Next, gadB1-gadB2 and gadB1-gadB2-ppc co-expression plasmids were transformed into C. glutamicum strains SH and Δmdh, resulting in four recombinant GAD strains SE1, SE2, SDE1, and SDE2, respectively. Finally, the mdh gene was overexpressed in mdh-deleted SDE1, generating the mdh-complemented GAD strain SDE3. After fermenting for 72 h, GABA production increased to 26.3 ± 3.4, 24.8 ± 0.7, and 25.5 ± 3.3 g/L in ppc-overexpressed SE2, mdh-deleted SDE1, and mdh-deleted ppc-overexpressed SDE2, respectively, which was higher than that in the control GAD strain SE1 (22.7 ± 0.5 g/L). While in the mdh-complemented SDE3, GABA production decreased to 20.0 ± 0.6 g/L. This study demonstrates that the recombinant strains SE2, SDE1, and SDE2 can be used as candidates for GABA production.

Restricted pleiotropy facilitates mutational erosion of major life-history traits.

PubMed

Marek, Agnieszka; Korona, Ryszard

2013-11-01

Radical shifts to new natural and human made niches can make some functions unneeded and thus exposed to genetic degeneration. Here we ask not about highly specialized and rarely used functions but those relating to major life-history traits, rate of growth, and resistance to prolonged starvation. We found that in yeast each of the two traits was visibly impaired by at least several hundred individual gene deletions. There were relatively few deletions affecting negatively both traits and likely none harming one but improving the other. Functional profiles of gene deletions affecting either growth or survival were strikingly different: the first related chiefly to synthesis of macromolecules whereas the second to maintenance and recycling of cellular structures. The observed pattern of gene indispensability corresponds to that of gene induction, providing a rather rare example of agreement between the results of deletion and expression studies. We conclude that transitions to new environments in which the ability to grow at possibly fastest rate or survive under very long starvation become practically unnecessary can result in rapid erosion of these vital functions because they are coded by many genes constituting large mutational targets and because restricted pleiotropy is unlikely to constrain this process. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

Identification of a Novel De Novo Heterozygous Deletion in the SOX10 Gene in Waardenburg Syndrome Type II Using Next-Generation Sequencing.

PubMed

Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping

2017-11-01

Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.

DNA Fragmentation Factor 45 (DFF45) Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line1

PubMed Central

Yang, Hong Wei; Chen, Ying Zhang; Piao, Hui Ying; Takita, Junko; Soeda, Eiichi; Hayashi, Yasuhide

2001-01-01

Abstract Recently, loss of heterozygosity (LOH) studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p) in neuroblastoma (NB). To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45) gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT)-polymerase chain reaction (PCR) and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region. PMID:11420752

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

PubMed Central

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-01-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

PubMed

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

A putative APSES transcription factor is necessary for normal growth and development of Aspergillus nidulans.

PubMed

Lee, Ji-Yeon; Kim, Lee-Han; Kim, Ha-Eun; Park, Jae-Sin; Han, Kap-Hoon; Han, Dong-Min

2013-12-01

The nsdD gene encoding a GATA type transcription factor positively controls sexual development in Aspergillus nidulans. According to microarray data, 20 genes that were upregulated by deleting nsdD during various life cycle stages were randomly selected and deleted for functional analysis. None of the mutants showed apparent changes in growth or development compared with those of the wild-type except the AN3154 gene that encodes a putative APSES transcription factor and is an ortholog of Saccharomyces cerevisiae swi4. Deleting AN3154 resulted in retarded growth and development, and the gene was named rgdA (retared growth and development). The rgdA deletion mutant developed a reduced number of conidia even under favorable conditions for asexual development. The retarded growth and development was partially suppressed by the veA1 mutation. The conidial heads of the mutant aborted, showing reduced and irregular shaped phialides. Fruiting body development was delayed compared with that in the wild-type. The mutant did not respond to various nutritional or environmental factors that affected the development patterns. The rgdA gene was expressed at low levels throughout the life cycle and was not significantly affected by several regulators of sexual and asexual development such as nsdD, veA, stuA, or brlA. However, the rgdA gene affected brlA and abaA expression, which function as key regulators of asexual sporulation, suggesting that rgdA functions upstream of those genes.

RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia.

PubMed

Kamran, Shawana; Raca, Gordana; Nazir, Kamran

2015-01-01

The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL). The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9)(q23;q34). Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH) studies, and Chromosomal Microarray Analysis (CMA). The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9)(q24;q34) and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

PubMed Central

Kamran, Shawana; Nazir, Kamran

2015-01-01

The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL). The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9)(q23;q34). Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH) studies, and Chromosomal Microarray Analysis (CMA). The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9)(q24;q34) and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL. PMID:26600955

Nature of frequent deletions in CEBPA.

PubMed

Fuchs, Ota; Kostecka, Arnost; Provaznikova, Dana; Krasna, Blazena; Brezinova, Jana; Filkukova, Jitka; Kotlin, Roman; Kouba, Michal; Kobylka, Petr; Neuwirtova, Radana; Jonasova, Anna; Caniga, Miroslav; Schwarz, Jiri; Markova, Jana; Maaloufova, Jacqueline; Sponerova, Dana; Novakova, Ludmila; Cermak, Jaroslav

2009-01-01

C/EBPalpha (CCAAT/enhancer binding protein alpha) belongs to the family of leucine zipper transcription factors and is necessary for transcriptional control of granulocyte, adipocyte and hepatocyte differentiation, glucose metabolism and lung development. C/EBPalpha is encoded by an intronless gene. CEBPA mutations cause a myeloid differentiation block and were detected in acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), multiple myeloma and non-Hodgkin's lymphoma (NHL) patients. In this study we identified in 41 individuals from 824 screened individuals (290 AML patients, 382 MDS patients, 56 NHL patients and 96 healthy individuals) a single class of 23 deletions in CEBPA gene which involved a direct repeat of at least 2 bp. These mutations are characterised by the loss of one of two same repeats at the ends of deleted sequence. Three most frequent repeats included in these deletions in CEBPA gene are CGCGAG (493-498_865-870), GCCAAGCAGC (508-517_907-916) and GG (486-487_885-886), all according to GenBank accession no. NM_004364.2. A mechanism for deletion formation between two repetitive sequences can be recombination events in the repair process. Double-stranded cut in DNA can initiate these recombination events of adjacent DNA sequences.

A novel deletion of SNURF/SNRPN exon 1 in a patient with Prader-Willi-like phenotype.

PubMed

Cao, Yang; AlHumaidi, Susan S; Faqeih, Eissa A; Pitel, Beth A; Lundquist, Patrick; Aypar, Umut

2017-08-01

Here we report the smallest deletion involving SNURF/SNRPN that causes major symptoms of Prader-Willi syndrome (PWS), including hypotonia, dysmorphic features, intellectual disability, and obesity. A female patient with the aforementioned and additional features was referred to the Mayo Clinic Cytogenetics laboratory for genetic testing. Chromosomal microarray analysis and subsequent Sanger sequencing identified a de novo 6.4 kb deletion at 15q11.2, containing exon 1 of the SNURF gene and exon 1 of the shortest isoform of the SNRPN gene. SNURF/SNRPN exon 1, which is methylated on the silent maternal allele, is associated with acetylated histones on the expressed paternal allele. This region also overlaps with the PWS-imprinting center (IC). Subsequent molecular methylation analysis was performed using methylation-specific MLPA (MS-MLPA), which characterized that the deletion of SNURF/SNRPN exon 1 was paternal in origin, consistent with the PWS-like phenotype. Since SNURF/SNRPN gene and the PWS-IC are known to regulate snoRNAs, it is likely that the PWS-like phenotype observed in patients with paternal SNURF/SNRPN deletion is due to the disrupted expression of SNORD116 snoRNAs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

21 CFR 1301.77 - Security controls for freight forwarding facilities.

Code of Federal Regulations, 2010 CFR

2010-04-01

... subject to continuous monitoring by security personnel will be deemed to meet the requirements of Section... forwarding facility must be packed in sealed, unmarked shipping containers. [65 FR 44678, July 19, 2000; 65...

21 CFR 1301.77 - Security controls for freight forwarding facilities.

Code of Federal Regulations, 2012 CFR

2012-04-01

... subject to continuous monitoring by security personnel will be deemed to meet the requirements of Section... forwarding facility must be packed in sealed, unmarked shipping containers. [65 FR 44678, July 19, 2000; 65...

21 CFR 1301.77 - Security controls for freight forwarding facilities.

Code of Federal Regulations, 2013 CFR

2013-04-01

... subject to continuous monitoring by security personnel will be deemed to meet the requirements of Section... forwarding facility must be packed in sealed, unmarked shipping containers. [65 FR 44678, July 19, 2000; 65...

21 CFR 1301.77 - Security controls for freight forwarding facilities.

Code of Federal Regulations, 2011 CFR

2011-04-01

... subject to continuous monitoring by security personnel will be deemed to meet the requirements of Section... forwarding facility must be packed in sealed, unmarked shipping containers. [65 FR 44678, July 19, 2000; 65...

21 CFR 1301.77 - Security controls for freight forwarding facilities.

Code of Federal Regulations, 2014 CFR

2014-04-01

... subject to continuous monitoring by security personnel will be deemed to meet the requirements of Section... forwarding facility must be packed in sealed, unmarked shipping containers. [65 FR 44678, July 19, 2000; 65...

Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

1993-07-01

A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

William's syndrome: gene expression is related to parental origin and regional coordinate control

PubMed Central

Collette, Jeremy C; Chen, Xiao-Ning; Mills, Debra L; Galaburda, Albert M; Reiss, Allan L; Bellugi, Ursula; Korenberg, Julie R

2013-01-01

William's syndrome (WS) features a spectrum of neurocognitive and behavioral abnormalities due to a rare 1.5MB deletion that includes about 24–28 genes on chromosome band 7q11.23. Study of the expression of these genes from the single normal copy provides an opportunity to elucidate the genetic and epigenetic controls on these genes as well as their roles in both WS and normal brain development and function. We used quantitative RT-PCR to determine the transcriptional level of 14 WS gene markers in a cohort of 77 persons with WS and 48 normal controls. Results reported here: (1) show that the expression of the genes deleted in WS is decreased in some but not all cases, (2) demonstrate that the parental origin of the deletion contributes to the level of expression of GTF2I independently of age and gender and (3) indicate that the correlation of expression between GTF2I and some other genes in the WS region differs in WS subjects and normal controls, which in turn points toward a regulatory role for this gene. Interspecies comparisons suggest GTF2I may play a key role in normal brain development. PMID:19282872

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

PubMed Central

Prontera, Paolo; Rogaia, Daniela; Mencarelli, Amedea; Ottaviani, Valentina; Guercini, Giorgio; Bersano, Anna; Stangoni, Gabriela

2017-01-01

Moyamoya angiopathy (MA) is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735). Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1). In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA. PMID:28926972

Rv3852 (H-NS) of Mycobacterium tuberculosis Is Not Involved in Nucleoid Compaction and Virulence Regulation.

PubMed

Odermatt, Nina T; Sala, Claudia; Benjak, Andrej; Kolly, Gaëlle S; Vocat, Anthony; Lupien, Andréanne; Cole, Stewart T

2017-08-15

A handful of nucleoid-associated proteins (NAPs) regulate the vast majority of genes in a bacterial cell. H-NS, the h istone-like n ucleoid- s tructuring protein, is one of these NAPs and protects Escherichia coli from foreign gene expression. Though lacking any sequence similarity with E. coli H-NS, Rv3852 was annotated as the H-NS ortholog in Mycobacterium tuberculosis , as it resembles human histone H1. The role of Rv3852 was thoroughly investigated by immunoblotting, subcellular localization, construction of an unmarked rv3852 deletion in the M. tuberculosis genome, and subsequent analysis of the resulting Δ rv3852 strain. We found that Rv3852 was predominantly present in the logarithmic growth phase with a decrease in protein abundance in stationary phase. Furthermore, it was strongly associated with the cell membrane and not detected in the cytosolic fraction, nor was it secreted. The Δ rv3852 strain displayed no growth defect or morphological abnormalities. Quantitative measurement of nucleoid localization in the Δ rv3852 mutant strain compared to that in the parental H37Rv strain showed no difference in nucleoid position or spread. Infection of macrophages as well as severe combined immunodeficient (SCID) mice demonstrated that loss of Rv3852 had no detected influence on the virulence of M. tuberculosis We thus conclude that M. tuberculosis Rv3852 is not involved in pathogenesis and is not a typical NAP. The existence of an as yet undiscovered Rv3852 ortholog cannot be excluded, although this role is likely played by the well-characterized Lsr2 protein. IMPORTANCE Mycobacterium tuberculosis is the causative agent of the lung infection tuberculosis, claiming more than 1.5 million lives each year. To understand the mechanisms of latent infection, where M. tuberculosis can stay dormant inside the human host, we require deeper knowledge of the basic biology and of the regulatory networks. In our work, we show that Rv3852, previously annotated as H-NS, is not a typical nucleoid-associated protein (NAP) as expected from its initial annotation. Rv3852 from M. tuberculosis has neither influence on nucleoid shape or compaction nor a role in virulence. Our findings reduce the repertoire of identified nucleoid-associated proteins in M. tuberculosis to four transcription regulators and underline the importance of genetic studies to assign a function to bacterial genes. Copyright © 2017 American Society for Microbiology.

A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion

PubMed Central

Viñas-Jornet, Marina; Esteba-Castillo, Susanna; Gabau, Elisabeth; Ribas-Vidal, Núria; Baena, Neus; San, Joan; Ruiz, Anna; Coll, Maria Dolors; Novell, Ramon; Guitart, Miriam

2014-01-01

Deletions in the 2p16.3 region that includes the neurexin (NRXN1) gene are associated with intellectual disability and various psychiatric disorders, in particular, autism and schizophrenia. We present three unrelated patients, two adults and one child, in whom we identified an intragenic 2p16.3 deletion within the NRXN1 gene using an oligonucleotide comparative genomic hybridization array. The three patients presented dual diagnosis that consisted of mild intellectual disability and autism and bipolar disorder. Also, they all shared a dysmorphic phenotype characterized by a long face, deep set eyes, and prominent premaxilla. Genetic analysis of family members showed two inherited deletions. A comprehensive neuropsychological examination of the 2p16.3 deletion carriers revealed the same phenotype, characterized by anxiety disorder, borderline intelligence, and dysexecutive syndrome. The cognitive pattern of dysexecutive syndrome with poor working memory and reduced attention switching, mental flexibility, and verbal fluency was the same than those of the adult probands. We suggest that in addition to intellectual disability and psychiatric disease, NRXN1 deletion is a risk factor for a characteristic cognitive and dysmorphic profile. The new cognitive phenotype found in the 2p16.3 deletion carriers suggests that 2p16.3 deletions might have a wide variable expressivity instead of incomplete penetrance. PMID:25614873

Usefulness of MLPA in the detection of SHOX deletions.

PubMed

Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

2010-01-01

SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

In vivo DNA deletion assay to detect environmental and genetic predisposition to cancer.

PubMed

Reliene, Ramune; Bishop, Alexander J R; Aubrecht, Jiri; Schiestl, Robert H

2004-01-01

Large-scale genomic rearrangements such as DNA deletions play a role in the etiology of cancer. The frequency of DNA deletions can be elevated by exposure to carcinogens or by mutations in genes involved in the maintenance of genomic integrity. The in vivo DNA deletion assay allows a visual detection of deletion events within the pink-eyed unstable (pun) locus in developing mouse embryos. A deletion of one copy of a duplicated 70-kb DNA fragment within the pun locus restores the pink-eyed dilute (p) gene, which encodes a protein responsible for the assembly of a black color melanin complex. Deletion events occurring in premelanocytes cause visible black patches (fur-spots) on the light gray fur of offspring and black pigmented cells (eye-spots) on the unpigmented retinal pigment epithelium (RPE). In the fur-spot assay, 10-d-old pups are observed for black spots on the fur. In the eye-spot assay, mice are sacrificed at d 20, eyes are removed, and the wholemount RPE slides are prepared for eye-spot analysis. The frequency, size, and position relative to the optic nerve of the eye-spots are determined. This assay can be used to study the effect of environmental chemicals and physical agents as well as the genetic control of DNA deletions in vivo.

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

Recurrent Deletions and Reciprocal Duplications of 10q11.21q11.23 Including CHAT and SLC18A3 are Likely Mediated by Complex Low-Copy Repeats

PubMed Central

Stankiewicz, Paweł; Kulkarni, Shashikant; Dharmadhikari, Avinash V.; Sampath, Srirangan; Bhatt, Samarth S.; Shaikh, Tamim H.; Xia, Zhilian; Pursley, Amber N.; Cooper, M. Lance; Shinawi, Marwan; Paciorkowski, Alex R.; Grange, Dorothy K.; Noetzel, Michael J.; Saunders, Scott; Simons, Paul; Summar, Marshall; Lee, Brendan; Scaglia, Fernando; Fellmann, Florence; Martinet, Danielle; Beckmann, Jacques S.; Asamoah, Alexander; Platky, Kathryn; Sparks, Susan; Martin, Ann S.; Madan-Khetarpal, Suneeta; Hoover, Jacqueline; Medne, Livija; Bonnemann, Carsten G.; Moeschler, John B.; Vallee, Stephanie E.; Parikh, Sumit; Irwin, Polly; Dalzell, Victoria P.; Smith, Wendy E.; Banks, Valerie C.; Flannery, David B.; Lovell, Carolyn M.; Bellus, Gary A.; Golden-Grant, Kathryn; Gorski, Jerome L.; Kussmann, Jennifer L.; McGregor, Tracy L.; Hamid, Rizwan; Pfotenhauer, Jean; Ballif, Blake C.; Shaw, Chad A.; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Rosenfeld, Jill A.; Cheung, Sau Wai; Shaffer, Lisa G.

2013-01-01

We report 24 unrelated individuals with deletions and 17 additional cases with duplications at 10q11.21q21.1 identified by chromosomal microarray analysis. The rearrangements range in size from 0.3 to 12 Mb. Nineteen of the deletions and eight duplications are flanked by large, directly oriented segmental duplications of >98% sequence identity, suggesting that nonallelic homologous recombination (NAHR) caused these genomic rearrangements. Nine individuals with deletions and five with duplications have additional copy number changes. Detailed clinical evaluation of 20 patients with deletions revealed variable clinical features, with developmental delay (DD) and/or intellectual disability (ID) as the only features common to a majority of individuals. We suggest that some of the other features present in more than one patient with deletion, including hypotonia, sleep apnea, chronic constipation, gastroesophageal and vesicoureteral refluxes, epilepsy, ataxia, dysphagia, nystagmus, and ptosis may result from deletion of the CHAT gene, encoding choline acetyltransferase, and the SLC18A3 gene, mapping in the first intron of CHAT and encoding vesicular acetylcholine transporter. The phenotypic diversity and presence of the deletion in apparently normal carrier parents suggest that subjects carrying 10q11.21q11.23 deletions may exhibit variable phenotypic expressivity and incomplete penetrance influenced by additional genetic and nongenetic modifiers. PMID:21948486

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Identification of MICA alleles with a long Leu-repeat in the transmembrane region and no cytoplasmic tail due to a frameshift-deletion in exon 4.

PubMed

Obuchi, N; Takahashi, M; Nouchi, T; Satoh, M; Arimura, T; Ueda, K; Akai, J; Ota, M; Naruse, T; Inoko, H; Numano, F; Kimura, A

2001-06-01

MHC class I chain-related gene A (MICA) is located close to HLA-B gene and expressed in epithelial cells. The MICA gene is reported to be highly polymorphic as are the classical class I genes. To further assess the polymorphism in the MICA gene, we analyzed a total of 60 HLA-homozygous cells for the sequences spanning exons 2-6. In the analysis, four new MICA alleles were identified and six variations were recognized in exon 6. MICA*017, which was identified in three HLA-B57 homozygous cells (DBB, DEM and WIN), differed from MICA*002 in exon 3 and had a guanine deletion at the 3' end of exon 4. MICA*015 identified in an HLA-B45 homozygous cell (OMW) also had the same deletion that causes a frameshift mutation resulting in complete change of the transmembrane region and premature termination in the cytoplasmic tail; these alleles have a long hydrophobic leucine-rich region instead of the alanine repeat in the transmembrane region and terminate at the second position in the cytoplasmic domain. The frameshift deletion was found only in HLA-B45- or -B57-positive panels tested, suggesting a strong linkage disequilibrium between the deletion and B45 or B57. MICA*048, which was different in exon 5 from MICA*008, was identified in an HLA-B61 homozygous cell (TA21), while MICA*00901 identified in HLA-B51 homozygous cells (LUY and KT2) was distinguished from MICA*009 by exon 6.

A 5-year-old white girl with Prader-Willi syndrome and a submicroscopic deletion of chromosome 15q11q13.

PubMed

Butler, M G; Christian, S L; Kubota, T; Ledbetter, D H

1996-10-16

We report on a 5-year-old white girl with Prader-Willi syndrome (PWS) and a submicroscopic deletion of 15q11q13 of approximately 100-200 kb in size. High resolution chromosome analysis was normal but fluorescence in situ hybridization (FISH), Southern hybridization, and microsatellite data from the 15q11q13 region demonstrated that the deletion was paternal in origin and included the SNRPN, PAR-5, and PAR-7 genes from the proximal to distal boundaries of the deletion segment. SNRPN and PW71B methylation studies showed an abnormal pattern consistent with the diagnosis of PWS and supported the presence of a paternal deletion of 15q11q13 or an imprinting mutation. Biparental (normal) inheritance of PW71B (D15S63 locus) and a deletion of the SNRPN gene were observed by microsatellite, quantitative Southern hybridization, and/or FISH analyses. Our patient met the diagnostic criteria for PWS, but has no reported behavior problems, hyperphagia, or hypopigmentation. Our patient further supports SNRPN and possibly other genomic sequences which are deleted as the cause of the phenotype recognized in PWS patients.

Generation of megabase-scale deletions, inversions and duplications involving the Contactin-6 gene in mice by CRISPR/Cas9 technology.

PubMed

Korablev, Alexei N; Serova, Irina A; Serov, Oleg L

2017-12-28

Copy Number Variation (CNV) of the human CNTN6 gene (encoding the contactin-6 protein), caused by deletions or duplications, is responsible for severe neurodevelopmental impairments, often in combination with facial dysmorphias. Conversely, deleterious point mutations of this gene do not show any clinical phenotypes. The aim of this study is to generate mice carrying large deletions, duplications and inversions involving the Cntn6 gene as a new experimental model to study CNV of the human CNTN6 locus. To generate large chromosomal rearrangements on mouse chromosome 6, we applied CRISPR/Cas9 technology in zygotes. Two guide RNAs (gRNAs) (flanking a DNA fragment of 1137 Mb) together with Cas9 mRNA and single-stranded DNA oligonucleotides (ssODN) were microinjected into the cytoplasm of 599 zygotes of F1 (C57BL x CBA) mice, and 256 of them were transplanted into oviducts of CD-1 females. As a result, we observed the birth of 41 viable F0 offspring. Genotyping of these mice was performed by PCR analysis and sequencing of PCR products. Among the 41 F0 offspring, we identified seven mice with deletions, two animals carrying duplications of the gene and four carrying inversions. Interestingly, two F0 offspring had both deletions and duplications. It is important to note that while three of seven deletion carriers showed expected sequences at the new joint sites, in another three, we identified an absence of 1-10 nucleotides at the CRISPR/Cas9 cut sites, and in one animal, 103 bp were missing, presumably due to error-prone non-homologous end joining. In addition, we detected the absence of 5 and 13 nucleotides at these sites in two F0 duplication carriers. Similar sequence changes at CRISPR/Cas9 cut sites were observed at the right and left boundaries of inversions. Thus, megabase-scale deletions, duplications and inversions were identified in 11 F0 offspring among 41 analyzed, i.e., approximately 25% efficiency. All genetically modified F0 offspring were viable and able to transmit these large chromosomal rearrangements to the next generation. Using CRISPR/Cas9 technology, we created mice carrying megabase-scale deletions, duplications, and inversions involving the full-sized Cntn6 gene. These mice became founders of new mouse lines, which may be more appropriate experimental models of CNV in the human 3p26.3 region than Сntn6 knockout mice.

Impact of enhancin genes on potency of LdNPV in gypsy moth

Treesearch

Kelli Hoover; Jim McNeil; Alyssa Gendron; James. Slavicek

2011-01-01

Lymantria dispar nucleopolyhedrovirus (LdNPV) contains two enhancin genes (E1 and E2) encoding proteases that degrade key peritrophic matrix (PM) proteins, thereby promoting infection and mortality by the virus. In a previous study, gypsy moth larvae inoculated with LdNPV in which both E1 and E2 were deleted (double deletion virus) resulted in a non-...

Novel contiguous gene deletion in peruvian girl with Trichothiodystrophy type 4 and glutaric aciduria type 3.

PubMed

La Serna-Infantes, Jorge; Pastor, Miguel Chávez; Trubnykova, Milana; Velásquez, Félix Chavesta; Sotomayor, Flor Vásquez; Barriga, Hugo Abarca

2018-07-01

Trichothiodystrophy type 4 is a rare autosomal recessive and ectodermal disorder, characterized by dry, brittle, sparse and sulfur-deficient hair and other features like intellectual disability, ichthyotic skin and short stature, caused by a homozygous mutation in MPLKIP gene. Glutaric aciduria type 3 is caused by a homozygous mutation in SUGCT gene with no distinctive phenotype. Both genes are localized on chromosome 7 (7p14). We report an 8-year-old female with short stature, microcephaly, development delay, intellectual disability and hair characterized for dark, short, coarse, sparse and brittle associated to classical trichorrhexis microscopy pattern. Chromosome microarray analysis showed a 125 kb homozygous pathogenic deletion, which includes genes MPLKIP and SUGCT, not described before. This is the first case described in Peru of a novel contiguous gene deletion of Trichothiodystrophy type 4 and Glutaric aciduria type 3 performed by chromosome microarray analysis, highlighting the contribution and importance of molecular technologies on diagnosis of rare genetic conditions. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

PubMed Central

de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

2008-01-01

We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

Deletion of a Stay-Green Gene Associates with Adaptive Selection in Brassica napus.

PubMed

Qian, Lunwen; Voss-Fels, Kai; Cui, Yixin; Jan, Habib U; Samans, Birgit; Obermeier, Christian; Qian, Wei; Snowdon, Rod J

2016-12-05

Chlorophyll levels provide important information about plant growth and physiological plasticity in response to changing environments. The stay-green gene NON-YELLOWING 1 (NYE1) is believed to regulate chlorophyll degradation during senescence, concomitantly affecting the disassembly of the light-harvesting complex and hence indirectly influencing photosynthesis. We identified Brassica napus accessions carrying an NYE1 deletion associated with increased chlorophyll content, and with upregulated expression of light-harvesting complex and photosynthetic reaction center (PSI and PSII) genes. Comparative analysis of the seed oil content of accessions with related genetic backgrounds revealed that the B. napus NYE1 gene deletion (bnnye1) affected oil accumulation, and linkage disequilibrium signatures suggested that the locus has been subject to artificial selection by breeding in oilseed B. napus forms. Comparative analysis of haplotype diversity groups (haplogroups) between three different ecotypes of the allopolyploid B. napus and its A-subgenome diploid progenitor, Brassica rapa, indicated that introgression of the bnnye1 deletion from Asian B. rapa into winter-type B. napus may have simultaneously improved its adaptation to cooler environments experienced by autumn-sown rapeseed. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

PubMed Central

González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

1997-01-01

AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

Germ-Line Recombination Activity of the Widely Used hGFAP-Cre and Nestin-Cre Transgenes

PubMed Central

Zhang, Jiong; Dublin, Pavel; Griemsmann, Stephanie; Klein, Alexandra; Brehm, Ralph; Bedner, Peter; Fleischmann, Bernd K.; Steinhäuser, Christian; Theis, Martin

2013-01-01

Herein we demonstrate with PCR, immunodetection and reporter gene approaches that the widely used human Glial Fibrillary Acidic Protein (hGFAP)-Cre transgene exhibits spontaneous germ-line recombination activity in leading to deletion in brain, heart and tail tissue with high frequency. The ectopic activity of hGFAP-Cre requires a rigorous control. We likewise observed that a second widely used nestin-Cre transgene shows germ-line deletion. Here we describe procedures to identify mice with germ-line recombination mediated by the hGFAP-Cre and nestin-Cre transgenes. Such control is essential to avoid pleiotropic effects due to germ-line deletion of loxP-flanked target genes and to maintain the CNS-restricted deletion status in transgenic mouse colonies. PMID:24349371

Genome Engineering in Bacillus anthracis Using Cre Recombinase

PubMed Central

Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

2006-01-01

Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate.

PubMed

Zhang, Z; Cavalier-Smith, T; Green, B R

2001-08-01

Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.

Oligonucleotide DNA microarray profiling of lung adenocarcinoma revealed significant downregulation and deletions of vasoactive intestinal peptide receptor 1.

PubMed

Mlakar, Vid; Strazisar, Mojca; Sok, Mihael; Glavac, Damjan

2010-06-01

The purpose of this study was to find novel gene(s) involved in the development of lung adenocarcinoma (AD). Using DNA microarrays, we identified 31 up-regulated and 8 downregulated genes in 12 AD. Real time PCR was used to measure expression of VIPR1 and SPP1 mRNA and possible losses or gains of genes in 32 AD. We describe significant upregulation of the SPP1 gene, downregulation of VIPR1, and losses of the VIPR1 gene. Our findings complement a proposed VIPR1 tumor suppressor role, in which deletions in the 3p22 chromosome region are an important mechanism leading to loss of the VIPR1 gene.

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

Complex mosaic CDKL5 deletion with two distinct mutant alleles in a 4-year-old girl.

PubMed

Boutry-Kryza, Nadia; Ville, Dorothée; Labalme, Audrey; Calender, Alain; Dupont, Jean-Michel; Touraine, Renaud; Edery, Patrick; des Portes, Vincent; Sanlaville, Damien; Lesca, Gaetan

2014-08-01

Mutations of the CDKL5 gene cause early epileptic encephalopathy. Patients manifest refractory epilepsy, beginning before the age of 3 months, which is associated with severe psychomotor delay and features that overlap with Rett syndrome. We report here a patient with mosaicism for CDKL5 exonic deletion, with the presence of two mutant alleles. The affected 4-year-old girl presented with infantile spasms, beginning at the age of 9 months, but subsequent progression of the disease was consistent with the classical CDKL5-related phenotype. A deletion of exons 17 and 18 was suspected on the basis of Multiplex Ligation Probe Amplification analysis, but unexpected results for cDNA analysis, which showed the presence of an abnormal transcript with the deletion of exon 18 only, led us to suspect that two distinct events might have occurred. We used custom array-CGH to determine the size and breakpoints of these deletions. Exon 18 was deleted from one of the abnormal alleles, and exon 17 was deleted from the other. A Fork Stalling and Template Switching (FoSTeS) mechanism was proposed to explain the two events, given the presence of regions of microhomology at the breakpoints. We propose here an original involvement of the FoSTeS mechanism to explain the co-occurrence of these two events in the CDKL5 gene in a single patient. This patient highlights the difficulties involved in the detection of such abnormalities, particularly when they occur in a mosaic state and involve two distinct mutational events in a single gene. © 2014 Wiley Periodicals, Inc.

NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

PubMed Central

Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

2000-01-01

Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

Targeted exome sequencing and chromosomal microarray for the molecular diagnosis of nevoid basal cell carcinoma syndrome.

PubMed

Matsudate, Yoshihiro; Naruto, Takuya; Hayashi, Yumiko; Minami, Mitsuyoshi; Tohyama, Mikiko; Yokota, Kenji; Yamada, Daisuke; Imoto, Issei; Kubo, Yoshiaki

2017-06-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder mainly caused by heterozygous mutations of PTCH1. In addition to characteristic clinical features, detection of a mutation in causative genes is reliable for the diagnosis of NBCCS; however, no mutations have been identified in some patients using conventional methods. To improve the method for the molecular diagnosis of NBCCS. We performed targeted exome sequencing (TES) analysis using a multi-gene panel, including PTCH1, PTCH2, SUFU, and other sonic hedgehog signaling pathway-related genes, based on next-generation sequencing (NGS) technology in 8 cases in whom possible causative mutations were not detected by previously performed conventional analysis and 2 recent cases of NBCCS. Subsequent analysis of gross deletion within or around PTCH1 detected by TES was performed using chromosomal microarray (CMA). Through TES analysis, specific single nucleotide variants or small indels of PTCH1 causing inferred amino acid changes were identified in 2 novel cases and 2 undiagnosed cases, whereas gross deletions within or around PTCH1, which are validated by CMA, were found in 3 undiagnosed cases. However, no mutations were detected even by TES in 3 cases. Among 3 cases with gross deletions of PTCH1, deletions containing the entire PTCH1 and additional neighboring genes were detected in 2 cases, one of which exhibited atypical clinical features, such as severe mental retardation, likely associated with genes located within the 4.3Mb deleted region, especially. TES-based simultaneous evaluation of sequences and copy number status in all targeted coding exons by NGS is likely to be more useful for the molecular diagnosis of NBCCS than conventional methods. CMA is recommended as a subsequent analysis for validation and detailed mapping of deleted regions, which may explain the atypical clinical features of NBCCS cases. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

Efficient generation of mutations mediated by CRISPR/Cas9 in the hairy root transformation system of Brassica carinata.

PubMed

Kirchner, Thomas W; Niehaus, Markus; Debener, Thomas; Schenk, Manfred K; Herde, Marco

2017-01-01

A protocol for the induction of site-directed deletions and insertions in the genome of Brassica carinata with CRISPR is described. The construct containing the Cas9 nuclease and the guide RNA (gRNA) was delivered by the hairy root transformation technique, and a successful transformation was monitored by GFP fluorescence. PAGE analysis of an amplified region, presumably containing the deletions and insertions, demonstrated up to seven different indels in one transgenic root and in all analyzed roots a wildtype allele of the modified gene was not detectable. Interestingly, many of these mutations consisted of relatively large indels with up to 112 bp. The exact size of the deletions was determined to allow an estimation whether the targeted gene was not functional due to a considerable deletion or a frame shift within the open reading frame. This allowed a direct phenotypic assessment of the previously characterized roots and, in fact, deletions in FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 1 (BcFLA1)-a gene with an expression pattern consistent with a role in root hair architecture-resulted in shorter root hairs compared to control roots ectopically expressing an allele of the gene that cannot be targeted by the gRNA in parallel to the CRISPR construct. As an additional line of evidence, we monitored BcFLA1 expression with qPCR and detected a significant reduction of the transcript in roots with an active CRISPR construct compared to the control, although residual amounts of the transcript were detected, possibly due to inefficient nonsense-mediated mRNA decay. Additionally, the presence of deletions and insertions were verified by Sanger sequencing of the respective amplicons. In summary we demonstrate the successful application of CRISPR/Cas9 in hairy roots of B. carinata, the proof of its effectiveness and its effect on the root hair phenotype. This study paves the way for experimental strategies involving the phenotypic assessment of gene lesions by CRISPR which do not require germline transmission.

Signaling pathways coordinating the alkaline pH response confer resistance to the hevein-type plant antimicrobial peptide Pn-AMP1 in Saccharomyces cerevisiae.

PubMed

Kwon, Youngho; Chiang, Jennifer; Tran, Grant; Giaever, Guri; Nislow, Corey; Hahn, Bum-Soo; Kwak, Youn-Sig; Koo, Ja-Choon

2016-12-01

Genome-wide screening of Saccharomyces cerevisiae revealed that signaling pathways related to the alkaline pH stress contribute to resistance to plant antimicrobial peptide, Pn-AMP1. Plant antimicrobial peptides (AMPs) are considered to be promising candidates for controlling phytopathogens. Pn-AMP1 is a hevein-type plant AMP that shows potent and broad-spectrum antifungal activity. Genome-wide chemogenomic screening was performed using heterozygous and homozygous diploid deletion pools of Saccharomyces cerevisiae as a chemogenetic model system to identify genes whose deletion conferred enhanced sensitivity to Pn-AMP1. This assay identified 44 deletion strains with fitness defects in the presence of Pn-AMP1. Strong fitness defects were observed in strains with deletions of genes encoding components of several pathways and complex known to participate in the adaptive response to alkaline pH stress, including the cell wall integrity (CWI), calcineurin/Crz1, Rim101, SNF1 pathways and endosomal sorting complex required for transport (ESCRT complex). Gene ontology (GO) enrichment analysis of these genes revealed that the most highly overrepresented GO term was "cellular response to alkaline pH". We found that 32 of the 44 deletion strains tested (72 %) showed significant growth defects compared with their wild type at alkaline pH. Furthermore, 9 deletion strains (20 %) exhibited enhanced sensitivity to Pn-AMP1 at ambient pH compared to acidic pH. Although several hundred plant AMPs have been reported, their modes of action remain largely uncharacterized. This study demonstrates that the signaling pathways that coordinate the adaptive response to alkaline pH also confer resistance to a hevein-type plant AMP in S. cerevisiae. Our findings have broad implications for the design of novel and potent antifungal agents.

The SH3 and cysteine-rich domain 3 (Stac3) gene is important to growth, fiber composition, and calcium release from the sarcoplasmic reticulum in postnatal skeletal muscle.

PubMed

Cong, Xiaofei; Doering, Jonathan; Mazala, Davi A G; Chin, Eva R; Grange, Robert W; Jiang, Honglin

2016-01-01

The SH3 and cysteine-rich domain 3 (Stac3) gene is specifically expressed in the skeletal muscle. Stac3 knockout mice die perinatally. In this study, we determined the potential role of Stac3 in postnatal skeletal muscle growth, fiber composition, and contraction by generating conditional Stac3 knockout mice. We disrupted the Stac3 gene in 4-week-old male mice using the Flp-FRT and tamoxifen-inducible Cre-loxP systems. RT-qPCR and western blotting analyses of the limb muscles of target mice indicated that nearly all Stac3 mRNA and more than 70 % of STAC3 protein were deleted 4 weeks after tamoxifen injection. Postnatal Stac3 deletion inhibited body and limb muscle mass gains. Histological staining and gene expression analyses revealed that postnatal Stac3 deletion decreased the size of myofibers and increased the percentage of myofibers containing centralized nuclei, with no effect on the total myofiber number. Grip strength and grip time tests indicated that postnatal Stac3 deletion decreased limb muscle strength in mice. Muscle contractile tests revealed that postnatal Stac3 deletion reduced electrostimulation-induced but not the ryanodine receptor agonist caffeine-induced maximal force output in the limb muscles. Calcium imaging analysis of single flexor digitorum brevis myofibers indicated that postnatal Stac3 deletion reduced electrostimulation- but not caffeine-induced calcium release from the sarcoplasmic reticulum. This study demonstrates that STAC3 is important to myofiber hypertrophy, myofiber-type composition, contraction, and excitation-induced calcium release from the sarcoplasmic reticulum in the postnatal skeletal muscle.

Role of p53, Mitochondrial DNA Deletions, and Paternal Age in Autism: A Case-Control Study

PubMed Central

Wong, Sarah; Napoli, Eleonora; Krakowiak, Paula; Tassone, Flora; Hertz-Picciotto, Irva

2016-01-01

BACKGROUND: The tumor suppressor p53 responds to a variety of environmental stressors by regulating cell cycle arrest, apoptosis, senescence, DNA repair, bioenergetics and mitochondrial DNA (mtDNA) copy number maintenance. Developmental abnormalities have been reported in p53-deficient mice, and altered p53 and p53-associated pathways in autism (AU). Furthermore, via the Pten-p53 crosstalk, Pten haploinsufficient-mice have autisticlike behavior accompanied by brain mitochondrial dysfunction with accumulation of mtDNA deletions. METHODS: mtDNA copy number and deletions, and p53 gene copy ratios were evaluated in peripheral blood monocytic cells from children aged 2–5 years with AU (n = 66), race-, gender-, and age-matched typically neurodeveloping children (n = 46), and both parents from each diagnostic group, recruited by the Childhood Autism Risk from Genes and Environment study at the University of California, Davis. RESULTS: mtDNA deletions and higher p53 gene copy ratios were more common in children with AU and their fathers. The incidence of mtDNA deletions in fathers of children with AU was increased 1.9-fold over fathers of typically neurodeveloping children, suggesting a role for deficient DNA repair capacity not driven by paternal age. Deletions in mtDNA and altered p53 gene copy ratios seem to result from genetics (children with severity scores ≥8) and/or act in concert with environmental factors (children with 6–7 severity scores). CONCLUSIONS: Given pro- and antioxidant activities of p53, and associations of genomic instability with disorders other than AU, our study suggests a link between DNA repair capacity, genomic instability in the 17p13.1 region influenced by environmental triggers, and AU diagnosis. PMID:27033107

Deletion of alpha-synuclein decreases impulsivity in mice.

PubMed

Peña-Oliver, Y; Buchman, V L; Dalley, J W; Robbins, T W; Schumann, G; Ripley, T L; King, S L; Stephens, D N

2012-03-01

The presynaptic protein alpha-synuclein, associated with Parkinson's Disease (PD), plays a role in dopaminergic neurotransmission and is implicated in impulse control disorders (ICDs) such as drug addiction. In this study we investigated a potential causal relationship between alpha-synuclein and impulsivity, by evaluating differences in motor impulsivity in the 5-choice serial reaction time task (5-CSRTT) in strains of mice that differ in the expression of the alpha-synuclein gene. C57BL/6JOlaHsd mice differ from their C57BL/6J ancestors in possessing a chromosomal deletion resulting in the loss of two genes, snca, encoding alpha-synuclein, and mmrn1, encoding multimerin-1. C57BL/6J mice displayed higher impulsivity (more premature responding) than C57BL/6JOlaHsd mice when the pre-stimulus waiting interval was increased in the 5-CSRTT. In order to ensure that the reduced impulsivity was indeed related to snca, and not adjacent gene deletion, wild type (WT) and mice with targeted deletion of alpha-synuclein (KO) were tested in the 5-CSRTT. Similarly, WT mice were more impulsive than mice with targeted deletion of alpha-synuclein. Interrogation of our ongoing analysis of impulsivity in BXD recombinant inbred mouse lines revealed an association of impulsive responding with levels of alpha-synuclein expression in hippocampus. Expression of beta- and gamma-synuclein, members of the synuclein family that may substitute for alpha-synuclein following its deletion, revealed no differential compensations among the mouse strains. These findings suggest that alpha-synuclein may contribute to impulsivity and potentially, to ICDs which arise in some PD patients treated with dopaminergic medication. © 2011 The Authors. Genes, Brain and Behavior © 2011 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

PubMed

Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

2013-09-01

There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

Accumulation of Mitochondrial DNA Common Deletion Since The Preataxic Stage of Machado-Joseph Disease.

PubMed

Raposo, Mafalda; Ramos, Amanda; Santos, Cristina; Kazachkova, Nadiya; Teixeira, Balbina; Bettencourt, Conceição; Lima, Manuela

2018-04-21

Molecular alterations reflecting pathophysiologic changes thought to occur many years before the clinical onset of Machado-Joseph disease (MJD)/spinocerebellar ataxia type 3 (SCA3), a late-onset polyglutamine disorder, remain unidentified. The absence of molecular biomarkers hampers clinical trials, which lack sensitive measures of disease progression, preventing the identification of events occurring prior to clinical onset. Our aim was to analyse the mtDNA content and the amount of the common deletion (m.8482_13460del4977) in a cohort of 16 preataxic MJD mutation carriers, 85 MJD patients and 101 apparently healthy age-matched controls. Relative expression levels of RPPH1, MT-ND1 and MT-ND4 genes were assessed by quantitative real-time PCR. The mtDNA content was calculated as the difference between the expression levels of a mitochondrial gene (MT-ND1) and a nuclear gene (RPPH1); the amount of mtDNA common deletion was calculated as the difference between expression levels of a deleted (MT-ND4) and an undeleted (MT-ND1) mitochondrial genes. mtDNA content in MJD carriers was similar to that of healthy age-matched controls, whereas the percentage of the common deletion was significantly increased in MJD subjects, and more pronounced in the preclinical stage (p < 0.05). The BCL2/BAX ratio was decreased in preataxic carriers compared to controls, suggesting that the mitochondrial-mediated apoptotic pathway is altered in MJD. Our findings demonstrate for the first time that accumulation of common deletion starts in the preclinical stage. Such early alterations provide support to the current understanding that any therapeutic intervention in MJD should start before the overt clinical phenotype.

A familial pericentric inversion of chromosome 11 associated with a microdeletion of 163 kb and microduplication of 288 kb at 11p13 and 11q22.3 without aniridia or eye anomalies.

PubMed

Balay, Lara; Totten, Ellen; Okada, Luna; Zell, Sidney; Ticho, Benjamin; Israel, Jeannette; Kogan, Jillene

2016-01-01

Interstitial deletions of 11p13 involving MPPED2, DCDC5, DCDC1, DNAJC24, IMMP1L, and ELP4 are previously reported to have downstream transcriptional effects on the expression of PAX6, due to a downstream regulatory region (DRR). Currently, no clear genotype-phenotype correlations have been established allowing for conclusive information regarding the exact location of the PAX6 DRR, though its location has been approximated in mouse models to be within the Elp4 gene. Of the clinical reports currently published examining patients with intact PAX6 genes but harboring deletions identified in genes downstream of PAX6, 100% indicate phenotypes which include aniridia, whereas approximately half report additional eye deformities, autism, or intellectual disability. In this clinical report, we present a 12-year-old male patient, his brother, and mother with pericentric inversions of chromosome 11 associated with submicroscopic interstitial deletions of 11p13 and duplications of 11q22.3. The inversions were identified by standard cytogenetic analysis; microarray and FISH detected the chromosomal imbalance. The patient's phenotype includes intellectual disability, speech abnormalities, and autistic behaviors, but interestingly neither the patient, his brother, nor mother have aniridia or other eye anomalies. To the best of our knowledge, these findings in three family members represent the only reported cases with 11p13 deletions downstream of PAX6 not demonstrating phenotypic characteristics of aniridia or abnormal eye development. Although none of the deleted genes are obvious candidates for the patient's phenotype, the absence of aniridia in the presence of this deletion in all three family members further delineates the location of the DRR for PAX6. © 2015 Wiley Periodicals, Inc.

Molecular analysis of mucopolysaccharidosis IVA: Common mutations and racial difference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomatsu, S.; Hori, T.; Nakashima, Y.

1994-09-01

Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine -6-sulfate sulfatase (GALNS). Studies on the molecular basis of MPS IVA have been facilitated following cloning of the full-length cDNA and genomic DNA. In this study we detected mutations from 20 Caucasian and 19 Japanese MPS IVA patients using SSCP system and compared mutations of Caucasian origin with those of Japanese origin. The results showed the presence of 16 various mutations (3 small, deletions, 2 nonsense and 11 missense mutations) for Caucasian patients and 15 (1 deletion, 1 large alteration and 13 missense mutations) formore » Japanese. Moreover, two common mutations existed; one is double gene deletion characteristic for Japanese (6 alleles; 15%) and the other is a point mutation (1113F A{yields}T transition) characteristic for Caucasian (9 alleles; 22.5%). And the clear genotype/phenotype relationship among 1342delCA, IVS1(-2), P151S, Q148X, R386C, I113F, Q473X, W220G, P151L, A291T, R90W, and P77R, for a severe type, G96B N204K and V138A for a milder type, was observed. Only R386 mutation was seen in both of the populations. Further, the precise DNA analysis for double gene deletion of a common double gene deletion has been performed by defining the breakpoints and the results showed that one deletion was caused by homologous recombination due to Alu repetitive sequences and the other was due to nonhomologous recombination of short direct repeat. Haplotype analysis for six alleles with double deletion were different, indicating the different origin of this mutation or the frequent recombination events before a mutational event. Thus the mutations in GALNS gene are very heterogeneous and the racial difference is characteristic.« less

Translocation breakpoint at 7q31 associated with tics: further evidence for IMMP2L as a candidate gene for Tourette syndrome

PubMed Central

Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny

2011-01-01

Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1–7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1–3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1–7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene. PMID:21386874

Translocation breakpoint at 7q31 associated with tics: further evidence for IMMP2L as a candidate gene for Tourette syndrome.

PubMed

Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny

2011-06-01

Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1-7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1-3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1-7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

[PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

PubMed

Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

2016-12-07

Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

PubMed

Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

2018-04-01

Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may be essential for chordopoxvirus replication based either on their conservation or individual gene deletion studies. However, this number may underestimate the true number of essential functions because of redundancy. Here we show that any one of three seemingly unrelated and individually nonessential proteins is required for the incompletely understood processes of genome uncoating and DNA replication, an example of synthetic lethality. Thus, poxviruses appear to have a complex genetic interaction network that has not been fully appreciated and which will require multifactor deletion screens to assess. Copyright © 2018 American Society for Microbiology.

Kidney epithelium specific deletion of kelch-like ECH-associated protein 1 (Keap1) causes hydronephrosis in mice.

PubMed

Noel, Sanjeev; Arend, Lois J; Bandapalle, Samatha; Reddy, Sekhar P; Rabb, Hamid

2016-08-02

Transcription factor Nrf2 protects from experimental acute kidney injury (AKI) and is promising to limit progression in human chronic kidney disease (CKD) by upregulating multiple antioxidant genes. We recently demonstrated that deletion of Keap1, the endogenous inhibitor of Nrf2, in T lymphocytes significantly protects from AKI. In this study, we investigated the effect of Keap1 deletion on Nrf2 mediated antioxidant response in the renal tubular epithelial cells. We deleted Keap1 exon 2 and 3 in the renal tubular epithelial cells by crossing Ksp-Cre mice with Keap1 floxed (Keap1 (f/f)) mice. Deletion of Keap1 gene in the kidney epithelial cells of Ksp-Keap1 (-/-) mice and its effect on Nrf2 target gene expression was performed using PCR and real-time PCR respectively. Histological evaluation was performed on H&E stained sections. Complete blood count, serum and urine analysis were performed to assess systemic effects of defective kidney development. Student's T test was used to determine statistical difference between the groups. Ksp-Cre resulted in the deletion of Keap1 exon 2 and 3 and subsequent upregulation of Nrf2 target genes, Nqo1, Gclm and Gclc in the kidney epithelial cells of Ksp-Keap1 (-/-) mice at baseline. Renal epithelial cell specific deletion of Keap1 in Ksp-Keap1 (-/-) mice caused marked renal pelvic expansion and significant compression of medullary parenchyma consistent with hydronephrosis in both (3 month-old) males and females. Kidneys from 6 month-old Ksp-Keap1 (-/-) mice showed progressive hydronephrosis. Hematological, biochemical and urinary analysis showed significantly higher red blood cell count (p = 0.04), hemoglobin (p = 0.01), hematocrit (p = 0.02), mean cell volume (p = 0.02) and mean cell hemoglobin concentration (p = 0.003) in Ksp-Keap1 (-/-) mice in comparison to Keap1 (f/f) mice. These unexpected findings demonstrate that Keap1 deletion in renal tubular epithelial cells results in an abnormal kidney development consistent with hydronephrosis and reveals a novel Keap1 mediated signaling pathway in renal development.

Associations between neurodevelopmental genes, neuroanatomy, and ultra high risk symptoms of psychosis in 22q11.2 deletion syndrome.

PubMed

Thompson, Carlie A; Karelis, Jason; Middleton, Frank A; Gentile, Karen; Coman, Ioana L; Radoeva, Petya D; Mehta, Rashi; Fremont, Wanda P; Antshel, Kevin M; Faraone, Stephen V; Kates, Wendy R

2017-04-01

22q11.2 deletion syndrome is a neurogenetic disorder resulting in the deletion of over 40 genes. Up to 40% of individuals with 22q11.2DS develop schizophrenia, though little is known about the underlying mechanisms. We hypothesized that allelic variation in functional polymorphisms in seven genes unique to the deleted region would affect lobar brain volumes, which would predict risk for psychosis in youth with 22q11.2DS. Participants included 56 individuals (30 males) with 22q11.2DS. Anatomic MR images were collected and processed using Freesurfer. Participants were genotyped for 10 SNPs in the COMT, DGCR8, GNB1L, PIK4CA, PRODH, RTN4R, and ZDHHC8 genes. All subjects were assessed for ultra high risk symptoms of psychosis. Allelic variation of the rs701428 SNP of RTN4R was significantly associated with volumetric differences in gray matter of the lingual gyrus and cuneus of the occipital lobe. Moreover, occipital gray matter volumes were robustly associated with ultra high risk symptoms of psychosis in the presence of the G allele of rs701428. Our results suggest that RTN4R, a relatively under-studied gene at the 22q11 locus, constitutes a susceptibility gene for psychosis in individuals with this syndrome through its alteration of the architecture of the brain. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Phenotypic variability in Waardenburg syndrome resulting from a 22q12.3-q13.1 microdeletion involving SOX10.

PubMed

Jelena, Brezo; Christina, Lam; Eric, Vilain; Fabiola, Quintero-Rivera

2014-06-01

Waardenburg syndrome (WS) is a neurocristopathy characterized by pigmentation abnormalities of the skin, hair, and iris, as well as sensorineural hearing loss. Contiguous gene deletions encompassing SOX10 are rare, which limits conclusions about genotype-phenotype correlation regarding patient prognosis and management. This study adds to the existing body of knowledge by characterizing a 2.4 Mb deletion [arr[hg19] 22q12.3-q13.1 (36467502-38878207)x1] encompassing SOX10 and 53 additional RefSeq genes in a 15-year-old female with atypical WS. The patient presented with developmental delay, profound bilateral sensorineural hearing loss, heterochromia iridis, hypotonia, and bilateral finger contractures. Published genomic and phenotypic profiles of patients with SOX10-encompassing deletions point toward several plausible candidate gene that could account for the considerable clinical heterogeneity. These studies suggest the existence of modifiers among the co-deleted, dosage-sensitive genes (e.g., MYH9) and among genes whose effect may depend on the unmasking of recessive mutations (e.g., PLA2G6). Finally, we highlight evidence illustrating extensive interconnectivity of SOX10-hypothesizing that haploinsufficiency of SOX10 may "unmask" subtler effects on expression or epistasis associated with variants in SOX10 targets (e.g., DHH), in its partners (e.g., PAX3, EGR2), and in genes with functional overlap (e.g., SOX8, SOX9). © 2014 Wiley Periodicals, Inc.

The effectiveness of ground-penetrating radar surveys in the location of unmarked burial sites in modern cemeteries

NASA Astrophysics Data System (ADS)

Fiedler, Sabine; Illich, Bernhard; Berger, Jochen; Graw, Matthias

2009-07-01

Ground-penetration radar (GPR) is a geophysical method that is commonly used in archaeological and forensic investigations, including the determination of the exact location of graves. Whilst the method is rapid and does not involve disturbance of the graves, the interpretation of GPR profiles is nevertheless difficult and often leads to incorrect results. Incorrect identifications could hinder criminal investigations and complicate burials in cemeteries that have no information on the location of previously existing graves. In order to increase the number of unmarked graves that are identified, the GPR results need to be verified by comparing them with the soil and vegetation properties of the sites examined. We used a modern cemetery to assess the results obtained with GPR which we then compared with previously obtained tachymetric data and with an excavation of the graves where doubt existed. Certain soil conditions tended to make the application of GPR difficult on occasions, but a rough estimation of the location of the graves was always possible. The two different methods, GPR survey and tachymetry, both proved suitable for correctly determining the exact location of the majority of graves. The present study thus shows that GPR is a reliable method for determining the exact location of unmarked graves in modern cemeteries. However, the method did not allow statements to be made on the stage of decay of the bodies. Such information would assist in deciding what should be done with graves where ineffective degradation creates a problem for reusing graves following the standard resting time of 25 years.

Diverse fission yeast genes required for responding to oxidative and metal stress: Comparative analysis of glutathione-related and other defense gene deletions.

PubMed

Pluskal, Tomáš; Sajiki, Kenichi; Becker, Joanne; Takeda, Kojiro; Yanagida, Mitsuhiro

2016-06-01

Living organisms have evolved multiple sophisticated mechanisms to deal with reactive oxygen species. We constructed a collection of twelve single-gene deletion strains of the fission yeast Schizosaccharomyces pombe designed for the study of oxidative and heavy metal stress responses. This collection contains deletions of biosynthetic enzymes of glutathione (Δgcs1 and Δgsa1), phytochelatin (Δpcs2), ubiquinone (Δabc1) and ergothioneine (Δegt1), as well as catalase (Δctt1), thioredoxins (Δtrx1 and Δtrx2), Cu/Zn- and Mn- superoxide dismutases (SODs; Δsod1 and Δsod2), sulfiredoxin (Δsrx1) and sulfide-quinone oxidoreductase (Δhmt2). First, we employed metabolomic analysis to examine the mutants of the glutathione biosynthetic pathway. We found that ophthalmic acid was produced by the same enzymes as glutathione in S. pombe. The identical genetic background of the strains allowed us to assess the severity of the individual gene knockouts by treating the deletion strains with oxidative agents. Among other results, we found that glutathione deletion strains were not particularly sensitive to peroxide or superoxide, but highly sensitive to cadmium stress. Our results show the astonishing diversity in cellular adaptation mechanisms to various types of oxidative and metal stress and provide a useful tool for further research into stress responses. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Characterization of large rearrangements in autosomal dominant polycystic kidney disease and the PKD1/TSC2 contiguous gene syndrome

PubMed Central

Consugar, Mark B.; Wong, Wai C.; Lundquist, Patrick A.; Rossetti, Sandro; Kubly, Vickie J.; Walker, Denise L.; Rangel, Laureano J.; Aspinwall, Richard; Niaudet, W. Patrick; Özen, Seza; David, Albert; Velinov, Milen; Bergstralh, Eric J.; Bae, Kyongtae T.; Chapman, Arlene B.; Guay-Woodford, Lisa M.; Grantham, Jared J.; Torres, Vicente E.; Sampson, Julian R.; Dawson, Brian D.; Harris, Peter C.

2009-01-01

Large DNA rearrangements account for about 8% of disease mutations and are more common in duplicated genomic regions, where they are difficult to detect. Autosomal dominant polycystic kidney disease (ADPKD) is caused by mutations in either PKD1 or PKD2. PKD1 is located in an intrachromosomally duplicated region. A tuberous sclerosis gene, TSC2, lies immediately adjacent to PKD1 and large deletions can result in the PKD1/TSC2 contiguous gene deletion syndrome. To rapidly identify large rearrangements, a multiplex ligation-dependent probe amplification assay was developed employing base-pair differences between PKD1 and the six pseudogenes to generate PKD1-specific probes. All changes in a set of 25 previously defined deletions in PKD1, PKD2 and PKD1/TSC2 were detected by this assay and we also found 14 new mutations at these loci. About 4% of the ADPKD patients in the CRISP study were found to have gross rearrangements, and these accounted for about a third of base-pair mutation negative families. Sensitivity of the assay showed that about 40% of PKD1/TSC contiguous gene deletion syndrome families contained mosaic cases. Characterization of a family found to be mosaic for a PKD1 deletion is discussed here to illustrate family risk and donor selection considerations. Our assay improves detection levels and the reliability of molecular testing of patients with ADPKD. PMID:18818683

Location interval at Xp22.3 for X-linked chondrodysplasia punctata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheffield, L.; Hutchison, W.; Holloway, A.

1994-09-01

The literature shows that there is a gene for chondropdysplasia punctata (CDP) located at Xp22.3 from the study of chromosomal rearrangements involving Xp. It is also suspected that there are genes for short stature and mental retardation nearby. Petit has described a family of brachytelephalangic CDP that was due to a submicroscopic interstitial deletion of Xp22.3. Symmetrical (mild) CDP seems to be identical to brachytelephalangic CDP clinically, has variable features of short stature and mental retardation, and has a preponderance of affected males. We describe results using DNA probes from Xp22.3 in 10 patients with radiologically proven symmetrical CDP. Othermore » known genes in this region have a high proportion of deletions as we screened our patients for deletions in DXYS20, MIC2, PABX, DXYS159X, DXS283, DXS285, J502(PCR), DXS31, DXS43 (listed distally to proximally). No deletions were found. We have also studied a fetus with proven CDP who has a X,Y translocation (46,V,t(X;Y)(p22.3;q12)mat). This patient was deleted for all distal probes up to J502(PCR). It is not yet known where the breakpoint lies but it may be just proximal to the CDP gene. The results of the 10 symmetrical CDPs and the X;Y translocation fetus are presented with further definition of the X chromosomal breakpoint in the translocation.« less

The effects of upaB deletion and the double/triple deletion of upaB, aatA, and aatB genes on pathogenicity of avian pathogenic Escherichia coli.

PubMed

Zhu-Ge, Xiang-Kai; Pan, Zi-Hao; Tang, Fang; Mao, Xiang; Hu, Lin; Wang, Shao-Hui; Xu, Bin; Lu, Cheng-Ping; Fan, Hong-Jie; Dai, Jian-Jun

2015-12-01

Autotransporters (ATs) are associated with pathogenesis of Avian Pathogenic Escherichia coli (APEC). The molecular characterization of APEC ATs can provide insights about their relevance to APEC pathogenesis. Here, we characterized a conventional autotransporter UpaB in APEC DE205B genome. The upaB existed in 41.9 % of 236 APEC isolates and was predominantly associated with ECOR B2 and D. Our studies showed that UpaB mediates the DE205B adhesion in DF-1 cells, and enhances autoaggregation and biofilm formation of fimbria-negative E. coli AAEC189 (MG1655Δfim) in vitro. Deletion of upaB of DE205B attenuates the virulence in duck model and early colonization in the duck lungs during APEC systemic infection. Furthermore, double and triple deletion of upaB, aatA, and aatB genes cumulatively attenuated DE205B adhesion in DF-1 cells, accompanying with decreased 50 % lethal dose (LD50) in duck model and the early colonization in the duck lungs. However, DE205BΔupaB/ΔaatA/ΔaatB might "compensate" the influence of gene deletion by upregulating the expression of fimbrial adhesin genes yqiL, yadN, and vacuolating autotransporter vat during early colonization of APEC. Finally, we demonstrated that vaccination with recombinant UpaB, AatA, and AatB proteins conferred protection against colisepticemia caused by DE205B infection in duck model.

A de novo interstitial 6q deletion in a boy with a split hand malformation.

PubMed

Duran-Gonzalez, Jorge; Gutierrez-Angulo, Melva; Garcia-Cruz, Diana; Ayala, Maria de la Luz; Padilla, Miguel; Davalos, Ingrid P

2007-01-01

We report on a de novo interstitial deletion of (6)(q15q22.2) in a 5-year-old boy with developmental delay, microcephaly, facial dysmorphism, cryptorchidism, congenital heart defect, and split-hand malformation. Previous reports and this patient suggest that 6q21 may contain a gene or genes related either directly or indirectly to limb development.

Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

PubMed

Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

2014-12-01

The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.

Contribution of the Receptor/Ligand Interaction Between CD44 and Osteopontin to Formation of Breast Cancer Metastases

DTIC Science & Technology

2001-07-01

mismatch repair gene Pms2 reduces the number of intestinal tumors as compared to mice with targeted deletion of this gene [27]. In contrast, deletion of the...Liskay. 1998. Enhanced intestinal adenomatous polyp formation in Pms2 "/;Min mice. Cancer Res. 58:1087-1089. 19 Weber et al. 28. Wilson, C.L., K.J

Identification and classification of genes required for tolerance to high-sucrose stress revealed by genome-wide screening of Saccharomyces cerevisiae.

PubMed

Ando, Akira; Tanaka, Fumiko; Murata, Yoshinori; Takagi, Hiroshi; Shima, Jun

2006-03-01

Yeasts used in bread making are exposed to high concentrations of sucrose during sweet dough fermentation. Despite its importance, tolerance to high-sucrose stress is poorly understood at the gene level. To clarify the genes required for tolerance to high-sucrose stress, genome-wide screening was undertaken using the complete deletion strain collection of diploid Saccharomyces cerevisiae. The screening identified 273 deletions that yielded high sucrose sensitivity, approximately 20 of which were previously uncharacterized. These 273 deleted genes were classified based on their cellular function and localization of their gene products. Cross-sensitivity of the high-sucrose-sensitive mutants to high concentrations of NaCl and sorbitol was studied. Among the 273 sucrose-sensitive deletion mutants, 269 showed cross-sensitivities to sorbitol or NaCl, and four (i.e. ade5,7, ade6, ade8, and pde2) were specifically sensitive to high sucrose. The general stress response pathways via high-osmolarity glycerol and stress response element pathways and the function of the invertase in the ade mutants were similar to those in the wild-type strain. In the presence of high-sucrose stress, intracellular contents of ATP in ade mutants were at least twofold lower than that of the wild-type cells, suggesting that depletion of ATP is a factor in sensitivity to high-sucrose stress. The genes identified in this study might be important for tolerance to high-sucrose stress, and therefore should be target genes in future research into molecular modification for breeding of yeast tolerant to high-sucrose stress.

BCR expression is decreased in meningiomas showing loss of heterozygosity of 22q within a new minimal deletion region.

PubMed

Wozniak, K; Piaskowski, S; Gresner, S M; Golanska, E; Bieniek, E; Bigoszewska, K; Sikorska, B; Szybka, M; Kulczycka-Wojdala, D; Zakrzewska, M; Zawlik, I; Papierz, W; Stawski, R; Jaskolski, D J; Och, W; Sieruta, M; Liberski, P P; Rieske, P

2008-05-01

Neurofibromin 2 (NF2), located on chromosome arm 22q, has been established as a tumor suppressor gene involved in meningioma pathogenesis. In our study, we investigated 149 meningiomas to determine whether there are additional tumor suppressor genes localized on chromosome 22q, apart from NF2, that might be involved in meningioma pathogenesis. The LOH analysis on chromosome 22q identified two regions of deletion: the first one, which is limited to the NF2 gene locus, and the second one, which is outside this location. The new minimal deletion region (MDR) included the following genes: BCR (breakpoint cluster region), RAB36 (a member of RAS oncogene family), GNAZ [guanine nucleotide binding protein (G protein), alpha-z polypeptide], and RTDR1 (rhabdoid tumor deletion region gene 1). The expression levels of all these genes, including NF2, were subsequently analyzed by quantitative real-time polymerase chain reaction. We observed a significantly lowered expression level of NF2 in meningiomas with 22q loss of heterozygosity (LOH) within NF2 region compared to the one in meningiomas with 22q retention of heterozygosity (ROH, P<0.05). Similarly, BCR showed a significantly lowered expression in meningiomas with 22q LOH within the new MDR compared to cases with 22q ROH (P<0.05). Our data, together with the already published information considering BCR function suggest that BCR can be considered as a candidate tumor suppressor gene localized on chromosome 22q which may be involved in meningioma pathogenesis.

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG

PubMed Central

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations—nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively—in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent. PMID:27413738