Investigation of the strength of shielded and unshielded underwater electrical cables

NASA Astrophysics Data System (ADS)

Glowe, D. E.; Arnett, S. L.

1981-09-01

The mechanical properties of shielded and unshielded submarine cables (MIL-C-915/8E) were investigated to determine the effect of shielding on cable life, performance, and reliability. Ten cables (five shielded and five unshielded) were selected for laboratory evaluation. A mission profile was developed to establish the mechanical stress limits that cables must endure in service and a test sequence designed to measure tensile strength, flexural abrasion endurance, crush resistance, creep under static tension, and performance in a hull-stuffing tube. The results of this program showed that: (1) DSS-2 cable does not have adequate tensile strength and should have a strength member added. DSS-3 and larger cables have adequate tensile strength with or without the shield; (2) Unshielded DSS-3 type cable does not perform satisfactorily in hull-stuffing tubes; (3) Shielding is not required to meet mission profile specifications for cable crush or flexural abrasion resistance; (4) Construction parameters other than shielding can significantly affect mechanical performance of cable; (5) Unshielded cable construction can result in increased reliability since it permits a thicker single-jacket construction; and (6) Unshielded cable construction can reduce the cost of cable by 8 to 20 percent.

Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

PubMed Central

Pollanen, M. S.; Markiewicz, P.; Bergeron, C.; Goh, M. C.

1994-01-01

Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures. Images Figure 1 PMID:8178938

Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

PubMed

Pollanen, M S; Markiewicz, P; Bergeron, C; Goh, M C

1994-05-01

Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures.

Controlling coupled bending-twisting vibrations of anisotropic composite wing

NASA Astrophysics Data System (ADS)

Ryabov, Victor; Yartsev, Boris

2018-05-01

The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance because it enables approximate analysis of real composite wings with complex geometry in the existing commercial software packages.

Spiral MRI on a 9.4T Vertical-bore Superconducting Magnet Using Unshielded and Self-shielded Gradient Coils

PubMed Central

Kodama, Nao; Setoi, Ayana; Kose, Katsumi

2018-01-01

Spiral MRI sequences were developed for a 9.4T vertical standard bore (54 mm) superconducting magnet using unshielded and self-shielded gradient coils. Clear spiral images with 64-shot scan were obtained with the self-shielded gradient coil, but severe shading artifacts were observed for the spiral-scan images acquired with the unshielded gradient coil. This shading artifact was successfully corrected with a phase-correction technique using reference scans that we developed based on eddy current field measurements. We therefore concluded that spiral imaging sequences can be installed even for unshielded gradient coils if phase corrections are performed using the reference scans. PMID:28367906

Spiral MRI on a 9.4T Vertical-bore Superconducting Magnet Using Unshielded and Self-shielded Gradient Coils.

PubMed

Kodama, Nao; Setoi, Ayana; Kose, Katsumi

2018-04-10

Spiral MRI sequences were developed for a 9.4T vertical standard bore (54 mm) superconducting magnet using unshielded and self-shielded gradient coils. Clear spiral images with 64-shot scan were obtained with the self-shielded gradient coil, but severe shading artifacts were observed for the spiral-scan images acquired with the unshielded gradient coil. This shading artifact was successfully corrected with a phase-correction technique using reference scans that we developed based on eddy current field measurements. We therefore concluded that spiral imaging sequences can be installed even for unshielded gradient coils if phase corrections are performed using the reference scans.

PHITS simulations of the Protective curtain experiment onboard the Service module of ISS: Comparison with absorbed doses measured with TLDs

NASA Astrophysics Data System (ADS)

Ploc, Ondřej; Sihver, Lembit; Kartashov, Dmitry; Shurshakov, Vyacheslav; Tolochek, Raisa

2013-12-01

"Protective curtain" was the physical experiment onboard the International Space Station (ISS) aimed on radiation measurement of the dose - reducing effect of the additional shielding made of hygienic water-soaked wipes and towels placed on the wall in the crew cabin of the Service module Zvezda. The measurements were performed with 12 detector packages composed of thermoluminescent detectors (TLDs) and plastic nuclear track detectors (PNTDs) placed at the Protective curtain, so that they created pairs of shielded and unshielded detectors.

Photoinduced intramolecular charge transfer (ICT) reaction in trans-methyl p-(dimethylamino) cinnamate: A combined fluorescence measurement and quantum chemical calculations

NASA Astrophysics Data System (ADS)

Chakraborty, Amrita; Kar, Samiran; Guchhait, Nikhil

2006-01-01

The photophysical behaviour of trans-methyl p-(dimethylamino) cinnamate ( t-MDMAC) donor-acceptor system has been investigated by steady-state absorption and emission spectroscopy and quantum chemical calculations. The molecule t-MDMAC shows an emission from the locally excited state in non-polar solvents. In addition to weak local emission, a strong solvent dependent red shifted fluorescence in polar aprotic solvents is attributed to highly polar intramolecular charge transfer state. However, the formation of hydrogen-bonded clusters with polar protic solvents has been suggested from a linear correlation between the observed red shifted fluorescence band maxima with hydrogen bonding parameters ( α). Calculations by ab initio and density functional theory show that the lone pair electron at nitrogen center is out of plane of the benzene ring in the global minimum ground state structure. In the gas phase, a potential energy surface along the twist coordinate at the donor (-NMe 2) and acceptor (-CH = CHCOOMe) sites shows stabilization of S 1 state and destabilization S 2 and S 0 states. A similar potential energy calculation along the twist coordinate in acetonitrile solvent using non-equilibrium polarized continuum model also shows more stabilization of S 1 state relative to other states and supports solvent dependent red shifted emission properties. In all types of calculations it is found that the nitrogen lone pair is delocalized over the benzene ring in the global minimum ground state and is localized on the nitrogen centre at the 90° twisted configuration. The S 1 energy state stabilization along the twist coordinate at the donor site and localized nitrogen lone pair at the perpendicular configuration support well the observed dual fluorescence in terms of proposed twisted intramolecular charge transfer (TICT) model.

Monopole-antimonopole interaction potential

NASA Astrophysics Data System (ADS)

Saurabh, Ayush; Vachaspati, Tanmay

2017-11-01

We numerically study the interactions of twisted monopole-antimonopole pairs in the 't Hooft-Polyakov model for a range of values of the scalar to vector mass ratio. We also recover the sphaleron solution at maximum twist discovered by Taubes [Commun. Math. Phys. 86, 257 (1982), 10.1007/BF01206014] and map out its energy and size as functions of parameters.

Shielded-Twisted-Pair Cable Model for Chafe Fault Detection via Time-Domain Reflectometry

NASA Technical Reports Server (NTRS)

Schuet, Stefan R.; Timucin, Dogan A.; Wheeler, Kevin R.

2012-01-01

This report details the development, verification, and validation of an innovative physics-based model of electrical signal propagation through shielded-twisted-pair cable, which is commonly found on aircraft and offers an ideal proving ground for detection of small holes in a shield well before catastrophic damage occurs. The accuracy of this model is verified through numerical electromagnetic simulations using a commercially available software tool. The model is shown to be representative of more realistic (analytically intractable) cable configurations as well. A probabilistic framework is developed for validating the model accuracy with reflectometry data obtained from real aircraft-grade cables chafed in the laboratory.

Ion behavior in low-power magnetically shielded and unshielded Hall thrusters

NASA Astrophysics Data System (ADS)

Grimaud, L.; Mazouffre, S.

2017-05-01

Magnetically shielded Hall thrusters achieve a longer lifespan than traditional Hall thrusters by reducing wall erosion. The lower erosion rate is attributed to a reduction of the high energy ion population impacting the walls. To investigate this phenomenon, the ion velocity distribution functions are measured with laser induced fluorescence at several points of interest in the magnetically shielded ISCT200-MS and the unshielded ISCT200-US Hall thrusters. The center of the discharge channel is probed to highlight the difference in plasma positioning between the shielded and unshielded thrusters. Erosion phenomena are investigated by taking measurements of the ion velocity distribution near the inner and outer wall as well as above the magnetic poles where some erosion is observed. The resulting distribution functions show a displacement of the acceleration region from inside the channel in the unshielded thruster to downstream of the exit plane in the ISCT200-MS. Near the walls, the unshielded thruster displays both a higher relative ion density as well as a significant fraction of the ions with velocities toward the walls compared to the shielded thruster. Higher proportions of high velocity ions are also observed. Those results are in accordance with the reduced erosion observed. Both shielded and unshielded thrusters have large populations of ions impacting the magnetic poles. The mechanism through which those ions are accelerated toward the magnetic poles has so far not been explained.

New dualities and misleading anomaly matchings from outer-automorphism twists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pal, Sridip; Song, Jaewon

We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

New dualities and misleading anomaly matchings from outer-automorphism twists

DOE PAGES

Pal, Sridip; Song, Jaewon

2017-03-29

We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

Rotary stripper for shielded and unshielded FCC

NASA Technical Reports Server (NTRS)

Angele, W.; Chambers, C. M.

1971-01-01

Rotary stripper removes narrow strips of insulation and shielding to any desired depth. Unshielded cables are stripped on both sides with one stroke, shielded cables are stripped in steps of different depths.

Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves.

PubMed

De Angelis, L; Alpeggiani, F; Di Falco, A; Kuipers, L

2017-11-17

Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves

NASA Astrophysics Data System (ADS)

De Angelis, L.; Alpeggiani, F.; Di Falco, A.; Kuipers, L.

2017-11-01

Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Coronal plasma development in wire-array z-pinches made of twisted-pairs

NASA Astrophysics Data System (ADS)

Hoyt, C. L.; Greenly, J. B.; Gourdain, P. A.; Knapp, P. F.; Pikuz, S. A.; Shelkovenko, T. A.; Hammer, D. A.; Kusse, B. R.

2009-11-01

We have investigated coronal and core plasma development in wire array z-pinches in which single fine wires are replaced by twisted-pairs (``cable'') on the 1 MA, 100 ns rise time COBRA pulsed power generator. X-ray radiography, employed to investigate dense wire core expansion, showed periodic axial nonuniformity and evidence for shock waves developing where the individual wire plasmas collide. Laser shadowgraphy images indicated that the axial instability properties of the coronal plasma are substantially modified from ordinary wire arrays. Cable mass per unit length, material and the twist wavelength were varied in order to study their effects upon the instability wavelength. Implosion uniformity and bright-spot formation, as well as magnetic topology evolution, have also been investigated using self-emission imaging, x-ray diagnostics and small B-dot probes, respectively. Results from the cable-array z-pinches will be compared with results from ordinary wire-array z-pinches. This research was supported by the SSAA program of the National Nuclear Security Administration under DOE Cooperative agreement DE-FC03-02NA00057.

Unraveling cellulose microfibrils: a twisted tale.

PubMed

Hadden, Jodi A; French, Alfred D; Woods, Robert J

2013-10-01

Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. Copyright © 2013 Wiley Periodicals, Inc.

Unraveling Cellulose Microfibrils: A Twisted Tale

PubMed Central

Hadden, Jodi A.; French, Alfred D.; Woods, Robert J.

2014-01-01

Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. PMID:23681971

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabuda, S. P.; Kozlova, S. G.; Novosibirsk State University, 2, Pirogova Str., Novosibirsk 630090

We report an abnormal difference of low-temperature mobility of left-twisted and right-twisted conformations of roto symmetric molecules C{sub 6}H{sub 12}N{sub 2} (dabco) located in the same positions in crystal Zn{sub 2}(C{sub 8}H{sub 4}O{sub 4}){sub 2}⋅C{sub 6}H{sub 12}N{sub 2}. The difference between {sup 1}H NMR (Nuclear Magnetic Resonance) spin-relaxation data for left-twisted and right-twisted molecules reaches ∼3 × 10{sup 3} times at 8 K and tends to grow at lower temperatures. We argue that taking into account four-component relativistic Dirac wave functions in the vicinity of the nodal plane of dabco molecules and vacuum fluctuations due to virtual particle-antiparticle pairs canmore » explain the changes which C{sub 6}H{sub 12}N{sub 2} conformations undergo at low temperatures.« less

Down hole transmission system

DOEpatents

Hall, David R [Provo, UT; Hall, Jr., H. Tracy

2007-07-24

A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. The electrically conducting coil comprises at least two generally fractional loops. In the preferred embodiment, the transmission elements are connected by an electrical conductor. Preferably, the electrical conductor is a coaxial cable. Preferably, the MCEI trough comprises ferrite. In the preferred embodiment, the fractional loops are connected by a connecting cable. In one aspect of the present invention, the connecting cable is a pair of twisted wires. In one embodiment the connecting cable is a shielded pair of twisted wires. In another aspect of the present invention, the connecting cable is a coaxial cable. The connecting cable may be disposed outside of the MCEI circular trough.

Lake Shore Drive\\\\Grand Ave.\\\\E. Illinois Ave., May 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements process did not exceed the instrument threshold. Unshielded readings ranged from a minimumof 4,600 cpm to a maximum of 14,200 cpm unshielded and shielded readings ranged from a minimum of1,800 cpm to 2,680 cpm.

SU-E-T-46: Application of a Twin-Detector Method for the Determination of the Mean Photon Energy Em at Points of Measurement in a Water Phantom Surrounding a GammaMed HDR 192Ir Brachytherapy Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chofor, N; Poppe, B; Nebah, F

Purpose: In a brachytherapy photon field in water the fluence-averaged mean photon energy Em at the point of measurement correlates with the radiation quality correction factor kQ of a non water-equivalent detector. To support the experimental assessment of Em, we show that the normalized signal ratio NSR of a pair of radiation detectors, an unshielded silicon diode and a diamond detector can serve to measure quantity Em in a water phantom at a Ir-192 unit. Methods: Photon fluence spectra were computed in EGSnrc based on a detailed model of the GammaMed source. Factor kQ was calculated as the ratio ofmore » the detector's spectrum-weighted responses under calibration conditions at a 60Co unit and under brachytherapy conditions at various radial distances from the source. The NSR was investigated for a pair of a p-type unshielded silicon diode 60012 and a synthetic single crystal diamond detector 60019 (both PTW Freiburg). Each detector was positioned according to its effective point of measurement, with its axis facing the source. Lateral signal profiles were scanned under complete scatter conditions, and the NSR was determined as the quotient of the signal ratio under application conditions x and that at position r-ref = 1 cm. Results: The radiation quality correction factor kQ shows a close correlation with the mean photon energy Em. The NSR of the diode/diamond pair changes by a factor of two from 0–18 cm from the source, while Em drops from 350 to 150 keV. Theoretical and measured NSR profiles agree by ± 2 % for points within 5 cm from the source. Conclusion: In the presence of the close correlation between radiation quality correction factor kQ and photon mean energy Em, the NSR provides a practical means of assessing Em under clinical conditions. Precise detector positioning is the major challenge.« less

Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

PubMed

Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

2014-10-01

We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Twisting short dsDNA with applied tension

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-02-01

The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

PubMed

Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

2004-11-12

Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

INDIRECT EFFECT OF X-RADIATION ON BONE GROWTH IN RATS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conard, R.A.

1962-12-21

Effects of 200 to 600 r of x irradiation on tibial bone growth in groups of weanling male rats were studied by in vivo measurement of tibial bone growth in serial radiographs. By comparison of growth rates in shielded with unshielded legs, direct and indirect effects of radiation were demonstrated, both roughly dose dependent, but with the indirect effect being about twice that of the direct effect. Pair-feeding experiments showed that about 70% of the indirect effect was due to radiation-induced lowered food consumption. By partial-body shielding experiments, using pnir-fed controls, it was shown that the abdomen may be themore » site of a non-nutritional abscopal effect. (auth)« less

DSL for traffic video

DOT National Transportation Integrated Search

1999-07-01

Many traffic operations use twisted pair wiring, either owned by the public or leased from a local provider, to control field devices such as traffic signals or ramp meters. There are now commercially available communications technologies that ...

Conformations of 1,3,3,5,7,7-Hexamethyl-1,5-diazacyclooctane and Its Bis-BH(3) Adduct. Mono- and Bis-BH(3) Adducts of Di-Tertiary Amines.

PubMed

Livant, P.; Majors, A. W.; Webb, T. R.

1996-05-03

A variable-temperature (1)H- and (13)C-NMR study revealed a conformational equilibrium for 1,3,3,5,7,7-hexamethyl-1,5-diazacyclooctane (4) having DeltaG() = 8.8 +/- 0.6 kcal/mol at 184 K. This activation barrier connects a major and a minor form of 4. Molecular mechanics calculations on 4 led to the conclusion that the major form is a set of twist-chair-chairs interconverting rapidly via the chair-chair and that the minor form is most likely a set of twist-boat-boats interconverting rapidly via the boat-boat. The proximity of the two nitrogen lone pairs in the major form of 4 made plausible the expectation that 4, as well as a related diamine with apposed nitrogens, 3,7-dimethyl-3,7-diazabicyclo[3.3.1]nonane (3), might bind a Lewis acid, namely BH(3), using both lone pairs simultaneously and equally. This proved not to be the case: for 3 only the bis-BH(3) adduct was found and for 4 the mono-BH(3) adduct utilized only one nitrogen lone pair. The structure of the bis-BH(3) adduct of 4 (12) was determined by X-ray crystallography to be a twist-boat-boat with BH(3)s cis. Molecular mechanics calculations on 12 were consistent with the solid state conformation found.

Towards generalized mirror symmetry for twisted connected sum G 2 manifolds

NASA Astrophysics Data System (ADS)

Braun, Andreas P.; Del Zotto, Michele

2018-03-01

We revisit our construction of mirror symmetries for compactifications of Type II superstrings on twisted connected sum G 2 manifolds. For a given G 2 manifold, we discuss evidence for the existence of mirror symmetries of two kinds: one is an autoequivalence for a given Type II superstring on a mirror pair of G 2 manifolds, the other is a duality between Type II strings with different chiralities for another pair of mirror manifolds. We clarify the role of the B-field in the construction, and check that the corresponding massless spectra are respected by the generalized mirror maps. We discuss hints towards a homological version based on BPS spectroscopy. We provide several novel examples of smooth, as well as singular, mirror G 2 backgrounds via pairs of dual projecting tops. We test our conjectures against a Joyce orbifold example, where we reproduce, using our geometrical methods, the known mirror maps that arise from the SCFT worldsheet perspective. Along the way, we discuss non-Abelian gauge symmetries, and argue for the generation of the Affleck-Harvey-Witten superpotential in the pure SYM case.

Resonance coupling and polarization conversion in terahertz metasurfaces with twisted split-ring resonator pairs

DOE PAGES

Li, Chenyu; Chang, Chun-Chieh; Zhou, Qingli; ...

2017-10-10

Here, we investigate edge-coupling of twisted split-ring resonator (SRR) pairs in the terahertz (THz) frequency range. By using a simple coupled-resonator model we show that such a system exhibits resonance splitting and cross-polarization conversion. Numerical simulations and experimental measurements agree well with theoretical calculations, verifying the resonance splitting as a function of the coupling strength given by the SRR separation. We further show that a metal ground plane can be integrated to significantly enhance the resonance coupling, which enables the effective control of resonance splitting and the efficiency and bandwidth of the cross-polarization conversion. Our findings improve the fundamental understandingmore » of metamaterials with a view of accomplishing metamaterial functionalities with enhanced performance, which is of great interest in realizing THz functional devices required in a variety of applications.« less

Echo-Planar Imaging for a 9.4 Tesla Vertical-Bore Superconducting Magnet Using an Unshielded Gradient Coil.

PubMed

Kodama, Nao; Kose, Katsumi

2016-10-11

Echo-planar imaging (EPI) sequences were developed for a 9.4 Tesla vertical standard bore (~54 mm) superconducting magnet using an unshielded gradient coil optimized for live mice imaging and a data correction technique with reference scans. Because EPI requires fast switching of intense magnetic field gradients, eddy currents were induced in the surrounding metallic materials, e.g., the room temperature bore, and this produced serious artifacts on the EPI images. We solved the problem using an unshielded gradient coil set of proper size (outer diameter = 39 mm, inner diameter = 32 mm) with time control of the current rise and reference scans. The obtained EPI images of a phantom and a plant sample were almost artifact-free and demonstrated the promise of our approach.

Skin entrance dose with and without lead apron in digital panoramic radiography for selected sensitive body regions.

PubMed

Schulze, Ralf Kurt Willy; Cremers, Catrin; Karle, Heiko; de Las Heras Gala, Hugo

2017-05-01

The aim of this study was to compare the dose at skin level at five significant anatomical regions for panoramic radiography devices with and without lead apron by means of a highly sensitive dosimeter. A female RANDO-phantom was exposed in five different digital panoramic radiography systems, and the dose at skin level was assessed tenfold for each measurement region by means of a highly sensitive solid-state-dosimeter. The five measurement regions selected were the thyroid, both female breasts, the gonads, and a central region in the back of the phantom. For each panoramic machine, the measurements were performed in two modes: with and without a commercial lead apron specifically designed for panoramic radiography. Reproducibility of the measurements was expressed by absolute differences and the coefficient of variation. Values between shielded and unshielded doses were pooled for each region and compared by means of the paired Wilcoxon tests (p ≤ 0.05). Reproducibility as represented by the mean CV was 22 ± 52 % (median 2.3 %) with larger variations for small dose values. Doses at skin level ranged between 0.00 μGy at the gonads and 85.39 μGy at the unshielded thyroid (mean ± SD 15 ± 24 μGy). Except for the gonads, the dose in all the other regions was significantly lower (p < 0.001) when a lead apron was applied. Unshielded doses were between 1.02-fold (thyroid) and 112-fold (at the right breast) higher than those with lead apron shielding (mean: 14-fold ± 18-fold). Although the doses were entirely very low, we observed a significant increase in dose in the radiation-sensitive female breast region when no lead apron was used. Future discussions on shielding requirements for panoramic radiography should focus on these differences in the light of the linear non-threshold (LNT) theory which is generally adopted in medical imaging.

Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

PubMed

Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

2013-01-30

Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

Visualization of drug-nucleic acid interactions at atomic resolution v. structure of two aminoacridine/dinucleoside monophosphate crystalline complexes, proflavine: 5-iodocytidylyl(3'-5') guanosine and acridine orange: 5-iodocytidylyl(3'-5') guanosine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.

1979-01-01

Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less

Unshielded Facility Nondestructive Inspection (NDI) Radiation Protection Survey for Homestead ARB, FL

DTIC Science & Technology

2013-09-09

dosimetry records, NDI’s operating procedures/instructions, and radiation safety training. c. Survey Personnel: (1) Health... Dosimetry . (1) Verify unshielded NDI safety procedures meet T.O. 33B-l-l and other occupational safety and health requirements. (2) Verify an...distribution is unlimited. Case Number: 88ABW-2013-3977, 9 Sep 2013 b. The electronic personal dosimeters (EPDs) worn by NDI personnel had

Exact special twist method for quantum Monte Carlo simulations

NASA Astrophysics Data System (ADS)

Dagrada, Mario; Karakuzu, Seher; Vildosola, Verónica Laura; Casula, Michele; Sorella, Sandro

2016-12-01

We present a systematic investigation of the special twist method introduced by Rajagopal et al. [Phys. Rev. B 51, 10591 (1995), 10.1103/PhysRevB.51.10591] for reducing finite-size effects in correlated calculations of periodic extended systems with Coulomb interactions and Fermi statistics. We propose a procedure for finding special twist values which, at variance with previous applications of this method, reproduce the energy of the mean-field infinite-size limit solution within an adjustable (arbitrarily small) numerical error. This choice of the special twist is shown to be the most accurate single-twist solution for curing one-body finite-size effects in correlated calculations. For these reasons we dubbed our procedure "exact special twist" (EST). EST only needs a fully converged independent-particles or mean-field calculation within the primitive cell and a simple fit to find the special twist along a specific direction in the Brillouin zone. We first assess the performances of EST in a simple correlated model such as the three-dimensional electron gas. Afterwards, we test its efficiency within ab initio quantum Monte Carlo simulations of metallic elements of increasing complexity. We show that EST displays an overall good performance in reducing finite-size errors comparable to the widely used twist average technique but at a much lower computational cost since it involves the evaluation of just one wave function. We also demonstrate that the EST method shows similar performances in the calculation of correlation functions, such as the ionic forces for structural relaxation and the pair radial distribution function in liquid hydrogen. Our conclusions point to the usefulness of EST for correlated supercell calculations; our method will be particularly relevant when the physical problem under consideration requires large periodic cells.

Development and evaluation of TWIST Dixon for dynamic contrast-enhanced (DCE) MRI with improved acquisition efficiency and fat suppression.

PubMed

Le, Yuan; Kroeker, Randall; Kipfer, Hal D; Lin, Chen

2012-08-01

To develop a new pulse sequence called time-resolved angiography with stochastic trajectories (TWIST) Dixon for dynamic contrast enhanced magnetic resonance imaging (DCE-MRI). The method combines dual-echo Dixon to generate separated water and fat images with a k-space view-sharing scheme developed for 3D TWIST. The performance of TWIST Dixon was compared with a volume interpolated breathhold examination (VIBE) sequence paired with spectrally selective adiabatic inversion Recovery (SPAIR) and quick fat-sat (QFS) fat-suppression techniques at 3.0T using quantitative measurements of fat-suppression accuracy and signal-to-noise ratio (SNR) efficiency, as well as qualitative breast image evaluations. The water fraction of a uniform phantom was calculated from the following images: 0.66 ± 0.03 for TWIST Dixon; 0.56 ± 0.23 for VIBE-SPAIR, and 0.53 ± 0.14 for VIBE-QFS, while the reference value is 0.70 measured by spectroscopy. For phantoms with contrast (Gd-BOPTA) concentration ranging from 0-6 mM, TWIST Dixon also provides consistently higher SNR efficiency (3.2-18.9) compared with VIBE-SPAIR (2.8-16.8) and VIBE-QFS (2.4-12.5). Breast images acquired with TWIST Dixon at 3.0T show more robust and uniform fat suppression and superior overall image quality compared with VIBE-SPAIR. The results from phantom and volunteer evaluation suggest that TWIST Dixon outperforms conventional methods in almost every aspect and it is a promising method for DCE-MRI and contrast-enhanced perfusion MRI, especially at higher field strength where fat suppression is challenging. Copyright © 2012 Wiley Periodicals, Inc.

Spectral perturbations from silicon diode detector encapsulation and shielding in photon fields.

PubMed

Eklund, Karin; Ahnesjö, Anders

2010-11-01

Silicon diodes are widely used as detectors for relative dose measurements in radiotherapy. The common manufacturing practice is to encapsulate the diodes in plastic for protection and to facilitate mounting in scanning devices. Diodes intended for use in photon fields commonly also have a shield of a high atomic number material (usually tungsten) integrated into the encapsulation to selectively absorb low-energy photons to which silicon diodes would otherwise over-response. However, new response models based on cavity theories and spectra calculations have been proposed for direct correction of the readout from unshielded (e.g., "electron") diodes used in photon fields. This raises the question whether it is correct to assume that the spectrum in a water phantom at the location of the detector cavity is not perturbed by the detector encapsulation materials. The aim of this work is to investigate the spectral effects of typical encapsulations, including shielding, used for clinical diodes. The effects of detector encapsulation of an unshielded and a shielded commercial diode on the spectra at the detector cavity location are studied through Monte Carlo simulations with PENELOPE-2005. Variance reduction based on correlated sampling is applied to reduce the CPU time needed for the simulations. The use of correlated sampling is found to be efficient and to not introduce any significant bias to the results. Compared to reference spectra calculated in water, the encapsulation for an unshielded diode is demonstrated to not perturb the spectrum, while a tungsten shielded diode caused not only the desired decrease in low-energy scattered photons but also a large increase of the primary electron fluence. Measurements with a shielded diode in a 6 MV photon beam proved that the shielding does not completely remove the field-size dependence of the detector response caused by the over-response from low-energy photons. Response factors of a properly corrected unshielded diode were shown to give comparable, or better, results than the traditionally used shielded diode. Spectra calculated for photon fields in water can be directly used for modeling the response of unshielded silicon diodes with plastic encapsulations. Unshielded diodes used together with appropriate corrections can replace shielded diodes in photon dose measurements.

Echo-Planar Imaging for a 9.4 Tesla Vertical-Bore Superconducting Magnet Using an Unshielded Gradient Coil

PubMed Central

KODAMA, Nao; KOSE, Katsumi

2016-01-01

Echo-planar imaging (EPI) sequences were developed for a 9.4 Tesla vertical standard bore (∼54 mm) superconducting magnet using an unshielded gradient coil optimized for live mice imaging and a data correction technique with reference scans. Because EPI requires fast switching of intense magnetic field gradients, eddy currents were induced in the surrounding metallic materials, e.g., the room temperature bore, and this produced serious artifacts on the EPI images. We solved the problem using an unshielded gradient coil set of proper size (outer diameter = 39 mm, inner diameter = 32 mm) with time control of the current rise and reference scans. The obtained EPI images of a phantom and a plant sample were almost artifact-free and demonstrated the promise of our approach. PMID:27001398

Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

NASA Astrophysics Data System (ADS)

Chen, Alexander Y.; Beloborodov, Andrei M.

2017-08-01

The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

Conducting wall Hall thrusters in magnetic shielding and standard configurations

NASA Astrophysics Data System (ADS)

Grimaud, Lou; Mazouffre, Stéphane

2017-07-01

Traditional Hall thrusters are fitted with boron nitride dielectric discharge channels that confine the plasma discharge. Wall properties have significant effects on the performances and stability of the thrusters. In magnetically shielded thrusters, interactions between the plasma and the walls are greatly reduced, and the potential drop responsible for ion acceleration is situated outside the channel. This opens the way to the utilization of alternative materials for the discharge channel. In this work, graphite walls are compared to BN-SiO2 walls in the 200 W magnetically shielded ISCT200-MS and the unshielded ISCT200-US Hall thrusters. The magnetically shielded thruster shows no significant change in the discharge current mean value and oscillations, while the unshielded thruster's discharge current increases by 25% and becomes noticeably less stable. The electric field profile is also investigated through laser spectroscopy, and no significant difference is recorded between the ceramic and graphite cases for the shielded thruster. The unshielded thruster, on the other hand, has its acceleration region shifted 15% of the channel length downstream. Lastly, the plume profile is measured with planar probes fitted with guard rings. Once again the material wall has little influence on the plume characteristics in the shielded thruster, while the unshielded one is significantly affected.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Recovery and radiation corrections and time constants of several sizes of shielded and unshielded thermocouple probes for measuring gas temperature

NASA Technical Reports Server (NTRS)

Glawe, G. E.; Holanda, R.; Krause, L. N.

1978-01-01

Performance characteristics were experimentally determined for several sizes of a shielded and unshielded thermocouple probe design. The probes are of swaged construction and were made of type K wire with a stainless steel sheath and shield and MgO insulation. The wire sizes ranged from 0.03- to 1.02-mm diameter for the unshielded design and from 0.16- to 0.81-mm diameter for the shielded design. The probes were tested through a Mach number range of 0.2 to 0.9, through a temperature range of room ambient to 1420 K, and through a total-pressure range of 0.03 to 0.2.2 MPa (0.3 to 22 atm). Tables and graphs are presented to aid in selecting a particular type and size. Recovery corrections, radiation corrections, and time constants were determined.

Light intensity compressor

DOEpatents

Rushford, Michael C.

1990-02-06

In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

Light intensity compressor

DOEpatents

Rushford, Michael C.

1990-01-01

In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

Local Area Networks.

ERIC Educational Resources Information Center

Marks, Kenneth E.; Nielsen, Steven

1991-01-01

Discusses cabling that is needed in local area networks (LANs). Types of cables that may be selected are described, including twisted pair, coaxial cables (or ethernet), and fiber optics; network topologies, the manner in which the cables are laid out, are considered; and cable installation issues are discussed. (LRW)

Integrated Networks.

ERIC Educational Resources Information Center

Robinovitz, Stewart

1987-01-01

A strategy for integrated data and voice networks implemented at the University of Michigan is described. These networks often use multi-technologies, multi-vendors, and multi-transmission media that will be fused into a single integrated network. Transmission media include twisted-pair wire, coaxial cable, fiber optics, and microwave. (Author/MLW)

A versatile small form factor twisted-pair TFC FMC for MTCA AMCs

NASA Astrophysics Data System (ADS)

Meder, L.; Lebedev, J.; Becker, J.

2017-03-01

In continuous readout systems of particle physics experiments, the provision of a common clock and time reference and the distribution of critical low latency messages to the processing and fronted layers of the readout are crucial tasks. In the context of the Compressed Baryonic Matter (CBM) experiment, a versatile small form factor Timing and Fast-Control (TFC) interfacing FPGA Mezzanine Card (FMC) was developed, offering bidirectional twisted-pair (TP) links for the communication between TFC nodes. Also a versatile clocking including voltage controlled oscillators and a connection to the telecommunication clock lines of mTCA crates are available. Being designed for both TFC Master and Slaves, the card allows rapid system developments without additional Slave hardware circuits. Measurements show that it is possible to transmit over cable lengths of 25 m at a rate of 240 Mbit/s for all data channels simultaneously. A TFC Master-Slave system using two of these cards can be synchronized with a precision of ±10 ps to an user-defined phase setpoint.

Characteristics of Partial Discharge and Ozone Generation for Twisted-pair of Enameled Wires under High-repetitive Impulse Voltage Application

NASA Astrophysics Data System (ADS)

Kanazawa, Seiji; Enokizono, Masato; Shibakita, Toshihide; Umehara, Eiji; Toshimitsu, Jun; Ninomiya, Shinji; Taniguchi, Hideki; Abe, Yukari

In recent years, inverter drive machines such as a hybrid vehicle and an electric vehicle are operated under high voltage pulse with high repetition rate. In this case, inverter surge is generated and affected the machine operation. Especially, the enameled wire of a motor is deteriorated due to the partial discharge (PD) and finally breakdown of the wire will occur. In order to investigate a PD on a resistant enameled wire, characteristics of PD in the twisted pair sample under bipolar repetitive impulse voltages are investigated experimentally. The relationship between the applied voltage and discharge current was measured at PD inception and extinction, and we estimated the repetitive PD inception and extinction voltages experimentally. The corresponding optical emission of the discharge was also observed by using an ICCD camera. Furthermore, ozone concentration due to the discharge was measured during the life-time test of the resistant enameled wires from a working environmental point of view.

Liquid droplet sensing using twisted optical fiber couplers fabricated by hydrofluoric acid flow etching

NASA Astrophysics Data System (ADS)

Son, Gyeongho; Jung, Youngho; Yu, Kyoungsik

2017-04-01

We report a directional-coupler-based refractive index sensor and its cost-effective fabrication method using hydrofluoric acid droplet wet-etching and surface-tension-driven liquid flows. The proposed fiber sensor consists of a pair of twisted tapered optical fibers with low excess losses. The fiber cores in the etched microfiber region are exposed to the surrounding medium for efficient interaction with the guided light. We observe that the etching-based low-loss fiber-optic sensors can measure the water droplet volume by detecting the refractive index changes of the surrounding medium around the etched fiber core region.

Unshielded and Shielded Facility Nondestructive Inspection (NDI) Radiation Protection Survey for F.S. Gabreski ANGB, NY

DTIC Science & Technology

2013-11-06

safety regulations to include a review of worker radiation dosimetry and radiation safety training records was completed. c. Survey Personnel...that is based upon T.O. 33B-1-1, 10 CFR 20, and AFMAN 48-125, Personnel Ionizing Radiation Dosimetry . (1) Verify unshielded/shielded NDI safety...rope barriers marked with appropriate signage as required by T.O. 33B-1-1. (4) Verify x-ray shot and personal radiation dosimetry logs were properly

Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

PubMed

Olson, Wilma K; Swigon, David; Coleman, Bernard D

2004-07-15

Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

Thickness-shear and thickness-twist modes in an AT-cut quartz acoustic wave filter.

PubMed

Zhao, Zinan; Qian, Zhenghua; Wang, Bin; Yang, Jiashi

2015-04-01

We studied thickness-shear and thickness-twist vibrations of a monolithic, two-pole crystal filter made from a plate of AT-cut quartz. The scalar differential equations derived by Tiersten and Smythe for electroded and unelectroded quartz plates were employed which are valid for both the fundamental and the overtone modes. Exact solutions for the free vibration resonant frequencies and modes were obtained from the equations. For a structurally symmetric filter, the modes can be separated into symmetric and antisymmetric ones. Trapped modes with vibrations mainly under the electrodes were found. The effect of the distance between the two pairs of electrodes was examined. Copyright © 2015 Elsevier B.V. All rights reserved.

Di-hadron production at Jefferson Laboratory

NASA Astrophysics Data System (ADS)

Anefalos Pereira, Sergio; CLAS Collaboration

2015-04-01

Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Pair of hadrons (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complements single-hadron SIDIS. The study of di-hadrons allow us to study higher twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs (f 1, g 1, h 1), the Higher Twist (HT) e and hL functions are very interesting because they offer insights into the physics of the largely unexplored quark-gluon correlations which provide direct and unique insights into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on beam-, target- and double-spin asymmetries will be presented.

On the use of unshielded cables in ionization chamber dosimetry for total-skin electron therapy.

PubMed

Chen, Z; Agostinelli, A; Nath, R

1998-03-01

The dosimetry of total-skin electron therapy (TSET) usually requires ionization chamber measurements in a large electron beam (up to 120 cm x 200 cm). Exposing the chamber's electric cable, its connector and part of the extension cable to the large electron beam will introduce unwanted electronic signals that may lead to inaccurate dosimetry results. While the best strategy to minimize the cable-induced electronic signal is to shield the cables and its connector from the primary electrons, as has been recommended by the AAPM Task Group Report 23 on TSET, cables without additional shielding are often used in TSET dosimetry measurements for logistic reasons, for example when an automatic scanning dosimetry is used. This paper systematically investigates the consequences and the acceptability of using an unshielded cable in ionization chamber dosimetry in a large TSET electron beam. In this paper, we separate cable-induced signals into two types. The type-I signal includes all charges induced which do not change sign upon switching the chamber polarity, and type II includes all those that do. The type-I signal is easily cancelled by the polarity averaging method. The type-II cable-induced signal is independent of the depth of the chamber in a phantom and its magnitude relative to the true signal determines the acceptability of a cable for use under unshielded conditions. Three different cables were evaluated in two different TSET beams in this investigation. For dosimetry near the depth of maximum buildup, the cable-induced dosimetry error was found to be less than 0.2% when the two-polarity averaging technique was applied. At greater depths, the relative dosimetry error was found to increase at a rate approximately equal to the inverse of the electron depth dose. Since the application of the two-polarity averaging technique requires a constant-irradiation condition, it was demonstrated than an additional error of up to 4% could be introduced if the unshielded cable's spatial configuration were altered during the two-polarity measurements. This suggests that automatic scanning systems with unshielded cables should not be used in TSET ionization chamber dosimetry. However, the data did show that an unshielded cable may be used in TSET ionization chamber dosimetry if the size of cable-induced error in a given TSET beam is pre-evaluated and the measurement is carefully conducted. When such an evaluation has not been performed, additional shielding should be applied to the cable being used, making measurements at multiple points difficult.

Large discharge-volume, silent discharge spark plug

DOEpatents

Kang, Michael

1995-01-01

A large discharge-volume spark plug for providing self-limiting microdischarges. The apparatus includes a generally spark plug-shaped arrangement of a pair of electrodes, where either of the two coaxial electrodes is substantially shielded by a dielectric barrier from a direct discharge from the other electrode, the unshielded electrode and the dielectric barrier forming an annular volume in which self-terminating microdischarges occur when alternating high voltage is applied to the center electrode. The large area over which the discharges occur, and the large number of possible discharges within the period of an engine cycle, make the present silent discharge plasma spark plug suitable for use as an ignition source for engines. In the situation, where a single discharge is effective in causing ignition of the combustible gases, a conventional single-polarity, single-pulse, spark plug voltage supply may be used.

Evaluation of several additional dry lubricants for spacecraft applications

NASA Technical Reports Server (NTRS)

Vest, C. E.

1973-01-01

Four transfer-film ball-bearing retainer materials were evaluated for their lubricating ability and wear capability under conditions of 120-gram radial load, 450-gram axial load, 3600-rpm unidirectional rotation, 23 C ambient temperature, and less than .1 microtorr pressure, using R-2 sized unshielded ball bearings. The 'stop-test' criterion was a total of one billion revolutions or a torque buildup greater than 18 gm-cm per bearing pair. A PTFE-fiberglass-MoS2 composite, a PTFE-bronze composite, and a tantalum-molybdenum-MoS2 composite operated for one billion revolutions without reaching the 18-gram torque limit. A p-oxybenzoyl polymer-MoS2 composite operated sixteen million revolutions before reaching the 18-gm cm stop-test torque. The first three materials are considered as suitable lubricants under the test conditions employed.

3D Cones Acquisition of Human Extremity Imaging Using a 1.5T Superconducting Magnet and an Unshielded Gradient Coil Set.

PubMed

Setoi, Ayana; Kose, Katsumi

2018-05-16

We developed ultrashort echo-time (UTE) imaging sequences with 3D Cones trajectories for a home-built compact MRI system using a 1.5T superconducting magnet and an unshielded gradient coil set. We achieved less than 7 min imaging time and obtained clear in vivo images of a human forearm with a TE of 0.4 ms. We concluded that UTE imaging using 3D Cones acquisition was successfully implemented in our 1.5T MRI system.

Unconventional superconductivity in magic-angle graphene superlattices.

PubMed

Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

2018-04-05

The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity-which cannot be explained by weak electron-phonon interactions-in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°-the first 'magic' angle-the electronic band structure of this 'twisted bilayer graphene' exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature-carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 10 11 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

Unconventional superconductivity in magic-angle graphene superlattices

NASA Astrophysics Data System (ADS)

Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

2018-04-01

The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity—which cannot be explained by weak electron–phonon interactions—in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°—the first ‘magic’ angle—the electronic band structure of this ‘twisted bilayer graphene’ exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature–carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 1011 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

Here's Looking at You, Kid.

ERIC Educational Resources Information Center

Milshtein, Amy

1997-01-01

The University of Maryland at College Park installed 25 surveillance cameras to combat crime. A minimum of disruption occurred because unused twisted pair wires left in place when the conversion to a fiber optic telephone system was made could be used for the camera installations. The campus is safer, and its budget is intact. (RE)

4-twist helix snake to maintain polarization in multi-GeV proton rings

DOE PAGES

Antoulinakis, F.; Chen, Y.; Dutton, A.; ...

2017-09-27

Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

4-twist helix snake to maintain polarization in multi-GeV proton rings

NASA Astrophysics Data System (ADS)

Antoulinakis, F.; Chen, Y.; Dutton, A.; Rossi De La Fuente, E.; Haupert, S.; Ljungman, E. A.; Myers, P. D.; Thompson, J. K.; Tai, A.; Aidala, C. A.; Courant, E. D.; Krisch, A. D.; Leonova, M. A.; Lorenzon, W.; Raymond, R. S.; Sivers, D. W.; Wong, V. K.; Yang, T.; Derbenev, Y. S.; Morozov, V. S.; Kondratenko, A. M.

2017-09-01

Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven's 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab's 120 GeV /c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9 - 120 GeV /c range. We found that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. This snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.

4-twist helix snake to maintain polarization in multi-GeV proton rings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antoulinakis, F.; Chen, Y.; Dutton, A.

Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

A Study of Dean Vortex Development and Structure in a Curved Rectangular Channel with Aspect Ratio of 40 at Dean Numbers up to 430

NASA Technical Reports Server (NTRS)

Ligrani, Phillip M.

1994-01-01

Flow in a curved channel with mild curvature, an aspect ratio of 40 to 1, and an inner to outer radius ratio of 0.979 is studied at Dean numbers De ranging from 35 to 430. For positions from the start of curvature ranging from 85 to 145 degrees, the sequence of transition events begins with curved channel Poiseuille flow at De less than 40-64. As the Dean number increases, observations show initial development of Dean vortex pairs, followed by symmetric vortex pairs which, when viewed in spanwise/radial planes, cover the entire channel height (De=90-100). At De from 40 to 125-130, the vortex pairs often develop intermittent waviness in the form of vortex undulations. Splitting and merging of vortex pairs is also observed over the same experimental conditions as well as at higher De. When Dean numbers range from 130 to 185-200, the undulating wavy mode is replaced by a twisting mode with higher amplitudes of oscillation and shorter wavelengths. The twisting wavy mode results in the development of regions where turbulence intensity is locally augmented at Dean numbers from 150 to 185-200, principally in the upwash regions between the two individual vortices which make up each vortex pair. These turbulent regions eventually increase in intensity and spatial extent as the Dean number increases further, until individual regions merge together so that the entire cross section of the channel contains chaotic turbulent motions. When Dean numbers then reach 400-435, spectra of velocity fluctuations then evidence fully turbulent flow.

Report on twisted nematic and supertwisted nematic device characterization program

NASA Technical Reports Server (NTRS)

1995-01-01

In this study we measured the optical characteristics of normally white twisted nematic (NWTN) and super twisted nematic (STN ) cells. Though no dynamic computer model was available, the static observations were compared with computer simulated behavior. The measurements were taken as a function of both viewing angle and applied voltage and included in the static case not only luminance but also contrast ratio and chromaticity . We employed the computer model Twist Cell Optics, developed at Kent State in conjunction with this study, and whose optical modeling foundation, Iike the ViDEOS program, is the 4 x 4 matrix method of Berreman. In order to resolve discrepancies between the experimental and modeled data the optical parameters of the individual cell components, where not known, were determined using refractometry, profilometry, and various forms of ellipsometry. The resulting agreement between experiment and model is quite good due primarily to a better understanding of the structure and optics of dichroic sheet polarizers. A description of the model and test cells employed are given in section 2. Section 3 contains the experimental data gathered and section 4 gives examples of the fit between model and experiment. Also included with this report are a pair of papers which resulted from the research and which detail the polarizer properties and some of the cell characterization methods.

Modeling and testing of ethernet transformers

NASA Astrophysics Data System (ADS)

Bowen, David

2011-12-01

Twisted-pair Ethernet is now the standard home and office last-mile network technology. For decades, the IEEE standard that defines Ethernet has required electrical isolation between the twisted pair cable and the Ethernet device. So, for decades, every Ethernet interface has used magnetic core Ethernet transformers to isolate Ethernet devices and keep users safe in the event of a potentially dangerous fault on the network media. The current state-of-the-art Ethernet transformers are miniature (<5mm diameter) ferrite-core toroids wrapped with approximately 10 to 30 turns of wire. As small as current Ethernet transformers are, they still limit further Ethernet device miniaturization and require a separate bulky package or jack housing. New coupler designs must be explored which are capable of exceptional miniaturization or on-chip fabrication. This dissertation thoroughly explores the performance of the current commercial Ethernet transformers to both increase understanding of the device's behavior and outline performance parameters for replacement devices. Lumped element and distributed circuit models are derived; testing schemes are developed and used to extract model parameters from commercial Ethernet devices. Transfer relation measurements of the commercial Ethernet transformers are compared against the model's behavior and it is found that the tuned, distributed models produce the best transfer relation match to the measured data. Process descriptions and testing results on fabricated thin-film dielectric-core toroid transformers are presented. The best results were found for a 32-turn transformer loaded with 100Ω, the impedance of twisted pair cable. This transformer gave a flat response from about 10MHz to 40MHz with a height of approximately 0.45. For the fabricated transformer structures, theoretical methods to determine resistance, capacitance and inductance are presented. A special analytical and numerical analysis of the fabricated transformer inductance is presented. Planar cuts of magnetic slope fields around the dielectric-core toroid are shown that describe the effect of core height and winding density on flux uniformity without a magnetic core.

Note: Unshielded bilateral magnetoencephalography system using two-dimensional gradiometers

NASA Astrophysics Data System (ADS)

Seki, Yusuke; Kandori, Akihiko; Ogata, Kuniomi; Miyashita, Tsuyoshi; Kumagai, Yukio; Ohnuma, Mitsuru; Konaka, Kuni; Naritomi, Hiroaki

2010-09-01

Magnetoencephalography (MEG) noninvasively measures neuronal activity with high temporal resolution. The aim of this study was to develop a new type of MEG system that can measure bilateral MEG waveforms without a magnetically shielded room, which is an obstacle to reducing both the cost and size of an MEG system. An unshielded bilateral MEG system was developed using four two-dimensional (2D) gradiometers and two symmetric cryostats. The 2D gradiometer, which is based on a low-Tc superconducting quantum interference device and wire-wound pickup coil detects a magnetic-field gradient in two orthogonal directions, or ∂/∂x(∂2Bz/∂z2), and reduces environmental magnetic-field noise by more than 50 dB. The cryostats can be symmetrically positioned in three directions: vertical, horizontal, and rotational. This makes it possible to detect bilateral neuronal activity in the cerebral cortex simultaneously. Bilateral auditory-evoked fields (AEF) of 18 elderly subjects were measured in an unshielded hospital environment using the MEG system. As a result, both the ipsilateral and the contralateral AEF component N100m, which is the magnetic counterpart of electric N100 in electroencephalography and appears about 100 ms after the onset of an auditory stimulus, were successfully detected for all the subjects. Moreover, the ipsilateral P50m and the contralateral P50m were also detected for 12 (67%) and 16 (89%) subjects, respectively. Experimental results demonstrate that the unshielded bilateral MEG system can detect MEG waveforms, which are associated with brain dysfunction such as epilepsy, Alzheimer's disease, and Down syndrome.

Silicon diodes as an alternative to diamond detectors for depth dose curves and profile measurements of photon and electron radiation.

PubMed

Scherf, Christian; Peter, Christiane; Moog, Jussi; Licher, Jörg; Kara, Eugen; Zink, Klemens; Rödel, Claus; Ramm, Ulla

2009-08-01

Depth dose curves and lateral dose profiles should correspond to relative dose to water in any measured point, what can be more or less satisfied with different detectors. Diamond as detector material has similar dosimetric properties like water. Silicon diodes and ionization chambers are also commonly used to acquire dose profiles. The authors compared dose profiles measured in an MP3 water phantom with a diamond detector 60003, unshielded and shielded silicon diodes 60008 and 60012 and a 0.125-cm(3) thimble chamber 233642 (PTW, Freiburg, Germany) for 6- and 25-MV photons. Electron beams of 6, 12 and 18 MeV were investigated with the diamond detector, the unshielded diode and a Markus chamber 23343. The unshielded diode revealed relative dose differences at the water surface below +10% for 6-MV and +4% for 25-MV photons compared to the diamond data. These values decreased to less than 1% within the first millimeters of water depth. The shielded diode was only required to obtain correct data of the fall-off zones for photon beams larger than 10 x 10 cm(2) because of important contributions of low-energy scattered photons. For electron radiation the largest relative dose difference of -2% was observed with the unshielded silicon diode for 6 MeV within the build-up zone. Spatial resolutions were always best with the small voluminous silicon diodes. Relative dose profiles obtained with the two silicon diodes have the same degree of accuracy as with the diamond detector.

Effects of shielded or unshielded laser and electrohydraulic lithotripsy on rabbit bladder.

PubMed

Bhatta, K M; Rosen, D I; Flotte, T J; Dretler, S P; Nishioka, N S

1990-04-01

The pulsed dye laser and electrohydraulic lithotriptor (EHL) are both effective devices for fragmenting urinary and biliary calculi. Both fragment stones by producing a plasma-mediated shockwave. Recently, a plasma shield consisting of a hollow spring and a metal end cap has been described for use with the laser and EHL devices in an attempt to minimize tissue damage without adversely affecting stone fragmentation rates. The tissue effects produced by a pulsed dye laser and an EHL device with and without plasma shields were examined and compared using rabbit urinary bladders. If blood was present, the unshielded laser perforated the bladder wall in two pulses. However, in the absence of blood, over 100 pulses were needed for the laser to perforate the bladder. A mean of six pulses were required to perforate the bladder wall with a shielded laser. The unshielded EHL perforated the bladder wall in two pulses, whereas, the shielded EHL required a mean of 35 pulses. Microscopically, areas of exposure revealed hemorrhage and tissue ablation. We conclude that all devices examined can produce significant tissue damage when discharged directly onto bladder epithelium.

The effects of high voltage transmission lines on honey bees. Interim report. [765 kV transmission line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenberg, B.; Kunich, J.C.; Bindokas, V.P.

1978-10-01

Results of the first year's field study of possible effects on honey bees of a 765 kV transmission line are reported. Conventional hives and metal-free hives, shielded and unshielded, were placed under the line (E-field, ca. 7 kV/m) and in a control area (E-field, ca. 10 V/m) about 400 m away. Bees in unshielded conventional hives under the line weighed less, stored little honey whose moisture content was subnormal (hive weight gain was essentially zero), propolyzed hive entrances excessively but not completely, produced fewer pupae but normal numbers of eggs and larvae, and failed to survive the winter. Unshielded metal-freemore » hives under the line had the following normal features: bee weight; hive weight gain; honey moisture content; and number of eggs, larvae, and pupae. Their abnormal features were: propolization of hive entrances, but at a slower rate and to a lesser extent than conventional hives; aggressive clusters of bees at lower front hive corners; poor overwintering survival; and possibly higher hemocyte counts.« less

Oblique abdominal muscle activity in response to external perturbations when pushing a cart.

PubMed

Lee, Yun-Ju; Hoozemans, Marco J M; van Dieën, Jaap H

2010-05-07

Cyclic activation of the external and internal oblique muscles contributes to twisting moments during normal gait. During pushing while walking, it is not well understood how these muscles respond to presence of predictable (cyclic push-off forces) and unpredictable (external) perturbations that occur in pushing tasks. We hypothesized that the predictable perturbations due to the cyclic push-off forces would be associated with cyclic muscle activity, while external perturbations would be counteracted by cocontraction of the oblique abdominal muscles. Eight healthy male subjects pushed at two target forces and two handle heights in a static condition and while walking without and with external perturbations. For all pushing tasks, the median, the static (10th percentile) and the peak levels (90th percentile) of the electromyographic amplitudes were determined. Linear models with oblique abdominal EMGs and trunk angles as input were fit to the twisting moments, to estimate trunk stiffness. There was no significant difference between the static EMG levels in pushing while walking compared to the peak levels in pushing while standing. When pushing while walking, the additional dynamic activity was associated with the twisting moments, which were actively modulated by the pairs of oblique muscles as in normal gait. The median and static levels of trunk muscle activity and estimated trunk stiffness were significantly higher when perturbations occurred than without perturbations. The increase baseline of muscle activity indicated cocontraction of the antagonistic muscle pairs. Furthermore, this cocontraction resulted in an increased trunk stiffness around the longitudinal axis. Copyright 2010 Elsevier Ltd. All rights reserved.

Di-hadron production at Jefferson Lab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anefalos Pereira, Sergio; et. al.,

Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Hadron pair (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complement single hadron SIDIS. Di-hadrons allow the study of low- and high-twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs ( f1, g1, h1), the Higher Twist (HT) e and hL functions are very interesting becausemore » they offer insights into the physics of the largely unexplored quark-gluon correlations, which provide access into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on di-hadron beam-, target- and double-spin asymmetries will be presented.« less

Efficacy of a radiation absorbing shield in reducing dose to the interventionalist during peripheral endovascular procedures: a single centre pilot study.

PubMed

Power, S; Mirza, M; Thakorlal, A; Ganai, B; Gavagan, L D; Given, M F; Lee, M J

2015-06-01

This prospective pilot study was undertaken to evaluate the feasibility and effectiveness of using a radiation absorbing shield to reduce operator dose from scatter during lower limb endovascular procedures. A commercially available bismuth shield system (RADPAD) was used. Sixty consecutive patients undergoing lower limb angioplasty were included. Thirty procedures were performed without the RADPAD (control group) and thirty with the RADPAD (study group). Two separate methods were used to measure dose to a single operator. Thermoluminescent dosimeter (TLD) badges were used to measure hand, eye, and unshielded body dose. A direct dosimeter with digital readout was also used to measure eye and unshielded body dose. To allow for variation between control and study groups, dose per unit time was calculated. TLD results demonstrated a significant reduction in median body dose per unit time for the study group compared with controls (p = 0.001), corresponding to a mean dose reduction rate of 65 %. Median eye and hand dose per unit time were also reduced in the study group compared with control group, however, this was not statistically significant (p = 0.081 for eye, p = 0.628 for hand). Direct dosimeter readings also showed statistically significant reduction in median unshielded body dose rate for the study group compared with controls (p = 0.037). Eye dose rate was reduced for the study group but this was not statistically significant (p = 0.142). Initial results are encouraging. Use of the shield resulted in a statistically significant reduction in unshielded dose to the operator's body. Measured dose to the eye and hand of operator were also reduced but did not reach statistical significance in this pilot study.

Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

PubMed Central

Ghorbani, Maryam; Mohammad-Rafiee, Farshid

2011-01-01

We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

Crystal structure of a four-stranded intercalated DNA: d(C4)

NASA Technical Reports Server (NTRS)

Chen, L.; Cai, L.; Zhang, X.; Rich, A.

1994-01-01

The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

High-resolution inchworm linear motor based on electrostatic twisting microactuators

NASA Astrophysics Data System (ADS)

Kim, Sang-Ho; Hwang, Il-Han; Jo, Kyoung-Woo; Yoon, Eui-Sung; Lee, Jong-Hyun

2005-09-01

A new inchworm micromotor using new electrostatic in-plane twisting microactuators has been designed, fabricated and characterized for nano-resolution manipulators. The proposed twisting mechanism was implemented employing a pair of differential electrostatic actuators with a high stiffness in the driving direction for stable positioning. The electromechanically coupled motion of the voltage-displacement relation was analyzed using a finite element method (FEM), confirming that the twisting actuator makes a tiny step movement efficiently. The proposed actuator was fabricated on a silicon-on-insulator (SOI) wafer with the device footprint of 2.2 × 2.8 mm2, and its nano-stepping characteristics were measured by an optical interferometer consisting of an integrated micromirror and optical fiber. The fabricated inchworm motor showed a minimum step displacement of 5.2 ± 3.8 nm (2σ) and 4.1 ± 2.9 nm (2σ) for cyclic motion in the +y- and the -y-directions, respectively, with the gripping voltage of 15 V and differential voltage of 1 V. As a result, the proposed inchworm micromotor could operate with a stroke of 3 µm and a bi-directional step displacement of less than 10 nm. The step displacement is the smallest value of in-plane-type micromotors so far, and its magnitude was controllable up to 120 nm/cycle by changing the differential voltage.

Fiber optic data link for data acquisition and analysis

NASA Astrophysics Data System (ADS)

Saulsberry, Garen

A data link has been designed and developed for use with fiber optics as a transmission medium, though coaxial and twisted pair cable might also be used. Multiple data types may be transferred at various rates up to 100 Mbits per second and data word width may be programmed to obtain the highest level of efficiency from the bit rate.

Active Regions Blossoming

NASA Image and Video Library

2015-10-28

As a pair of active regions began to rotate into view, their towering magnetic field lines above them bloomed into a dazzling display of twisting arches (Oct. 27-28, 2015). Some of the lines reached over and connected with the neighboring active region. Active regions are usually the source of solar storms. The images were taken in a wavelength of extreme ultraviolet light. http://photojournal.jpl.nasa.gov/catalog/PIA20048

Monte Carlo simulations of nematic and chiral nematic shells

NASA Astrophysics Data System (ADS)

Wand, Charlie R.; Bates, Martin A.

2015-01-01

We present a systematic Monte Carlo simulation study of thin nematic and cholesteric shells with planar anchoring using an off-lattice model. The results obtained using the simple model correspond with previously published results for lattice-based systems, with the number, type, and position of defects observed dependent on the shell thickness with four half-strength defects in a tetrahedral arrangement found in very thin shells and a pair of defects in a bipolar (boojum) configuration observed in thicker shells. A third intermediate defect configuration is occasionally observed for intermediate thickness shells, which is stabilized in noncentrosymmetric shells of nonuniform thickness. Chiral nematic (cholesteric) shells are investigated by including a chiral term in the potential. Decreasing the pitch of the chiral nematic leads to a twisted bipolar (chiral boojum) configuration with the director twist increasing from the inner to the outer surface.

Folded supersymmetry with a twist

DOE PAGES

Cohen, Timothy; Craig, Nathaniel; Lou, Hou Keong; ...

2016-03-30

Folded supersymmetry (f-SUSY) stabilizes the weak scale against radiative corrections from the top sector via scalar partners whose gauge quantum numbers differ from their Standard Model counterparts. This non-trivial pairing of states can be realized in extra-dimensional theories with appropriate supersymmetry-breaking boundary conditions. We present a class of calculable f-SUSY models that are parametrized by a non-trivial twist in 5D boundary conditions and can accommodate the observed Higgs mass and couplings. Although the distinctive phenomenology associated with the novel folded states should provide strong evidence for this mechanism, the most stringent constraints are currently placed by conventional supersymmetry searches. Asmore » a result, these models remain minimally fine-tuned in light of LHC8 data and provide a range of both standard and exotic signatures accessible at LHC13.« less

The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

NASA Astrophysics Data System (ADS)

Manning, Gerald S.

2015-09-01

We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA.

PubMed

Manning, Gerald S

2015-09-14

We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity-a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

Three-dimensional doubly diffusive convectons: instability and transition to complex dynamics

NASA Astrophysics Data System (ADS)

Knobloch, Edgar; Beaume, Cedric; Bergeon, Alain

2017-11-01

Doubly diffusive convection in a closed vertically extended 3D container driven by competing horizontal temperature and concentration gradients is studied. No-slip boundary conditions are imposed. The buoyancy number N = - 1 to ensure the presence of a conduction state. The primary instability is subcritical and generates two families of spatially localised steady states known as convectons. The convectons bifurcate directly from the conduction state and are organized in a pair of primary branches that snake within a well-defined range of Rayleigh numbers as the convectons grow in length. Secondary instabilities generating twist result in secondary snaking branches of twisted convectons. These destabilize the primary convectons and are responsible for the absence of stable steady states, localized or otherwise, in the subcritical regime. As a result, once the Rayleigh number for the primary instability of the conduction state is exceeded, the system exhibits an abrupt transition to large amplitude spatio-temporal chaos that arises whenever the twist instability leading to collapse is faster than the nucleation time for new rolls. These numerical results are confirmed by determining the stability properties of all convecton states as well as spatially extended convection. Supported in part by the National Science Foundation under Grant DMS-1613132.

The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manning, Gerald S., E-mail: jerrymanning@rcn.com

We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helicalmore » spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.« less

Measurements of occupational exposure for a technologist performing 18F FDG PET scans.

PubMed

Biran, Talma; Weininger, Jolie; Malchi, Shalom; Marciano, Rami; Chisin, Roland

2004-11-01

Radiation doses to one PET technologist performing 100 18F FDG (18F fluorodeoxyglucose) imaging procedures were measured in a clinical setting using two types of thermoluminescent dosimeter (TLD) badges, one finger-ring TLD and one electronic pocket dosimeter (EPD). 18F FDG was handled either with unshielded or with viewing window tungsten shielded syringes. The resulting doses using unshielded syringes were 13.8 +/- 0.8 microSv/370 MBq and 14.3 +/- 0.4 microSv/370 MBq, measured with TLD 100 and with TLD 700H/600H, respectively. For the same series of measurements, the doses obtained using shielded syringes were 10.7 +/- 0.4 microSv/370 MBq and 7.2 +/- 2.1 microSv/370 MBq with TLD700H/600H and with EPD, respectively. The dose to the right hand from shielded syringes was 69.3 +/- 5.5 microSv/370 MBq. All these values are within the ICRP recommended dose limits. Extrapolated to 725 examinations per year, the resulting effective dose measured with TLD would be 10 mSv with unshielded and 7.5 mSv with shielded syringes, respectively (25% dose reduction). The doses measured by TLD were consistently higher than those measured by EPD, suggesting that EPD measurements might underestimate occupational doses.

Dosimetric characteristics of a new unshielded silicon diode and its application in clinical photon and electron beams.

PubMed

Griessbach, Irmgard; Lapp, Markus; Bohsung, Jörg; Gademann, Günther; Harder, Dietrich

2005-12-01

Shielded p-silicon diodes, frequently applied in general photon-beam dosimetry, show certain imperfections when applied in the small photon fields occurring in stereotactic or intensity modulated radiotherapy (IMRT), in electron beams and in the buildup region of photon beam dose distributions. Using as a study object the shielded p-silicon diode PTW 60008, well known for its reliable performance in general photon dosimetry, we have identified these imperfections as effects of electron scattering at the metallic parts of the shielding. In order to overcome these difficulties a new, unshielded diode PTW 60012 has been designed and manufactured by PTW Freiburg. By comparison with reference detectors, such as thimble and plane-parallel ionization chambers and a diamond detector, we could show the absence of these imperfections. An excellent performance of the new unshielded diode for the special dosimetric tasks in small photon fields, electron beams and build-up regions of photon beams has been observed. The new diode also has an improved angular response. However, due to its over-response to low-energy scattered photons, its recommended range of use does not include output factor measurements in large photon fields, although this effect can be compensated by a thin auxiliary lead shield.

Efficacy of a Radiation Absorbing Shield in Reducing Dose to the Interventionalist During Peripheral Endovascular Procedures: A Single Centre Pilot Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Power, S.; Mirza, M.; Thakorlal, A.

PurposeThis prospective pilot study was undertaken to evaluate the feasibility and effectiveness of using a radiation absorbing shield to reduce operator dose from scatter during lower limb endovascular procedures.Materials and MethodsA commercially available bismuth shield system (RADPAD) was used. Sixty consecutive patients undergoing lower limb angioplasty were included. Thirty procedures were performed without the RADPAD (control group) and thirty with the RADPAD (study group). Two separate methods were used to measure dose to a single operator. Thermoluminescent dosimeter (TLD) badges were used to measure hand, eye, and unshielded body dose. A direct dosimeter with digital readout was also used tomore » measure eye and unshielded body dose. To allow for variation between control and study groups, dose per unit time was calculated.ResultsTLD results demonstrated a significant reduction in median body dose per unit time for the study group compared with controls (p = 0.001), corresponding to a mean dose reduction rate of 65 %. Median eye and hand dose per unit time were also reduced in the study group compared with control group, however, this was not statistically significant (p = 0.081 for eye, p = 0.628 for hand). Direct dosimeter readings also showed statistically significant reduction in median unshielded body dose rate for the study group compared with controls (p = 0.037). Eye dose rate was reduced for the study group but this was not statistically significant (p = 0.142).ConclusionInitial results are encouraging. Use of the shield resulted in a statistically significant reduction in unshielded dose to the operator’s body. Measured dose to the eye and hand of operator were also reduced but did not reach statistical significance in this pilot study.« less

SU-E-T-495: Neutron Induced Electronics Failure Rate Analysis for a Single Room Proton Accelerator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knutson, N; DeWees, T; Klein, E

2014-06-01

Purpose: To determine the failure rate as a function of neutron dose of the range modulator's servo motor controller system (SMCS) while shielded with Borated Polyethylene (BPE) and unshielded in a single room proton accelerator. Methods: Two experimental setups were constructed using two servo motor controllers and two motors. Each SMCS was then placed 30 cm from the end of the plugged proton accelerator applicator. The motor was then turned on and observed from outside of the vault while being irradiated to known neutron doses determined from bubble detector measurements. Anytime the motor deviated from the programmed motion a failuremore » was recorded along with the delivered dose. The experiment was repeated using 9 cm of BPE shielding surrounding the SMCS. Results: Ten SMCS failures were recorded in each experiment. The dose per monitor unit for the unshielded SMCS was 0.0211 mSv/MU and 0.0144 mSv/MU for the shielded SMCS. The mean dose to produce a failure for the unshielded SMCS was 63.5 ± 58.3 mSv versus 17.0 ±12.2 mSv for the shielded. The mean number of MUs between failures were 2297 ± 1891 MU for the unshielded SMCS and 2122 ± 1523 MU for the shielded. A Wilcoxon Signed Ranked test showed the dose between failures were significantly different (P value = 0.044) while the number of MUs between failures were not (P value = 1.000). Statistical analysis determined a SMCS neutron dose of 5.3 mSv produces a 5% chance of failure. Depending on the workload and location of the SMCS, this failure rate could impede clinical workflow. Conclusion: BPE shielding was shown to not reduce the average failure of the SMCS and relocation of the system outside of the accelerator vault was required to lower the failure rate enough to avoid impeding clinical work flow.« less

Estudio de un microcable de par trenzado para la comunicacion y lectura del modulo de pixeles del experimento CMS

NASA Astrophysics Data System (ADS)

Oliveros Tautiva, Sandra Jimena

The Compact Muon Solenoid (CMS) is one of the two most important experiments at the Large Hadron Collider (LHC). The pixel detector is the component closest to the collision in CMS and it receives large doses of radiation which will affect its performance. The pixel detector will be replaced by a new one after four years. The aim is to reduce material in the sensitive zone of the new pixel detector, which leads to the implementation of a type of micro twisted pair cable that will replace the existing kapton cables and some connections will be eliminated. The purpose of this work was to study the viability of using these micro twisted pair cables in the existing 40 MHz analog readout. The electrical parameters of micro cables were determined, and operational tests were performed in a module using these cables for communicating and reading. Three different lengths of micro cables were used, 1.0, 1.5 and 2.0 m, in order to compare test results with those obtained using the kapton cable. It was found that the use of these cables does not affect the programming and reading of the pixels in one module, so the micro cables are viable to be used in place of the kapton cables.

Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

PubMed

Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

2018-06-04

The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

4-Bromo-N-(di-n-propyl-carbamothioyl)-benzamide.

PubMed

Binzet, Gün; Flörke, Ulrich; Külcü, Nevzat; Arslan, Hakan

2009-02-04

The synthesis of the title compound, C(14)H(19)BrN(2)OS, involves the reaction of 4-bromo-benzoyl chloride with potassium thio-cyanate in acetone followed by condensation of the resulting 4-bromo-benzoyl isothio-cyanate with di-n-propyl-amine. Typical thio-urea carbonyl and thio-carbonyl double bonds, as well as shortened C-N bonds, are observed in the title compound. The short C-N bond lengths in the centre of the mol-ecule reveal the effects of resonance in this part of the mol-ecule. The asymmetric unit of the title compound contains two crystallographically independent mol-ecules, A and B. There is very little difference between the bond lengths and angles of these mol-ecules. In mol-ecule B, one di-n-propyl group is twisted in a -anti-periplanar conformation with C-C-C-H = -179.1 (3)° and the other adopts a -synclinal conformation with C-C-C-H = -56.7 (4)°; in mol-ecule A the two di-n-propyl groups are twisted in + and -anti-periplanar conformations, with C-C-C-H = -179.9 (3) and 178.2 (3)°, respectively. In the crystal, the mol-ecules are linked into dimeric pairs via pairs of N-H⋯S hydrogen bonds.

EFFECT OF ABDOMINAL SHIELDING ON THE METABOLISM OF HYDROCORTISONE BY LIVER TISSUE OF X-IRRADIATED RATS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lott, J.R.

Liver slices removed from adult rats at various times following whole body x-irradiations of 850, 1500, and 2000 r were tested for their ability to metabolize hydrocortisone ( free alcohol). The animals were divided into a non- irradiated control group, an irradiated unshielded group, and an abdominal- shielded irradiated group. It was found that the irradiated unshielded liver slices metabo lized the hydrocortisone at a lower rate than control slices. Liver slices removed from animals whose abdominal regions were shielded during irradiation were found to metabolize hydrocortisone at a higher rate than control slices. The effects observed appeared to bemore » dependent on total dosage and time of removal of the liver post-irradiation. (auth)« less

Formation of space-charge bunches in a multivelocity-electron-beam-based microwave oscillator with a cathode unshielded from the magnetic field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalinin, Yu. A.; Starodubov, A. V.; Fokin, A. S., E-mail: alexander1989fokin@mail.ru

The influence of the magnitude and configuration of the magnetic field on the parameters of electron bunches formed in a multivelocity electron beam is analyzed. It is shown that the use of a cathode unshielded from the magnetic field and a nonuniform magnetic field increasing along the drift space enables the formation of compact electron bunches. The ratio between the current density in such bunches and the beam current density at the entrance to the drift space reaches 10{sup 6}, which results in a substantial broadening of the output microwave spectrum due to an increase in the amplitudes of themore » higher harmonics of the fundamental frequency.« less

Differential Models for B-Type Open-Closed Topological Landau-Ginzburg Theories

NASA Astrophysics Data System (ADS)

Babalic, Elena Mirela; Doryn, Dmitry; Lazaroiu, Calin Iuliu; Tavakol, Mehdi

2018-05-01

We propose a family of differential models for B-type open-closed topological Landau-Ginzburg theories defined by a pair (X,W), where X is any non-compact Calabi-Yau manifold and W is any holomorphic complex-valued function defined on X whose critical set is compact. The models are constructed at cochain level using smooth data, including the twisted Dolbeault algebra of polyvector-valued forms and a twisted Dolbeault category of holomorphic factorizations of W. We give explicit proposals for cochain level versions of the bulk and boundary traces and for the bulk-boundary and boundary-bulk maps of the Landau-Ginzburg theory. We prove that most of the axioms of an open-closed TFT (topological field theory) are satisfied on cohomology and conjecture that the remaining two axioms (namely non-degeneracy of bulk and boundary traces and the topological Cardy constraint) are also satisfied.

Does the lead apron and collar always reduce radiation dose?

PubMed

Nortje, C J; Harris, A M; Lackovic, K P; Wood, R E

2001-11-01

The possibility that personal lead shielding devices can increase absorption of radiation has not been entertained. The purpose of the present investigation specifically was to determine whether pituitary dose might be increased when a leaded apron and thyroid collar are used. Thermoluminescent dosimeters (TLDs) were used to measure absorbed dose. They were calibrated at the kVp used in the clinical situation and a calibration curve relating light output to dose was generated. Lithium fluoride TLD discs were placed in the pituitary gland region of a Rando-Alderson female human phantom. The equivalent of 100 transpharyngeal exposures were delivered. The resultant light output from recovered dosimeters was converted to a uGy value using the calibration curve. The experiment was repeated using a 0.25 mm lead equivalent collar and apron fitted to the phantom in the customary manner. The entire process was repeated in order to have 30 dosimeters for the unshielded and 30 dosimeters for the shielded conditions. A further 30 dosimeters were sham irradiated and served as controls. A statistical comparison between unshielded and shielded conditions was performed. When the leaded apron and thyroid collar were used the absorbed dose to the pituitary gland was increased significantly (P < 0.05). Following this a second group, using a different dosimetry system and a male phantom repeated the experiment. In both cases, the shielded phantom received significantly higher dose to the pituitary region than the unshielded.

Structural modeling of HTS tapes and cables

NASA Astrophysics Data System (ADS)

Allen, N. C.; Chiesa, L.; Takayasu, M.

2016-12-01

Structural finite element analysis (FEA) has been used as an insightful tool to investigate the electromechanical behavior of HTS REBCO tapes and twisted stacked-tape cables under tension, torsion, bending and combined loads. A novel technique was developed for modeling the layered composite structure of the 2G tapes with structural solid-shell elements in ANSYS®. The FEA models produced detailed strain information for the REBCO superconducting layer which was then paired with an analytical model to predict the critical current performance of the 2G HTS tapes under various loads. Two commercially available HTS tapes (SuperPower and SuNAM) under tension, torsion and combined tension-torsion were first analyzed with FEA and compared with available experimental results at 77 K. A sharp critical current degradation was experienced at the yield strength of the tapes under tension and below a 100 mm twist-pitch under torsion. Combined tension-torsion loads had a more gradual degradation of critical current for twist-pitches of 115 mm or shorter but had a negligible difference compared to pure tension for longer twist-pitches. Using the structural solid-shell technique for modeling 2G tapes in ANSYS®, an FEA methodology for simulating full scale three-dimensional HTS stacked-tape cables under pure bending was created. A model of a Twisted-Stacked Tape Cable (TSTC), a configuration first proposed at MIT, was initially developed and then adapted to the slotted-core HTS Cable-In-Conduit Conductor produced by the ENEA laboratory in Italy. The numerical axial strain of the HTS REBCO tapes within the cables as calculated by FEA were found to agree with an analytical model for two cases: perfect-slip (frictionless) and no-slip (bonded). The ENEA CICC model was also compared with recent experimental critical current data at 77 K and was found to match best using a low friction coefficient of 0.02 indicating that the tapes within the cable freely slide with respect to each other helping to reduce the axial strain during bending.

The manufacture of flat conductor cable

NASA Technical Reports Server (NTRS)

Angele, W.

1974-01-01

The major techniques are described for fabricating flat conductor cable (FCC). Various types of FCC, including unshielded, shielded, power, and signal, in both existing and conceptual constructions, are covered.

46 CFR 120.330 - Distribution panels and switchboards.

Code of Federal Regulations, 2010 CFR

2010-10-01

... INSTALLATION Power Sources and Distribution Systems § 120.330 Distribution panels and switchboards. (a) Each... vessel's wiring, must not have electrically unshielded or uninsulated surfaces. (k) Switchboards and...

46 CFR 183.330 - Distribution panels and switchboards.

Code of Federal Regulations, 2010 CFR

2010-10-01

... (UNDER 100 GROSS TONS) ELECTRICAL INSTALLATION Power Sources and Distribution Systems § 183.330... vessel's wiring, must not have any electrically unshielded or uninsulated surfaces. (j) Switchboards and...

A Comparison of Measured and Calculated Air-Transported Radiation from a Fast. Unshielded Nuclear Reactor.

DTIC Science & Technology

1980-12-01

UNSHIELDED NUCLEAR REACTOR by H. A. Robitaille and B. E. Hoffarth D T ICS ELECTE SEP 1 5 i9813 C- LA . DISTRIBUTION STATEMENT A O PROJECT NO. 1 DECEMBER 1980...et de neutrons b diff6rentes distances jusqu’ 1100 m~tres du r6acteur ncldaire & neutrons rapides de la Pulse Radiation Division de la U.S. Army...u)UOU 𔃽N~nl4 N0in0 -CuD z f- 000 LUU ’4 :1O 00 w4 w4 w (u3)uU3 𔃽N~n-A NO.Ln3 rc ino OQQ z ca co, 0 0- C ) LU c C. M CU m CD 0 LA (u3uOU 𔃽N~n1.4No

End-to-end distance and contour length distribution functions of DNA helices

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-06-01

I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

Integrable aspects and rogue wave solution of Sasa-Satsuma equation with variable coefficients in the inhomogeneous fiber

NASA Astrophysics Data System (ADS)

Zhang, Yu-Ping; Yu, Lan; Wei, Guang-Mei

2018-02-01

Under investigation with symbolic computation in this paper, is a variable-coefficient Sasa-Satsuma equation (SSE) which can describe the ultra short pulses in optical fiber communications and propagation of deep ocean waves. By virtue of the extended Ablowitz-Kaup-Newell-Segur system, Lax pair for the model is directly constructed. Based on the obtained Lax pair, an auto-Bäcklund transformation is provided, then the explicit one-soliton solution is obtained. Meanwhile, an infinite number of conservation laws in explicit recursion forms are derived to indicate its integrability in the Liouville sense. Furthermore, exact explicit rogue wave (RW) solution is presented by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the RW can exhibit graphically an intriguing twisted rogue-wave (TRW) pair that involve four well-defined zero-amplitude points.

Analysis of a monolithic crystal plate acoustic wave filter.

PubMed

He, Huijing; Liu, Jinxi; Yang, Jiashi

2011-12-01

We study thickness-shear and thickness-twist vibrations of a finite, monolithic, AT-cut quartz plate crystal filter with two pairs of electrodes. The equations of anisotropic elasticity are used with the omission of the small elastic constant c(56). An analytical solution is obtained using Fourier series from which the resonant frequencies, mode shapes, and the vibration confinement due to the electrode inertia are calculated and examined. Copyright © 2011 Elsevier B.V. All rights reserved.

Human Tau Isoforms Assemble into Ribbon-like Fibrils That Display Polymorphic Structure and Stability*

PubMed Central

Wegmann, Susanne; Jung, Yu Jin; Chinnathambi, Subashchandrabose; Mandelkow, Eva-Maria; Mandelkow, Eckhard; Muller, Daniel J.

2010-01-01

Fibrous aggregates of Tau protein are characteristic features of Alzheimer disease. We applied high resolution atomic force and EM microscopy to study fibrils assembled from different human Tau isoforms and domains. All fibrils reveal structural polymorphism; the “thin twisted” and “thin smooth” fibrils resemble flat ribbons (cross-section ∼10 × 15 nm) with diverse twist periodicities. “Thick fibrils” show periodicities of ∼65–70 nm and thicknesses of ∼9–18 nm such as routinely reported for “paired helical filaments” but structurally resemble heavily twisted ribbons. Therefore, thin and thick fibrils assembled from different human Tau isoforms challenge current structural models of paired helical filaments. Furthermore, all Tau fibrils reveal axial subperiodicities of ∼17–19 nm and, upon exposure to mechanical stress or hydrophobic surfaces, disassemble into uniform fragments that remain connected by thin thread-like structures (∼2 nm). This hydrophobically induced disassembly is inhibited at enhanced electrolyte concentrations, indicating that the fragments resemble structural building blocks and the fibril integrity depends largely on hydrophobic and electrostatic interactions. Because full-length Tau and repeat domain constructs assemble into fibrils of similar thickness, the “fuzzy coat” of Tau protein termini surrounding the fibril axis is nearly invisible for atomic force microscopy and EM, presumably because of its high flexibility. PMID:20566652

499 E Illinois, November 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements did not exceed the respective field instrument threshold value previously stated andmaximum values observed at each lift ranged from approximately 10,700 to 12,600 cpm unshielded

Adaptive suppression of power line interference in ultra-low field magnetic resonance imaging in an unshielded environment

NASA Astrophysics Data System (ADS)

Huang, Xiaolei; Dong, Hui; Qiu, Yang; Li, Bo; Tao, Quan; Zhang, Yi; Krause, Hans-Joachim; Offenhäusser, Andreas; Xie, Xiaoming

2018-01-01

Power-line harmonic interference and fixed-frequency noise peaks may cause stripe-artifacts in ultra-low field (ULF) magnetic resonance imaging (MRI) in an unshielded environment and in a conductively shielded room. In this paper we describe an adaptive suppression method to eliminate these artifacts in MRI images. This technique utilizes spatial correlation of the interference from different positions, and is realized by subtracting the outputs of the reference channel(s) from those of the signal channel(s) using wavelet analysis and the least squares method. The adaptive suppression method is first implemented to remove the image artifacts in simulation. We then experimentally demonstrate the feasibility of this technique by adding three orthogonal superconducting quantum interference device (SQUID) magnetometers as reference channels to compensate the output of one 2nd-order gradiometer. The experimental results show great improvement in the imaging quality in both 1D and 2D MRI images at two common imaging frequencies, 1.3 kHz and 4.8 kHz. At both frequencies, the effective compensation bandwidth is as high as 2 kHz. Furthermore, we examine the longitudinal relaxation times of the same sample before and after compensation, and show that the MRI properties of the sample did not change after applying adaptive suppression. This technique can effectively increase the imaging bandwidth and be applied to ULF MRI detected by either SQUIDs or Faraday coil in both an unshielded environment and a conductively shielded room.

Inclusive Prompt Photons from the Color Glass Condensate at NLO

NASA Astrophysics Data System (ADS)

Benić, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; Venugopalan, Raju

2018-05-01

The cross-section for photons radiated by quarks in proton-nucleus collisions at collider energies was obtained using the Color Glass Condensate framework, in the dense-dilute kinematics regime. We observe that the inclusive photon cross-section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations in the gluon saturation regime of QCD.

Woven ribbon cable for cryogenic instruments

NASA Astrophysics Data System (ADS)

Cunningham, C. R.; Hastings, P. R.; Strachan, J. M. D.

Robust woven ribbon cables are described for connecting sensors at low temperatures to higher temperature systems. Woven cables have several advantages over conventional wiring or flat ribbon cables in cryostats: heat sinking is easier; twisted pairs may be used; and miniature multi-way connectors are easily incorporated. Their use is demonstrated in making connections from 131 bolometers in two arrays mounted in a dilution refrigerator at 100 mK. Thermal and electrical properties are discussed, as are other possible applications in cryogenic instruments.

Photoinduced Charge Shifts and Electron Transfer in Viologen-Tetraphenylborate Complexes: Push-Pull Character of the Exciplex.

PubMed

Santos, Willy G; Budkina, Darya S; Deflon, Victor M; Tarnovsky, Alexander N; Cardoso, Daniel R; Forbes, Malcolm D E

2017-06-14

Viologen-tetraarylborate ion-pair complexes were prepared and investigated by steady-state and time-resolved spectroscopic techniques such as fluorescence and femtosecond transient absorption. The results highlight a charge transfer transition that leads to changes in the viologen structure in the excited singlet state. Femtosecond transient absorption reveals the formation of excited-state absorption and stimulated emission bands assigned to the planar (k obs < 10 12 s -1 ) and twisted (k obs ∼ 10 10 s -1 ) structures between two pyridinium groups in the viologen ion. An efficient photoinduced electron transfer from the tetraphenylborate anionic moiety to the viologen dication was observed less than 1 μs after excitation. This is a consequence of the push-pull character of the electron donor twisted viologen structure, which helps formation of the borate triplet state. The borate triplet state is deactivated further via a second electron transfer process, generating viologen cation radical (V •+ ).

Spin Physics Experiments at NICA-SPD

NASA Astrophysics Data System (ADS)

Kouznetsov, O.; Savin, I.

2017-01-01

Nuclotron based Ion Collider fAcility (NICA) is a flagship project of the Joint Institute for Nuclear Research which is expected to be operational by 2021. Main tasks of ;NICA Facility; are study of hot and dense baryonic matter, investigation the polarisation phenomena and the nucleon spin structure. The material presented here based on the Letter of Intent (LoI) dedicated to nucleon spin structure studies at NICA. Measurements of asymmetries in the lepton pair (Drell-Yan) production in collisions of non-polarised, longitudinally and transversely polarised proton and deuteron beams to be performed using the specialized Spin Physics Detector (SPD). These measurements can provide an access to all leading twist collinear and Transverse Momentum Dependent Parton Distribution Functions (TMD PDFs) in nucleons. The measurements of asymmetries in production of J/ψ and direct photons, which supply complimentary information on the nucleon structure, will be performed simultaneously. The set of these measurements permits to tests the quark-parton model of nucleons at the QCD twist-2 level with minimal systematic errors.

High-Power Actuation from Molecular Photoswitches in Enantiomerically Paired Soft Springs.

PubMed

Aßhoff, Sarah J; Lancia, Federico; Iamsaard, Supitchaya; Matt, Benjamin; Kudernac, Tibor; Fletcher, Stephen P; Katsonis, Nathalie

2017-03-13

Motion in plants often relies on dynamic helical systems as seen in coiling tendrils, spasmoneme springs, and the opening of chiral seedpods. Developing nanotechnology that would allow molecular-level phenomena to drive such movements in artificial systems remains a scientific challenge. Herein, we describe a soft device that uses nanoscale information to mimic seedpod opening. The system exploits a fundamental mechanism of stimuli-responsive deformation in plants, namely that inflexible elements with specific orientations are integrated into a stimuli-responsive matrix. The device is operated by isomerization of a light-responsive molecular switch that drives the twisting of strips of liquid-crystal elastomers. The strips twist in opposite directions and work against each other until the pod pops open from stress. This mechanism allows the photoisomerization of molecular switches to stimulate rapid shape changes at the macroscale and thus to maximize actuation power. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Evaluation Of Risk And Possible Mitigation Schemes For Previously Unidentified Hazards

NASA Technical Reports Server (NTRS)

Linzey, William; McCutchan, Micah; Traskos, Michael; Gilbrech, Richard; Cherney, Robert; Slenski, George; Thomas, Walter, III

2006-01-01

This report presents the results of arc track testing conducted to determine if such a transfer of power to un-energized wires is possible and/or likely during an arcing event, and to evaluate an array of protection schemes that may significantly reduce the possibility of such a transfer. The results of these experiments may be useful for determining the level of protection necessary to guard against spurious voltage and current being applied to safety critical circuits. It was not the purpose of these experiments to determine the probability of the initiation of an arc track event only if an initiation did occur could it cause the undesired event: an inadvertent thruster firing. The primary wire insulation used in the Orbiter is aromatic polyimide, or Kapton , a construction known to arc track under certain conditions [3]. Previous Boeing testing has shown that arc tracks can initiate in aromatic polyimide insulated 28 volts direct current (VDC) power circuits using more realistic techniques such as chafing with an aluminum blade (simulating the corner of an avionics box or lip of a wire tray), or vibration of an aluminum plate against a wire bundle [4]. Therefore, an arc initiation technique was chosen that provided a reliable and consistent technique of starting the arc and not a realistic simulation of a scenario on the vehicle. Once an arc is initiated, the current, power and propagation characteristics of the arc depend on the power source, wire gauge and insulation type, circuit protection and series resistance rather than type of initiation. The initiation method employed for these tests was applying an oil and graphite mixture to the ends of a powered twisted pair wire. The flight configuration of the heater circuits, the fuel/oxider (or ox) wire, and the RCS jet solenoid were modeled in the test configuration so that the behavior of these components during an arcing event could be studied. To determine if coil activation would occur with various protection wire schemes, 145 tests were conducted using various fuel/ox wire alternatives (shielded and unshielded) and/or different combinations of polytetrafuloroethylene (PTFE), Mystik tape and convoluted wraps to prevent unwanted coil activation. Test results were evaluated along with other pertinent data and information to develop a mitigation strategy for an inadvertent RCS firing. The SSP evaluated civilian aircraft wiring failures to search for aging trends in assessing the wire-short hazard. Appendix 2 applies Weibull statistical methods to the same data with a similar purpose.

Navy Pier roundabout, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated, and ranged from a minimum of 2,300 cpm to a maximum of 4,300cpm unshielded.

305 E. Erie Street, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated, and ranged from a minimum of 1,900 cpm to a maximum of 3,900cpm unshielded.

400-420 N St Clair St, May 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and the spoil materials generatedduring the excavation process did not exceed the respective instrument threshold previously stated witha maximum of 8,000 cpm unshielded.

301-45 E Illinois St, May 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and the spoil materials generatedduring the excavation process did not exceed the respective instrument threshold previously stated with amaximum of 7,500 cpm unshielded.

360 N. Michigan Ave, January 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation did not exceed the instrument threshold previouslystated with unshielded maximum values of 7,700 cpm and 9,300 cpm in the respective sections of theexcavation.

455 N St Clair St, August 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the spoil materials generated during the drilling process did not exceed the respective threshold values previously stated withthe maximum unshielded gamma reading observed being 5,500 cpm.

335 E. Erie, January 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 4,900 cpm to a maximum of 10,200cpm unshielded.

215 E. Grand Ave, December 2015, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 6,800 cpm to a maximum of 7,200cpm unshielded.

224 E Ontario, February 2015, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 6,200 cpm to a maximum of 7,500cpm unshielded.

225 E. Grand Ave, Septmber 2015, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 5,300 cpm to a maximum of 9,700cpm unshielded.

226-237 E. Ontario, April 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements did not exceed the field instrument threshold equivalent to the USEPA removal actionlevel and ranged from a minimum of 6,000 cpm to a maximum of approximately 9,000 cpm unshielded.

228 E. Ontario, February 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 5,400 cpm to a maximum of 10,000cpm unshielded.

330-334 E. Ontario, April 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurement did not exceed the field instrument threshold equivalent to the USEPA removal actionlevel and ranged from a minimum of 5,700 cpm to a maximum of approximately 13,100 cpm unshielded.

Apparatus for in situ determination of burnup, cooling time and fissile content of an irradiated nuclear fuel assembly in a fuel storage pond

DOEpatents

Phillips, John R.; Halbig, James K.; Menlove, Howard O.; Klosterbuer, Shirley F.

1985-01-01

A detector head for in situ inspection of irradiated nuclear fuel assemblies submerged in a water-filled nuclear fuel storage pond. The detector head includes two parallel arms which extend from a housing and which are spaced apart so as to be positionable on opposite sides of a submerged fuel assembly. Each arm includes an ionization chamber and two fission chambers. One fission chamber in each arm is enclosed in a cadmium shield and the other fission chamber is unshielded. The ratio of the outputs of the shielded and unshielded fission chambers is used to determine the boron content of the pond water. Correcting for the boron content, the neutron flux and gamma ray intensity are then used to verify the declared exposure, cooling time and fissile material content of the irradiated fuel assembly.

A fully relativistic twisted disc around a slowly rotating Kerr black hole: derivation of dynamical equations and the shape of stationary configurations

NASA Astrophysics Data System (ADS)

Zhuravlev, V. V.; Ivanov, P. B.

2011-08-01

In this paper we derive equations describing the dynamics and stationary configurations of a twisted fully relativistic thin accretion disc around a slowly rotating black hole. We assume that the inclination angle of the disc is small and that the standard relativistic generalization of the α model of accretion discs is valid when the disc is flat. We find that similar to the case of non-relativistic twisted discs the disc dynamics and stationary shapes can be determined by a pair of equations formulated for two complex variables describing the orientation of the disc rings and velocity perturbations induced by the twist. We analyse analytically and numerically the shapes of stationary twisted configurations of accretion discs having non-zero inclinations with respect to the black hole equatorial plane at large distances r from the black hole. It is shown that the stationary configurations depend on two parameters - the viscosity parameter α and the parameter ?, where δ* is the opening angle (δ*˜h/r, where h is the disc half-thickness and r is large) of a flat disc and a is the black hole rotational parameter. When a > 0 and ? the shapes depend drastically on the value of α. When α is small the disc inclination angle oscillates with radius with amplitude and radial frequency of the oscillations dramatically increasing towards the last stable orbit, Rms. When α has a moderately small value the oscillations do not take place but the disc does not align with the equatorial plane at small radii. The disc inclination angle either is increasing towards Rms or exhibits a non-monotonic dependence on the radial coordinate. Finally, when α is sufficiently large the disc aligns with the equatorial plane at small radii. When a < 0 the disc aligns with the equatorial plane for all values of α. The results reported here may have implications for determining the structure and variability of accretion discs close to Rms as well as for modelling of emission spectra coming from different sources, which are supposed to contain black holes.

Adaptive suppression of power line interference in ultra-low field magnetic resonance imaging in an unshielded environment.

PubMed

Huang, Xiaolei; Dong, Hui; Qiu, Yang; Li, Bo; Tao, Quan; Zhang, Yi; Krause, Hans-Joachim; Offenhäusser, Andreas; Xie, Xiaoming

2018-01-01

Power-line harmonic interference and fixed-frequency noise peaks may cause stripe-artifacts in ultra-low field (ULF) magnetic resonance imaging (MRI) in an unshielded environment and in a conductively shielded room. In this paper we describe an adaptive suppression method to eliminate these artifacts in MRI images. This technique utilizes spatial correlation of the interference from different positions, and is realized by subtracting the outputs of the reference channel(s) from those of the signal channel(s) using wavelet analysis and the least squares method. The adaptive suppression method is first implemented to remove the image artifacts in simulation. We then experimentally demonstrate the feasibility of this technique by adding three orthogonal superconducting quantum interference device (SQUID) magnetometers as reference channels to compensate the output of one 2nd-order gradiometer. The experimental results show great improvement in the imaging quality in both 1D and 2D MRI images at two common imaging frequencies, 1.3 kHz and 4.8 kHz. At both frequencies, the effective compensation bandwidth is as high as 2 kHz. Furthermore, we examine the longitudinal relaxation times of the same sample before and after compensation, and show that the MRI properties of the sample did not change after applying adaptive suppression. This technique can effectively increase the imaging bandwidth and be applied to ULF MRI detected by either SQUIDs or Faraday coil in both an unshielded environment and a conductively shielded room. Copyright © 2017 Elsevier Inc. All rights reserved.

Analysis of a Statistical Relationship Between Dose and Error Tallies in Semiconductor Digital Integrated Circuits for Application to Radiation Monitoring Over a Wireless Sensor Network

NASA Astrophysics Data System (ADS)

Colins, Karen; Li, Liqian; Liu, Yu

2017-05-01

Mass production of widely used semiconductor digital integrated circuits (ICs) has lowered unit costs to the level of ordinary daily consumables of a few dollars. It is therefore reasonable to contemplate the idea of an engineered system that consumes unshielded low-cost ICs for the purpose of measuring gamma radiation dose. Underlying the idea is the premise of a measurable correlation between an observable property of ICs and radiation dose. Accumulation of radiation-damage-induced state changes or error events is such a property. If correct, the premise could make possible low-cost wide-area radiation dose measurement systems, instantiated as wireless sensor networks (WSNs) with unshielded consumable ICs as nodes, communicating error events to a remote base station. The premise has been investigated quantitatively for the first time in laboratory experiments and related analyses performed at the Canadian Nuclear Laboratories. State changes or error events were recorded in real time during irradiation of samples of ICs of different types in a 60Co gamma cell. From the error-event sequences, empirical distribution functions of dose were generated. The distribution functions were inverted and probabilities scaled by total error events, to yield plots of the relationship between dose and error tallies. Positive correlation was observed, and discrete functional dependence of dose quantiles on error tallies was measured, demonstrating the correctness of the premise. The idea of an engineered system that consumes unshielded low-cost ICs in a WSN, for the purpose of measuring gamma radiation dose over wide areas, is therefore tenable.

Shielding of the Hip Prosthesis During Radiation Therapy for Heterotopic Ossification is Associated with Increased Failure of Prophylaxis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balboni, Tracy A.; Gaccione, Peter; Gobezie, Reuben

2007-04-01

Purpose: Radiation therapy (RT) is frequently administered to prevent heterotopic ossification (HO) after total hip arthroplasty (THA). The purpose of this study was to determine if there is an increased risk of HO after RT prophylaxis with shielding of the THA components. Methods and Materials: This is a retrospective analysis of THA patients undergoing RT prophylaxis of HO at Brigham and Women's Hospital between June 1994 and February 2004. Univariate and multivariate logistic regressions were used to assess the relationships of all variables to failure of RT prophylaxis. Results: A total of 137 patients were identified and 84 were eligiblemore » for analysis (61%). The median RT dose was 750 cGy in one fraction, and the median follow-up was 24 months. Eight of 40 unshielded patients (20%) developed any progression of HO compared with 21 of 44 shielded patients (48%) (p = 0.009). Brooker Grade III-IV HO developed in 5% of unshielded and 18% of shielded patients (p 0.08). Multivariate analysis revealed shielding (p = 0.02) and THA for prosthesis infection (p = 0.03) to be significant predictors of RT failure, with a trend toward an increasing risk of HO progression with age (p = 0.07). There was no significant difference in the prosthesis failure rates between shielded and unshielded patients. Conclusions: A significantly increased risk of failure of RT prophylaxis for HO was noted in those receiving shielding of the hip prosthesis. Shielding did not appear to reduce the risk of prosthesis failure.« less

479 N Columbus Dr, March 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

field gamma measurements did not exceed the respective field instrument threshold values previously stated and ranged from aminimum of 4,500 cpm unshielded to a maximum of 5,700 cpm shielded in the bottom of the excavation.

545 N McClurg Ct, February 2015, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 5,700 cpm to a maximum of 13,500cpm unshielded.

600 N McClurg Ct, April 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements did not exceed the respective field instrument threshold values previously stated andranged from 3,400 to 9,500 cpm unshielded with a maximum of 4,500 cpm shielded in the bottom of theexcavation

300 East Randolph, December 2010, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements within the excavation and the spoil materials generated during theexcavation process did not exceed the respective threshold values previously stated and generallyranged from 4,050 cpm to 9,690 cpm with the unshielded probe.

356 E Grand, July 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 5,000 cpm to amaximum of 9,600 cpm unshielded.

362-363 E. Ontario, April 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

field gamma measurements did not exceed the respective field instrument threshold values previously stated andranged from 3,400 to 9,500 cpm unshielded with a maximum of 4,500 cpm shielded in the bottom of theexcavation.

237 E Ontario, July 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 8,600 cpm to amaximum of 9,500 cpm unshielded.

226-228 E Ontario St, December 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theunshielded instrument threshold previously stated and ranged from a minimum of 6,200 cpm to amaximum of 8,800 cpm unshielded.

380 E. North Water St, April 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation during the excavation process did not exceed theinstrument threshold previously stated and ranged from a minimum of 6,800 cpm to a maximum of 12,100cpm unshielded.

Crystal structure of methyl 3'-benzamido-4'-(4-meth-oxy-phen-yl)-1'-methyl-spiro-[indeno-[1,2-b]quinoxaline-11,2'-pyrrolidine]-3'-carboxyl-ate.

PubMed

Chandralekha, Kuppan; Sureshbabu, Adukamparai Rajukrishnan; Gavaskar, Deivasigamani; Lakshmi, Srinivasakannan

2016-09-01

In the title compound, C 35 H 30 N 4 O 3 , the spiro C atom connects the five-membered pyrrolidine ring and the indeno-quinoxaline ring system. The pyrrolidine ring adopts a twist conformation. An intra-molecular N-H⋯N inter-action between the amino group and the pyrazine ring is observed. In the crystal, mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers.

Network Implementation Trade-Offs in Existing Homes

NASA Astrophysics Data System (ADS)

Keiser, Gerd

2013-03-01

The ever-increasing demand for networking of high-bandwidth services in existing homes has resulted in several options for implementing an in-home network. Among the options are power-line communication techniques, twisted-pair copper wires, wireless links, and plastic or glass optical fibers. Whereas it is easy to install high-bandwidth optical fibers during the construction of new living units, retrofitting of existing homes with networking capabilities requires some technology innovations. This article addresses some trade-offs that need to be made on what transmission media can be retrofitted most effectively in existing homes.

Shaft transducer having dc output proportional to angular velocity

NASA Technical Reports Server (NTRS)

Handlykken, M. B. (Inventor)

1984-01-01

A brushless dc tachometer is disclosed that includes a high strength toroidal permanent magnet for providing a uniform magnetic field in an air gap, an annular pole piece opposite the magnet, and a pickup coil wound around the pole piece and adapted to rotate about the axis of the pole piece. The pickup coil is rotated by an input shaft to which the coil is coupled with the friction clip. The output of the coil is conducted to circuitry by a twisted wire pair. The input shaft also activates a position transducing potentiometer.

Functional asymmetry of posture and body system regulation

NASA Technical Reports Server (NTRS)

Boloban, V. N.; Otsupok, A. P.

1980-01-01

The manifestation of functional asymmetry during the regulation of an athlete's posture and a system of bodies and its effect on the execution of individual and group acrobatic exercises were studied. Functional asymmetry of posture regulation was recorded in acrobats during the execution of individual and group exercises. It was shown that stability is maintained at the expense of bending and twisting motions. It is important to consider whether the functional asymmetry of posture regulation is left or right sided in making up pairs and groups of acrobats.

240 E Ontario St, September 2011, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Unshielded field gamma measurements within theexcavation and the spoil materials generated during the excavation process did not exceed the respectivethreshold values previously stated and ranged from a minimum of 7,500 cpm to a maximum of 8,100 cpm.

450 N. Cityfront Plaza, October 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 4,400 cpm to amaximum of 6,000 cpm unshielded.

465 E. Illinois St., February 2015, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements within the excavation and the spoil materials generatedduring the excavation process did not exceed the field instrument threshold previously stated and rangedfrom a minimum of 10,000 cpm to a maximum of 15,500 cpm unshielded.

465 N. Park Ave, October 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 4,100 cpm to amaximum of 16,600 cpm unshielded.

641 N Michigan, September 2011, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The unshielded field gamma measurements within the spoil matehals generated during the drilling processdid not exceed the respective threshold values previously stated and ranged from background levels of 4,000cpm to a maximum of about 8,000 cpm.

633 N. Michigan Ave, May 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 4,400 cpm to amaximum of 5,900 cpm unshielded.

157 - 165 E. Ohio, May 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and ranged from a minimum of 5,000 cpm to amaximum of 5,900 cpm unshielded.

Evaluation of surface characteristics of rotary nickel-titanium instruments produced by different manufacturing methods.

PubMed

Inan, U; Gurel, M

2017-02-01

Instrument fracture is a serious concern in endodontic practice. The aim of this study was to investigate the surface quality of new and used rotary nickel-titanium (NiTi) instruments manufactured by the traditional grinding process and twisting methods. Total 16 instruments of two rotary NiTi systems were used in this study. Eight Twisted Files (TF) (SybronEndo, Orange, CA, USA) and 8 Mtwo (VDW, Munich, Germany) instruments were evaluated. New and used of 4 experimental groups were evaluated using an atomic force microscopy (AFM). New and used instruments were analyzed on 3 points along a 3 mm. section at the tip of the instrument. Quantitative measurements according to the topographical deviations were recorded. The data were statistically analyzed with paired samples t-test and independent samples t-test. Mean root mean square (RMS) values for new and used TF 25.06 files were 10.70 ± 2.80 nm and 21.58 ± 6.42 nm, respectively, and the difference between them was statistically significant (P < 0.05). Mean RMS values for new and used Mtwo 25.06 files were 24.16 ± 9.30 nm and 39.15 ± 16.20 nm respectively, the difference between them also was statistically significant (P < 0.05). According to the AFM analysis, instruments produced by twisting method (TF 25.06) had better surface quality than the instruments produced by traditional grinding process (Mtwo 25.06 files).

Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

DOE PAGES

Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

2018-03-05

Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

PubMed Central

Westhof, E; Sundaralingam, M

1980-01-01

The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

Sequence-dependent effects in drug-DNA interaction: the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG)2 duplex.

PubMed Central

Spink, N; Brown, D G; Skelly, J V; Neidle, S

1994-01-01

The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488

200 E Illinois St, December 2011, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements within the excavation and the spoil materials generated during the excavation process did not exceed the respective threshold value previously stated and ranged from a minimum of 7,100 cpm to amaximum of 9,400 cpm unshielded.

158 East Ontario, July 23, 2013, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Field gamma measurements within the excavation and the spoil materials generated during the excavationprocess did not exceed the respective threshold values previously stated and ranged from a minimum of6,700 cpm to a maximum of 8,700 cpm unshielded.

639-640 E. Ohio St, August 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and of the spoil materials generatedduring the excavation process did not exceed the instrument threshold previously stated and ranged froma minimum of 5,100 cpm to a maximum of 6,700 cpm unshielded.

323-399 E Lower Wacker Dr., December 2012, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Gamma readings from the remaining trenching activities ranged from a minimum of 4,600 cpm to a maximum of 12,200 cpm unshielded. The value of 12,200 cpm was measured within and at the base of the trench.

500-03 N. Peshtigo, October 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and predominantly ranged from a minimum of5,600 cpm to a maximum of 11,000 cpm unshielded.

301-40 N. Field, October 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavations and of the spoil during the excavation process didnot exceed the instrument threshold previously stated and predominantly ranged from a minimum of3,000 cpm to a maximum of 10,000 cpm unshielded.

Lindsay Light Radiological Survey 350 E Ohio St, May 2013

EPA Pesticide Factsheets

Field gamma measurements within the excavation and the spoil materials generated during the excavationprocess did not exceed the respective threshold values previously stated and ranged from a minimum of5,700 cpm to a maximum of 12,200 cpm unshielded.

405 E Illinois St, May 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and the spoil materials generatedduring the excavation process did not exceed the field instrument threshold previously stated and rangedfrom a minimum of 6,000 cpm to a maximum of 8,050 cpm unshielded

200-210 E. Ohio St., May 2014, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

The field gamma measurements within the excavation and the spoil materials generatedduring the excavation process did not exceed the field instrument threshold previously stated and rangedfrom a minimum of 6,000 cpm to a maximum of 7,500 cpm unshielded

237 E. Ontario St., January 2017, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Radiological Survey of Right-of-Way Utility Excavation. The measurements within the excavations and of the soil did not exceed the instrument USEPA threshold and ranged from a minimum of 4,800 cpm to a maximum of 8,300 cpm unshielded.

Add-On Shielding for Unshielded Wire

NASA Technical Reports Server (NTRS)

Koenig, J. C.; Billitti, J. W.; Tallon, J. M.

1983-01-01

Fabrication sequence used to produce compact shields slipped into place from free ends of wires already soldered into connectors at other ends. Single shields are formed into harnesses by connecting grounding jumpers. Technique is especially useful for small diameter wire attached to microminiature connectors.

α-Synuclein Amyloid Fibrils with Two Entwined, Asymmetrically Associated Protofibrils*

PubMed Central

Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; Heymann, J. Bernard; Kajava, Andrey V.; Varkey, Jobin; Langen, Ralf; Steven, Alasdair C.

2016-01-01

Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders of metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. We propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently. PMID:26644467

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar

Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian

Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

PubMed Central

Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

2013-01-01

Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

The Morphogenesis of Cranial Sutures in Zebrafish

PubMed Central

Topczewska, Jolanta M.; Shoela, Ramy A.; Tomaszewski, Joanna P.; Mirmira, Rupa B.; Gosain, Arun K.

2016-01-01

Using morphological, histological, and TEM analyses of the cranium, we provide a detailed description of bone and suture growth in zebrafish. Based on expression patterns and localization, we identified osteoblasts at different degrees of maturation. Our data confirm that, unlike in humans, zebrafish cranial sutures maintain lifelong patency to sustain skull growth. The cranial vault develops in a coordinated manner resulting in a structure that protects the brain. The zebrafish cranial roof parallels that of higher vertebrates and contains five major bones: one pair of frontal bones, one pair of parietal bones, and the supraoccipital bone. Parietal and frontal bones are formed by intramembranous ossification within a layer of mesenchyme positioned between the dermal mesenchyme and meninges surrounding the brain. The supraoccipital bone has an endochondral origin. Cranial bones are separated by connective tissue with a distinctive architecture of osteogenic cells and collagen fibrils. Here we show RNA in situ hybridization for col1a1a, col2a1a, col10a1, bglap/osteocalcin, fgfr1a, fgfr1b, fgfr2, fgfr3, foxq1, twist2, twist3, runx2a, runx2b, sp7/osterix, and spp1/ osteopontin, indicating that the expression of genes involved in suture development in mammals is preserved in zebrafish. We also present methods for examining the cranium and its sutures, which permit the study of the mechanisms involved in suture patency as well as their pathological obliteration. The model we develop has implications for the study of human disorders, including craniosynostosis, which affects 1 in 2,500 live births. PMID:27829009

Three-Dimensional MHD Simulation of FTEs Produced by Merging at an Isolated Point in a Sheared Magnetic Field Configuration

NASA Technical Reports Server (NTRS)

Santos, J. C.; Sibeck, D. G.; Buchner, J.; Gonzalez, W. D.; Ferreira, J. L.

2014-01-01

We present predictions for the evolution of FTEs generated by localized bursts of reconnection on a planar magnetopause that separates a magnetosheath region of high densities and weak magnetic field from a magnetospheric region of low densities and strong magnetic field. The magnetic fields present a shear angle of 105 degrees. Reconnection forms a pair of FTEs each crossing the magnetopause in the field reversal region and bulging into the magnetosphere and magnetosheath. At their initial stage they can be characterized as flux tubes since the newly reconnected magnetic field lines are not twisted. Reconnection launches Alfvenic perturbations that propagate along the FTEs generating high-speed jets, which move the pair of FTEs in opposite directions. As the FTE moves, it displaces the ambient magnetic field and plasma producing bipolar magnetic field and plasma velocity signatures normal to the nominal magnetopause in the regions surrounding the FTE. The combination of the ambient plasma with the FTE flows generates a vortical velocity pattern around the reconnected field lines. During its evolution the FTE evolves to a flux rope configuration due to the twist of the magnetic field lines. The alfvenic perturbations propagate faster along the part of the FTE bulging into the magnetosphere than in the magnetosheath, and due to the differences between the plasma and magnetic field properties the perturbations have slightly different signatures in the two regions. As a consequence, the FTEs have different signatures depending on whether the satellite encounters the part bulging into the magnetosphere or into the magnetosheath.

Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

PubMed

Cao, Hu; Lu, Yonggang

2017-01-01

With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

500 E Illinois St, June 2013, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

In the immediatevicinity of the area of the potential contamination the surface gamma readings were 8,400 to 9,500 cpm.The unshielded Ludlum threshold value equivalent to the USEPA cleanup value of 7.1 pCi/g total radiumwas 17,920 cpm.

Hobel stripper for shielded and unshielded flat conductor cable

NASA Technical Reports Server (NTRS)

Angele, W.

1971-01-01

Stripping tool exposes an area of shield for grounding purposes without removing an area of insulation between terminated shield and exposed conductors. Tool does not require heated blade and is capable of removing small portions of material at a time, to any depth.

Effect of reactor coolant radioactivity upon configuration feasibility for a nuclear electric propulsion vehicle

NASA Technical Reports Server (NTRS)

Soffer, L.; Wright, G. N.

1973-01-01

A preliminary shielding analysis was carried out for a conceptual nuclear electric propulsion vehicle designed to transport payloads from low earth orbit to synchronous orbit. The vehicle employed a thermionic nuclear reactor operating at 1575 kilowatts and generated 120 kilowatts of electricity for a round-trip mission time of 2000 hours. Propulsion was via axially directed ion engines employing 3300 pounds of mercury as a propellant. The vehicle configuration permitted a reactor shadow shield geometry using LiH and the mercury propellant for shielding. However, much of the radioactive NaK reactor coolant was unshielded and in close proximity to the power conditioning electronics. An estimate of the radioactivity of the NaK coolant was made and its unshielded dose rate to the power conditioning equipment calculated. It was found that the activated NaK contributed about three-fourths of the gamma dose constraint. The NaK dose was considered a sufficiently high fraction of the allowable gamma dose to necessitate modifications in configuration.

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

PubMed

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-02-28

Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

PubMed Central

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-01-01

Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

Single-handed helical carbonaceous nanotubes prepared using a pair of cationic low molecular weight gelators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Huayan; Wang, Qing; Guo, Yongmin

Highlights: • 3-aminophenol-formaldeyde resins were prepared through a templating method. • A pair of cationic gelators have been used as the templates. • Single-handed helical carbonaceous nanotubes were obtained after carbonization. • The carbonaceous nanotubes showed optical activity. - Abstract: We design a facile route to obtain enantiopure carbonaceous nanostructures, which have potential application as chiral sensors, electromagnetic wave absorbers, and asymmetric catalysts. A pair of cationic low molecular weight gelators was synthesized, which were able to self-assemble into twisted nanoribbons in ethanol at a concentration of 20 g L{sup −1} at 25 °C. Single-handed helical 3-aminophenol-formaldehyde resin nanotubes withmore » optical activity were prepared using the self-assembly of the low molecular weight gelators as templates. After carbonization, single-handed helical carbonaceous nanotubes were obtained and characterized using circular dichroism, wide-angle X-ray diffraction, field-emission scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy. The results indicate that the walls of the nanotubes are amorphous carbon. Moreover, the left- and right-handed helical nanotubes exhibit opposite optical activity.« less

A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

PubMed

Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

2016-11-08

Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

Cooling arrangement for a tapered turbine blade

DOEpatents

Liang, George

2010-07-27

A cooling arrangement (11) for a highly tapered gas turbine blade (10). The cooling arrangement (11) includes a pair of parallel triple-pass serpentine cooling circuits (80,82) formed in an inner radial portion (50) of the blade, and a respective pair of single radial channel cooling circuits (84,86) formed in an outer radial portion (52) of the blade (10), with each single radial channel receiving the cooling fluid discharged from a respective one of the triple-pass serpentine cooling circuit. The cooling arrangement advantageously provides a higher degree of cooling to the most highly stressed radially inner portion of the blade, while providing a lower degree of cooling to the less highly stressed radially outer portion of the blade. The cooling arrangement can be implemented with known casting techniques, thereby facilitating its use on highly tapered, highly twisted Row 4 industrial gas turbine blades that could not be cooled with prior art cooling arrangements.

A braided monoidal category for free super-bosons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Runkel, Ingo, E-mail: ingo.runkel@uni-hamburg.de

The chiral conformal field theory of free super-bosons is generated by weight one currents whose mode algebra is the affinisation of an abelian Lie super-algebra h with non-degenerate super-symmetric pairing. The mode algebras of a single free boson and of a single pair of symplectic fermions arise for even|odd dimension 1|0 and 0|2 of h, respectively. In this paper, the representations of the untwisted mode algebra of free super-bosons are equipped with a tensor product, a braiding, and an associator. In the symplectic fermion case, i.e., if h is purely odd, the braided monoidal structure is extended to representations ofmore » the Z/2Z-twisted mode algebra. The tensor product is obtained by computing spaces of vertex operators. The braiding and associator are determined by explicit calculations from three- and four-point conformal blocks.« less

Annual-ring-type quasi-phase-matching crystal for generation of narrowband high-dimensional entanglement

NASA Astrophysics Data System (ADS)

Hua, Yi-Lin; Zhou, Zong-Quan; Liu, Xiao; Yang, Tian-Shu; Li, Zong-Feng; Li, Pei-Yun; Chen, Geng; Xu, Xiao-Ye; Tang, Jian-Shun; Xu, Jin-Shi; Li, Chuan-Feng; Guo, Guang-Can

2018-01-01

A photon pair can be entangled in many degrees of freedom such as polarization, time bins, and orbital angular momentum (OAM). Among them, the OAM of photons can be entangled in an infinite-dimensional Hilbert space which enhances the channel capacity of sharing information in a network. Twisted photons generated by spontaneous parametric down-conversion offer an opportunity to create this high-dimensional entanglement, but a photon pair generated by this process is typically wideband, which makes it difficult to interface with the quantum memories in a network. Here we propose an annual-ring-type quasi-phase-matching (QPM) crystal for generation of the narrowband high-dimensional entanglement. The structure of the QPM crystal is designed by tracking the geometric divergences of the OAM modes that comprise the entangled state. The dimensionality and the quality of the entanglement can be greatly enhanced with the annual-ring-type QPM crystal.

Test report for twinax cable (Rockwell type MB0150-051). [effects of mismatched termination

NASA Technical Reports Server (NTRS)

Doland, G. D.

1978-01-01

A controlled impedance twisted pair shielded cable was tested to determine the frequency response and effects of mismatched termination. It was found that a long length of this cable, about 100 feet, exhibited a frequency sensitive attenuation roll-off greater than 1.5 db down at 5 MHz. It was also determined that improper termination resulted in losses of 1/2 to 1 db within the frequency range of 200 KHz to greater than 1-1/2 MHz. The test results indicate a possible problem where mismatched connectors are used in video signal cables.

Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 2

NASA Technical Reports Server (NTRS)

Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shane M.; Godley, Franklin

2010-01-01

In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis methods and test data is shown to be very good.

Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 1

NASA Technical Reports Server (NTRS)

Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shame M.; Godley, Richard Franklin

2010-01-01

In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis, simulation, and test data is shown to be very good.

Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

PubMed Central

Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

2014-01-01

Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

504-510 N. Peshtigo Ct. November 2016, Lindsay Light Radiological Survey

EPA Pesticide Factsheets

Initial gamma readings collected after the removal of asphalt and a layer of granitepavers ranged from 4,700 and 14,300 cpm unshielded. Subsequent readings conducted w/ a shieldedprobe mainly ranged from a min of 2,000 cpm to a max of 4,000cpm shielded

Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

PubMed

Xue, Gongda; Hemmings, Brian A

2012-02-01

The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

PubMed Central

Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

2015-01-01

Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

Copper link evaluations/solutions for fiber channel, SSA, SONET, ATM, and other services through 4 Gb/sec: basic information, test results, and evaluation

NASA Astrophysics Data System (ADS)

Leib, Michael J.

1995-10-01

Technitrol, the original designer of MIL-STD-1553 transformers, the original military 1Mb/s LAN, has advanced the state of the art one further notch, introducing a series of transceivers that allow high speed (through 1 Gb/s) data transmission over copper wire instead of fiber optic cable. One such device can be employed to implement the Fiber Channel Interface as defined by hte X3T11 ANSI Fibre Channel Committee using either mini coax, Type 1 shielded twisted pair, twinax or video cable. The technology now exists to upgrade data transmission rates on current physical media to speeds formerly only available with fiber optic cabling. Copper transceiver technology provides a cost effective alternative for dealing with demanding high speed applications such as high speed serial data transfer, high speed disk and tape storage transfer, imaging telemetry, radar, and other avionics applications. Eye diagrams will be presented to show that excellent data transmission at rates of 1 gigabit/sec with low jitter is capable over mini coax at distances to approximately 50 meters, shielded twisted pair and twinax cable to distances of 105 meters, and video cable to distances of 175 meters. Distances are further at lower data rates. As a member of the X3T11 ANSI Fiber Channel Committee, Technitrol has developed a Physical Media (copper wire) Dependant (PMD) transceiver not only compliant with the Fibre Channel Specifications but exceeding the specifications by a factor greater than four. Conceivably, this opens high speed interconnections for today's high data rate requirements to copper cabling systems. Fibre Optic problems need not be dealt with to obtain data transfers for high speed information transfers.

Feature extraction using molecular planes for fuzzy relational clustering of a flexible dopamine reuptake inhibitor.

PubMed

Banerjee, Amit; Misra, Milind; Pai, Deepa; Shih, Liang-Yu; Woodley, Rohan; Lu, Xiang-Jun; Srinivasan, A R; Olson, Wilma K; Davé, Rajesh N; Venanzi, Carol A

2007-01-01

Six rigid-body parameters (Shift, Slide, Rise, Tilt, Roll, Twist) are commonly used to describe the relative displacement and orientation of successive base pairs in a nucleic acid structure. The present work adapts this approach to describe the relative displacement and orientation of any two planes in an arbitrary molecule-specifically, planes which contain important pharmacophore elements. Relevant code from the 3DNA software package (Nucleic Acids Res. 2003, 31, 5108-5121) was generalized to treat molecular fragments other than DNA bases as input for the calculation of the corresponding rigid-body (or "planes") parameters. These parameters were used to construct feature vectors for a fuzzy relational clustering study of over 700 conformations of a flexible analogue of the dopamine reuptake inhibitor, GBR 12909. Several cluster validity measures were used to determine the optimal number of clusters. Translational (Shift, Slide, Rise) rather than rotational (Tilt, Roll, Twist) features dominate clustering based on planes that are relatively far apart, whereas both types of features are important to clustering when the pair of planes are close by. This approach was able to classify the data set of molecular conformations into groups and to identify representative conformers for use as template conformers in future Comparative Molecular Field Analysis studies of GBR 12909 analogues. The advantage of using the planes parameters, rather than the combination of atomic coordinates and angles between molecular planes used in our previous fuzzy relational clustering of the same data set (J. Chem. Inf. Model. 2005, 45, 610-623), is that the present clustering results are independent of molecular superposition and the technique is able to identify clusters in the molecule considered as a whole. This approach is easily generalizable to any two planes in any molecule.

Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

NASA Technical Reports Server (NTRS)

Nixon, Mark W.

1987-01-01

This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

The Twist Limit for Bipolar Active Regions

NASA Technical Reports Server (NTRS)

Moore, Ron; Falconer, David; Gary, Allen

2008-01-01

We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

Twisted intramolecular charge transfer investigation of semi organic L-Glutamic acid hydrochloride single crystal for organic light-emitting and optical limiting applications

NASA Astrophysics Data System (ADS)

Joy, Lija K.; George, Merin; Alex, Javeesh; Aravind, Arun; Sajan, D.; Vinitha, G.

2018-03-01

Single crystals of L-Glutamic acid hydrochloride (LGHCl) were grown by slow evaporation solution technique and good crystalline perfection was confirmed by Powder X-ray diffraction studies. The complete vibrational studies of the compound were analyzed by FT-IR, FT-Raman and UV-visible spectra combined with Normal Coordinate Analysis (NCA) following the scaled quantum mechanical force field methodology and density functional theory (DFT). Twisted Intramolecular Charge Transfer (ICT) occurs due to the presence of strong ionic intra-molecular Nsbnd H⋯O hydrogen bonding was confirmed by Hirshfeld Surface analysis. The existence of intermolecular Nsbnd H⋯Cl hydrogen bonds due to the interaction between the lone pair of oxygen with the antibonding orbital was established by NBO analysis. The Z-scan result indicated that the title molecule exhibits saturable absorption behavior. The attractive third-order nonlinear properties suggest that LGHCl can be a promising candidate for the design and development devices for optical limiting applications. LGHCL exhibits distinct emission in the blue region of the fluorescence lifetime which proves to be a potential candidate for blue- Organic light-emitting diodes (OLEDs) fabrication.

α-Synuclein amyloid fibrils with two entwined, asymmetrically associated protofibrils [α-Synuclein amyloid fibrils with two entwined, asymmetrically associated, protofibrils and axially stacked metal binding sites

DOE PAGES

Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; ...

2015-12-07

Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

A dual-satellite study of the spatial properties of FTEs. [flux transfer events

NASA Technical Reports Server (NTRS)

Saunders, M. A.; Russell, C. T.; Sckopke, N.

1984-01-01

Reconnection at the earth's dayside magnetopause may manifest itself primarily as a localized and transient process called a flux-transfer event (FTE). The spatial properties of FTEs are investigated directly by examining data from the ISEE satellite pair when the satellites were separated by more than 1000 km in the vicinity of the magnetopause. Examples of magnetosheath and boundary layer FTEs, each having a dimension normal to the magnetopause of order an earth radius, R(E), are shown, and this scale-size result is substantiated statistically for magnetosheath FTEs. When combined with other information, a 1-R(E) normal dimension implies that the voltage associated with the FTE process at one magnetopause location is at least 10 kV. These findings strengthen the view that the magnetic field comprising an FTE is twisted, this twisting appearing to be continuous in sense across the magnetopause and corresponding to a core field-aligned current of magnitude a few hundred kA. Changes in plasma flow speed and direction are found to be associated with FTEs. The transverse field and flow perturbations accompanying the three magnetosheath FTEs studied here satisfy approximately the Walen relation, the relation which describes a propagating Alfven wave.

Probing gluon saturation with next-to-leading order photon production at central rapidities in proton-nucleus collisions

DOE PAGES

Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; ...

2017-01-26

Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

Processing mechanics of alternate twist ply (ATP) yarn technology

NASA Astrophysics Data System (ADS)

Elkhamy, Donia Said

Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The successful results of this work have led to the filing of a US patent disclosing the method for producing ATP yarns with high yarn twist efficiency using a high convergence angle at the self ply point together with applying ply torque.

Genomic pathways modulated by Twist in breast cancer.

PubMed

Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

2017-01-13

The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic dysregulation of Twist at the cellular level drives alterations in gene pathways in the Twist metastatic mouse model which are comparable to changes seen in human breast cancers. Lastly, we have identified novel genes and pathways that could be further investigated as targets for drugs to treat metastatic breast cancer.

The Effect of Lighting on the Behavior of Children Who Are Developmentally Disabled.

ERIC Educational Resources Information Center

Shapiro, Michele; Roth, Dana; Marcus, Angela

2001-01-01

A study examined the behavior of 8 Israeli children (ages 2-4) with developmental disabilities and maladaptive behavior who were exposed to direct lighting with unshielded standard fluorescent lamps vs. indirect diffuse full spectrum fluorescent lamps. The duration of adaptive behaviors was significantly higher under the indirect lighting.…

Mode Transitions in Magnetically Shielded Hall Effect Thrusters

NASA Technical Reports Server (NTRS)

Sekerak, Michael J.; Longmier, Benjamin W.; Gallimore, Alec D.; Huang, Wensheng; Kamhawi, Hani; Hofer, Richard R.; Jorns, Benjamin A.; Polk, James E.

2014-01-01

A mode transition study is conducted in magnetically shielded thrusters where the magnetic field magnitude is varied to induce mode transitions. Three different oscillatory modes are identified with the 20-kW NASA-300MS-2 and the 6-kW H6MS: Mode 1) global mode similar to unshielded thrusters at low magnetic fields, Mode 2) cathode oscillations at nominal magnetic fields, and Mode 3) combined spoke, cathode and breathing mode oscillations at high magnetic fields. Mode 1 exhibits large amplitude, low frequency (1-10 kHz), breathing mode type oscillations where discharge current mean value and oscillation amplitude peak. The mean discharge current is minimized while thrust-to-power and anode efficiency are maximized in Mode 2, where higher frequency (50-90 kHz), low amplitude, cathode oscillations dominate. Thrust is maximized in Mode 3 and decreases by 5-6% with decreasing magnetic field strength. The presence or absence of spokes and strong cathode oscillations do not affect each other or discharge current. Similar to unshielded thrusters, mode transitions and plasma oscillations affect magnetically shielded thruster performance and should be characterized during system development.

Characterization of sequences in human TWIST required for nuclear localization

PubMed Central

Singh, Shalini; Gramolini, Anthony O

2009-01-01

Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

Teaching Spatial Awareness for Better Twisting Somersaults.

ERIC Educational Resources Information Center

Hennessy, Jeff T.

1985-01-01

The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer

PubMed Central

2014-01-01

Background Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. Methods The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). Results MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3′UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Conclusions Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy. PMID:24885626

miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer.

PubMed

Yu, Jingshuang; Xie, Furong; Bao, Xin; Chen, Wantao; Xu, Qin

2014-05-24

Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3'UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy.

Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

PubMed Central

Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

2015-01-01

Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

PubMed

Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

PubMed Central

Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

Quantification of precipitation measurement discontinuity induced by wind shields on national gauges

USGS Publications Warehouse

Yang, Daqing; Goodison, Barry E.; Metcalfe, John R.; Louie, Paul; Leavesley, George H.; Emerson, Douglas G.; Hanson, Clayton L.; Golubev, Valentin S.; Elomaa, Esko; Gunther, Thilo; Pangburn, Timothy; Kang, Ersi; Milkovic, Janja

1999-01-01

Various combinations of wind shields and national precipitation gauges commonly used in countries of the northern hemisphere have been studied in this paper, using the combined intercomparison data collected at 14 sites during the World Meteorological Organization's (WMO) Solid Precipitation Measurement Intercomparison Project. The results show that wind shields improve gauge catch of precipitation, particularly for snow. Shielded gauges, on average, measure 20–70% more snow than unshielded gauges. Without a doubt, the use of wind shields on precipitation gauges has introduced a significant discontinuity into precipitation records, particularly in cold and windy regions. This discontinuity is not constant and it varies with wind speed, temperature, and precipitation type. Adjustment for this discontinuity is necessary to obtain homogenous precipitation data for climate change and hydrological studies. The relation of the relative catch ratio (RCR, ratio of measurements of shielded gauge to unshielded gauge) versus wind speed and temperature has been developed for Alter and Tretyakov wind shields. Strong linear relations between measurements of shielded gauge and unshielded gauge have also been found for different precipitation types. The linear relation does not fully take into account the varying effect of wind and temperature on gauge catch. Overadjustment by the linear relation may occur at those sites with lower wind speeds, and underadjustment may occur at those stations with higher wind speeds. The RCR technique is anticipated to be more applicable in a wide range of climate conditions. The RCR technique and the linear relation have been tested at selected WMO intercomparison stations, and reasonable agreement between the adjusted amounts and the shielded gauge measurements was obtained at most of the sites. Test application of the developed methodologies to a regional or national network is therefore recommended to further evaluate their applicability in different climate conditions. Significant increase of precipitation is expected due to the adjustment particularly in high latitudes and other cold regions. This will have a meaningful impact on climate variation and change analyses.

SU-F-T-490: Separating Effects Influencing Detector Response in Small MV Photon Fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wegener, S; Sauer, O

2016-06-15

Purpose: Different detector properties influence their responses especially in field sizes below the lateral electron range. Due to the finite active volume, the detector density and electron perturbation at other structural parts, the response factor is in general field size dependent. We aimed to visualize and separate the main effects contributing to detector behavior for a variety of detector types. This was achieved in an experimental setup, shielding the field center. Thus, effects caused by scattered radiation could be examined separately. Methods: Signal ratios for field sizes down to 8 mm (SSD 90 cm, water depth 10 cm) of amore » 6MV beam from a Siemens Primus LINAC were recorded with several detectors: PTW microDiamond and PinPoint ionization chamber, shielded diodes (PTW P-60008, IBA PFD and SNC Edge) and unshielded diodes (PTW E-60012 and IBA SFD). Measurements were carried out in open fields and with an aluminum pole of 4 mm diameter as a central block. The geometric volume effect was calculated from profiles obtained with Gafchromic EBT3 film, evaluated using FilmQA Pro software (Ashland, USA). Results: Volume corrections were 1.7% at maximum. After correction, in small open fields, unshielded diodes showed a lower response than the diamond, i.e. diamond detector over-response seems to be higher than that for unshielded diodes. Beneath the block, this behavior was amplified by a factor of 2. For the shielded diodes, the overresponse for small open fields could be confirmed. However their lateral response behavior was strongly type dependent, e.g. the signal ratio dropped from 1.02 to 0.98 for the P-60008 diode. Conclusion: The lateral detector response was experimentally examined. Detector volume and density alone do not fully account for the field size dependence of detector response. Detector construction details play a major role, especially for shielded diodes.« less

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

2017-12-01

We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, F.; Das, Suprem R.; Luan, Y.

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Hydrogen bonds and twist in cellulose microfibrils.

PubMed

Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

2017-11-01

There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE PAGES

Hu, F.; Das, Suprem R.; Luan, Y.; ...

2017-12-13

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Gauge transformations for twisted spectral triples

NASA Astrophysics Data System (ADS)

Landi, Giovanni; Martinetti, Pierre

2018-05-01

It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

Random waves in the brain: Symmetries and defect generation in the visual cortex

NASA Astrophysics Data System (ADS)

Schnabel, M.; Kaschube, M.; Löwel, S.; Wolf, F.

2007-06-01

How orientation maps in the visual cortex of the brain develop is a matter of long standing debate. Experimental and theoretical evidence suggests that their development represents an activity-dependent self-organization process. Theoretical analysis [1] exploring this hypothesis predicted that maps at an early developmental stage are realizations of Gaussian random fields exhibiting a rigorous lower bound for their densities of topological defects, called pinwheels. As a consequence, lower pinwheel densities, if observed in adult animals, are predicted to develop through the motion and annihilation of pinwheel pairs. Despite of being valid for a large class of developmental models this result depends on the symmetries of the models and thus of the predicted random field ensembles. In [1] invariance of the orientation map's statistical properties under independent space rotations and orientation shifts was assumed. However, full rotation symmetry appears to be broken by interactions of cortical neurons, e.g. selective couplings between groups of neurons with collinear orientation preferences [2]. A recently proposed new symmetry, called shift-twist symmetry [3], stating that spatial rotations have to occur together with orientation shifts in order to be an appropriate symmetry transformation, is more consistent with this organization. Here we generalize our random field approach to this important symmetry class. We propose a new class of shift-twist symmetric Gaussian random fields and derive the general correlation functions of this ensemble. It turns out that despite strong effects of the shift-twist symmetry on the structure of the correlation functions and on the map layout the lower bound on the pinwheel densities remains unaffected, predicting pinwheel annihilation in systems with low pinwheel densities.

Arm position influences the activation patterns of trunk muscles during trunk range-of-motion movements.

PubMed

Siu, Aaron; Schinkel-Ivy, Alison; Drake, Janessa Dm

2016-10-01

To understand the activation patterns of the trunk musculature, it is also important to consider the implications of adjacent structures such as the upper limbs, and the muscles that act to move the arms. This study investigated the effects of arm positions on the activation patterns and co-activation of the trunk musculature and muscles that move the arm during trunk range-of-motion movements (maximum trunk axial twist, flexion, and lateral bend). Fifteen males and fifteen females, asymptomatic for low back pain, performed maximum trunk range-of-motion movements, with three arm positions for axial twist (loose, crossed, abducted) and two positions for flexion and lateral bend (loose, crossed). Electromyographical data were collected for eight muscles bilaterally, and activation signals were cross-correlated between trunk muscles and the muscles that move the arms (upper trapezius, latissimus dorsi). Results revealed consistently greater muscle co-activation (higher cross-correlation coefficients) between the trunk muscles and upper trapezius for the abducted arm position during maximum trunk axial twist, while results for the latissimus dorsi-trunk pairings were more dependent on the specific trunk muscles (either abdominal or back) and latissimus dorsi muscle (either right or left side), as well as the range-of-motion movement. The findings of this study contribute to the understanding of interactions between the upper limbs and trunk, and highlight the influence of arm positions on the trunk musculature. In addition, the comparison of the present results to those of individuals with back or shoulder conditions may ultimately aid in elucidating underlying mechanisms or contributing factors to those conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

PubMed

Modesto-Costa, Lucas; Borges, Itamar

2018-08-05

The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

Downhole transmission system

DOEpatents

Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

2008-01-15

A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. An electrical conductor connects both the transmission elements. The electrical conductor comprises at least three electrically conductive elements insulated from each other. In the preferred embodiment the electrical conductor comprises an electrically conducting outer shield, an electrically conducting inner shield and an electrical conducting core. In some embodiments of the present invention, the electrical conductor comprises an electrically insulating jacket. In other embodiments, the electrical conductor comprises a pair of twisted wires. In some embodiments, the electrical conductor comprises semi-conductive material.

Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

NASA Technical Reports Server (NTRS)

Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

1995-01-01

The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

PubMed

Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

2018-01-01

Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

Twist for Snyder space

NASA Astrophysics Data System (ADS)

Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

2018-03-01

We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

Effect of twist on single-mode fiber-optic 3 × 3 couplers

NASA Astrophysics Data System (ADS)

Chen, Dandan; Ji, Minning; Peng, Lei

2018-01-01

In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.

NASA Astrophysics Data System (ADS)

Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum

Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.

Twisted supersymmetry: Twisted symmetry versus renormalizability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

Twist limits for late twisting double somersaults on trampoline.

PubMed

Yeadon, M R; Hiley, M J

2017-06-14

An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

PubMed Central

Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

2017-01-01

TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

PubMed Central

Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

2012-01-01

KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

Transverse kink oscillations in the presence of twist

NASA Astrophysics Data System (ADS)

Terradas, J.; Goossens, M.

2012-12-01

Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

Modeling and control of active twist aircraft

NASA Astrophysics Data System (ADS)

Cramer, Nicholas Bryan

The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

Anderson transition in a multiply-twisted helix.

PubMed

Ugajin, R

2001-06-01

We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

PubMed

Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

2018-01-01

Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

PubMed

Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

2011-01-01

Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

Read-out electronics for DC squid magnetic measurements

DOEpatents

Ganther, Jr., Kenneth R.; Snapp, Lowell D.

2002-01-01

Read-out electronics for DC SQUID sensor systems, the read-out electronics incorporating low Johnson noise radio-frequency flux-locked loop circuitry and digital signal processing algorithms in order to improve upon the prior art by a factor of at least ten, thereby alleviating problems caused by magnetic interference when operating DC SQUID sensor systems in magnetically unshielded environments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Shyy Woei; Yang, Tsun Lirng; Liou, Jin Shuen

An experimental study measuring the axial heat transfer distributions and the pressure drop coefficients of the tube fitted with a broken twisted tape of twist ratio 1, 1.5, 2, 2.5 or {infinity} is performed in the Re range of 1000-40,000. This type of broken twisted tape is newly invented without previous investigations available. Local Nusselt numbers and mean Fanning friction factors in the tube fitted with the broken twisted tape increase as the twist ratio decreases. Heat transfer coefficients, mean Fanning friction factors and thermal performance factors in the tube fitted with the broken twisted tape are, respectively, augmented tomore » 1.28-2.4, 2-4.7 and 0.99-1.8 times of those in the tube fitted with the smooth twisted tape. Empirical heat transfer and pressure drop correlations which evaluate the local Nusselt number and the mean Fanning friction factor for the tube with the broken twisted tape insert are generated to assist the industrial applications. (author)« less

Conical twist fields and null polygonal Wilson loops

NASA Astrophysics Data System (ADS)

Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

2018-06-01

Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

PubMed

Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

2011-02-01

The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

PubMed

Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

2015-05-13

We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

PubMed

Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

2016-05-01

Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

Analysis of lead twist in modern high-performance grinding methods

NASA Astrophysics Data System (ADS)

Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

2016-11-01

According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

Highly sensitive torsion sensor based on long period fiber grating fabricated by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Dong, Xinran; Xie, Zheng; Song, Yuxin; Yin, Kai; Luo, Zhi; Duan, Ji'an; Wang, Cong

2017-12-01

A highly sensitive torsion sensor based on long period fiber grating (LPFG) fabricated by 800 nm femtosecond laser pulses is proposed and demonstrated. LPFG with an attenuation depth of ∼14 dB is achieved within the wavelength range of 1425-1575 nm. The experiment results show that the LP02 and LP03 resonant wavelengths experience red-shift when the twist direction is clockwise while they occur blue-shift in the twist counterclockwise direction as the twist rate increases. However, the LP04 resonant wavelength is always shifted toward shorter wavelength independently of the twist directions and higher twist sensitivity is observed. In addition, the loss peak amplitude of LPFG shows a tendency to decrease with the twist rate increases whether the LPFG is twisted clockwise or counterclockwise. Meanwhile, the resonant wavelength occurs splitting phenomenon in the case of higher twist rate as well as the high order resonant wavelength performs more significantly. Additionally, the sensor shows a twist sensitivity as high as 118.7 pm/(rad/m) in the range of -105 to -52.5 rad/m and that of 181.7 pm/(rad/m) in the range of 52.5-105 rad/m.

Experimental Analysis of the Thermo-Hydraulic Performance on a Cylindrical Parabolic Concentrating Solar Water Heater with Twisted Tape Inserts in an Absorber Tube

NASA Astrophysics Data System (ADS)

Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.

2018-05-01

A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.

Electronic and Optical Properties of Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Huang, Shengqiang

The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion symmetry is broken with an external electric field. We observe a double-line profile of these states on the domain walls, only occurring when the AB and BA regions are gaped. These states give rise to channels that could transport charge in a dissipationless manner making twisted bilayer graphene a promising platform to realize controllable topological networks for future applications.

Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

PubMed Central

Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

2017-01-01

Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

Tight Placement of Erich Arch Bar While Avoiding Wire Fatigue Failure.

PubMed

Kirk, Daniel; Whitney, Joseph; Shafer, David; Song, Liansheng

2016-03-01

To determine the number of wire twists needed to acquire ideal Erich arch bar tightness before wire fatigue failure (fracture) in relation to different distances and angles at which different gauge wires are grasped to provide information to improve the efficiency of arch bar application. This study mimicked surgical placement of arch bars with 24- and 26-gauge wires. The number of twists to tightness and failure was evaluated when the wire distance between the arch bar and wire holder tip changed (5 vs 10 mm) and when the degree at which the wire was held relative to the tooth axis was changed (45° vs 90°). A wire shearing test also was used to investigate the fatigability of wires tightened under these same conditions. Wires twisted to tightness, past tightness, and after shearing test movements were visualized with electron microscopy. For 24-gauge wire held at 5 mm, 2.6 to 2.8 twists were needed for wire tightness, with failure after 1.7 to 1.9 twists past tightness; for 24-gauge wire held at 10 mm, 4.4 to 4.9 twists produced tightness, with failure after 2.3 to 2.9 twists past tightness. For 26-gauge wire held at 5 mm, 3.3 to 3.5 twists provided tightness, with 1.6 to 1.8 twists past tightness causing failure; for 26-gauge wire held at 10 mm, 5.1 to 5.5 twists produced tightness, with 3.1 to 3.7 twists past tightness causing failure. At a 45° angle, the wire tightened with fewer twists and showed more resistance to failure with twists past tightness compared with 90° using 24- and 26-gauge wires. In contrast, 24-gauge wire held at a 5-mm distance showed the opposite result, with decreased resistance to failure at the 45° angle. However, the differences were not statistically meaningful. Scanning election microscopy showed no wire fatigue for either angle for 26-gauge wire held at a 5-mm distance and twisted to tightness. After overtightening and oscillation, the 90° angle trials showed fatigue, whereas the 45° angle trials did not. Holding a 24-gauge wire at 45° to the tooth axis is recommended owing to fewer twists to tightness and more resistance to failure. A 5-mm grasping distance is recommended for experienced surgeons owing to fewer twists to tightness, whereas a 10-mm grasping distance is recommended for novice surgeons owing to a greater tolerance for over-twisting before failure. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

PubMed

Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

2017-06-15

TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.

Define the Twist ATX LPAR1 Signaling Axis in Promoting Obesity Associated Triple Negative Breast Cancer

DTIC Science & Technology

2017-05-01

developed CRISPR technology to examine if Twist enhances ATX and LPAR1 expression. Specifically, we performed lentiviral transduction of Twist...targeting gRNA into breast cancer cells MDA-MB-578 and SUM-1315, and selected single cell colony with Twist knockout. We chose CRISPR -gRNA over the...shRNA system which was originally proposed, as CRISPR provides higher specificity and fewer off-target effects. To verify knockout of Twist, we first

Highly sensitive twist sensor based on tilted fiber Bragg grating of polarization-dependent properties

NASA Astrophysics Data System (ADS)

Lu, Yanfang; Shen, Changyu; Chen, Debao; Chu, Jinlei; Wang, Qiang; Dong, Xinyong

2014-10-01

The transmission intensity of the tilted fiber Bragg grating (TFBG) is strongly dependent on the polarization properties of the TFBG. The polarization characteristic of the cladding modes can be used for twist measuring. In this paper, a highly sensitive fiber twist sensor is proposed. The transmission intensity on the strong loss wavelength showed a quasi-sin θ changing with the twist angle ranging from 0° to 180° for S- or P-polarized input. A high sensitivity of 0.299 dB/° is achieved, which is almost 17.9 times higher than that of the current similar existing twist sensor. The twist angle can be measured precisely with the matrix.

Au-coated tilted fiber Bragg grating twist sensor based on surface plasmon resonance

NASA Astrophysics Data System (ADS)

Shen, Changyu; Zhang, Yang; Zhou, Wenjun; Albert, Jacques

2014-02-01

A fiber twist sensor based on the surface plasmon resonance (SPR) effect of an Au-coated tilted fiber Bragg grating (TFBG) is proposed. The SPR response to the twist effect on an Au-coated TFBG (immersing in distilled water) is studied theoretically and experimentally. The results show that the transmission power around the wavelength of SPR changes with the twist angle. For the twist ranging from 0° to 180° in clockwise or anti-clockwise directions, the proposed sensor shows sensitivities of 0.037 dBm/° (S-polarized) and 0.039 dBm/° (P-polarized), which are almost 7.5 times higher than that of the current similar existing twist sensor.

The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis

PubMed Central

Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

2011-01-01

The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis. PMID:20714342

The Effect of a Twisted Magnetic Field on the Phase Mixing of the Kink Magnetohydrodynamic Waves in Coronal Loops

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebrahimi, Zanyar; Karami, Kayoomars; Soler, Roberto, E-mail: z.ebrahimi@uok.ac.ir

There is observational evidence for the existence of a twisted magnetic field in the solar corona. This inspires us to investigate the effect of a twisted magnetic field on the evolution of magnetohydrodynamic (MHD) kink waves in coronal loops. With this aim, we solve the incompressible linearized MHD equations in a magnetically twisted nonuniform coronal flux tube in the limit of long wavelengths. Our results show that a twisted magnetic field can enhance or diminish the rate of phase mixing of the Alfvén continuum modes and the decay rate of the global kink oscillation depending on the twist model andmore » the sign of the longitudinal ( k{sub z} ) and azimuthal ( m ) wavenumbers. Also, our results confirm that in the presence of a twisted magnetic field, when the sign of one of the two wavenumbers m and k {sub z} is changed, the symmetry with respect to the propagation direction is broken. Even a small amount of twist can have an important impact on the process of energy cascading to small scales.« less

Heat Transfer Enhancement of Laminar Nanofluids Flow in a Circular Tube Fitted with Parabolic-Cut Twisted Tape Inserts

PubMed Central

Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

2014-01-01

Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055

Insulin-like growth factor-I induces CLU expression through Twist1 to promote prostate cancer growth.

PubMed

Takeuchi, Ario; Shiota, Masaki; Beraldi, Eliana; Thaper, Daksh; Takahara, Kiyoshi; Ibuki, Naokazu; Pollak, Michael; Cox, Michael E; Naito, Seiji; Gleave, Martin E; Zoubeidi, Amina

2014-03-25

Clusterin (CLU) is cytoprotective molecular chaperone that is highly expressed in castrate-resistant prostate cancer (CRPC). CRPC is also characterized by increased insulin-like growth factor (IGF)-I responsiveness which induces prostate cancer survival and CLU expression. However, how IGF-I induces CLU expression and whether CLU is required for IGF-mediated growth signaling remain unknown. Here we show that IGF-I induced CLU via STAT3-Twist1 signaling pathway. In response to IGF-I, STAT3 was phosphorylated, translocated to the nucleus and bound to the Twist1 promoter to activate Twist1 transcription. In turn, Twist1 bound to E-boxes on the CLU promoter and activated CLU transcription. Inversely, we demonstrated that knocking down Twist1 abrogated IGF-I induced CLU expression, indicating that Twist1 mediated IGF-I-induced CLU expression. When PTEN knockout mice were crossed with lit/lit mice, the resultant IGF-I deficiency suppressed Twist1 as well as CLU gene expression in mouse prostate glands. Moreover, both Twist1 and CLU knockdown suppressed prostate cancer growth accelerated by IGF-I, suggesting the relevance of this signaling not only in an in vitro, but also in an in vivo. Collectively, this study indicates that IGF-I induces CLU expression through sequential activation of STAT3 and Twist1, and suggests that this signaling cascade plays a critical role in prostate cancer pathogenesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Twist number and order properties of periodic orbits

NASA Astrophysics Data System (ADS)

Petrisor, Emilia

2013-11-01

A less studied numerical characteristic of periodic orbits of area preserving twist maps of the annulus is the twist or torsion number, called initially the amount of rotation Mather (1984) [2]. It measures the average rotation of tangent vectors under the action of the derivative of the map along that orbit, and characterizes the degree of complexity of the dynamics. The aim of this paper is to give new insights into the definition and properties of the twist number and to relate its range to the order properties of periodic orbits. We derive an algorithm to deduce the exact value or a demi-unit interval containing the exact value of the twist number. We prove that at a period-doubling bifurcation threshold of a mini-maximizing periodic orbit, the new born doubly periodic orbit has the absolute twist number larger than the absolute twist of the original orbit after bifurcation. We give examples of periodic orbits having large absolute twist number, that are badly ordered, and illustrate how characterization of these orbits only by their residue can lead to incorrect results. In connection to the study of the twist number of periodic orbits of standard-like maps we introduce a new tool, called 1-cone function. We prove that the location of minima of this function with respect to the vertical symmetry lines of a standard-like map encodes a valuable information on the symmetric periodic orbits and their twist number.

How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

PubMed

Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

2018-01-12

The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

Optimal flapping wing for maximum vertical aerodynamic force in hover: twisted or flat?

PubMed

Phan, Hoang Vu; Truong, Quang Tri; Au, Thi Kim Loan; Park, Hoon Cheol

2016-07-08

This work presents a parametric study, using the unsteady blade element theory, to investigate the role of twist in a hovering flapping wing. For the investigation, a flapping-wing system was developed to create a wing motion of large flapping amplitude. Three-dimensional kinematics of a passively twisted wing, which is capable of creating a linearly variable geometric angle of attack (AoA) along the wingspan, was measured during the flapping motion and used for the analysis. Several negative twist or wash-out configurations with different values of twist angle, which is defined as the difference in the average geometric AoAs at the wing root and the wing tip, were obtained from the measured wing kinematics through linear interpolation and extrapolation. The aerodynamic force generation and aerodynamic power consumption of these twisted wings were obtained and compared with those of flat wings. For the same aerodynamic power consumption, the vertical aerodynamic forces produced by the negatively twisted wings are approximately 10%-20% less than those produced by the flat wings. However, these twisted wings require approximately 1%-6% more power than flat wings to produce the same vertical force. In addition, the maximum-force-producing twisted wing, which was found to be the positive twist or wash-in configuration, was used for comparison with the maximum-force-producing flat wing. The results revealed that the vertical aerodynamic force and aerodynamic power consumption of the two types of wings are almost identical for the hovering condition. The power loading of the positively twisted wing is only approximately 2% higher than that of the maximum-force-producing flat wing. Thus, the flat wing with proper wing kinematics (or wing rotation) can be regarded as a simple and efficient candidate for the development of hovering flapping-wing micro air vehicle.

Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

PubMed Central

Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

2012-01-01

Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise

PubMed Central

Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J.

2016-01-01

Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, V˙O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32–69% of V˙O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results. PMID:27100099

The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise.

PubMed

Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J

2016-01-01

Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, [Formula: see text]O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32-69% of [Formula: see text]O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results.

Tyrosine kinase receptor c-ros-oncogene 1 inhibition alleviates aberrant bone formation of TWIST-1 haploinsufficient calvarial cells from Saethre-Chotzen syndrome patients.

PubMed

Camp, Esther; Anderson, Peter J; Zannettino, Andrew C W; Glackin, Carlotta A; Gronthos, Stan

2018-09-01

Saethre-Chotzen syndrome (SCS), associated with TWIST-1 mutations, is characterized by premature fusion of cranial sutures. TWIST-1 haploinsufficiency, leads to alterations in suture mesenchyme cellular gene expression patterns, resulting in aberrant osteogenesis and craniosynostosis. We analyzed the expression of the TWIST-1 target, Tyrosine kinase receptor c-ros-oncogene 1 (C-ROS-1) in TWIST-1 haploinsufficient calvarial cells derived from SCS patients and calvaria of Twist-1 del/+ mutant mice and found it to be highly expressed when compared to TWIST-1 wild-type controls. Knock-down of C-ROS-1 expression in TWIST-1 haploinsufficient calvarial cells derived from SCS patients was associated with decreased capacity for osteogenic differentiation in vitro. Furthermore, treatment of human SCS calvarial cells with the tyrosine kinase chemical inhibitor, Crizotinib, resulted in reduced C-ROS-1 activity and the osteogenic potential of human SCS calvarial cells with minor effects on cell viability or proliferation. Cultured human SCS calvarial cells treated with Crizotinib exhibited a dose-dependent decrease in alkaline phosphatase activity and mineral deposition, with an associated decrease in expression levels of Runt-related transcription factor 2 and OSTEOPONTIN, with reduced PI3K/Akt signalling in vitro. Furthermore, Crizotinib treatment resulted in reduced BMP-2 mediated bone formation potential of whole Twist-1 del/+ mutant mouse calvaria organotypic cultures. Collectively, these results suggest that C-ROS-1 promotes osteogenic differentiation of TWIST-1 haploinsufficient calvarial osteogenic progenitor cells. Furthermore, the aberrant osteogenic potential of these cells is inhibited by the reduction of C-ROS-1. Therefore, targeting C-ROS-1 with a pharmacological agent, such as Crizotinib, may serve as a novel therapeutic strategy to alleviate craniosynostosis associated with aberrant TWIST-1 function. © 2018 Wiley Periodicals, Inc.

On structural transitions, thermodynamic equilibrium, and the phase diagram of DNA and RNA duplexes under torque and tension.

PubMed

Wereszczynski, Jeff; Andricioaei, Ioan

2006-10-31

A precise understanding of the flexibility of double stranded nucleic acids and the nature of their deformed conformations induced by external forces is important for a wide range of biological processes including transcriptional regulation, supercoil and catenane removal, and site-specific recombination. We present, at atomic resolution, a simulation of the dynamics involved in the transitions from B-DNA and A-RNA to Pauling (P) forms and to denatured states driven by application of external torque and tension. We then calculate the free energy profile along a B- to P-transition coordinate and from it, compute a reversible pathway, i.e., an isotherm of tension and torque pairs required to maintain P-DNA in equilibrium. The reversible isotherm maps correctly onto a phase diagram derived from single molecule experiments, and yields values of elongation, twist, and twist-stretch coupling in agreement with measured values. We also show that configurational entropy compensates significantly for the large electrostatic energy increase due to closer-packed P backbones. A similar set of simulations applied to RNA are used to predict a novel structure, P-RNA, with its associated free energy, equilibrium tension, torque and structural parameters, and to assign the location, on the phase-diagram, of a putative force-torque-dependent RNA "triple point."

Chirality of Single-Handed Twisted Titania Tubular Nanoribbons Prepared Through Sol-gel Transcription.

PubMed

Wang, Sibing; Zhang, Chuanyong; Li, Yi; Li, Baozong; Yang, Yonggang

2015-08-01

Single-handed twisted titania tubular nanoribbons were prepared through sol-gel transcription using a pair of enantiomers. Handedness was controlled by that of the template. The obtained samples were characterized using field-emission electron microscopy, transmission electron microscopy, diffuse reflectance circular dichroism (DRCD), and X-ray diffraction. The DRCD spectra indicated that the titania nanotubes exhibit optical activity. Although the tubular structure was destroyed after being calcined at 700 °C for 2.0 h, DRCD signals were still identified. However, the DRCD signals disappeared after being calcined at 1000 °C for 2.0 h. The optical activity of titania was proposed to be due to chiral defects. Previous results showed that straight titania tubes could be used as asymmetric autocatalysts, indicating that titania exhibit chirality at the angstrom level. Herein, it was found that they also exhibit DRCD signals, indicating that there are no obvious relationships between morphology at the nano level and chirality at the angstrom level. The nanotube chirality should originate from the chiral defects on the nanotube inner surface. The Fourier transform infrared spectra indicated that the chirality of the titania was transferred from the gelators through the hydrogen bonding between N-H and Ti-OH. © 2015 Wiley Periodicals, Inc.

Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

PubMed

Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

2017-06-22

DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

The Nuclear Weapons Effects National Enterprise

DTIC Science & Technology

2010-06-01

dependent on computers and electrical circuitry for effectiveness. The danger from radiation induced upset or burnout of improperly or unshielded...for Unmanned Systems Radiation Effect Thermal mechanical shock - X-ray Prompt X-ray/gamma dose rate - Rail-span collapse - Photoionization burnout ...event upset (SEU) or even single-event burnout . SEU results when enough ionization charge is deposited by a high-energy particle (natural or man

76 FR 33991 - Airworthiness Directives; The Boeing Company Model 727, 727C, 727-100, 727-100C, 727-200, and 727...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-10

... manufacturer. We are issuing this AD to increase the level of protection from lightning strikes and prevent the... of protection from lightning strikes and prevent the potential of ignition sources inside fuel tanks... existing unshielded fuel quantity indication system (FQIS) wire bundles with double shielded FQIS wire...

Precipitation measurements on wind-swept slopes

Treesearch

Austin E. Helmers

1954-01-01

Precipitation catch for three calendar years is compared for four types of gage installation on a wind-swept south-facing slope with a 22° gradient at elevation 5500 ft. The 1950 precipitation catch by (1) weighing-recording gage with the orifice and an Alter type wind shield sloped parallel to the ground surface, (2) unshielded nonrecording gage with orifice sloped...

SQUIDs De-fluxing Using a Decaying AC Magnetic Field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matlashov, Andrei Nikolaevich; Semenov, Vasili Kirilovich; Anderson, Bill

Flux trapping is the Achilles’ heel of all superconductor electronics. The most direct way to avoid flux trapping is a prevention of superconductor circuits from exposure to magnetic fields. Unfortunately this is not feasible if the circuits must be exposed to a strong DC magnetic field even for a short period of time. For example, such unavoidable exposures take place in superparamagnetic relaxation measurements (SPMR) and ultra-low field magnetic resonance imaging (ULF MRI) using unshielded thin-film SQUID-based gradiometers. Unshielded SQUIDs stop working after being exposed to DC magnetic fields of only a few Gauss in strength. In this paper wemore » present experimental results with de-fluxing of planar thin-film LTS SQUID-based gradiometers using a strong decaying AC magnetic field. We used four commercial G136 gradiometers for SPMR measurements with up to a 10 mT magnetizing field. Strong 12.9 kHz decaying magnetic field pulses reliably return SQUIDs to normal operation 50 ms after zeroing the DC magnetizing field. This new AC de-fluxing method was also successfully tested with seven other different types of LTS SQUID sensors and has been shown to dissipate extremely low energy.« less

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Superconducting flat tape cable magnet

DOEpatents

Takayasu, Makoto

2015-08-11

A method for winding a coil magnet with the stacked tape cables, and a coil so wound. The winding process is controlled and various shape coils can be wound by twisting about the longitudinal axis of the cable and bending following the easy bend direction during winding, so that sharp local bending can be obtained by adjusting the twist pitch. Stack-tape cable is twisted while being wound, instead of being twisted in a straight configuration and then wound. In certain embodiments, the straight length should be half of the cable twist-pitch or a multiple of it.

Twist-induced tuning in tapered fiber couplers.

PubMed

Birks, T A

1989-10-01

The power-splitting ratio of fused tapered single-mode fiber couplers can be reversibly tuned by axial twisting without affecting loss. The twist-tuning behavior of a range of different tapered couplers is described. A simple expression for twist-tuning can be derived by representing the effects of twist by a change in the refractive index profile. Good agreement between this expression and experimental results is demonstrated. Repeated tuning over tens of thousands of cycles is found not to degrade coupler performance, and a number of practical applications, including a freely tunable tapered coupler, are described.

Effect of Magnetic Twist on Nonlinear Transverse Kink Oscillations of Line-tied Magnetic Flux Tubes

NASA Astrophysics Data System (ADS)

Terradas, J.; Magyar, N.; Van Doorsselaere, T.

2018-01-01

Magnetic twist is thought to play an important role in many structures of the solar atmosphere. One of the effects of twist is to modify the properties of the eigenmodes of magnetic tubes. In the linear regime standing kink solutions are characterized by a change in polarization of the transverse displacement along the twisted tube. In the nonlinear regime, magnetic twist affects the development of shear instabilities that appear at the tube boundary when it is oscillating laterally. These Kelvin–Helmholtz instabilities (KHI) are produced either by the jump in the azimuthal component of the velocity at the edge of the sharp boundary between the internal and external part of the tube or by the continuous small length scales produced by phase mixing when there is a smooth inhomogeneous layer. In this work the effect of twist is consistently investigated by solving the time-dependent problem including the process of energy transfer to the inhomogeneous layer. It is found that twist always delays the appearance of the shear instability, but for tubes with thin inhomogeneous layers the effect is relatively small for moderate values of twist. On the contrary, for tubes with thick layers, the effect of twist is much stronger. This can have some important implications regarding observations of transverse kink modes and the KHI itself.

Sox5 induces epithelial to mesenchymal transition by transactivation of Twist1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pei, Xin-Hong; Department of Pathology, The Basic Medical College of Zhengzhou University, Zhengzhou, Henan; Lv, Xin-Quan

2014-03-28

Highlights: • Depletion of Sox5 inhibits breast cancer proliferation, migration, and invasion. • Sox5 transactivates Twist1 expression. • Sox5 induces epithelial to mesenchymal transition through transactivation of Twist1 expression. - Abstract: The epithelial to mesenchymal transition (EMT), a highly conserved cellular program, plays an important role in normal embryogenesis and cancer metastasis. Twist1, a master regulator of embryonic morphogenesis, is overexpressed in breast cancer and contributes to metastasis by promoting EMT. In exploring the mechanism underlying the increased Twist1 in breast cancer cells, we found that the transcription factor SRY (sex-determining region Y)-box 5(Sox5) is up-regulation in breast cancer cellsmore » and depletion of Sox5 inhibits breast cancer cell proliferation, migration, and invasion. Furthermore, depletion of Sox5 in breast cancer cells caused a dramatic decrease in Twist1 and chromosome immunoprecipitation assay showed that Sox5 can bind directly to the Twist1 promoter, suggesting that Sox5 transactivates Twist1 expression. We further demonstrated that knockdown of Sox5 up-regulated epithelial phenotype cell biomarker (E-cadherin) and down-regulated mesenchymal phenotype cell biomarkers (N-cadherin, Vimentin, and Fibronectin 1), resulting in suppression of EMT. Our study suggests that Sox5 transactivates Twist1 expression and plays an important role in the regulation of breast cancer progression.« less

Wire harness twisting aid

NASA Technical Reports Server (NTRS)

Casey, E. J.; Commadore, C. C.; Ingles, M. E.

1980-01-01

Long wire bundles twist into uniform spiral harnesses with help of simple apparatus. Wires pass through spacers and through hand-held tool with hole for each wire. Ends are attached to low speed bench motor. As motor turns, operator moves hand tool away forming smooth twists in wires between motor and tool. Technique produces harnesses that generate less radio-frequency interference than do irregularly twisted cables.

Twist Model Development and Results from the Active Aeroelastic Wing F/A-18 Aircraft

NASA Technical Reports Server (NTRS)

Lizotte, Andrew M.; Allen, Michael J.

2007-01-01

Understanding the wing twist of the active aeroelastic wing (AAW) F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption. This technique produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

Twist Model Development and Results From the Active Aeroelastic Wing F/A-18 Aircraft

NASA Technical Reports Server (NTRS)

Lizotte, Andrew; Allen, Michael J.

2005-01-01

Understanding the wing twist of the active aeroelastic wing F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption and by using neural networks. These techniques produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

Coexistence of twisted and untwisted crystals: An impurity/structural order model with implications for agate patterns

USGS Publications Warehouse

Comer, J.; Ortoleva, P.

2007-01-01

Coexistence of twisted and untwisted crystals is explained via a model that accounts for the coupling of the entropic and energetic effects of impurities and a supra-lattice-scale structural order parameter. It is shown that twisted impure crystals can be in equilibrium with untwisted purer ones. The model explains how coexistence can occur in agates and other systems under hydrostatic stress. The model implies that untwisted crystals grown under one set of conditions could undergo a phase separation that, when accompanied by an imposed compositional gradient, leads to commonly observed, alternating bands of twisted and untwisted crystals and, when occurring in the absence of an external gradient, mossy patterns of crystal texture can emerge. This phenomenon is not related to anisotropic applied stress. Rather coexistence is a consequence of a compositional segregation/twist phase transition. Since twist coexistence is a compositional equilibrium, it arises from the exchange between bulk phases; hence, the detailed nature of the atomic structure within an interface between twisted and untwisted zones is not relevant. The approach places crystal-twist phenomena within the theory of order/disorder phase transitions.

Operator constraints for twist-3 functions and Lorentz invariance properties of twist-3 observables

DOE PAGES

Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

2016-03-14

We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

Experimental Investigation of the Electronic Properties of Twisted Bilayer Graphene by STM and STS

NASA Astrophysics Data System (ADS)

Yin, Longjing; Qiao, Jiabin; Wang, Wenxiao; Zuo, Weijie; He, Lin

The electronic properties of graphene multilayers depend sensitively on their stacking order. A twisted angle is treated as a unique degree of freedom to tune the electronic properties of graphene system. Here we study electronic structures of the twisted bilayers by scanning tunneling microscopy (STM) and spectroscopy (STS). We demonstrate that the interlayer coupling strength affects both the Van Hove singularities and the Fermi velocity of twisted bilayers dramatically. This removes the discrepancy about the Fermi velocity renormalization in the twisted bilayers and provides a consistent interpretation of all current data. Moreover, we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by STM and STS. At a magic twisted angle, about 1.11°, a pronounced sharp peak is observed in the tunnelling spectra due to the action of the non-Abelian gauge fields. Because of the effective non-Abelian gauge fields, the rotation angle could transfer the charge carriers in the twisted bilayers from massless Dirac fermions into well localized electrons, or vice versa, efficiently. This provides a new route to tune the electronic properties of graphene systems, which will be essential in future graphene nanoelectronics.

An analysis of rotor blade twist variables associated with different Euler sequences and pretwist treatments

NASA Technical Reports Server (NTRS)

Alkire, K.

1984-01-01

A nonlinear analysis which is necessary to adequately model elastic helicopter rotor blades experiencing moderately large deformations was examined. The analysis must be based on an appropriate description of the blade's deformation geometry including elastic bending and twist. Built-in pretwist angles complicate the deformation process ant its definition. Relationships between the twist variables associated with different rotation sequences and corresponding forms of the transformation matrix are lasted. Relationships between the twist variables associated with first, the pretwist combined with the deformation twist are included. Many of the corresponding forms of the transformation matrix for the two cases are listed. It is shown that twist variables connected with the combined twist treatment are related to those where the pretwist is applied initially. A method to determine the relationships and some results are outlined. A procedure to evaluate the transformation matrix that eliminates the Eulerlike sequence altogether is demonstrated. The resulting form of the transformation matrix is unaffected by rotation sequence or pretwist treatment.

Aeroelastic Analysis of Helicopter Rotor Blades Incorporating Anisotropic Piezoelectric Twist Actuation

NASA Technical Reports Server (NTRS)

Wilkie, W. Keats; Belvin, W. Keith; Park, K. C.

1996-01-01

A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consists of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for dynamics simulation using numerical integration. The twist actuation responses for three conceptual fullscale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

An aeroelastic analysis of helicopter rotor blades incorporating piezoelectric fiber composite twist actuation

NASA Technical Reports Server (NTRS)

Wilkie, W. Keats; Park, K. C.

1996-01-01

A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consist of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for numerical integration. The twist actuation responses for three conceptual full-scale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

Electrostatic contribution to twist rigidity of DNA.

PubMed

Mohammad-Rafiee, Farshid; Golestanian, Ramin

2004-06-01

The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

Effect of twist on transverse impact response of ballistic fiber yarns

DOE PAGES

Song, Bo; Lu, Wei -Yang

2015-06-15

A Hopkinson bar was employed to conduct transverse impact testing of twisted Kevlar KM2 fiber yarns at the same impact speed. The speed of Euler transverse wave generated by the impact was measured utilizing a high speed digital camera. The study included fiber yarns twisted by different amounts. The Euler transverse wave speed was observed to increase with increasing amount of twist of the fiber yarn, within the range of this investigation. As a result, the higher transverse wave speeds in the more twisted fiber yarns indicate better ballistic performance in soft body armors for personal protection.

Combined detection of Twist1, Snail1 and squamous cell carcinoma antigen for the prognostic evaluation of invasion and metastasis in cervical squamous cell carcinoma.

PubMed

Yang, Huilun; Hu, Haiyang; Gou, Yanling; Hu, Yuhong; Li, Hui; Zhao, Hongwei; Wang, Beidi; Li, Peiling; Zhang, Zongfeng

2018-04-01

Cervical cancer is one of the most common malignant tumours of the female reproductive system, ranking second only to breast cancer in morbidity worldwide. Essential features of the progression of cervical cancer are invasion and metastasis, which are closely related to disease prognosis and mortality rate. At the present time there is no effective method to evaluate cancer invasion and metastasis before surgery. Here we report our study on molecular changes in biopsy tissue for the prognostic evaluation of cancer invasion and metastasis. Expression of the epithelial-mesenchymal transition-inducing transcription factors Twist1 and Snail1 was detected by immunohistochemistry in 32 normal, 36 low-grade squamous intraepithelial neoplasia (LSIL), 54 high-grade squamous intraepithelial neoplasia (HSIL) and 320 cervical squamous cell carcinoma (CSCC) samples. The correlation between the expression of Twist1, Snail1 and squamous cell carcinoma antigen (SCCA) in CSCC tissues and clinical pathology results was evaluated. A transwell migration and invasion assay was used to explore the roles of Twist1 and Snail1 in the invasion of cancer cells. Lymph node metastasis and lymphovascular space invasion (LVSI) rates for the following groups were analysed: SCCA(+) group, Twist1(+) group, Snail1(+) group, Twist1(+)Snail1(+)group, Twist1(+)SCCA(+)group, Snail1(+)SCCA(+)group and Twist1(+)Snail1(+)SCCA(+) group. The expression of Twist1 and Snail1 was significantly upregulated in HSIL and CSCC (p < 0.05). Twist1 and Snail1 expression levels were associated with LVSI, lymph node metastasis and histological grade (p < 0.05) but not with age or FIGO stage (p > 0.05). The expression of SCCA was associated with LVSI, lymph node metastasis, FIGO stage and histological grade (p < 0.05) but not with age (p > 0.05). Twist1 was an independent factor contributing to the invasion ability of cervical cancer cells. In addition, the positive rate of lymph node metastasis and LVSI was higher in the Twist1(+)Snail1(+)SCCA(+) group than in the SCCA(+) group, Twist1(+) group and Snail1(+) group, respectively (p < 0.05). Combined detection of Twist1 and Snail1 in SCCA-positive biopsy specimens may be a potential method for evaluating the invasion and metastasis of CSCC prior to surgery.

Anisotropic piezoelectric twist actuation of helicopter rotor blades: Aeroelastic analysis and design optimization

NASA Astrophysics Data System (ADS)

Wilkie, William Keats

1997-12-01

An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain a soluti An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain amited additional piezoelectric material mass, it is shown that blade twist actuation approaches which exploit in-plane piezoelectric free-stain anisotropies are capable of producing amplitudes of oscillatory blade twisting sufficient for rotor vibration reduction applications. The second study examines the effectiveness of using embedded piezoelectric actuator laminae to alleviate vibratory loads due to retreating blade stall. A 10 to 15 percent improvement in dynamic stall limited forward flight speed, and a 5 percent improvement in stall limited rotor thrust were numerically demonstrated for the active twist rotor blade relative to a conventional blade design. The active twist blades are also demonstrated to be more susceptible than the conventional blades to dynamic stall induced vibratory loads when not operating with twist actuation. This is the result of designing the active twist blades with low torsional stiffness in order to maximize piezoelectric twist authority. Determining the optimum tradeoff between blade torsional stiffness and piezoelectric twist actuation authority is the subject of the third study. For this investigation, a linearized hovering-flight eigenvalue analysis is developed. Linear optimal control theory is then utilized to develop an optimum active twist blade design in terms of reducing structural energy and control effort cost. The forward flight vibratory loads characteristics of the torsional stiffness optimized active twist blade are then examined using the nonlinear, forward flight aeroelastic analysis. The optimized active twist rotor blade is shown to have improved passive and active vibratory loads characteristics relative to the baseline active twist blades.

Twisting failure of centrally loaded open-section columns in the elastic range

NASA Technical Reports Server (NTRS)

Kappus, Robert

1938-01-01

In the following report a complete theory of twisting failure by the energy method is developed, based on substantially the same assumptions as those employed by Wagner and Bleich. Problems treated in detail are: the stress and strain condition under St. Venant twist and in twist with axial constraint; the concept of shear center and the energy method for problems of elastic stability.

On the twists of interplanetary magnetic flux ropes observed at 1 AU

NASA Astrophysics Data System (ADS)

Wang, Yuming; Zhuang, Bin; Hu, Qiang; Liu, Rui; Shen, Chenglong; Chi, Yutian

2016-10-01

Magnetic flux ropes (MFRs) are one kind of fundamental structures in the solar/space physics and involved in various eruption phenomena. Twist, characterizing how the magnetic field lines wind around a main axis, is an intrinsic property of MFRs, closely related to the magnetic free energy and stableness. Although the effect of the twist on the behavior of MFRs had been widely studied in observations, theory, modeling, and numerical simulations, it is still unclear how much amount of twist is carried by MFRs in the solar atmosphere and in heliosphere and what role the twist played in the eruptions of MFRs. Contrasting to the solar MFRs, there are lots of in situ measurements of magnetic clouds (MCs), the large-scale MFRs in interplanetary space, providing some important information of the twist of MFRs. Thus, starting from MCs, we investigate the twist of interplanetary MFRs with the aid of a velocity-modified uniform-twist force-free flux rope model. It is found that most of MCs can be roughly fitted by the model and nearly half of them can be fitted fairly well though the derived twist is probably overestimated by a factor of 2.5. By applying the model to 115 MCs observed at 1 AU, we find that (1) the twist angles of interplanetary MFRs generally follow a trend of about 0.6l/R radians, where l/R is the aspect ratio of a MFR, with a cutoff at about 12π radians AU-1, (2) most of them are significantly larger than 2.5π radians but well bounded by 2l/R radians, (3) strongly twisted magnetic field lines probably limit the expansion and size of MFRs, and (4) the magnetic field lines in the legs wind more tightly than those in the leading part of MFRs. These results not only advance our understanding of the properties and behavior of interplanetary MFRs but also shed light on the formation and eruption of MFRs in the solar atmosphere. A discussion about the twist and stableness of solar MFRs are therefore given.

Aeromechanical Evaluation of Smart-Twisting Active Rotor

NASA Technical Reports Server (NTRS)

Lim, Joon W.; Boyd, D. Douglas, Jr.; Hoffman, Frauke; van der Wall, Berend G.; Kim, Do-Hyung; Jung, Sung N.; You, Young H.; Tanabe, Yasutada; Bailly, Joelle; Lienard, Caroline;

Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

DOE PAGES

Sanabria, Charlie; Lee, Peter J.; Starch, William; ...

2016-05-31

As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanabria, Charlie; Lee, Peter J.; Starch, William

As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

Solution structure of a DNA complex with the fluorescent bis-intercalator TOTO determined by NMR spectroscopy.

PubMed

Spielmann, H P; Wemmer, D E; Jacobsen, J P

1995-07-11

We have used two-dimensional 1H NMR spectroscopy to determine the solution structure of the DNA oligonucleotide d(5'-CGCTAGCG-3')2 complexed with the bis-intercalating dye 1,1'-(4,4,8,8-tetramethyl-4,8-diazaundecamethylene)bis[4-(3-methyl -2,3- dihydrobenzo-1,3-thiazolyl-2-methylidene)qui nolinium] tetraiodide (TOTO). The determination of the structure was based on total relaxation matrix analysis of the NOESY cross-peak intensities using the program MARDIGRAS. Improved procedures to consider the experimental "noise" in NOESY spectra during these calculations have been employed. The NOE-derived distance restraints were applied in restrained molecular dynamics calculations. Twenty final structures each were generated for the TOTO complex from both A-form and B-form dsDNA starting structures. The root-mean-square (rms) deviation of the coordinates for the 40 structures of the complex was 1.45 A. The local DNA structure is distorted in the complex. The helix is unwound by 60 degrees and has an overall helical repeat of 12 base pairs, caused by bis-intercalation of TOTO. The poly(propylenamine) linker chain is located in the minor groove of dsDNA. Calculations indicate that the benzothiazole ring system is twisted relative to the quinoline in the uncomplexed TOTO molecule. The site selectivity of TOTO for the CTAG-CTAG site is explained by its ability to adapt to the base pair propeller twist of dsDNA to optimize stacking and the hydrophobic interaction between the thymidine methyl group and the benzothiazole ring. There is a 3000-fold fluorescence enhancement upon binding of TOTO to dsDNA. Rotation about the cyanine methine bonds is possible in free TOTO, allowing relaxation nonradiatively. When bound to dsDNA, the benzothiazole ring and the quinolinium ring are clamped by the nucleobases preventing this rotation, and the chromophore loses excitation energy by fluorescence instead.

Optical Access Networks

NASA Astrophysics Data System (ADS)

Zheng, Jun; Ansari, Nirwan

2005-02-01

Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks.

Spectral determinants for twist field correlators

NASA Astrophysics Data System (ADS)

Belitsky, A. V.

2018-04-01

Twist fields were introduced a few decades ago as a quantum counterpart to classical kink configurations and disorder variables in low dimensional field theories. In recent years they received a new incarnation within the framework of geometric entropy and strong coupling limit of four-dimensional scattering amplitudes. In this paper, we study their two-point correlation functions in a free massless scalar theory, namely, twist-twist and twist-antitwist correlators. In spite of the simplicity of the model in question, the properties of the latter are far from being trivial. The problem is reduced, within the formalism of the path integral, to the study of spectral determinants on surfaces with conical points, which are then computed exactly making use of the zeta function regularization. We also provide an insight into twist correlators for a massive complex scalar by means of the Lifshitz-Krein trace formula.

Strength of surgical wire fixation. A laboratory study.

PubMed

Guadagni, J R; Drummond, D S

1986-08-01

Because of the frequent use of stainless steel wire in spinal surgery and to augment fracture fixation, several methods of securing wire fixation were tested in the laboratory to determine the relative strength of fixation. Any method of fixation stronger than the yield strength of the wire is sufficient. Square knots, knot twists, symmetric twists, and the AO loop-tuck techniques afforded acceptable resistance against tension loads, but the wire wrap and AO loop technique were unacceptable. The double symmetric twist, which is frequently used for tension banding, was barely acceptable. The symmetric twist technique was the most practical because it is strong enough, efficient in maintaining tension applied during fixation, and least likely to cause damage to the wire. To optimize the fixation strength of the symmetrical twist, at least two twists are required at a reasonably tight pitch.

THE EFFECT OF A TWISTED MAGNETIC FIELD ON THE PERIOD RATIO P{sub 1}/P{sub 2} OF NONAXISYMMETRIC MAGNETOHYDRODYNAMIC WAVES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karami, K.; Bahari, K., E-mail: KKarami@uok.ac.ir, E-mail: K.Bahari@razi.ac.ir

2012-10-01

We consider nonaxisymmetric magnetohydrodynamic (MHD) modes in a zero-beta cylindrical compressible thin magnetic flux tube modeled as a twisted core surrounded by a magnetically twisted annulus, with both embedded in a straight ambient external field. The dispersion relation is derived and solved analytically and numerically to obtain the frequencies of the nonaxisymmetric MHD waves. The main result is that the twisted magnetic annulus does affect the period ratio P{sub 1}/P{sub 2} of the kink modes. For the kink modes, the magnetic twist in the annulus region can achieve deviations from P{sub 1}/P{sub 2} = 2 of the same order ofmore » magnitude as in the observations. Furthermore, the effect of the internal twist on the fluting modes is investigated.« less

To investigate the relation between pore size and twist angle in enhanced thermoelectric efficient porous armchair graphene nanoribbons

NASA Astrophysics Data System (ADS)

Kaur, Sukhdeep; Randhawa, Deep Kamal Kaur; Bindra Narang, Sukhleen

2018-05-01

Based on Non-Equilibrium Green’s function method, we demonstrate that the twisted deformation is an efficient method to improve the figure of merit ZT of porous armchair graphene nanoribbons AGNRs. The peak value of ZT can be obtained for a certain tunable twist angle. Further analysis shows that the tunable twist angle exhibits an inverse relationship with the pore size laying forth the designers a choice for the larger twists to be replaced by smaller ones simply by increasing the size of the pore. Ballistic transport regime and semi-empirical method using Huckel basis set is used to obtain the electrical properties while the Tersoff potential is employed for the phononic system. These interesting findings indicate that the twisted porous AGNRs can be utilized as designing materials for potential thermoelectric applications.

Mesoporous Silica Nanoparticle Delivery of Chemically Modified siRNA Against TWIST1 Leads to Reduced Tumor Burden

PubMed Central

Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.

2015-01-01

Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637

Twisted surfaces with vanishing curvature in Galilean 3-space

NASA Astrophysics Data System (ADS)

Dede, Mustafa; Ekici, Cumali; Goemans, Wendy; Ünlütürk, Yasin

In this work, we define twisted surfaces in Galilean 3-space. In order to construct these surfaces, a planar curve is subjected to two simultaneous rotations, possibly with different rotation speeds. The existence of Euclidean rotations and isotropic rotations leads to three distinct types of twisted surfaces in Galilean 3-space. Then we classify twisted surfaces in Galilean 3-space with zero Gaussian curvature or zero mean curvature.

Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

NASA Technical Reports Server (NTRS)

Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

2001-01-01

A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

NASA Astrophysics Data System (ADS)

Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

2018-05-01

Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

Structural and electron diffraction scaling of twisted graphene bilayers

NASA Astrophysics Data System (ADS)

Zhang, Kuan; Tadmor, Ellad B.

2018-03-01

Multiscale simulations are used to study the structural relaxation in twisted graphene bilayers and the associated electron diffraction patterns. The initial twist forms an incommensurate moiré pattern that relaxes to a commensurate microstructure comprised of a repeating pattern of alternating low-energy AB and BA domains surrounding a high-energy AA domain. The simulations show that the relaxation mechanism involves a localized rotation and shrinking of the AA domains that scales in two regimes with the imposed twist. For small twisting angles, the localized rotation tends to a constant; for large twist, the rotation scales linearly with it. This behavior is tied to the inverse scaling of the moiré pattern size with twist angle and is explained theoretically using a linear elasticity model. The results are validated experimentally through a simulated electron diffraction analysis of the relaxed structures. A complex electron diffraction pattern involving the appearance of weak satellite peaks is predicted for the small twist regime. This new diffraction pattern is explained using an analytical model in which the relaxation kinematics are described as an exponentially-decaying (Gaussian) rotation field centered on the AA domains. Both the angle-dependent scaling and diffraction patterns are in quantitative agreement with experimental observations. A Matlab program for extracting the Gaussian model parameters accompanies this paper.

Twisted sigma-model solitons on the quantum projective line

NASA Astrophysics Data System (ADS)

Landi, Giovanni

2018-04-01

On the configuration space of projections in a noncommutative algebra, and for an automorphism of the algebra, we use a twisted Hochschild cocycle for an action functional and a twisted cyclic cocycle for a topological term. The latter is Hochschild-cohomologous to the former and positivity in twisted Hochschild cohomology results into a lower bound for the action functional. While the equations for the critical points are rather involved, the use of the positivity and the bound by the topological term lead to self-duality equations (thus yielding twisted noncommutative sigma-model solitons, or instantons). We present explicit nontrivial solutions on the quantum projective line.

Explicit formulae for Chern-Simons invariants of the twist-knot orbifolds and edge polynomials of twist knots

NASA Astrophysics Data System (ADS)

Ham, J.-Y.; Lee, J.

2016-09-01

We calculate the Chern-Simons invariants of twist-knot orbifolds using the Schläfli formula for the generalized Chern-Simons function on the family of twist knot cone-manifold structures. Following the general instruction of Hilden, Lozano, and Montesinos-Amilibia, we here present concrete formulae and calculations. We use the Pythagorean Theorem, which was used by Ham, Mednykh and Petrov, to relate the complex length of the longitude and the complex distance between the two axes fixed by two generators. As an application, we calculate the Chern-Simons invariants of cyclic coverings of the hyperbolic twist-knot orbifolds. We also derive some interesting results. The explicit formulae of the A-polynomials of twist knots are obtained from the complex distance polynomials. Hence the edge polynomials corresponding to the edges of the Newton polygons of the A-polynomials of twist knots can be obtained. In particular, the number of boundary components of every incompressible surface corresponding to slope -4n+2 turns out to be 2. Bibliography: 39 titles.

Scanning tunneling microscopy and spectroscopy of twisted trilayer graphene

NASA Astrophysics Data System (ADS)

Zuo, Wei-Jie; Qiao, Jia-Bin; Ma, Dong-Lin; Yin, Long-Jing; Sun, Gan; Zhang, Jun-Yang; Guan, Li-Yang; He, Lin

2018-01-01

Twist, as a simple and unique degree of freedom, could lead to enormous novel quantum phenomena in bilayer graphene. A small rotation angle introduces low-energy van Hove singularities (VHSs) approaching the Fermi level, which result in unusual correlated states in the bilayer graphene. It is reasonable to expect that the twist could also affect the electronic properties of few-layer graphene dramatically. However, such an issue has remained experimentally elusive. Here, by using scanning tunneling microscopy/spectroscopy (STM/STS), we systematically studied a twisted trilayer graphene (TTG) with two different small twist angles between adjacent layers. Two sets of VHSs, originating from the two twist angles, were observed in the TTG, indicating that the TTG could be simply regarded as a combination of two different twisted bilayers of graphene. By using high-resolution STS, we observed a split of the VHSs and directly imaged the spatial symmetry breaking of electronic states around the VHSs. These results suggest that electron-electron interactions play an important role in affecting the electronic properties of graphene systems with low-energy VHSs.

Experimental and theoretical study of the in- fiber twist sensor based on quasi-fan Solc structure filter.

PubMed

Sun, Chunran; Wang, Muguang; Jian, Shuisheng

2017-08-21

In this paper, a novel quasi-fan Solc structure filter based on elliptical-core spun fiber for twist sensing has been experimentally investigated and theoretically analyzed. The discrete model of spun fiber has been built to analyze the transmission characteristics of proposed sensor. Both experimental and simulated results indicate that the extinction ratio of the comb spectrum based on quasi-fan Solc birefringent fiber filter varies with twist angle and agrees well with each other. Based on the intensity modulation, the proposed twist sensor exhibits a high sensitivity of 0.02219 dB/(°/m). Moreover, thanks to the invariability of the fiber birefringence and the state of polarization of the input light, the proposed twist sensor has a very low temperature and strain sensitivity, which can avoid the cross-sensitivity problem existing in most twist sensors.

Two-pseudoscalar-meson decay of {chi}{sub cJ} with twist-3 corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Mingzhen; Zhou Haiqing; Department of Physics, Southeast University, Nanjing 211189

2009-11-01

The decays of {chi}{sub cJ}{yields}{pi}{sup +}{pi}{sup -}, K{sup +}K{sup -} (J=0,2) are discussed within the standard and modified hard-scattering approach when including the contributions from twist-3 distribution amplitudes and wave functions of the light pseudoscalar meson. A model for twist-2 and twist-3 distribution amplitudes and wave functions of the pion and kaon with BHL prescription are proposed as the solution to the end-point singularities. The results show that the contributions from twist-3 parts are actually not power suppressed comparing with the leading-twist contribution. After including the effects from the transverse momentum of light meson valence-quark state and Sudakov factors, themore » decay widths of the {chi}{sub cJ} into pions or kaons are comparable with the their experimental data.« less

Raman spectroscopy measurement of bilayer graphene's twist angle to boron nitride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Bin; Wang, Peng; Pan, Cheng

2015-07-20

When graphene is placed on hexagonal boron nitride with a twist angle, new properties develop due to the resulting moiré superlattice. Here, we report a method using Raman spectroscopy to make rapid, non-destructive measurements of the twist angle between bilayer graphene and hexagonal boron nitride. The lattice orientation is determined by using flakes with both bilayer and monolayer regions, and using the known Raman signature for the monolayer to measure the twist angle of the entire flake. The widths of the second order Raman peaks are found to vary linearly in the superlattice period and are used to determine themore » twist angle. The results are confirmed by using transport measurements to infer the superlattice period by the charge density required to reach the secondary resistance peaks. Small twist angles are also found to produce a significant modification of the first order Raman G band peak.« less

Landau damping of Langmuir twisted waves with kappa distributed electrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman; Mahmood, Shahzad

2015-11-15

The kinetic theory of Landau damping of Langmuir twisted modes is investigated in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the Langmuir twisted waves in a nonthermal plasma. The strong damping effects of the Langmuir twisted waves at wavelengths approaching Debye length are also obtained by using an exact numerical method and aremore » illustrated graphically. The damping rates of the planar Langmuir waves are found to be larger than the twisted Langmuir waves in plasmas which shows opposite behavior as depicted in Fig. 3 by J. T. Mendoça [Phys. Plasmas 19, 112113 (2012)].« less

Acoustic Aspects of Active-Twist Rotor Control

NASA Technical Reports Server (NTRS)

Booth, Earl R., Jr.; Wilbur, Matthew L.

2002-01-01

The use of an Active Twist Rotor system to provide both vibration reduction and performance enhancement has been explored in recent analytical and experimental studies. Effects of active-twist control on rotor noise, however, had not been determined. During a recent wind tunnel test of an active-twist rotor system, a set of acoustic measurements were obtained to assess the effects of active-twist control on noise produced by the rotor, especially blade-vortex interaction (BVI) noise. It was found that for rotor operating conditions where BVI noise is dominant, active-twist control provided a reduction in BVI noise level. This BVI noise reduction was almost, but not quite, as large as that obtained in a similar test using HHC. However, vibration levels were usually adversely affected at operating conditions favoring minimum BVI noise. Conversely, operating conditions favoring minimum vibration levels affected BVI noise levels, but not always adversely.

Spectroscopic and Ab Initio Determination of the Ring-Twisting Potential Energy Function for 1,3-Cyclohexadiene

NASA Astrophysics Data System (ADS)

Autrey, Daniel; Choo, Jaebum; Laane, Jaan

2000-10-01

The ring-twisting vibration of 1,3-cyclohexadiene has been studied using Raman and infrared spectroscopy of the molecule in the vapor phase. The Raman spectrum shows five ring-twisting transitions in the 150 - 200 cm-1 region. The far-infrared spectrum shows only two transitions for this vibration, which is infrared forbidden in the C_2v (planar) approximation. Three ring-twisting combination bands were also observed off a fundamental vibration at 926.1 cm-1. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function. Ab initio calculations were performed using Moller-Plesset perturbation theory (MP2) using different basis sets. The barrier to planarity of 1150 cm-1 was determined from the spectroscopic data. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range.

Geometric Constraints and the Anatomical Interpretation of Twisted Plant Organ Phenotypes

PubMed Central

Weizbauer, Renate; Peters, Winfried S.; Schulz, Burkhard

2011-01-01

The study of plant mutants with twisting growth in axial organs, which normally grow straight in the wild-type, is expected to improve our understanding of the interplay among microtubules, cellulose biosynthesis, cell wall structure, and organ biomechanics that control organ growth and morphogenesis. However, geometric constraints based on symplastic growth and the consequences of these geometric constraints concerning interpretations of twisted-organ phenotypes are currently underestimated. Symplastic growth, a fundamental concept in plant developmental biology, is characterized by coordinated growth of adjacent cells based on their connectivity through cell walls. This growth behavior implies that in twisting axial organs, all cell files rotate in phase around the organ axis, as has been illustrated for the Arabidopsis spr1 and twd1 mutants in this work. Evaluating the geometry of such organs, we demonstrate that a radial gradient in cell elongation and changes in cellular growth anisotropy must occur in twisting organs out of geometric necessity alone. In-phase rotation of the different cell layers results in a decrease of length and angle toward organ axis from the outer cell layers inward. Additionally, the circumference of each cell layer increases in twisting organs, which requires compensation through radial expansion or an adjustment of cell number. Therefore, differential cell elongation and growth anisotropy cannot serve as arguments for or against specific hypotheses regarding the molecular cause of twisting growth. We suggest instead, that based on mathematical modeling, geometric constraints in twisting organs are indispensable for the explanation of the causal connection of molecular and biomechanical processes in twisting as well as normal organs. PMID:22645544

Characterization of paired helical filaments by scanning transmission electron microscopy.

PubMed

Ksiezak-Reding, Hanna; Wall, Joseph S

2005-07-01

Paired helical filaments (PHFs) are abnormal twisted filaments composed of hyperphosphorylated tau protein. They are found in Alzheimer's disease and other neurodegenerative disorders designated as tauopathies. They are a major component of intracellular inclusions known as neurofibrillary tangles (NFTs). The objective of this review is to summarize various structural studies of PHFs in which using scanning transmission electron microscopy (STEM) has been particularly informative. STEM provides shape and mass per unit length measurements important for studying ultrastructural aspects of filaments. These include quantitative comparisons between dispersed and aggregated populations of PHFs as well as comparative studies of PHFs in Alzheimer's disease and other neurodegenerative disorders. Other approaches are also discussed if relevant or complementary to studies using STEM, e.g., application of a novel staining reagent, Nanovan. Our understanding of the PHF structure and the development of PHFs into NFTs is presented from a historical perspective. Others goals are to describe the biochemical and ultrastructural complexity of authentic PHFs, to assess similarities between authentic and synthetic PHFs, and to discuss recent advances in PHF modeling.

Paired quantum Hall states on noncommutative two-tori

NASA Astrophysics Data System (ADS)

Marotta, Vincenzo; Naddeo, Adele

2010-08-01

By exploiting the notion of Morita equivalence for field theories on noncommutative tori and choosing rational values of the noncommutativity parameter θ (in appropriate units), a one-to-one correspondence between an Abelian noncommutative field theory (NCFT) and a non-Abelian theory of twisted fields on ordinary space can be established. Starting from this general result, we focus on the conformal field theory (CFT) describing a quantum Hall fluid (QHF) at paired states fillings ν=mp/m+2 Cristofano et al. (2000) [1], recently obtained by means of m-reduction procedure, and show that it is the Morita equivalent of a NCFT. In this way we extend the construction proposed in Marotta and Naddeo (2008) [2] for the Jain series ν=>m2p/m+1. The case m=2 is explicitly discussed and the role of noncommutativity in the physics of quantum Hall bilayers is emphasized. Our results represent a step forward the construction of a new effective low energy description of certain condensed matter phenomena and help to clarify the relationship between noncommutativity and quantum Hall fluids.

DNA denaturation bubbles: free-energy landscape and nucleation/closure rates.

PubMed

Sicard, François; Destainville, Nicolas; Manghi, Manoel

2015-01-21

The issue of the nucleation and slow closure mechanisms of non-superhelical stress-induced denaturation bubbles in DNA is tackled using coarse-grained MetaDynamics and Brownian simulations. A minimal mesoscopic model is used where the double helix is made of two interacting bead-spring rotating strands with a prescribed torsional modulus in the duplex state. We demonstrate that timescales for the nucleation (respectively, closure) of an approximately 10 base-pair bubble, in agreement with experiments, are associated with the crossing of a free-energy barrier of 22 kBT (respectively, 13 kBT) at room temperature T. MetaDynamics allows us to reconstruct accurately the free-energy landscape, to show that the free-energy barriers come from the difference in torsional energy between the bubble and duplex states, and thus to highlight the limiting step, a collective twisting, that controls the nucleation/closure mechanism, and to access opening time scales on the millisecond range. Contrary to small breathing bubbles, those more than 4 base-pair bubbles are of biological relevance, for example, when a pre-existing state of denaturation is required by specific DNA-binding proteins.

Far infrared promotes wound healing through activation of Notch1 signaling.

PubMed

Hsu, Yung-Ho; Lin, Yuan-Feng; Chen, Cheng-Hsien; Chiu, Yu-Jhe; Chiu, Hui-Wen

2017-11-01

The Notch signaling pathway is critically involved in cell proliferation, differentiation, development, and homeostasis. Far infrared (FIR) has an effect that promotes wound healing. However, the underlying molecular mechanisms are unclear. In the present study, we employed in vivo and HaCaT (a human skin keratinocyte cell line) models to elucidate the role of Notch1 signaling in FIR-promoted wound healing. We found that FIR enhanced keratinocyte migration and proliferation. FIR induced the Notch1 signaling pathway in HaCaT cells and in a microarray dataset from the Gene Expression Omnibus database. We next determined the mRNA levels of NOTCH1 in paired normal and wound skin tissues derived from clinical patients using the microarray dataset and Ingenuity Pathway Analysis software. The result indicated that the Notch1/Twist1 axis plays important roles in wound healing and tissue repair. In addition, inhibiting Notch1 signaling decreased the FIR-enhanced proliferation and migration. In a full-thickness wound model in rats, the wounds healed more rapidly and the scar size was smaller in the FIR group than in the light group. Moreover, FIR could increase Notch1 and Delta1 in skin tissues. The activation of Notch1 signaling may be considered as a possible mechanism for the promoting effect of FIR on wound healing. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model.

Enhanced epithelial to mesenchymal transition (EMT) and upregulated MYC in ectopic lesions contribute independently to endometriosis.

PubMed

Proestling, Katharina; Birner, Peter; Gamperl, Susanne; Nirtl, Nadine; Marton, Erika; Yerlikaya, Gülen; Wenzl, Rene; Streubel, Berthold; Husslein, Heinrich

2015-07-22

Epithelial to mesenchymal transition (EMT) is a process in which epithelial cells lose polarity and cell-to-cell contacts and acquire the migratory and invasive abilities of mesenchymal cells. These abilities are thought to be prerequisites for the establishment of endometriotic lesions. A hallmark of EMT is the functional loss of E-cadherin (CDH1) expression in epithelial cells. TWIST1, a transcription factor that represses E-cadherin transcription, is among the EMT inducers. SNAIL, a zinc-finger transcription factor, and its close relative SLUG have similar properties to TWIST1 and are thus also EMT inducers. MYC, which is upregulated by estrogens in the uterus by an estrogen response cis-acting element (ERE) in its promoter, is associated with proliferation in endometriosis. The role of EMT and proliferation in the pathogenesis of endometriosis was evaluated by analyzing TWIST1, CDH1 and MYC expression. CDH1, TWIST1, SNAIL and SLUG mRNA expression was analyzed by qRT-PCR from 47 controls and 74 patients with endometriosis. Approximately 42 ectopic and 62 eutopic endometrial tissues, of which 30 were matched samples, were collected during the same surgical procedure. We evaluated TWIST1 and MYC protein expression by immunohistochemistry (IHC) in the epithelial and stromal tissue of 69 eutopic and 90 ectopic endometrium samples, of which 49 matched samples were analyzed from the same patient. Concordant expression of TWIST1/SNAIL/SLUG and CDH1 but also of TWIST1 and MYC was analyzed. We found that TWIST1, SNAIL and SLUG are overexpressed (p < 0.001, p = 0.016 and p < 0.001) in endometriosis, while CDH1 expression was concordantly reduced in these samples (p < 0.001). Similar to TWIST1, the epithelial expression of MYC was also significantly enhanced in ectopic endometrium compared to eutopic tissues (p = 0.008). We found exclusive expression of either TWIST1 or MYC in the same samples (p = 0.003). Epithelial TWIST1 is overexpressed in endometriosis and may contribute to the formation of endometriotic lesions by inducing epithelial to mesenchymal transition, as CDH1 was reduced in ectopic lesions. We found exclusive expression of either TWIST1 or MYC in the same samples, indicating that EMT and proliferation contribute independently of each other to the formation of endometriotic lesions.

Description of the HiMAT Tailored composite structure and laboratory measured vehicle shape under load

NASA Technical Reports Server (NTRS)

Monaghan, R. C.

1981-01-01

The aeroelastically tailored outer wing and canard of the highly maneuverable aircraft technology (HiMAT) vehicle are closely examined and a general description of the overall structure of the vehicle is provided. Test data in the form of laboratory measured twist under load and predicted twist from the HiMAT NASTRAN structural design program are compared. The results of this comparison indicate that the measured twist is generally less than the NASTRAN predicted twist. These discrepancies in twist predictions are attributed, at least in part, to the inability of current analytical composite materials programs to provide sufficiently accurate properties of matrix dominated laminates for input into structural programs such as NASTRAN.

Demonstration of an elastically coupled twist control concept for tilt rotor blade application

NASA Technical Reports Server (NTRS)

Lake, R. C.; Nixon, M. W.; Wilbur, M. L.; Singleton, J. D.; Mirick, P. H.

1994-01-01

The purpose of this Note is to present results from an analytic/experimental study that investigated the potential for passively changing blade twist through the use of extension-twist coupling. A set of composite model rotor blades was manufactured from existing blade molds for a low-twist metal helicopter rotor blade, with a view toward establishing a preliminary proof concept for extension-twist-coupled rotor blades. Data were obtained in hover for both a ballasted and unballasted blade configuration in sea-level atmospheric conditions. Test data were compared with results obtained from a geometrically nonlinear analysis of a detailed finite element model of the rotor blade developed in MSC/NASTRAN.

A photometric determination of twists in early-type galaxies. II

NASA Technical Reports Server (NTRS)

Williams, T. B.; Schwarzschild, M.

1979-01-01

In continuation of previous work, detailed photometric data have been obtained for two elliptical galaxies by using the Mount Lemmon 1.5-m telescope and a large SEC television camera. As before, the aim of this photometry is to gain additional information on the occurrence of twists in such galaxies; i.e., on the change of the position angle of the major axes of the isophotes from the center outward. No significant twist was found in NGC 1052. However, NGC 584 was found to have a securely observed twist of about 10 deg within 10 kpc from its center. These data strengthen previous indications that many ellipticals contain twists in their inner, bright portions.

Lifshits Tails for Randomly Twisted Quantum Waveguides

NASA Astrophysics Data System (ADS)

Kirsch, Werner; Krejčiřík, David; Raikov, Georgi

2018-03-01

We consider the Dirichlet Laplacian H_γ on a 3D twisted waveguide with random Anderson-type twisting γ . We introduce the integrated density of states N_γ for the operator H_γ , and investigate the Lifshits tails of N_γ , i.e. the asymptotic behavior of N_γ (E) as E \\downarrow \\inf supp dN_γ . In particular, we study the dependence of the Lifshits exponent on the decay rate of the single-site twisting at infinity.

Twisted Vanes Would Enhance Fuel/Air Mixing In Turbines

NASA Technical Reports Server (NTRS)

Nguyen, H. Lee; Micklow, Gerald J.; Dogra, Anju S.

1994-01-01

Computations of flow show performance of high-shear airblast fuel injector in gas-turbine engine enhanced by use of appropriately proportioned twisted (instead of flat) dome swirl vanes. Resultant more nearly uniform fuel/air mixture burns more efficiently, emitting smaller amounts of nitrogen oxides. Twisted-vane high-shear airblast injectors also incorporated into paint sprayers, providing advantages of low pressure drop characteristic of airblast injectors in general and finer atomization of advanced twisted-blade design.

Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition.

PubMed

Khan, Md Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

2015-08-14

Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis.

Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition

PubMed Central

Khan, Md. Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

2015-01-01

Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis. PMID:26023736

Projection Moire Interferometry for Rotorcraft Applications: Deformation Measurements of Active Twist Rotor Blades

NASA Technical Reports Server (NTRS)

Fleming, Gary A.; Soto, Hector L.; South, Bruce W.

2002-01-01

Projection Moire Interferometry (PMI) has been used during wind tunnel tests to obtain azimuthally dependent blade bending and twist measurements for a 4-bladed Active Twist Rotor (ATR) system in simulated forward flight. The ATR concept offers a means to reduce rotor vibratory loads and noise by using piezoelectric active fiber composite actuators embedded in the blade structure to twist each blade as they rotate throughout the rotor azimuth. The twist imparted on the blades for blade control causes significant changes in blade loading, resulting in complex blade deformation consisting of coupled bending and twist. Measurement of this blade deformation is critical in understanding the overall behavior of the ATR system and the physical mechanisms causing the reduction in rotor loads and noise. PMI is a non-contacting, video-based optical measurement technique capable of obtaining spatially continuous structural deformation measurements over the entire object surface within the PMI system field-of-view. When applied to rotorcraft testing, PMI can be used to measure the azimuth-dependent blade bending and twist along the full span of the rotor blade. This paper presents the PMI technique as applied to rotorcraft testing, and provides results obtained during the ATR tests demonstrating the PMI system performance. PMI measurements acquired at select blade actuation conditions generating minimum and maximum rotor loads are provided to explore the interrelationship between rotor loads, blade bending, and twist.

Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

PubMed

Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

2015-07-02

Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Non-contact data access with direction identification for industrial differential serial bus

NASA Astrophysics Data System (ADS)

Xie, Kai; Li, Xiaoping; Zhang, Hanlu; Yang, Ming; Ye, Yinghao

2013-06-01

We propose a non-contact method for accessing data in industrial differential serial bus applications, which could serve as an effective and safe online testing and diagnosing tool. The data stream and the transmission direction are reconstructed simultaneously from the near-field emanations of a twisted pair, eliminating direct contact with the actual conductors, and avoiding damage to the insulation (only the outer sheathing is removed). A non-contact probe with the ability to sense electric and magnetic fields is presented, as are theories for data reconstruction, direction identification, and a circuit implementation. The prototype was built using inexpensive components and then tested on a standard RS-485 industrial serial bus. Experimental results verified the validity of the proposed scheme.

Star-triangle and star-star relations in statistical mechanics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baxter, R.J.

1997-01-20

The homogeneous three-layer Zamolodchikov model is equivalent to a four-state model on the checkerboard lattice which closely resembles the four-state critical Potts model, but with some of its Boltzmann weights negated. Here the author shows that it satisfies a star-to-reverse-star (or simply star-star) relation, even though they know of no star-triangle relation for this model. For any nearest-neighbor checkerboard model, they show that this star-star relation is sufficient to ensure that the decimated model (where half the spins have been summed over) satisfies a twisted Yang-Baxter relation. This ensures that the transfer matrices of the original model commute in pairs,more » which is an adequate condition for solvability.« less

Enhanced sampling simulations of DNA step parameters.

PubMed

Karolak, Aleksandra; van der Vaart, Arjan

2014-12-15

A novel approach for the selection of step parameters as reaction coordinates in enhanced sampling simulations of DNA is presented. The method uses three atoms per base and does not require coordinate overlays or idealized base pairs. This allowed for a highly efficient implementation of the calculation of all step parameters and their Cartesian derivatives in molecular dynamics simulations. Good correlation between the calculated and actual twist, roll, tilt, shift, and slide parameters is obtained, while the correlation with rise is modest. The method is illustrated by its application to the methylated and unmethylated 5'-CATGTGACGTCACATG-3' double stranded DNA sequence. One-dimensional umbrella simulations indicate that the flexibility of the central CG step is only marginally affected by methylation. © 2014 Wiley Periodicals, Inc.

Multimedia article. The keys to the new laparoscopic world Thumbs up! knot and Tornado knot.

PubMed

Uchida, K; Haruta, N; Okajima, M; Matsuda, M; Yamamoto, M

2005-06-01

Most laparoscopic surgeons feel some anxiety when performing intracorporeal knotting with conventional techniques [1, 2]. Two factors contribute to this anxiety. The first is the necessity of recognizing three dimensions on a two-dimensional monitor. The conventional intracorporeal knotting techniques make loops by twisting the thread with a second pair of forceps. This necessitates cooperative movement of both hands, with the added difficulties of depth perception. Regular touch confirmations reduce problems with depth perception. However, touch confirmation is more complicated in laparoscopic surgery than in laparotomy. The second problem is that tied loops can come loose and escape the instruments, especially with hard thread. This is not only stressful but also increases operation time.

Long Distance Reactor Antineutrino Flux Monitoring

NASA Astrophysics Data System (ADS)

Dazeley, Steven; Bergevin, Marc; Bernstein, Adam

2015-10-01

The feasibility of antineutrino detection as an unambiguous and unshieldable way to detect the presence of distant nuclear reactors has been studied. While KamLAND provided a proof of concept for long distance antineutrino detection, the feasibility of detecting single reactors at distances greater than 100 km has not yet been established. Even larger detectors than KamLAND would be required for such a project. Considerations such as light attenuation, environmental impact and cost, which favor water as a detection medium, become more important as detectors get larger. We have studied both the sensitivity of water based detection media as a monitoring tool, and the scientific impact such detectors might provide. A next generation water based detector may be able to contribute to important questions in neutrino physics, such as supernova neutrinos, sterile neutrino oscillations, and non standard electroweak interactions (using a nearby compact accelerator source), while also providing a highly sensitive, and inherently unshieldable reactor monitoring tool to the non proliferation community. In this talk I will present the predicted performance of an experimental non proliferation and high-energy physics program. Lawrence Livermore National Laboratory is operated by Lawrence Livermore National Security, LLC, for the U.S. Department of Energy, National Nuclear Security Administration under Contract DE-AC52-07NA27344. Release number LLNL-ABS-674192.

Jet Noise Shielding Provided by a Hybrid Wing Body Aircraft

NASA Technical Reports Server (NTRS)

Doty, Michael J.; Brooks, Thomas F.; Burley, Casey L.; Bahr, Christopher J.; Pope, Dennis S.

2014-01-01

One approach toward achieving NASA's aggressive N+2 noise goal of 42 EPNdB cumulative margin below Stage 4 is through the use of novel vehicle configurations like the Hybrid Wing Body (HWB). Jet noise measurements from an HWB acoustic test in NASA Langley's 14- by 22-Foot Subsonic Tunnel are described. Two dual-stream, heated Compact Jet Engine Simulator (CJES) units are mounted underneath the inverted HWB model on a traversable support to permit measurement of varying levels of shielding provided by the fuselage. Both an axisymmetric and low noise chevron nozzle set are investigated in the context of shielding. The unshielded chevron nozzle set shows 1 to 2 dB of source noise reduction (relative to the unshielded axisymmetric nozzle set) with some penalties at higher frequencies. Shielding of the axisymmetric nozzles shows up to 6.5 dB of reduction at high frequency. The combination of shielding and low noise chevrons shows benefits beyond the expected additive benefits of the two, up to 10 dB, due to the effective migration of the jet source peak noise location upstream for increased shielding effectiveness. Jet noise source maps from phased array results processed with the Deconvolution Approach for the Mapping of Acoustic Sources (DAMAS) algorithm reinforce these observations.

Extraction of depth-dependent perturbation factors for silicon diodes using a plastic scintillation detector.

PubMed

Lacroix, Frederic; Guillot, Mathieu; McEwen, Malcolm; Gingras, Luc; Beaulieu, Luc

2011-10-01

This work presents the experimental extraction of the perturbation factor in megavoltage electron beams for three models of silicon diodes (IBA Dosimetry, EFD and SFD, and the PTW 60012 unshielded) using a plastic scintillation detector (PSD). The authors used a single scanning PSD mounted on a high-precision scanning tank to measure depth-dose curves in 6-, 12-, and 18-MeV clinical electron beams. They also measured depth-dose curves using the IBA Dosimetry, EFD and SFD, and the PTW 60012 unshielded diodes. The authors used the depth-dose curves measured with the PSD as a perturbation-free reference to extract the perturbation factors of the diodes. The authors found that the perturbation factors for the diodes increased substantially with depth, especially for low-energy electron beams. The experimental results show the same trend as published Monte Carlo simulation results for the EFD diode; however, the perturbations measured experimentally were greater. They found that using an effective point of measurement (EPOM) placed slightly away from the source reduced the variation of perturbation factors with depth and that the optimal EPOM appears to be energy dependent. The manufacturer recommended EPOM appears to be incorrect at low electron energy (6 MeV). In addition, the perturbation factors for diodes may be greater than predicted by Monte Carlo simulations.

Three-Dimensional Rotation, Twist and Torsion Analyses Using Real-Time 3D Speckle Tracking Imaging: Feasibility, Reproducibility, and Normal Ranges in Pediatric Population.

PubMed

Zhang, Li; Zhang, Jing; Han, Wei; Gao, Jun; He, Lin; Yang, Yali; Yin, Ping; Xie, Mingxing; Ge, Shuping

2016-01-01

The specific aim of this study was to evaluate the feasibility, reproducibility and maturational changes of LV rotation, twist and torsion variables by real-time 3D speckle-tracking echocardiography (RT3DSTE) in children. A prospective study was conducted in 347 consecutive healthy subjects (181 males/156 females, mean age 7.12 ± 5.3 years, and range from birth to 18-years) using RT 3D echocardiography (3DE). The LV rotation, twist and torsion measurements were made off-line using TomTec software. Manual landmark selection and endocardial border editing were performed in 3 planes (apical "2"-, "4"-, and "3"- chamber views) and semi-automated tracking yielded LV rotation, twist and torsion measurements. LV rotation, twist and torsion analysis by RT 3DSTE were feasible in 307 out of 347 subjects (88.5%). There was no correlation between rotation or twist and age, height, weight, BSA or heart rate, respectively. However, there was statistically significant, but very modest correlation between LV torsion and age (R2 = 0.036, P< 0.001). The normal ranges were defined for rotation and twist in this cohort, and for torsion for each age group. The intra-observer and inter-observer variabilities for apical and basal rotation, twist and torsion ranged from 7.3% ± 3.8% to 12.3% ± 8.8% and from 8.8% ± 4.6% to 15.7% ± 10.1%, respectively. We conclude that analysis of LV rotation, twist and torsion by this new RT3D STE is feasible and reproducible in pediatric population. There is no maturational change in rotation and twist, but torsion decreases with age in this cohort. Further refinement is warranted to validate the utility of this new methodology in more sensitive and quantitative evaluation of congenital and acquired heart diseases in children.

Low-Frequency Interlayer Raman Modes to Probe Interface of Twisted Bilayer MoS 2

DOE PAGES

Huang, Shengxi; Liang, Liangbo; Ling, Xi; ...

2016-02-21

A variety of van der Waals homo- and hetero- structures assembled by stamping monolayers together present optoelectronic properties suitable for diverse applications. Understanding the details of the interlayer stacking and resulting coupling is crucial for tuning these properties. Twisted bilayer transition metal dichalcogenides offer a great platform for developing a precise understanding of the structure/property relationship. Here, we study the low-frequency interlayer shear and breathing Raman modes (<50 cm-1) in twisted bilayer MoS 2 by Raman spectroscopy and first-principles modeling. Twisting introduces both rotational and translational shifts and significantly alters the interlayer stacking and coupling, leading to notable frequency andmore » intensity changes of low-frequency modes. The frequency variation can be up to 8 cm-1 and the intensity can vary by a factor of ~5 for twisting near 0 and 60 , where the stacking is a mixture of multiple high-symmetry stacking patterns and is thus especially sensitive to twisting. Moreover, for twisting angles between 20 and 40 , the interlayer coupling is nearly constant since the stacking results in mismatched lattices over the entire sample. It follows that the Raman signature is relatively uniform. Interestingly, unlike the breathing mode, the shear mode is extremely sensitive to twisting: it disappears between 20 and 40 as its frequency drops to almost zero due to the stacking-induced mismatch. Note that for some samples, multiple breathing mode peaks appear, indicating non-uniform coupling across the interface. In contrast to the low-frequency interlayer modes, high-frequency intralayer Raman modes are much less sensitive to interlayer stacking and coupling, showing negligible changes upon twisting. Our research demonstrates the effectiveness of low-frequency Raman modes for probing the interfacial coupling and environment of twisted bilayer MoS2, and potentially other two-dimensional materials and heterostructures.« less

Sunspot rotation. II. Effects of varying the field strength and twist of an emerging flux tube

NASA Astrophysics Data System (ADS)

Sturrock, Z.; Hood, A. W.

2016-09-01

Context. Observations of flux emergence indicate that rotational velocities may develop within sunspots. However, the dependence of this rotation on sub-photospheric field strength and twist remains largely unknown. Aims: We investigate the effects of varying the initial field strength and twist of an emerging sub-photospheric magnetic flux tube on the rotation of the sunspots at the photosphere. Methods: We consider a simple model of a stratified domain with a sub-photospheric interior layer and three overlying atmospheric layers. A twisted arched flux tube is inserted in the interior and is allowed to rise into the atmosphere. To achieve this, the magnetohydrodynamic equations are solved using the Lagrangian-remap code, Lare3d. We perform a parameter study by independently varying the sub-photospheric magnetic field strength and twist. Results: Altering the initial magnetic field strength and twist of the flux tube significantly affects the tube's evolution and the rotational motions that develop at the photosphere. The rotation angle, vorticity, and current show a direct dependence on the initial field strength. We find that an increase in field strength increases the angle through which the fieldlines rotate, the length of the fieldlines extending into the atmosphere, and the magnetic energy transported to the atmosphere. This also affects the amount of residual twist in the interior. The length of the fieldlines is crucial as we predict the twist per unit length equilibrates to a lower value on longer fieldlines. No such direct dependence is found when we modify the twist of the magnetic field owing to the complex effect this has on the tension force acting on the tube. However, there is still a clear ordering in quantities such as the rotation angle, helicity, and free energy with higher initial twist cases being related to sunspots that rotate more rapidly, transporting more helicity and magnetic energy to the atmosphere.

Twist1 Transcriptional Targets in the Developing Atrio-Ventricular Canal of the Mouse

PubMed Central

Vrljicak, Pavle; Cullum, Rebecca; Xu, Eric; Chang, Alex C. Y.; Wederell, Elizabeth D.; Bilenky, Mikhail; Jones, Steven J. M.; Marra, Marco A.; Karsan, Aly; Hoodless, Pamela A.

2012-01-01

Malformations of the cardiovascular system are the most common type of birth defect in humans, frequently affecting the formation of valves and septa. During heart valve and septa formation, cells from the atrio-ventricular canal (AVC) and outflow tract (OFT) regions of the heart undergo an epithelial-to-mesenchymal transformation (EMT) and invade the underlying extracellular matrix to give rise to endocardial cushions. Subsequent maturation of newly formed mesenchyme cells leads to thin stress-resistant leaflets. TWIST1 is a basic helix-loop-helix transcription factor expressed in newly formed mesenchyme cells of the AVC and OFT that has been shown to play roles in cell survival, cell proliferation and differentiation. However, the downstream targets of TWIST1 during heart valve formation remain unclear. To identify genes important for heart valve development downstream of TWIST1, we performed global gene expression profiling of AVC, OFT, atria and ventricles of the embryonic day 10.5 mouse heart by tag-sequencing (Tag-seq). Using this resource we identified a novel set of 939 genes, including 123 regulators of transcription, enriched in the valve forming regions of the heart. We compared these genes to a Tag-seq library from the Twist1 null developing valves revealing significant gene expression changes. These changes were consistent with a role of TWIST1 in controlling differentiation of mesenchymal cells following their transformation from endothelium in the mouse. To study the role of TWIST1 at the DNA level we performed chromatin immunoprecipitation and identified novel direct targets of TWIST1 in the developing heart valves. Our findings support a role for TWIST1 in the differentiation of AVC mesenchyme post-EMT in the mouse, and suggest that TWIST1 can exert its function by direct DNA binding to activate valve specific gene expression. PMID:22815831

Experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers

NASA Astrophysics Data System (ADS)

Yin, Long-Jing; Qiao, Jia-Bin; Zuo, Wei-Jie; Li, Wen-Tian; He, Lin

2015-08-01

Non-Abelian gauge potentials are quite relevant in subatomic physics, but they are relatively rare in a condensed matter context. Here we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by scanning tunneling microscopy and spectroscopy. At a magic twisted angle, θ ≈(1.11±0.05 ) ∘ , a pronounced sharp peak, which arises from the nondispersive flat bands at the charge neutrality point, is observed in the tunneling density of states due to the action of the non-Abelian gauge fields. Moreover, we observe confined electronic states in the twisted bilayer, as manifested by regularly spaced tunneling peaks with energy spacing δ E ≈vF/D ≈70 meV (here vF is the Fermi velocity of graphene and D is the period of the moiré patterns). This indicates that the non-Abelian gauge potentials in twisted graphene bilayers confine low-energy electrons into a triangular array of quantum dots following the modulation of the moiré patterns. Our results also directly demonstrate that the Fermi velocity in twisted bilayers can be tuned from about 106m /s to zero by simply reducing the twisted angle of about 2∘.

Twist phase-induced characteristics changes of a radially polarized Gaussian Schell-Model beam in a uniaxial crystal orthogonal to the optical axis

NASA Astrophysics Data System (ADS)

Cao, Pengfei; Fu, Wenyu

2017-10-01

Based on the extended Huygens-Fresnel integral formula and unified theory of coherence and polarization, we obtained the cross-spectral density matrix elements for a radially polarized partially coherent twist (RPPCT) beam in a uniaxial crystal. Moreover, compared with free space, we explore numerically the evolution properties of a RPPCT beam in a uniaxial crystal. The calculation results show that the evolution properties of a RPPCT beam in crystals are substantially different from its properties in free space. These properties in crystals are mainly determined by the twist factor and the ratio of extraordinary index to ordinary refractive index. In a uniaxial crystal, the distribution of the intensity of a RPPCT beam all exhibits non-circular symmetry, and these distributions change with twist factor and the ratio of extraordinary index to ordinary refractive index. The twist factor affects their rotation orientation angles, and the ratio of extraordinary index to ordinary refractive index impacts their twisted levels. This novel characteristics can be used for free-space optical communications, particle manipulation and nonlinear optics, where partially coherent beam with controlled profile and twist factor are required.

Cross-scale transport processes in the three-dimensional Kelvin-Helmholtz instability

NASA Astrophysics Data System (ADS)

Delamere, P. A.; Burkholder, B. L.; Ma, X.; Nykyri, K.

2017-12-01

The Kelvin-Helmholtz (KH) instability is a crucial aspect of the solar wind interaction with the giant magnetospheres. Rapid internal rotation of the magnetodisc produces conditions favorable for the growth of KH vortices along much of the equatorial magnetopause boundary. Pronounced dawn/dusk asymmetries at Jupiter and Saturn indicate a robust interaction with the solar wind. Using three-dimensional hybrid simulations we investigate the transport processes associated with the flow shear-driven KH instability. Of particular importance is small-scale and intermittent reconnection generated by the twisting of the magnetic field into configurations with antiparallel components. In three-dimensions strong guide field reconnection can occur even for initially parallel magnetic field configurations. Often the twisting motion leads to pairs of reconnection sites that can operate asynchronously, generating intermittent open flux and Maxwell stresses at the magnetopause boundary. We quantify the generation of open flux using field line tracing methods, determine the Reynolds and Maxwell stresses, and evaluate the mass transport as functions of magnetic shear, velocity shear, electron pressure and plasma beta. These results are compared with magnetohydrodynamic simulations (Ma et al., 2017). In addition, we present preliminary results for the role of cross-scale coupling processes, from fluid to ion scales. In particular, we characterize small-scale waves and the their role in mixing, diffusing and heating plasma at the magnetopause boundary.

Scleraxis is a transcriptional activator that regulates the expression of Tenomodulin, a marker of mature tenocytes and ligamentocytes.

PubMed

Shukunami, Chisa; Takimoto, Aki; Nishizaki, Yuriko; Yoshimoto, Yuki; Tanaka, Seima; Miura, Shigenori; Watanabe, Hitomi; Sakuma, Tetsushi; Yamamoto, Takashi; Kondoh, Gen; Hiraki, Yuji

2018-02-16

Tenomodulin (Tnmd) is a type II transmembrane glycoprotein predominantly expressed in tendons and ligaments. We found that scleraxis (Scx), a member of the Twist-family of basic helix-loop-helix transcription factors, is a transcriptional activator of Tnmd expression in tenocytes. During embryonic development, Scx expression preceded that of Tnmd. Tnmd expression was nearly absent in tendons and ligaments of Scx-deficient mice generated by transcription activator-like effector nucleases-mediated gene disruption. Tnmd mRNA levels were dramatically decreased during serial passages of rat tenocytes. Scx silencing by small interfering RNA significantly suppressed endogenous Tnmd mRNA levels in tenocytes. Mouse Tnmd contains five E-box sites in the ~1-kb 5'-flanking region. A 174-base pair genomic fragment containing a TATA box drives transcription in tenocytes. Enhancer activity was increased in the upstream region (-1030 to -295) of Tnmd in tenocytes, but not in NIH3T3 and C3H10T1/2 cells. Preferential binding of both Scx and Twist1 as a heterodimer with E12 or E47 to CAGATG or CATCTG and transactivation of the 5'-flanking region were confirmed by electrophoresis mobility shift and dual luciferase assays, respectively. Scx directly transactivates Tnmd via these E-boxes to positively regulate tenocyte differentiation and maturation.

Formation of Magnetic Flux Ropes during a Confined Flaring Well before the Onset of a Pair of Major Coronal Mass Ejections

NASA Astrophysics Data System (ADS)

Chintzoglou, Georgios; Patsourakos, Spiros; Vourlidas, Angelos

2015-08-01

NOAA active region (AR) 11429 was the source of twin super-fast coronal mass ejections (CMEs). The CMEs took place within an hour from each other, with the onset of the first taking place in the beginning of 2012 March 7. This AR fulfills all the requirements for a “super active region” namely, Hale's law incompatibility and a δ-spot magnetic configuration. One of the biggest storms of Solar Cycle 24 to date ({D}{st}=-143 nT) was associated with one of these events. Magnetic flux ropes (MFRs) are twisted magnetic structures in the corona, best seen in ˜10 MK hot plasma emission and are often considered the core of erupting structures. However, their “dormant” existence in the solar atmosphere (i.e., prior to eruptions), is an open question. Aided by multi-wavelength observations by the Solar Dynamics Observatory (SDO) and by the Solar Terrestrial Relations Observatory (STEREO) and a nonlinear force-free model for the coronal magnetic field, our work uncovers two separate, weakly twisted magnetic flux systems which suggest the existence of pre-eruption MFRs that eventually became the seeds of the two CMEs. The MFRs could have been formed during confined (i.e., not leading to major CMEs) flaring and sub-flaring events which took place the day before the two CMEs in the host AR 11429.

Statistical mechanics of ribbons under bending and twisting torques.

PubMed

Sinha, Supurna; Samuel, Joseph

2013-11-20

We present an analytical study of ribbons subjected to an external torque. We first describe the elastic response of a ribbon within a purely mechanical framework. We then study the role of thermal fluctuations in modifying its elastic response. We predict the moment-angle relation of bent and twisted ribbons. Such a study is expected to shed light on the role of twist in DNA looping and on bending elasticity of twisted graphene ribbons. Our quantitative predictions can be tested against future single molecule experiments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kleinert, J.; Haimberger, C.; Zabawa, P. J.

We describe the realization of a dc electric-field trap for ultracold polar molecules, the thin-wire electrostatic trap (TWIST). The thin wires that form the electrodes of the TWIST allow us to superimpose the trap onto a magneto-optical trap (MOT). In our experiment, ultracold polar NaCs molecules in their electronic ground state are created in the MOT via photoassociation, achieving a continuous accumulation in the TWIST of molecules in low-field seeking states. Initial measurements show that the TWIST trap lifetime is limited only by the background pressure in the chamber.

Morphing wing structure with controllable twist based on adaptive bending-twist coupling

NASA Astrophysics Data System (ADS)

Raither, Wolfram; Heymanns, Matthias; Bergamini, Andrea; Ermanni, Paolo

2013-06-01

A novel semi-passive morphing airfoil concept based on variable bending-twist coupling induced by adaptive shear center location and torsional stiffness is presented. Numerical parametric studies and upscaling show that the concept relying on smart materials permits effective twist control while offering the potential of being lightweight and energy efficient. By means of an experimental characterization of an adaptive beam and a scaled adaptive wing structure, effectiveness and producibility of the structural concept are demonstrated.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eiamsa-ard, Smith; Seemawute, Panida; Wongcharee, Khwanchit

Effects of peripherally-cut twisted tape insert on heat transfer, friction loss and thermal performance factor characteristics in a round tube were investigated. Nine different peripherally-cut twisted tapes with constant twist ratio (y/W = 3.0) and different three tape depth ratios (DR = d/W = 0.11, 0.22 and 0.33), each with three different tape width ratios (WR = w/W = 0.11, 0.22 and 0.33) were tested. Besides, one typical twisted tape was also tested for comparison. The measurement of heat transfer rate was conducted under uniform heat flux condition while that of friction factor was performed under isothermal condition. Tests weremore » performed with Reynolds number in a range from 1000 to 20,000, using water as a working fluid. The experimental results revealed that both heat transfer rate and friction factor in the tube equipped with the peripherally-cut twisted tapes were significantly higher than those in the tube fitted with the typical twisted tape and plain tube, especially in the laminar flow regime. The higher turbulence intensity of fluid in the vicinity of the tube wall generated by the peripherally-cut twisted tape compared to that induced by the typical twisted tape is referred as the main reason for achieved results. The obtained results also demonstrated that as the depth ratio increased and width ratio decreased, the heat transfer enhancement increased. Over the range investigated, the peripherally-cut twisted tape enhanced heat transfer rates in term of Nusselt numbers up to 2.6 times (turbulent regime) and 12.8 times (laminar regime) of that in the plain tube. These corresponded to the maximum performance factors of 1.29 (turbulent regime) and 4.88 (laminar regime). (author)« less

Cytoplasmic expression of Twist1, an EMT-related transcription factor, is associated with higher grades renal cell carcinomas and worse progression-free survival in clear cell renal cell carcinoma.

PubMed

Rasti, Arezoo; Madjd, Zahra; Abolhasani, Maryam; Mehrazma, Mitra; Janani, Leila; Saeednejad Zanjani, Leili; Asgari, Mojgan

2018-05-01

Twist1 is a key transcription factor, which confers tumor cells with cancer stem cell (CSC)-like characteristics and enhances epithelial-mesenchymal transition in pathological conditions including tumor malignancy and metastasis. This study aimed to evaluate the expression patterns and clinical significance of Twist1 in renal cell carcinoma (RCC). The cytoplasmic and nuclear expression of Twist1 were examined in 252 well-defined renal tumor tissues, including 173 (68.7%) clear cell renal cell carcinomas (ccRCC), 45 (17.9%) papillary renal cell carcinomas (pRCC) and 34 (13.5%) chromophobe renal cell carcinoma, by immunohistochemistry on a tissue microarray. The association between expression of this marker and clinicopathologic parameters and survival outcomes were then analyzed. Twist1 was mainly localized to the cytoplasm of tumor cells (98.8%). Increased cytoplasmic expression of Twist1 was associated with higher grade tumors (P = 0.045), renal vein invasion (P = 0.031) and microvascular invasion (P = 0.044) in RCC. It was positively correlated with higher grade tumors (P = 0.026), shorter progression-free survival time (P = 0.027) in patients with ccRCC, and also with higher stage in pRCC patients (P = 0.036). Significantly higher cytoplasmic expression levels of Twist1 were found in ccRCC and pRCC subtypes, due to their more aggressive tumor behavior. Increased cytoplasmic expression of Twist1 had a critical role in worse prognosis in ccRCC. These findings suggest that cytoplasmic, rather than nuclear expression of Twist1 can be considered as a prognostic and therapeutic marker for targeted therapy of RCC, especially for ccRCC patients.

Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: II. Significant reduction of strand movement and strand damage in short twist pitch CICCs

DOE PAGES

Sanabria, Charlos; Lee, Peter J.; Starch, William; ...

2015-10-14

Prototype cable in conduit conductors (CICCs) destined for use in the Toroidal Field (TF) and Central Solenoid (CS) coils of the ITER experimental fusion reactor underwent severe cyclic loading in the SULTAN facility. Their autopsies revealed significant and permanent transverse strand migration due to the large Lorentz forces of the SULTAN test. The movement resulted in a 3 7% void fraction increase on the Low Pressure (LP) side of the longer twist pitch CICCs. However, short twist pitch conductors exhibited less than 1% void fraction increase in the LP side, as well as a complete absence of the Nb 3Snmore » filament fractures observed in the longer twist pitch conductors. We report here a detailed strand to cable analysis of short and longer “baseline” twist pitch CICCs. It was found that the use of Internal Tin strands in the longer “baseline” twist pitch CICCs can be beneficial possibly because of their superior stiffness—which better resist strand movement—while the use of Bronze Process strands showed more movement and poorer cyclic test performance. This was not the case for the short twist pitch CICC. Such conductor design seems to work well with both strand types. But it was found that despite the absence of filament fractures, the short twist pitch CICC made from the Internal Tin strands studied here developed severe strand distortion during cabling which resulted in diffusion barrier breaks and Sn contamination of the Cu stabilizer during the heat treatment. Furthermore, the short twist pitch CICC made from Bronze Process strands preserved diffusion barrier integrity.« less

Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning

PubMed Central

Harfe, Brian D.; Gomes, Ana Vaz; Kenyon, Cynthia; Liu, Jun; Krause, Michael; Fire, Andrew

1998-01-01

Mesodermal development is a multistep process in which cells become increasingly specialized to form specific tissue types. In Drosophila and mammals, proper segregation and patterning of the mesoderm involves the bHLH factor Twist. We investigated the activity of a Twist-related factor, CeTwist, during Caenorhabditis elegans mesoderm development. Embryonic mesoderm in C. elegans derives from a number of distinct founder cells that are specified during the early lineages; in contrast, a single blast cell (M) is responsible for all nongonadal mesoderm formation during postembryonic development. Using immunofluorescence and reporter fusions, we determined the activity pattern of the gene encoding CeTwist. No activity was observed during specification of mesodermal lineages in the early embryo; instead, the gene was active within the M lineage and in a number of mesodermal cells with nonstriated muscle fates. A role for CeTwist in postembryonic mesodermal cell fate specification was indicated by ectopic expression and genetic interference assays. These experiments showed that CeTwist was responsible for activating two target genes normally expressed in specific subsets of nonstriated muscles derived from the M lineage. In vitro and in vivo assays suggested that CeTwist cooperates with the C. elegans E/Daughterless homolog in directly activating these targets. The two target genes that we have studied, ceh-24 and egl-15, encode an NK-2 class homeodomain and an FGF receptor (FGFR) homolog, respectively. Twist activates FGFR and NK-homeodomain target genes during mesodermal patterning of Drosophila and similar target interactions have been proposed to modulate mesenchymal growth during closure of the vertebrate skull. These results suggest the possibility that a conserved pathway may be used for diverse functions in mesodermal specification. PMID:9716413

Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: II. Significant reduction of strand movement and strand damage in short twist pitch CICCs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanabria, Charlos; Lee, Peter J.; Starch, William

Prototype cable in conduit conductors (CICCs) destined for use in the Toroidal Field (TF) and Central Solenoid (CS) coils of the ITER experimental fusion reactor underwent severe cyclic loading in the SULTAN facility. Their autopsies revealed significant and permanent transverse strand migration due to the large Lorentz forces of the SULTAN test. The movement resulted in a 3 7% void fraction increase on the Low Pressure (LP) side of the longer twist pitch CICCs. However, short twist pitch conductors exhibited less than 1% void fraction increase in the LP side, as well as a complete absence of the Nb 3Snmore » filament fractures observed in the longer twist pitch conductors. We report here a detailed strand to cable analysis of short and longer “baseline” twist pitch CICCs. It was found that the use of Internal Tin strands in the longer “baseline” twist pitch CICCs can be beneficial possibly because of their superior stiffness—which better resist strand movement—while the use of Bronze Process strands showed more movement and poorer cyclic test performance. This was not the case for the short twist pitch CICC. Such conductor design seems to work well with both strand types. But it was found that despite the absence of filament fractures, the short twist pitch CICC made from the Internal Tin strands studied here developed severe strand distortion during cabling which resulted in diffusion barrier breaks and Sn contamination of the Cu stabilizer during the heat treatment. Furthermore, the short twist pitch CICC made from Bronze Process strands preserved diffusion barrier integrity.« less

Interaction between left ventricular twist mechanics and arterial haemodynamics during localised, non-metabolic hyperaemia with and without blood flow restriction.

PubMed

van Mil, Anke C C M; Pearson, James; Drane, Aimee L; Cockcroft, John R; McDonnell, Barry J; Stöhr, Eric J

2016-04-01

What is the central question of this study? Left ventricular (LV) twist is reduced when afterload is increased, but the meaning of this specific heart muscle response and its impact on cardiac output are not well understood. What is the main finding and its importance? This study shows that LV twist responds even when arterial haemodynamics are altered only locally, and without apparent change in metabolic (i.e. heat-induced) demand. The concurrent decline in cardiac output and LV twist during partial arterial occlusion despite the increased peripheral demand caused by heat stress suggests that LV twist may be involved in the protective sensing of heart muscle stress that can override the provision of the required cardiac output. Whether left ventricular (LV) twist and untwisting rate (LV twist mechanics) respond to localised, peripheral, non-metabolic changes in arterial haemodynamics within an individual's normal afterload range is presently unknown. Furthermore, previous studies indicate that LV twist mechanics may override the provision of cardiac output, but this hypothesis has not been examined purposefully. Therefore, we acutely altered local peripheral arterial haemodynamics in 11 healthy humans (women/men n = 3/8; age 26 ± 5 years) by bilateral arm heating (BAH). Ultrasonography was used to examine arterial haemodynamics, LV twist mechanics and the twist-to-shortening ratio (TSR). To determine the arterial function-dependent contribution of LV twist mechanics to cardiac output, partial blood flow restriction to the arms was applied during BAH (BAHBFR ). Bilateral arm heating increased arm skin temperatures [change (Δ) +6.4 ± 0.9°C, P < 0.0001] but not core temperature (Δ -0.0 ± 0.1°C, P > 0.05), concomitant to increases in brachial artery blood flow (Δ 212 ± 77 ml, P < 0.0001), cardiac output (Δ 495 ± 487 l min(-1) , P < 0.05), LV twist (Δ 3.0 ± 3.5 deg, P < 0.05) and TSR (Δ 3.3 ± 1.3, P < 0.05) but maintained carotid artery blood flow (Δ 18 ± 147 ml, P > 0.05). Subsequently, BAHBFR reduced all parameters to preheating levels, except for TSR and heart rate, which remained at BAH levels. In conclusion, LV twist mechanics responded to local peripheral arterial haemodynamics within the normal afterload range, in part independent of TSR and heart rate. The findings suggest that LV twist mechanics may be more closely associated with intrinsic sensing of excessive pressure stress rather than being associated with the delivery of adequate cardiac output. © 2016 The Authors. Experimental Physiology © 2016 The Physiological Society.

Fermion number of twisted kinks in the NJL2 model revisited

NASA Astrophysics Data System (ADS)

Thies, Michael

2018-03-01

As a consequence of axial current conservation, fermions cannot be bound in localized lumps in the massless Nambu-Jona-Lasinio model. In the case of twisted kinks, this manifests itself in a cancellation between the valence fermion density and the fermion density induced in the Dirac sea. To attribute the correct fermion number to these bound states requires an infrared regularization. Recently, this has been achieved by introducing a bare fermion mass, at least in the nonrelativistic regime of small twist angles and fermion numbers. Here, we propose a simpler regularization using a finite box which preserves integrability and can be applied at any twist angle. A consistent and physically plausible assignment of fermion number to all twisted kinks emerges.

An empirically-based model for the lift coefficients of twisted airfoils with leading-edge tubercles

NASA Astrophysics Data System (ADS)

Ni, Zao; Su, Tsung-chow; Dhanak, Manhar

2018-04-01

Experimental data for untwisted airfoils are utilized to propose a model for predicting the lift coefficients of twisted airfoils with leading-edge tubercles. The effectiveness of the empirical model is verified through comparison with results of a corresponding computational fluid-dynamic (CFD) study. The CFD study is carried out for both twisted and untwisted airfoils with tubercles, the latter shown to compare well with available experimental data. Lift coefficients of twisted airfoils predicted from the proposed empirically-based model match well with the corresponding coefficients determined using the verified CFD study. Flow details obtained from the latter provide better insight into the underlying mechanism and behavior at stall of twisted airfoils with leading edge tubercles.

"Twisted Beam" SEE Observations of Ionospheric Heating from HAARP

NASA Astrophysics Data System (ADS)

Briczinski, S. J.; Bernhardt, P. A.; Siefring, C. L.; Han, S.-M.; Pedersen, T. R.; Scales, W. A.

2015-10-01

Nonlinear interactions of high power HF radio waves in the ionosphere provide aeronomers with a unique space-based laboratory capability. The High-Frequency Active Auroral Research Program (HAARP) in Gakona, Alaska is the world's largest heating facility, yielding effective radiated powers in the gigawatt range. New results are present from HAARP experiments using a "twisted beam" excitation mode. Analysis of twisted beam heating shows that the SEE results obtained are identical to more traditional patterns. One difference in the twisted beam mode is the heating region produced is in the shape of a ring as opposed to the more traditional "solid spot" region from a pencil beam. The ring heating pattern may be more conducive to the creation of stable artificial airglow layers because of the horizontal structure of the ring. The results of these runs include artificial layer creation and evolution as pertaining to the twisted beam pattern. The SEE measurements aid the interpretation of the twisted beam interactions in the ionosphere.

Structures of Highly Twisted Amides Relevant to Amide N-C Cross-Coupling: Evidence for Ground-State Amide Destabilization.

PubMed

Pace, Vittorio; Holzer, Wolfgang; Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

2016-10-04

Herein, we show that acyclic amides that have recently enabled a series of elusive transition-metal-catalyzed N-C activation/cross-coupling reactions are highly twisted around the N-C(O) axis by a new destabilization mechanism of the amide bond. A unique effect of the N-glutarimide substituent, leading to uniformly high twist (ca. 90°) irrespective of the steric effect at the carbon side of the amide bond has been found. This represents the first example of a twisted amide that does not bear significant steric hindrance at the α-carbon atom. The (15) N NMR data show linear correlations between electron density at nitrogen and amide bond twist. This study strongly supports the concept of amide bond ground-state twist as a blueprint for activation of amides toward N-C bond cleavage. The new mechanism offers considerable opportunities for organic synthesis and biological processes involving non-planar amide bonds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The association between left ventricular twisting motion and mechanical dyssynchrony: a three-dimensional speckle tracking study.

PubMed

Fujiwara, Shohei; Komamura, Kazuo; Nakabo, Ayumi; Masaki, Mitsuru; Fukui, Miho; Sugahara, Masataka; Itohara, Kanako; Soyama, Yuko; Goda, Akiko; Hirotani, Shinichi; Mano, Toshiaki; Masuyama, Tohru

2016-02-01

Left ventricular (LV) dyssynchrony is a causal factor in LV dysfunction and thought to be associated with LV twisting motion. We tested whether three-dimensional speckle tracking (3DT) can be used to evaluate the relationship between LV twisting motion and dyssynchrony. We examined 25 patients with sick sinus syndrome who had received dual chamber pacemakers. The acute effects of ventricular pacing on LV wall motion after the switch from atrial to ventricular pacing were assessed. LV twisting motion and dyssynchrony during each pacing mode were measured using 3DT. LV dyssynchrony was calculated from the time to the minimum peak systolic area strain of 16 LV imaging segments. Ventricular pacing increased LV dyssynchrony and decreased twist and torsion. A significant correlation was observed between changes in LV dyssynchrony and changes in torsion (r = -0.65, p < 0.01). Evaluation of LV twisting motion can potentially be used for diagnosing LV dyssynchrony.

Twisted electron-acoustic waves in plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Department of Physics and Applied Mathematics; Ali, S.

2016-08-15

In the paraxial limit, a twisted electron-acoustic (EA) wave is studied in a collisionless unmagnetized plasma, whose constituents are the dynamical cold electrons and Boltzmannian hot electrons in the background of static positive ions. The analytical and numerical solutions of the plasma kinetic equation suggest that EA waves with finite amount of orbital angular momentum exhibit a twist in its behavior. The twisted wave particle resonance is also taken into consideration that has been appeared through the effective wave number q{sub eff} accounting for Laguerre-Gaussian mode profiles attributed to helical phase structures. Consequently, the dispersion relation and the damping ratemore » of the EA waves are significantly modified with the twisted parameter η, and for η → ∞, the results coincide with the straight propagating plane EA waves. Numerically, new features of twisted EA waves are identified by considering various regimes of wavelength and the results might be useful for transport and trapping of plasma particles in a two-electron component plasma.« less

Kinetic study of ion acoustic twisted waves with kappa distributed electrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Mahmood, Shahzad, E-mail: shahzadm100@gmail.com

2016-05-15

The kinetic theory of Landau damping of ion acoustic twisted modes is developed in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons and Maxwellian ions. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the ion acoustic twisted waves in a non-thermal plasma. The strong damping effects of ion acoustic twisted waves at low values of temperature ratio of electrons and ions aremore » also obtained by using exact numerical method and illustrated graphically, where the weak damping wave theory fails to explain the phenomenon properly. The obtained results of Landau damping rates of the twisted ion acoustic wave are discussed at different values of azimuthal wave number and non-thermal parameter kappa for electrons.« less

Modeling and development of a twisting wing using inductively heated shape memory alloy actuators

NASA Astrophysics Data System (ADS)

Saunders, Robert N.; Hartl, Darren J.; Boyd, James G.; Lagoudas, Dimitris C.

2015-04-01

Wing twisting has been shown to improve aircraft flight performance. The potential benefits of a twisting wing are often outweighed by the mass of the system required to twist the wing. Shape memory alloy (SMA) actuators repeatedly demonstrate abilities and properties that are ideal for aerospace actuation systems. Recent advances have shown an SMA torsional actuator that can be manufactured and trained with the ability to generate large twisting deformations under substantial loading. The primary disadvantage of implementing large SMA actuators has been their slow actuation time compared to conventional actuators. However, inductive heating of an SMA actuator allows it to generate a full actuation cycle in just seconds rather than minutes while still . The aim of this work is to demonstrate an experimental wing being twisted to approximately 10 degrees by using an inductively heated SMA torsional actuator. This study also considers a 3-D electromagnetic thermo-mechanical model of the SMA-wing system and compare these results to experiments to demonstrate modeling capabilities.

Twisted ultrathin silicon nanowires: A possible torsion electromechanical nanodevice

NASA Astrophysics Data System (ADS)

Garcia, J. C.; Justo, J. F.

2014-11-01

Nanowires have been considered for a number of applications in nanometrology. In such a context, we have explored the possibility of using ultrathin twisted nanowires as torsion nanobalances to probe forces and torques at molecular level with high precision, a nanoscale system analogous to the Coulomb's torsion balance electrometer. In order to achieve this goal, we performed a first-principles investigation on the structural and electronic properties of twisted silicon nanowires, in their pristine and hydrogenated forms. The results indicated that wires with pentagonal and hexagonal cross-sections are the thinnest stable silicon nanostructures. Additionally, all wires followed a Hooke's law behavior for small twisting deformations. Hydrogenation leads to spontaneous twisting, but with angular spring constants considerably smaller than the ones for the respective pristine forms. We observed considerable changes on the nanowire electronic properties upon twisting, which allows to envision the possibility of correlating the torsional angular deformation with the nanowire electronic transport. This could ultimately allow a direct access to measurements on interatomic forces at molecular level.

Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade

NASA Technical Reports Server (NTRS)

Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon

2000-01-01

Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.

Reaction mechanism of the acidic hydrolysis of highly twisted amides: Rate acceleration caused by the twist of the amide bond.

PubMed

Mujika, Jon I; Formoso, Elena; Mercero, Jose M; Lopez, Xabier

2006-08-03

We present an ab initio study of the acid hydrolysis of a highly twisted amide and a planar amide analogue. The aim of these studies is to investigate the effect that the twist of the amide bond has on the reaction barriers and mechanism of acid hydrolysis. Concerted and stepwise mechanisms were investigated using density functional theory and polarizable continuum model calculations. Remarkable differences were observed between the mechanism of twisted and planar amide, due mainly to the preference for N-protonation of the former and O-protonation of the latter. In addition, we were also able to determine that the hydrolytic mechanism of the twisted amide will be pH dependent. Thus, there is a preference for a stepwise mechanism with formation of an intermediate in the acid hydrolysis, whereas the neutral hydrolysis undergoes a concerted-type mechanism. There is a nice agreement between the characterized intermediate and available X-ray data and a good agreement with the kinetically estimated rate acceleration of hydrolysis with respect to analogous undistorted amide compounds. This work, along with previous ab initio calculations, describes a complex and rich chemistry for the hydrolysis of highly twisted amides as a function of pH. The theoretical data provided will allow for a better understanding of the available kinetic data of the rate acceleration of amides upon twisting and the relation of the observed rate acceleration with intrinsic differential reactivity upon loss of amide bond resonance.

Enhanced intersystem crossing in core-twisted aromatics.

PubMed

Nagarajan, Kalaivanan; Mallia, Ajith R; Muraleedharan, Keerthi; Hariharan, Mahesh

2017-03-01

We describe the design, bottom-up synthesis and X-ray single crystal structure of systematically twisted aromatics 1c and 2d for efficient intersystem crossing. Steric congestion at the cove region creates a nonplanar geometry that induces a significant yield of triplet excited states in the electron-poor core-twisted aromatics 1c and 2d . A systematic increase in the number of twisted regions in 1c and 2d results in a concomitant enhancement in the rate and yield of intersystem crossing, monitored using femtosecond and nanosecond transient absorption spectroscopy. Time-resolved absorption spectroscopic measurements display enhanced triplet quantum yields ( Φ T = 10 ± 1% for 1c and Φ T = 30 ± 2% for 2d ) in the twisted aromatics when compared to a negligible Φ T (<1%) in the planar analog 3c . Twist-induced spin-orbit coupling via activated out-of-plane C-H/C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 C vibrations can facilitate the formation of triplet excited states in twisted aromatics 1c and 2d , in contrast to the negligible intersystem crossing in the planar analog 3c . The ease of synthesis, high solubility, access to triplet excited states and strong electron affinity make such imide functionalized core-twisted aromatics desirable materials for organic electronics such as solar cells.

Chirality-controlled spontaneous twisting of crystals due to thermal topochemical reaction.

PubMed

Rai, Rishika; Krishnan, Baiju P; Sureshan, Kana M

2018-03-20

Crystals that show mechanical response against various stimuli are of great interest. These stimuli induce polymorphic transitions, isomerizations, or chemical reactions in the crystal and the strain generated between the daughter and parent domains is transcribed into mechanical response. We observed that the crystals of modified dipeptide LL (N 3 -l-Ala-l-Val-NHCH 2 C≡CH) undergo spontaneous twisting to form right-handed twisted crystals not only at room temperature but also at 0 °C over time. Using various spectroscopic techniques, we have established that the twisting is due to the spontaneous topochemical azide-alkyne cycloaddition (TAAC) reaction at room temperature or lower temperatures. The rate of twisting can be increased by heating, exploiting the faster kinetics of the TAAC reaction at higher temperatures. To address the role of molecular chirality in the direction of twisting the enantiomer of dipeptide LL, N 3 -d-Ala-d-Val-NHCH 2 C≡CH (DD), was synthesized and topochemical reactivity and mechanoresponse of its crystals were studied. We have found that dipeptide DD not only underwent TAAC reaction, giving 1,4-triazole-linked pseudopolypeptides of d-amino acids, but also underwent twisting with opposite handedness (left-handed twisting), establishing the role of molecular chirality in controlling the direction of mechanoresponse. This paper reports ( i ) a mechanical response due to a thermal reaction and ( ii ) a spontaneous mechanical response in crystals and ( iii ) explains the role of molecular chirality in the handedness of the macroscopic mechanical response.

Design and analysis of variable-twist tiltrotor blades using shape memory alloy hybrid composites

NASA Astrophysics Data System (ADS)

Park, Jae-Sang; Kim, Seong-Hwan; Jung, Sung Nam; Lee, Myeong-Kyu

2011-01-01

The tiltrotor blade, or proprotor, acts as a rotor in the helicopter mode and as a propeller in the airplane mode. For a better performance, the proprotor should have different built-in twist distributions along the blade span, suitable for each operational mode. This paper proposes a new variable-twist proprotor concept that can adjust the built-in twist distribution for given flight modes. For a variable-twist control, the present proprotor adopts shape memory alloy hybrid composites (SMAHC) containing shape memory alloy (SMA) wires embedded in the composite matrix. The proprotor of the Korea Aerospace Research Institute (KARI) Smart Unmanned Aerial Vehicle (SUAV), which is based on the tiltrotor concept, is used as a baseline proprotor model. The cross-sectional properties of the variable-twist proprotor are designed to maintain the cross-sectional properties of the original proprotor as closely as possible. However, the torsion stiffness is significantly reduced to accommodate the variable-twist control. A nonlinear flexible multibody dynamic analysis is employed to investigate the dynamic characteristics of the proprotor such as natural frequency and damping in the whirl flutter mode, the blade structural loads in a transition flight and the rotor performance in hover. The numerical results show that the present proprotor is designed to have a strong similarity to the baseline proprotor in dynamic and load characteristics. It is demonstrated that the present proprotor concept could be used to improve the hover performance adaptively when the variable-twist control using the SMAHC is applied appropriately.

Universality, twisted fans, and the Ising model. [Renormalization, two-loop calculations, scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dash, J.W.; Harrington, S.J.

1975-06-24

Critical exponents are evaluated for the Ising model using universality in the form of ''twisted fans'' previously introduced in Reggeon field theory. The universality is with respect to scales induced through renormalization. Exact twists are obtained at ..beta.. = 0 in one loop for D = 2,3 with ..nu.. = 0.75 and 0.60 respectively. In two loops one obtains ..nu.. approximately 1.32 and 0.68. No twists are obtained for eta, however. The results for the standard two loop calculations are also presented as functions of a scale.

Twist-3 contributions to wide-angle photoproduction of pions

NASA Astrophysics Data System (ADS)

Kroll, P.; Passek-Kumerički, K.

2018-04-01

We investigate wide-angle π0 photoproduction within the handbag approach to twist-3 accuracy. In contrast to earlier work both the 2-particle as well as the 3-particle twist-3 contributions are taken into account. It is shown that both are needed for consistent results that respect gauge invariance and crossing properties. The numerical studies reveal the dominance of the twist-3 contribution. With it fair agreement with the recent CLAS measurement of the π0 cross section is obtained. We briefly comment also on wide-angle photoproduction of other pseudoscalar mesons.

Moiré edge states in twisted graphene nanoribbons

NASA Astrophysics Data System (ADS)

Fleischmann, M.; Gupta, R.; Weckbecker, D.; Landgraf, W.; Pankratov, O.; Meded, V.; Shallcross, S.

2018-05-01

The edge physics of graphene based systems is well known to be highly sensitive to the atomic structure at the boundary, with localized zero mode edge states found only on the zigzag-type termination of the lattice. Here we demonstrate that the graphene twist bilayer supports an additional class of edge states, that (i) are found for all edge geometries and thus are robust against edge roughness, (ii) occur at energies coinciding with twist induced Van Hove singularities in the bulk and (iii) possess an electron density strongly modulated by the moiré lattice. Interestingly, these "moiré edge states" exist only for certain lattice commensurations and thus the edge physics of the twist bilayer is, in dramatic contrast to that of the bulk, not uniquely determined by the twist angle.

Composite material bend-twist coupling for wind turbine blade applications

NASA Astrophysics Data System (ADS)

Walsh, Justin M.

Current efforts in wind turbine blade design seek to employ bend-twist coupling of composite materials for passive power control by twisting blades to feather. Past efforts in this area of study have proved to be problematic, especially in formulation of the bend-twist coupling coefficient alpha. Kevlar/epoxy, carbon/epoxy and glass/epoxy specimens were manufactured to study bend-twist coupling, from which numerical and analytical models could be verified. Finite element analysis was implemented to evaluate fiber orientation and material property effects on coupling magnitude. An analytical/empirical model was then derived to describe numerical results and serve as a replacement for the commonly used coupling coefficient alpha. Through the results from numerical and analytical models, a foundation for aeroelastic design of wind turbines blades utilizing biased composite materials is provided.

Formation of Twisted Elephant Trunks in the Rosette Nebula

NASA Astrophysics Data System (ADS)

Carlqvist, P.; Gahm, G. F.; Kristen, H.

New observations show that dark elephant trunks in the Rosette nebula are often built up by thin filaments. In several of the trunks the filaments seem to form a twisted pattern. This pattern is hard to reconcile with current theory. We propose a new model for the formation of twisted elephant trunks in which electromagnetic forces play an important role. The model considers the behaviour of a twisted magnetic filament in a molecular cloud, where a cluster of hot stars has been recently born. As a result of stellar winds, and radiation pressure, electromagnetic forces, and inertia forces part of the filament can develop into a double helix pointing towards the stars. The double helix represents the twisted elephant trunk. A simple analogy experiment visualizes and supports the trunk model.

Slug, Twist, and E-Cadherin as Immunohistochemical Biomarkers in Meningeal Tumors

PubMed Central

Nagaishi, Masaya; Nobusawa, Sumihito; Tanaka, Yuko; Ikota, Hayato; Yokoo, Hideaki; Nakazato, Yoichi

2012-01-01

The overexpression of Twist and Slug and subsequent down-regulation of E-cadherin facilitate the acquirement of invasive growth properties in cancer cells. It is unclear which of these molecules are expressed in mesenchymal tumors in the central nervous system. Here, we investigated 10 cases each of hemangiopericytoma, solitary fibrous tumor, meningothelial, fibrous, angiomatous, and atypical meningiomas, and 5 cases of anaplastic meningioma for Slug, Twist, E-cadherin, and N-cadherin immunoexpression. Nuclear Slug expression was observed in 9/10 (90%) hemangiopericytomas and 5/10 (50%) solitary fibrous tumors, but not in any meningiomas, except for 1 case. Similarly, nuclear Twist expression was more extensive in hemangiopericytomas and solitary fibrous tumors than meningiomas. In contrast to Slug and Twist, the positive expression of E-cadherin was observed in 39/45 (87%) meningiomas, but not in any hemangiopericytomas or solitary fibrous tumors (P<0.0001). The fraction of tumor cells expressing E-cadherin in meningeal tumors was negatively correlated to those of Twist (P = 0.004) and Slug (P<0.0001). The overexpression of Slug and Twist with down-regulation of E-cadherin was characteristic findings in hemangiopericytomas and solitary fibrous tumors, but not in meningiomas. The immunohistochemical profiles of the two tumor groups may be useful as diagnostic markers in cases that present a differential diagnosis challenge. PMID:23029385

Full action of two deformation operators in the D1D5 CFT

NASA Astrophysics Data System (ADS)

Carson, Zaq; Hampton, Shaun; Mathur, Samir D.

2017-11-01

We are interested in thermalization in the D1D5 CFT, since this process is expected to be dual to black hole formation. We expect that the lowest order process where thermalization occurs will be at second order in the perturbation that moves us away from the orbifold point. The operator governing the deformation off of the orbifold point consists of a twist operator combined with a supercharge operator acting on this twist. In a previous paper we computed the action of two twist operators on an arbitrary state of the CFT. In the present work we compute the action of the supercharges on these twist operators, thereby obtaining the full action of two deformation operators on an arbitrary state of the CFT. We show that the full amplitude can be related to the amplitude with just the twists through an action of the supercharge operators on the initial and final states. The essential part of this computation consists of moving the contours from the twist operators to the initial and final states; to do this one must first map the amplitude to a covering space where the twists are removed, and then map back to the original space on which the CFT is defined.

Nanorobotic System iTRo for Controllable 1D Micro/nano Material Twisting Test.

PubMed

Lu, Haojian; Shang, Wanfeng; Wei, Xueyong; Yang, Zhan; Fukuda, Toshio; Shen, Yajing

2017-06-08

In-situ micro/nano characterization is an indispensable methodology for material research. However, the precise in-situ SEM twisting of 1D material with large range is still challenge for current techniques, mainly due to the testing device's large size and the misalignment between specimen and the rotation axis. Herein, we propose an in-situ twist test robot (iTRo) to address the above challenges and realize the precise in-situ SEM twisting test for the first time. Firstly, we developed the iTRo and designed a series of control strategies, including assembly error initialization, triple-image alignment (TIA) method for rotation axis alignment, deformation-based contact detection (DCD) method for sample assembly, and switch control for robots cooperation. After that, we chose three typical 1D material, i.e., magnetic microwire Fe 74 B 13 Si 11 C 2 , glass fiber, and human hair, for twisting test and characterized their properties. The results showed that our approach is able to align the sample to the twisting axis accurately, and it can provide large twisting range, heavy load and high controllability. This work fills the blank of current in-situ mechanical characterization methodologies, which is expected to give significant impact in the fundamental nanomaterial research and practical micro/nano characterization.

Electronic structure and optical properties of twisted bilayer graphene calculated via time evolution of states in real space

NASA Astrophysics Data System (ADS)

Le, H. Anh; Do, V. Nam

2018-03-01

We investigate the electronic and optical properties of twisted bilayer graphene with arbitrary twist angles θ . Our results are based on a method of evolving in time quantum states in lattice space. We propose an efficient scheme of sampling lattice nodes that helps to reduce significantly computational cost, particularly for tiny twist angles. We demonstrate the continuous variation of the density of states and the optical conductivity with respect to the twist angle. It indicates that the commensurability between the two graphene layers does not play an essential role in governing the electronic and optical properties. We point out that, for the twist angles roughly in the range 0 .1∘<θ <3∘ , the density of states in the vicinity of the Fermi energy exhibits the typical W shape with a small peak locating at the Fermi energy. This peak is formed as the merging of two van Hove peaks and reflects the appearance of states strongly localized in the AA-like region of moiré zones. When decreasing the twist angle to zero, the W shape is gradually transformed to the U shape, which is seen as the behavior of the density of states in the limit of θ →0∘ .

Magnetic helicity and flux tube dynamics in the solar convection zone: Comparisons between observation and theory

NASA Astrophysics Data System (ADS)

Nandy, Dibyendu

2006-12-01

Magnetic helicity, a conserved topological parameter in ideal MHD systems, conditions close to which are realized in the solar plasma, is intimately connected to the creation and subsequent dynamics of magnetic flux tubes in the solar interior. It can therefore be used as a tool to probe such dynamics. In this paper we show how photospheric observations of magnetic helicity of isolated magnetic flux tubes, manifested as the twist and writhe of solar active regions, can constrain the creation and dynamics of flux tubes in the solar convection zone and the nature of convective turbulence itself. We analyze the observed latitudinal distribution of twists in photospheric active regions, derived from solar vector magnetograms, in the largest such sample studied till-date. We confirm and put additional constraints on the hemispheric twist helicity trend and find that the dispersion in the active region twist distribution is latitude-independent, implying that the amplitude of turbulent fluctuations does not vary with latitude in the convection zone. Our data set also shows that the amplitude and dispersion of twist decreases with increasing magnetic size of active regions, supporting the conclusion that larger flux tubes are less affected by turbulence. Among the various theoretical models that have been proposed till-date to explain the origin of twist, our observations best match the Σ effect model, which invokes helical turbulent buffeting of rising flux tubes as the mechanism for twist creation. Finally, we complement our analysis of twists with past observations of tilts in solar active regions and tie them in with theoretical modeling studies, to build up a comprehensive picture of the dynamics of twisted magnetic flux tubes throughout the solar convection zone. This general framework, binding together theory and observations, suggests that flux tubes have a wide range of twists in the solar convection zone, with some as high as to make them susceptible to the kink instability mechanism that results in the formation of δ spot or non-Hale active regions.

Performance of twist-coupled blades on variable speed rotors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lobitz, D.W.; Veers, P.S.; Laino, D.J.

1999-12-07

The load mitigation and energy capture characteristics of twist-coupled HAWT blades that are mounted on a variable speed rotor are investigated in this paper. These blades are designed to twist toward feather as they bend with pretwist set to achieve a desirable twist distribution at rated power. For this investigation, the ADAMS-WT software has been modified to include blade models with bending-twist coupling. Using twist-coupled and uncoupled models, the ADAMS software is exercised for steady wind environments to generate C{sub p} curves at a number of operating speeds to compare the efficiencies of the two models. The ADAMS software ismore » also used to generate the response of a twist-coupled variable speed rotor to a spectrum of stochastic wind time series. This spectrum contains time series with two mean wind speeds at two turbulence levels. Power control is achieved by imposing a reactive torque on the low speed shaft proportional to the RPM squared with the coefficient specified so that the rotor operates at peak efficiency in the linear aerodynamic range, and by limiting the maximum RPM to take advantage of the stall controlled nature of the rotor. Fatigue calculations are done for the generated load histories using a range of material exponents that represent materials from welded steel to aluminum to composites, and results are compared with the damage computed for the rotor without twist-coupling. Results indicate that significant reductions in damage are achieved across the spectrum of applied wind loading without any degradation in power production.« less

Using 4th order Runge-Kutta method for solving a twisted Skyrme string equation

NASA Astrophysics Data System (ADS)

Hadi, Miftachul; Anderson, Malcolm; Husein, Andri

2016-03-01

We study numerical solution, especially using 4th order Runge-Kutta method, for solving a twisted Skyrme string equation. We find numerically that the value of minimum energy per unit length of vortex solution for a twisted Skyrmion string is 20.37 × 1060 eV/m.

TWIST and p-Akt immunoexpression in normal oral epithelium oral dysplasia and in oral squamous cell carcinoma

PubMed Central

Yamamoto, Fernanda-Paula; Corrêa Pontes, Flávia-Sirotheau; Cury, Sérgio-Elias; Fonseca, Felipe-Paiva; Rebelo-Pontes, Hélder; Pinto-Júnior, Décio-dos Santos

2012-01-01

Objectives: The aim of this study was to evaluate the immunoexpression of TWIST and p-Akt proteins in oral leukoplakia (OL) and oral squamous cell carcinoma (OSCC), correlating their expressions with the histological features of the lesions. Study design: Immunohistochemical studies were carried out on 10 normal oral epithelium, 30 OL and 20 OSCC formalin-fixed, paraffin-embedded tissue samples. Immunoperoxidase reactions for TWIST and p-Akt proteins were applied on the specimens and the positivity of the reactions was calculated for 1000 epithelial cells. Results: Kruskal-Wallis and Dunn’s post tests revealed a significant difference in TWIST and p-Akt immunoexpression among normal oral mucosa, OL and OSCC. In addition, a significant positive correlation was found between TWIST and p-Akt expressions according to the Pearson’s correlation test. Conclusions: The results obtained in the current study suggest that TWIST and p-Akt may participate of the multi-step process of oral carcinogenesis since its early stages. Key words: Oral cancer, oral leukoplakia, dysplasia, immunohistochemistry. PMID:21743395

Investigation friction factor and heat transfer characteristics of turbulent flow inside the corrugated tube inserted with typical and V-cut twisted tapes

NASA Astrophysics Data System (ADS)

Langeroudi, H. G.; Javaherdeh, K.

2018-07-01

In present paper the effects of using typical twisted tape (TT) and V-cut twisted tape (VTT) on Nusselt number (Nu), friction factor (f) and thermal performance factor (η) inside corrugated tube in the turbulent flow are experimentally investigated despite the fact that the wall is under uniform heat flux. The experiments are conducted by twisted tapes with different twist ratio (y = 4.5, 6.07), depth and width ratios ranging (0.285-0.5) and Reynolds number varied from 5300 to 25,700 and water was as a working fluid. The obtained results show that the Nusselt number for corrugated tube that equipped with twisted tapes increases with increasing Reynolds number and is remarkable at high Reynolds Number while the friction factor is low. Moreover, the thermal performance factor for fluid increases with increasing Reynolds number and also the thermal performance factor for all states of VTT are higher than of TT. The new empirical correlations for Nusselt number, friction factor and thermal performance factor are predicted and compared with experimental data.

Twist1-positive epithelial cells retain adhesive and proliferative capacity throughout dissemination

PubMed Central

Shamir, Eliah R.; Coutinho, Kester; Georgess, Dan; Auer, Manfred

2016-01-01

ABSTRACT Dissemination is the process by which cells detach and migrate away from a multicellular tissue. The epithelial-to-mesenchymal transition (EMT) conceptualizes dissemination in a stepwise fashion, with downregulation of E-cadherin leading to loss of intercellular junctions, induction of motility, and then escape from the epithelium. This gain of migratory activity is proposed to be mutually exclusive with proliferation. We previously developed a dissemination assay based on inducible expression of the transcription factor Twist1 and here utilize it to characterize the timing and dynamics of intercellular adhesion, proliferation and migration during dissemination. Surprisingly, Twist1+ epithelium displayed extensive intercellular junctions, and Twist1– luminal epithelial cells could still adhere to disseminating Twist1+ cells. Although proteolysis and proliferation were both observed throughout dissemination, neither was absolutely required. Finally, Twist1+ cells exhibited a hybrid migration mode; their morphology and nuclear deformation were characteristic of amoeboid cells, whereas their dynamic protrusive activity, pericellular proteolysis and migration speeds were more typical of mesenchymal cells. Our data reveal that epithelial cells can disseminate while retaining competence to adhere and proliferate. PMID:27402962

DC conductivity of twisted bilayer graphene: Angle-dependent transport properties and effects of disorder

NASA Astrophysics Data System (ADS)

Andelković, M.; Covaci, L.; Peeters, F. M.

2018-03-01

The in-plane dc conductivity of twisted bilayer graphene is calculated using an expansion of the real-space Kubo-Bastin conductivity in terms of Chebyshev polynomials. We investigate within a tight-binding approach the transport properties as a function of rotation angle, applied perpendicular electric field, and vacancy disorder. We find that for high-angle twists, the two layers are effectively decoupled, and the minimum conductivity at the Dirac point corresponds to double the value observed in monolayer graphene. This remains valid even in the presence of vacancies, hinting that chiral symmetry is still preserved. On the contrary, for low twist angles, the conductivity at the Dirac point depends on the twist angle and is not protected in the presence of disorder. Furthermore, for low angles and in the presence of an applied electric field, we find that the chiral boundary states emerging between AB and BA regions contribute to the dc conductivity, despite the appearance of localized states in the AA regions. The results agree qualitatively with recent transport experiments in low-angle twisted bilayer graphene.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji

We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

A quality-of-life-oriented endpoint for comparing therapies.

PubMed

Gelber, R D; Gelman, R S; Goldhirsch, A

1989-09-01

An endpoint, time without symptoms of disease and toxicity of treatment (TWiST), is defined to provide a single measure of length and quality of survival. Time with subjective side effects of treatment and time with unpleasant symptoms of disease are subtracted from overall survival time to calculate TWiST for each patient. The purpose of this paper is to describe the construction of this endpoint, and to elaborate on its interpretation for patient care decision-making. Estimating the distribution of TWiST using actuarial methods is shown by simulation studies to be biased as a result of induced dependency between TWiST and its censoring distribution. Considering the distribution of TWiST accumulated within a specified time from start of therapy, L, allows one to reduce this bias by substituting estimated TWiST for censored values and provides a method to evaluate the "payback" period for early toxic effects. Quantile distance plots provide graphical representations for treatment comparisons. The analysis of Ludwig Trial III evaluating toxic adjuvant therapies versus a no-treatment control group for postmenopausal women with node-positive breast cancer illustrates the methodology.

Far-Infrared and Raman Spectra and The Ring-Twisting Potential Energy Function of 1,3-Cyclohexadiene

NASA Astrophysics Data System (ADS)

Autrey, Daniel; Choo, Jaebum; Laane, Jaan

2001-10-01

The nu19 (A2) ring-twisting vibration of 1,3-cyclohexadiene has been analyzed from the vapor-phase Raman and infrared spectra. The Raman spectrum shows nine ring-twisting transitions in the 116 - 199 cm-1 region. The far-infrared spectrum confirms five of these transitions, despite the fact that the vibration is infrared forbidden in the C2v (planar) approximation. Other Raman and infrared combination bands verify the assignments and provide information on the vibrational coupling. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function, which has a barrier to planarity of 1132 cm-1 and energy minima corresponding to twisting angles of 9.1º and 30.1º. Ab initio calculations were also carried out using Moller-Plesset perturbation theory (MP2) with a large number of different basis sets. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range and calculated vibrational frequencies in excellent agreement with the experimental values.

High performance twisted and coiled soft actuator with spandex fiber for artificial muscles

NASA Astrophysics Data System (ADS)

Yang, Sang Yul; Cho, Kyeong Ho; Kim, Youngeun; Song, Min-Geun; Jung, Ho Sang; Yoo, Ji Wang; Moon, Hyungpil; Koo, Ja Choon; Nam, Jae-do; Ryeol Choi, Hyouk

2017-10-01

This paper reports the twisted and coiled soft actuator (abbreviated with STCA) with spandex fiber. The STCA exhibits higher actuation strain at lower temperature than the previous nylon twisted and coiled soft actuators (abbreviated with NTCAs). While NTCAs are fabricated using a twist-insertion process until coils are formed, a new method is developed to fabricate the STCA using the ultra-stretch of spandex, whereby the STCA is twisted again after the coil has been formed. A 6-gear-twist-insertion device that increases the stability and the fabrication speed is developed to fabricate the STCA. The superior performance exhibited by the STCA is due to the 14% contraction strain of the bare spandex (bare nylon: 4%) and the low spring constant of 0.0115 N mm-1. The maximum tensile actuation strain of STCA was 45% at 130 °C, and the maximum specific work was 1.523 kJ kg-1 at 130 °C. STCA could repeatedly actuate 100 times with a strain change of less than 0.4%.

New collinear twist-3 analysis of transverse SSA: Toward a resolution for the sign-mismatch problem

DOE PAGES

Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

2014-10-19

We present a new collinear twist-3 analysis of the transverse SSA A N at RHIC. We use the TMD Sivers/Collins function to fix some of the relevant collinear twist-3 functions and perform a fit of the RHIC data with other parameterized twist-3 functions. This allows us to keep the consistency among descriptions in pp collision, SIDIS, and e +e – annihilation and thus could provide a unified description of the spin asymmetries in the low- and high-P T processes. In conclusion, by taking into account the twist-3 fragmentation contribution, we show for the first time this contribution could be themore » main source of A N in pp ↑ → hX and its inclusion could provide a solution for the sign-mismatch problem.« less

Scaling effects in resonant coupling phenomena between fundamental and cladding modes in twisted microstructured optical fibers.

PubMed

Napiorkowski, Maciej; Urbanczyk, Waclaw

2018-04-30

We show that in twisted microstructured optical fibers (MOFs) the coupling between the core and cladding modes can be obtained for helix pitch much greater than previously considered. We provide an analytical model describing scaling properties of the twisted MOFs, which relates coupling conditions to dimensionless ratios between the wavelength, the lattice pitch and the helix pitch of the twisted fiber. Furthermore, we verify our model using a rigorous numerical method based on the transformation optics formalism and study its limitations. The obtained results show that for appropriately designed twisted MOFs, distinct, high loss resonance peaks can be obtained in a broad wavelength range already for the fiber with 9 mm helix pitch, thus allowing for fabrication of coupling based devices using a less demanding method involving preform spinning.

The influence of vagal control on sex-related differences in left ventricular mechanics and hemodynamics.

PubMed

Williams, Alexandra Mackenzie; Shave, Robert E; Coulson, James M; White, Harriet; Rosser-Stanford, Bryn; Eves, Neil Derek

2018-06-01

Left ventricular (LV) twist mechanics differ between males and females during acute physiological stress, which may be partly mediated by sex differences in autonomic control. While males appear to have greater adrenergic control of LV twist, the potential contribution of vagal modulation to sex differences in LV twist remains unknown. Therefore, this study examined the role of vagal control on sex differences in LV twist during graded lower body negative pressure (LBNP) and supine cycling. On two separate visits, LV mechanics were assessed using 2-dimensional speckle-tracking echocardiography in 18 males (22{plus minus}2yr) and 17 females (21{plus minus}4yr) during -40 and -60 mmHg LBNP and 25% and 50% of peak supine cycling workload, with and without glycopyrrolate (vagal blockade). LV twist was not different at baseline but was greater in females during -60 mmHg in both control (F:16.0{plus minus}3.4º, M:12.9{plus minus}2.3º, p=0.004) and glycopyrrolate trials (F:17.7{plus minus}5.9{degree sign}, M:13.9{plus minus}3.3{degree sign}, p<0.001) due to greater apical rotation during control (F:11.9{plus minus}3.6º, M:7.8{plus minus}1.5º, p<0.001) and glycopyrrolate (F:11.6{plus minus}4.9{degree sign}, M:7.1{plus minus}3.6{degree sign}, p=0.009). These sex differences in LV twist consistently coincided with a greater LV sphericity index (i.e. ellipsoid geometry) in females compared to males. In contrast, LV twist did not differ between the sexes during exercise, with or without glycopyrrolate. Females have augmented LV twist compared to males during large reductions to preload, even during vagal blockade. As such, differences in vagal control do not appear to contribute to sex differences in the LV twist responses to physiological stress, but may be related to differences in ventricular geometry.

Bend-Twist Coupled Carbon-Fiber Laminate Beams: Fundamental Behavior and Applications

NASA Astrophysics Data System (ADS)

Babuska, Pavel

Material-induced bend-twist coupling in laminated composite beams has seen applications in engineered structures for decades, ranging from airplane wings to turbine blades. Symmetric, unbalanced, carbon fiber laminates which exhibit bend-twist coupling can be difficult to characterize and exhibit unintuitive deformation states which may pose challenges to the engineer. In this thesis, bend-twist coupled beams are investigated comprehensively, by experimentation, numerical modeling, and analytical methods. Beams of varying fiber angle and amount of coupling were manufactured and physically tested in both linear and nonlinear static and dynamic settings. Analytical mass and stiffness matrices were derived for the development of a beam element to use in the stiffness matrix analysis method. Additionally, an ABAQUS finite element model was used in conjunction with the analytical methods to predict and further characterize the behavior of the beams. The three regimes, experimental, analytical, and numerical, represent a full-field characterization of bend-twist coupling in composite beams. A notable application of bend-twist coupled composites is for passively adaptive turbine blades whereby the deformation coupling can be built into the blade structure to simultaneously bend and twist, thus pitching the blade into or away from the fluid flow, changing the blade angle of attack. Passive pitch adaptation has been implemented successfully in wind turbine blades, however, for marine turbine blades, the technology is still in the development phase. Bend-twist coupling has been shown numerically to be beneficial to the tidal turbine performance, however little validation has been conducted in the experimental regime. In this thesis, passively adaptive experiment scale tidal turbine blades were designed, analyzed, manufactured, and physically tested, validating the foundational numerical work. It was shown that blade forces and root moments as well as turbine thrust and power coefficients can be manipulated by inclusion of passive pitch adaption by bend-twist coupling.

Stromal Clues in Endometrial Carcinoma: Loss of Expression of β-Catenin, Epithelial-Mesenchymal Transition Regulators, and Estrogen-Progesterone Receptor.

PubMed

Senol, Serkan; Sayar, Ilyas; Ceyran, Ayse B; Ibiloglu, Ibrahim; Akalin, Ibrahim; Firat, Ugur; Kosemetin, Duygu; Engin Zerk, Pinar; Aydin, Abdullah

2016-05-01

Epithelial-stroma interactions in the endometrium are known to be responsible for physiological functions and emergence of several pathologic lesions. Periglandular stromal cells act on endometrial cells in a paracrine manner through sex hormones. In this study, we immunohistochemically evaluated the expression of epithelial-mesenchymal transition regulators (SNAIL/SLUG, TWIST, ZEB1), adhesion molecules (β-catenin and E-cadhenin), estrogen (ER)-progesterone (PR) receptor and their correlation with each other in 30 benign, 148 hyperplastic (EH), and 101 endometrioid-type endometrial carcinoma (EC) endometria. In the epithelial component, loss of expression in E-cadherin, ER and PR, and overexpression of TWIST and ZEB1 were significantly higher in EC than in EH (P<0.01). In the periglandular stromal component, β-catenin and SNAIL/SLUG expression were significantly higher in normal endometrium and simple without atypical EH compared with complex atypical EH and EC (P<0.01). In addition, periglandular stromal TWIST expression was significantly higher in EH group compared with EC (P<0.05). There was significantly negative correlation between β-catenin and ER, TWIST and ER, and TWIST and PR in hyperplastic and carcinomatous glandular epithelium, whereas there was a significantly positive correlation between β-catenin and SNAIL-SLUG, β-catenin and TWIST, β-catenin and ER, β-catenin and PR, SNAIL-SLUG and ER, SNAIL-SLUG and PR, TWIST and ER, TWIST and PR, in periglandular/cancer-associated stromal cells (P<0.01). In conclusion, the pattern of positive and negative correlations in the expression of epithelial-mesenchymal transition regulators (SNAIL-SLUG and TWIST), sex hormone receptors (ER and PR), and β-catenin between ECs and hyperplasia, as well as between epithelium and stroma herein, is suggestive of a significant role for these proteins and their underlying molecular processes in the development of endometrial carcinomas.

Stromal Clues in Endometrial Carcinoma: Loss of Expression of β-Catenin, Epithelial-Mesenchymal Transition Regulators, and Estrogen-Progesterone Receptor

PubMed Central

Sayar, Ilyas; Ceyran, Ayse B.; Ibiloglu, Ibrahim; Akalin, Ibrahim; Firat, Ugur; Kosemetin, Duygu; Engin Zerk, Pinar; Aydin, Abdullah

2016-01-01

Epithelial-stroma interactions in the endometrium are known to be responsible for physiological functions and emergence of several pathologic lesions. Periglandular stromal cells act on endometrial cells in a paracrine manner through sex hormones. In this study, we immunohistochemically evaluated the expression of epithelial-mesenchymal transition regulators (SNAIL/SLUG, TWIST, ZEB1), adhesion molecules (β-catenin and E-cadhenin), estrogen (ER)-progesterone (PR) receptor and their correlation with each other in 30 benign, 148 hyperplastic (EH), and 101 endometrioid-type endometrial carcinoma (EC) endometria. In the epithelial component, loss of expression in E-cadherin, ER and PR, and overexpression of TWIST and ZEB1 were significantly higher in EC than in EH (P<0.01). In the periglandular stromal component, β-catenin and SNAIL/SLUG expression were significantly higher in normal endometrium and simple without atypical EH compared with complex atypical EH and EC (P<0.01). In addition, periglandular stromal TWIST expression was significantly higher in EH group compared with EC (P<0.05). There was significantly negative correlation between β-catenin and ER, TWIST and ER, and TWIST and PR in hyperplastic and carcinomatous glandular epithelium, whereas there was a significantly positive correlation between β-catenin and SNAIL-SLUG, β-catenin and TWIST, β-catenin and ER, β-catenin and PR, SNAIL-SLUG and ER, SNAIL-SLUG and PR, TWIST and ER, TWIST and PR, in periglandular/cancer-associated stromal cells (P<0.01). In conclusion, the pattern of positive and negative correlations in the expression of epithelial-mesenchymal transition regulators (SNAIL-SLUG and TWIST), sex hormone receptors (ER and PR), and β-catenin between ECs and hyperplasia, as well as between epithelium and stroma herein, is suggestive of a significant role for these proteins and their underlying molecular processes in the development of endometrial carcinomas. PMID:26367784

FAST copper for broadband access

NASA Astrophysics Data System (ADS)

Chiang, Mung; Huang, Jianwei; Cendrillon, Raphael; Tan, Chee Wei; Xu, Dahai

2006-10-01

FAST Copper is a multi-year, U.S. NSF funded project that started in 2004, and is jointly pursued by the research groups of Mung Chiang at Princeton University, John Cioffi at Stanford University, and Alexader Fraser at Fraser Research Lab, and in collaboration with several industrial partners including AT&T. The goal of the FAST Copper Project is to provide ubiquitous, 100 Mbps, fiber/DSL broadband access to everyone in the U.S. with a phone line. This goal will be achieved through two threads of research: dynamic and joint optimization of resources in Frequency, Amplitude, Space, and Time (thus the name 'FAST') to overcome the attenuation and crosstalk bottlenecks, and the integration of communication, networking, computation, modeling, and distributed information management and control for the multi-user twisted pair network.

A microcomputer network for control of a continuous mining machine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schiffbauer, W.H.

1993-12-31

This report details a microcomputer-based control and monitoring network that was developed in-house by the U.S. Bureau of Mines and installed on a continuous mining machine. The network consists of microcomputers that are connected together via a single twisted-pair cable. Each microcomputer was developed to provide a particular function in the control process. Machine-mounted microcomputers, in conjunction with the appropriate sensors, provide closed-loop control of the machine, navigation, and environmental monitoring. Off-the-machine microcomputers provide remote control of the machine, sensor status, and a connection to the network so that external computers can access network data and control the continuous miningmore » machine. Because of the network`s generic structure, it can be installed on most mining machines.« less

Expert Systems In Medical Studies - A New Twist

NASA Astrophysics Data System (ADS)

Slagle, James R.; Long, John M.; Wick, Michael R.; Matts, John P.; Leon, Arthur S.

1986-03-01

The use of experts to evaluate large amounts of trial data results in increasingly expensive and time consuming research. We are investigating the role expert systems can play in reducing the time and expense of research projects. Current methods in large clinical studies for evaluating data are often crude and superficial. We have developed, for a large clinical trial, an expert system for analysis of treadmill exercise ECG test results. In the cases we are studying, a patient is given a treadmill exercise ECG test once a year for five years. Pairs of these exercise tests are then evaluated by cardiologists to determine the condition of the patient's heart. The results of our system show great promise for the use of expert systems in reducing the time and expense of large clinical trials.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuz'mina, L. G., E-mail: kuzmina@igic.ras.ru; Sitin, A. G.; Gulakova, E. N.

The crystal and molecular structures of five styrylheterocycles of the quinoline series are studied. All molecules are planar. The double bond in the ethylene fragment is essentially localized. In the molecule of 2-(4-methylstyryl)quinoline, the ethylene fragment is disordered by the bicycle-pedal pattern. In four of the five compounds, the crystal packings do not contain stacking dimers prearranged for the [2+2] photocycloaddition (PCA) reaction. In the crystal of 2-(3-nitrostyryl)quinoline, pairs of crystallographically independent molecules form stacking dimers. In a dimer, the ethylene fragments have a twist orientation, which is incompatible with the PCA reaction. An attempt to initiate a temperature-dependent processmore » of bicyclepedal isomerization in the crystal and, as a consequence, the PCA reaction by means of simultaneous irradiation and heating of a single crystal is unsuccessful.« less

High-order orbital angular momentum mode generator based on twisted photonic crystal fiber.

PubMed

Fu, Cailing; Liu, Shen; Wang, Ying; Bai, Zhiyong; He, Jun; Liao, Changrui; Zhang, Yan; Zhang, Feng; Yu, Bin; Gao, Shecheng; Li, Zhaohui; Wang, Yiping

2018-04-15

High-order orbital angular momentum (OAM) modes, namely, OAM +5 and OAM +6 , were generated and demonstrated experimentally by twisting a solid-core hexagonal photonic crystal fiber (PCF) during hydrogen-oxygen flame heating. Leaky orbital resonances in the cladding depend strongly on the twist rate and length of the helical PCF. Moreover, the generated high-order OAM mode could be a polarized mode. The secret of the successful observation of high-order modes is that leaky orbital resonances in the twisted PCF cladding have a high coupling efficiency of more than -20  dB.

Trapping of ultracold polar molecules with a thin-wire electrostatic trap.

PubMed

Kleinert, J; Haimberger, C; Zabawa, P J; Bigelow, N P

2007-10-05

We describe the realization of a dc electric-field trap for ultracold polar molecules, the thin-wire electrostatic trap (TWIST). The thin wires that form the electrodes of the TWIST allow us to superimpose the trap onto a magneto-optical trap (MOT). In our experiment, ultracold polar NaCs molecules in their electronic ground state are created in the MOT via photoassociation, achieving a continuous accumulation in the TWIST of molecules in low-field seeking states. Initial measurements show that the TWIST trap lifetime is limited only by the background pressure in the chamber.

Origin of chiral interactions in cellulose supra-molecular microfibrils.

PubMed

Khandelwal, Mudrika; Windle, Alan

2014-06-15

The formation of a chiral-nematic phase from cellulose nanowhiskers has been frequently reported in the literature. The most popular theory used to explain the chiral interactions is that of twisted morphology of cellulose nanowhiskers. Two possible origins of twist have been suggested: the intrinsic chirality of cellulose chains and result of interaction of chiral surfaces. High resolution SEM and AFM have been used to locate twists in cellulose microfibrils and nanowhiskers. The origin of the twisted morphology in cellulose microfibrils has been studied with reference to the protein aggregation theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Advances in the evaluation of wind-induced undercatch using CFD-based simulations of snow gauge performance

NASA Astrophysics Data System (ADS)

Colli, Matteo; Lanza, Luca; Rasmussen, Roy; Thériault, Julie

2016-04-01

Despite its importance, accurate measurements of precipitation remains a challenge. Measurement errors for solid precipitation, which are often ignored for automated systems, frequently range from 20% to 70% due to undercatch in windy conditions. While solid precipitation measurements have been the subject of many studies, there have been only a limited number of numerical modeling efforts to estimate the collection efficiency of solid precipitation gauges when exposed to the wind, in both shielded and unshielded configurations. The available models use CFD simulations of the airflow pattern generated by the aerodynamic response of the gauge/shield geometry to perform the Lagrangian tracking of solid precipitation particles (Thériault et al., 2012; Colli et al. 2016a and 2016b). Validation of the results against field observations yields similarities in the overall behavior, but the model output only approximately reproduces the dependence of the experimental collection efficiency on wind speed. We present recent developments of such a modelling approach including various gauge/shield configurations, the influence of the drag coefficient calculation on the model performance, and the role of the particle size distribution in explaining the scatter of the collection efficiency observed at any particular wind speed (Colli et al. 2015). Comparison with observations at the Marshall (CO) field test site is used to validate results of the various modelling schemes and to support the analysis of the microphysical characteristics of ice crystals. References: Colli, M., Rasmussen, R.M., Thèriault, J.M., Lanza, L.G., Baker, B.C. and J. Kochendorfer (2015). An improved trajectory model to evaluate the collection performance of snow gauges. J.Appl.Meteor.Climatol., 54(8), pages 1826-1836. Colli, M., Lanza, L.G., Rasmussen, R.M. and J.M. Thèriault (2016a). The collection efficiency of shielded and unshielded precipitation gauges. Part I: CFD airflow modelling. J. of Hydrometeorol., 17(1), pages 231-243. Colli, M., Lanza, L.G., Rasmussen, R.M. and J.M. Thèriault (2016b). The collection efficiency of shielded and unshielded precipitation gauges. Part II: modelling particle trajectories. J. of Hydrometeorol., 17(1), 245-255. Thériault, J. M., R. Rasmussen, K. Ikeda, and S. Landolt, (2012). Dependence of snow gauge collection efficiency on snowflake characteristics. J. Appl. Meteor. Climatol., 51, 745-762.

Twist-induced Magnetosphere Reconfiguration for Intermittent Pulsars

NASA Astrophysics Data System (ADS)

Huang, Lei; Yu, Cong; Tong, Hao

2016-08-01

We propose that the magnetosphere reconfiguration induced by magnetic twists in the closed field line region can account for the mode switching of intermittent pulsars. We carefully investigate the properties of axisymmetric force-free pulsar magnetospheres with magnetic twists in closed field line regions around the polar caps. The magnetosphere with twisted closed lines leads to enhanced spin-down rates. The enhancement in spin-down rate depends on the size of the region with twisted closed lines. Typically, it is increased by a factor of ˜2, which is consistent with the intermittent pulsars’ spin-down behavior during the “off” and “on” states. We find that there is a threshold of maximal twist angle {{Δ }}{φ }{{thres}}˜ 1. The magnetosphere is stable only if the closed line twist angle is less than {{Δ }}{φ }{{thres}}. Beyond this value, the magnetosphere becomes unstable and gets untwisted. The spin-down rate would reduce to its off-state value. The quasi-periodicity in spin-down rate change can be explained by long-term activities in the star’s crust and the untwisting induced by MHD instability. The estimated duration of on-state is about 1 week, consistent with observations. Due to the MHD instability, there exists an upper limit for the spin-down ratio (f˜ 3) between the on-state and the off-state, if the Y-point remains at the light cylinder.

Effect of the cross sectional aspect ratio on the flow past a twisted cylinder

NASA Astrophysics Data System (ADS)

Jung, Jae Hwan; Yoon, Hyun Sik

2013-11-01

The cross-flow around twisted cylinders of cross sectional aspect ratio (A/B) from 1 to 2.25 is investigated at a subcritical Reynolds number (Re) of 3000 using large eddy simulation (LES). The flow past a corresponding smooth and wavy cylinder is also calculated for comparison and validation against experimental data. The effect of twisted surface assessed in terms of the mean drag and root-mean-square (RMS) value of fluctuating lift. The shear layer of the twisted cylinder covering the recirculation region is more elongated than those of the smooth and the wavy cylinder. Successively, vortex shedding of the twisted cylinder is considerably suppressed, compared with those of the smooth and the wavy cylinder. The maximum drag reduction of up to 13% compared with a smooth cylinder is obtained at a certain cross sectional aspect ratio. The fluctuating lift coefficient of the twisted cylinder is also significantly suppressed. We found that the cross sectional cross sectional aspect ratio (A/B) plays an essential role in determining the vortical structures behind the twisted cylinder which has a significant effect on the reduction of the fluctuating lift and suppression of flow-induced vibration. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIP) through GCRC-SOP (No. 2011-0030013).

The Effects of Rare Earth Doping on Gallium Nitride Thin Films

DTIC Science & Technology

2011-09-01

MAW Molar mass . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 Microscopic nuclear cross...container) is ∼ 770 nm−2 s−1 [8]. When compared to an unmoderated, unshielded hypothetical mass of 5 kg of 94% enriched 239Pu (weapons grade) at a...emission of a doubly-ionized helium atom ( 4 2He 2+ ) , or alpha particle, as A ZX −→ A-4Z-2Y + 42He2+ + Q , (4) where A represents the atomic mass or the

Combination Therapy with a Second-Generation Androgen Receptor Antagonist and a Metastasis Vaccine Improves Survival in a Spontaneous Prostate Cancer Model

PubMed Central

Ardiani, Andressa; Farsaci, Benedetto; Rogers, Connie J.; Protter, Andy; Guo, Zhimin; King, Thomas H.; Apelian, David; Hodge, James W.

2013-01-01

Purpose Enzalutamide, a second-generation androgen antagonist, was approved by the FDA for castration-resistant prostate cancer (CRPC) treatment. Immunotherapy has been shown to be a promising strategy for prostate cancer. This study is performed to provide data to support the combination of enzalutamide and immunotherapy for CRPC treatment. Experimental Design Male C57BL/6 or TRAMP prostate cancer model mice were exposed to enzalutamide and/or a therapeutic vaccine targeting Twist, an antigen involved in epithelial-to-mesenchymal transition and metastasis. The physiological and immunological effects of enzalutamide were characterized. The generation of Twist-specific immunity by Twist-vaccine was evaluated. Finally, the combination of enzalutamide and Twist-vaccine to improve TRAMP mice overall survival was evaluated. Results Enzalutamide mediated immunogenic modulation in TRAMP-C2 cells. In vivo, enzalutamide mediated reduced genitourinary tissue weight, enlargement of the thymus, and increased levels of T-cell excision circles. Because no changes were seen in T-cell function, as determined by CD4+ T-cell proliferation and Treg functional assays, enzalutamide was determined to be immune inert. Enzalutamide did not diminish the Twist-vaccine’s ability to generate Twist-specific immunity. Twist was confirmed as a valid tumor antigen in TRAMP mice by immunohistochemistry. The combination of enzalutamide and Twist-vaccine resulted in significantly increased overall survival of TRAMP mice compared to other treatment groups (27.5 vs. 10.3 weeks). Notably, the effectiveness of the combination therapy increased with disease stage, i.e., the greatest survival benefit was seen in mice with advanced-stage prostate tumors. Conclusions These data support the combination of enzalutamide and immunotherapy as a promising treatment strategy for CRPC. PMID:24048332

PARTIAL ERUPTION OF A FILAMENT WITH TWISTING NON-UNIFORM FIELDS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bi, Yi; Jiang, Yunchun; Yang, Jiayan

The eruption of a filament in a kinklike fashion is often regarded as a signature of kink instability. However, the kink instability threshold for the filament’s magnetic structure is not widely understood. Using Hα observations from the New Vacuum Solar Telescope, we present a partial eruptive filament. During the eruption, the filament thread appeared to split from its middle and to break out in a kinklike fashion. In this period, the remaining filament material stayed below and erupted without the kinking motion later on. The coronal magnetic field lines associated with the filament are obtained from nonlinear force-free field extrapolationsmore » using the twelve-minute-cadence vector magnetograms of the Helioseismic and Magnetic Imager (HMI) on board the Solar Dynamic Observatory. We studied the extrapolated field lines passing through the magnetic dips which are in good agreement with the observed filament. The field lines are non-uniformly twisted and appear to be composed of two twisted flux ropes winding around each other. One of them has a higher twist than the other, and the flux rope with the higher twist has its dips aligned with the kinking eruptive thread at the beginning of its eruption. Before the eruption, moreover, the flux rope with the higher twist was found to expand with an approximately constant field twist. In addition, the helicity flux maps deduced from the HMI magnetograms show that some helicity is injected into the overlying magnetic arcade, but no significant helicity is injected into the flux ropes. Accordingly, we suggest that the highly twisted flux rope became kink unstable when the instability threshold declined with the expansion of the flux rope.« less

Recombinant mouse periostin ameliorates coronal sutures fusion in Twist1+/- mice.

PubMed

Bai, Shanshan; Li, Dong; Xu, Liang; Duan, Huichuan; Yuan, Jie; Wei, Min

2018-04-17

Saethre-Chotzen syndrome is an autosomal dominantly inherited disorder caused by mutations in the twist family basic helix-loop-helix transcription factor 1 (TWIST1) gene. Surgical procedures are frequently required to reduce morphological and functional defects in patients with Saethre-Chotzen syndrome. Therefore, the development of noninvasive procedures to treat Saethre-Chotzen syndrome is critical. We identified that periostin, which is an extracellular matrix protein that plays an important role in both bone and connective tissues, is downregulated in craniosynostosis patients. We aimed to verify the effects of different concentrations (0, 50, 100, and 200 μg/l) of recombinant mouse periostin in Twist1 +/- mice (a mouse model of Saethre-Chotzen syndrome) coronal suture cells in vitro and in vivo. Cell proliferation, migration, and osteogenic differentiation were observed and detected. Twist1 +/- mice were also injected with recombinant mouse periostin to verify the treatment effects. Cell Counting Kit-8 results showed that recombinant mouse periostin inhibited the proliferation of suture-derived cells in a time- and concentration-dependent manner. Cell migration was also suppressed when treated with recombinant mouse periostin. Real-time quantitative PCR and Western blotting results suggested that messenger ribonucleic acid and protein expression of alkaline phosphatase, bone sialoprotein, collagen type I, and osteocalcin were all downregulated after treatment with recombinant mouse periostin. However, the expression of Wnt-3a, Wnt-1, and β-catenin were upregulated. The in vivo results demonstrated that periostin-treated Twist1 +/- mice showed patent coronal sutures in comparison with non-treated Twist1 +/- mice which have coronal craniosynostosis. Our results suggest that recombinant mouse periostin can inhibit coronal suture cell proliferation and migration and suppress osteogenic differentiation of suture-derived cells via Wnt canonical signaling, as well as ameliorate coronal suture fusion in Twist1 +/- mice.

Type B drum packages

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCoy, J.C.

1994-08-01

The Type B drum packages (TBD) are conceptualized as a family of containers in which a single 208 L or 114 L (55 gal or 30 gal) drum containing Type B quantities of radioactive material (RAM) can be packaged for shipment. The TBD containers are being developed to fill a void in the packaging and transportation capabilities of the U.S. Department of Energy as no container packaging single drums of Type B RAM exists offering double containment. Several multiple-drum containers currently exist, as well as a number of shielded casks, but the size and weight of these containers present manymore » operational challenges for single-drum shipments. As an alternative, the TBD containers will offer up to three shielded versions (light, medium, and heavy) and one unshielded version, each offering single or optional double containment for a single drum. To reduce operational complexity, all versions will share similar design and operational features where possible. The primary users of the TBD containers are envisioned to be any organization desiring to ship single drums of Type B RAM, such as laboratories, waste retrieval activities, emergency response teams, etc. Currently, the TBD conceptual design is being developed with the final design and analysis to be completed in 1995 to 1996. Testing and certification of the unshielded version are planned to be completed in 1996 to 1997 with production to begin in 1997 to 1998.« less

An intravascular loopless monopole antenna for vessel wall MR imaging at 3.0 T.

PubMed

Yuan, Hongyang; Lv, Xing; Ma, Xiaohai; Zhang, Rui; Fu, Youyi; Yang, Xuedong; Wang, Xiaoying; Zhang, Zhaoqi; Zhang, Jue; Fang, Jing

2013-01-01

The purpose of this study was to develop a novel intravascular loopless monopole antenna (ILMA) design specifically for imaging of small vessel walls. The ILMA consisted of an unshielded, low-friction guide wire and a tuning/matching box. The material of the guide wire was nitinol and it was coated with polyurethane. Because the guide wire was unshielded, it could be made thinner than the coaxial cable-based loopless intravascular antenna design. The material of the box was aluminum. In this study, the diameter of the guide wire was 0.5 mm and the length was 58.7 mm. The ILMA was used as a receiving antenna and body coil for transmission. To verify the feasibility of the ILMA, in vitro and in vivo experiments were performed on a 3.0-T magnetic resonance (MR) scanner. In vitro tests using the ILMA indicated that the proposed design could be used to image target vessel walls with a spatial resolution of 313 μm at the frequency coding direction and more than 100 mm of longitudinal coverage. In vivo tests demonstrated that the images showed the vessel walls clearly by using the ILMA and also indicated that the ILMA could be used for small vessels. The proposed antenna may therefore be utilized to promote MR-based diagnoses and therapeutic solutions for cardiovascular atherosclerotic diseases. Copyright © 2013 Elsevier Inc. All rights reserved.

Detectability of cold streams into high-redshift galaxies by absorption lines

NASA Astrophysics Data System (ADS)

Goerdt, Tobias; Dekel, Avishai; Sternberg, Amiel; Gnat, Orly; Ceverino, Daniel

2012-08-01

Cold gas streaming along the dark matter filaments of the cosmic web is predicted to be the major source of fuel for disc buildup, violent disc instability and star formation in massive galaxies at high redshift. We investigate to what extent such cold gas is detectable in the extended circumgalactic environment of galaxies via Lyα absorption and selected low-ionization metal absorption lines. We model the expected absorption signatures using high-resolution zoom-in adaptive mesh refinement cosmological simulations. In the post-processing, we distinguish between self-shielded gas and unshielded gas. In the self-shielded gas, which is optically thick to Lyman continuum radiation, we assume pure collisional ionization for species with an ionization potential greater than 13.6 eV. In the optically-thin, unshielded gas, these species are also photoionized by the metagalactic radiation. In addition to absorption of radiation from background quasars, we compute the absorption line profiles of radiation emitted by the galaxy at the centre of the same halo. We predict the strength of the absorption signal for individual galaxies without stacking. We find that the Lyα absorption profiles produced by the streams are consistent with observations of absorption and emission Lyα profiles in high-redshift galaxies. Due to the low metallicities in the streams, and their low covering factors, the metal absorption features are weak and difficult to detect.

Female gonadal shielding with automatic exposure control increases radiation risks.

PubMed

Kaplan, Summer L; Magill, Dennise; Felice, Marc A; Xiao, Rui; Ali, Sayed; Zhu, Xiaowei

2018-02-01

Gonadal shielding remains common, but current estimates of gonadal radiation risk are lower than estimated risks to colon and stomach. A female gonadal shield may attenuate active automatic exposure control (AEC) sensors, resulting in increased dose to colon and stomach as well as to ovaries outside the shielded area. We assess changes in dose-area product (DAP) and absorbed organ dose when female gonadal shielding is used with AEC for pelvis radiography. We imaged adult and 5-year-old equivalent dosimetry phantoms using pelvis radiograph technique with AEC in the presence and absence of a female gonadal shield. We recorded DAP and mAs and measured organ absorbed dose at six internal sites using film dosimetry. Female gonadal shielding with AEC increased DAP 63% for the 5-year-old phantom and 147% for the adult phantom. Absorbed organ dose at unshielded locations of colon, stomach and ovaries increased 21-51% in the 5-year-old phantom and 17-100% in the adult phantom. Absorbed organ dose sampled under the shield decreased 67% in the 5-year-old phantom and 16% in the adult phantom. Female gonadal shielding combined with AEC during pelvic radiography increases absorbed dose to organs with greater radiation sensitivity and to unshielded ovaries. Difficulty in proper use of gonadal shields has been well described, and use of female gonadal shielding may be inadvisable given the risks of increasing radiation.

Combined experimental and Monte Carlo verification of brachytherapy plans for vaginal applicators

NASA Astrophysics Data System (ADS)

Sloboda, Ron S.; Wang, Ruqing

1998-12-01

Dose rates in a phantom around a shielded and an unshielded vaginal applicator containing Selectron low-dose-rate sources were determined by experiment and Monte Carlo simulation. Measurements were performed with thermoluminescent dosimeters in a white polystyrene phantom using an experimental protocol geared for precision. Calculations for the same set-up were done using a version of the EGS4 Monte Carlo code system modified for brachytherapy applications into which a new combinatorial geometry package developed by Bielajew was recently incorporated. Measured dose rates agree with Monte Carlo estimates to within 5% (1 SD) for the unshielded applicator, while highlighting some experimental uncertainties for the shielded applicator. Monte Carlo calculations were also done to determine a value for the effective transmission of the shield required for clinical treatment planning, and to estimate the dose rate in water at points in axial and sagittal planes transecting the shielded applicator. Comparison with dose rates generated by the planning system indicates that agreement is better than 5% (1 SD) at most positions. The precision thermoluminescent dosimetry protocol and modified Monte Carlo code are effective complementary tools for brachytherapy applicator dosimetry.

Families of vector-like deformations of relativistic quantum phase spaces, twists and symmetries

NASA Astrophysics Data System (ADS)

Meljanac, Daniel; Meljanac, Stjepan; Pikutić, Danijel

2017-12-01

Families of vector-like deformed relativistic quantum phase spaces and corresponding realizations are analyzed. A method for a general construction of the star product is presented. The corresponding twist, expressed in terms of phase space coordinates, in the Hopf algebroid sense is presented. General linear realizations are considered and corresponding twists, in terms of momenta and Poincaré-Weyl generators or gl(n) generators are constructed and R-matrix is discussed. A classification of linear realizations leading to vector-like deformed phase spaces is given. There are three types of spaces: (i) commutative spaces, (ii) κ -Minkowski spaces and (iii) κ -Snyder spaces. The corresponding star products are (i) associative and commutative (but non-local), (ii) associative and non-commutative and (iii) non-associative and non-commutative, respectively. Twisted symmetry algebras are considered. Transposed twists and left-right dual algebras are presented. Finally, some physical applications are discussed.

Axial flow positive displacement worm gas generator

NASA Technical Reports Server (NTRS)

Giffin, Rollin George (Inventor); Fakunle, Oladapo (Inventor); Murrow, Kurt David (Inventor)

2010-01-01

An axial flow positive displacement engine has an inlet axially spaced apart and upstream from an outlet. Inner and outer bodies have offset inner and outer axes extend from the inlet to the outlet through first, second, and third sections of a core assembly in serial downstream flow relationship. At least one of the bodies is rotatable about its axis. The inner and outer bodies have intermeshed inner and outer helical blades wound about the inner and outer axes respectively. The inner and outer helical blades extend radially outwardly and inwardly respectively. The helical blades have first, second, and third twist slopes in the first, second, and third sections respectively. The first twist slopes are less than the second twist slopes and the third twist slopes are less than the second twist slopes. A combustor section extends axially downstream through at least a portion of the second section.

Dynamics of Scroll Wave in a Three-Dimensional System with Changing Gradient.

PubMed

Yuan, Xiao-Ping; Chen, Jiang-Xing; Zhao, Ye-Hua; Liu, Gui-Quan; Ying, He-Ping

2016-01-01

The dynamics of a scroll wave in an excitable medium with gradient excitability is studied in detail. Three parameter regimes can be distinguished by the degree of gradient. For a small gradient, the system reaches a simple rotating synchronization. In this regime, the rigid rotating velocity of spiral waves is maximal in the layers with the highest filament twist. As the excitability gradient increases, the scroll wave evolutes into a meandering synchronous state. This transition is accompanied by a variation in twisting rate. Filament twisting may prevent the breakup of spiral waves in the bottom layers with a low excitability with which a spiral breaks in a 2D medium. When the gradient is large enough, the twisted filament breaks up, which results in a semi-turbulent state where the lower part is turbulent while the upper part contains a scroll wave with a low twisting filament.

Formation and stability of twisted ribbons in mixtures of rod-like fd-virus and non-adsorbing polymer

NASA Astrophysics Data System (ADS)

Dogic, Z.; Didonna, B.; Bryning, M.; Lubensky, T. C.; Yodh, A. G.; Janmey, P. A.

2003-03-01

We are investigating the behavior of mixtures of monodisperse fd-virus rods and non-adsorbing polymer. We observe the formation of isolated smectic disks. The single smectic disk is of a monolayer of aligned rods while its thickness equal to the length of a single rod. As disks coalesce they undergo shape transformations from flat structures to elongated twisted ribbons. A theoretical model is formulated wherein the chirality of the molecule favors the formation of the elongated ribbon structure while the line tension favors formation of untwisted disks. To check the validity of the theoretical model line tension and twist constants are experimentally measured. The line tension is deduced from thermal fluctuations of the interface. The twist constant is determined by unwinding the twisted ribbons using optical tweezers. This work is partially supported by NSF grants DMR-0203378, the PENN MRSEC, DMR-0079909, and NASA grant NAG8-2172.

A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes

NASA Astrophysics Data System (ADS)

Wang, Meng; Lin, Bao-Ping; Yang, Hong

2016-12-01

In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes.

PubMed

Wang, Meng; Lin, Bao-Ping; Yang, Hong

2016-12-22

In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

Intrinsic flexibility of B-DNA: the experimental TRX scale.

PubMed

Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2010-01-01

B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.

Designing Polyamide Inhibitors of TWIST 1 for Prosenescence Therapy

DTIC Science & Technology

2014-09-01

Pyrrole -Imidazole Polyamides; TWIST1; KRAS; non-small cell lung cancer (NSCLC); senescence 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF... Pyrrole -Imidazole Polyamides (PIP) are a class of cell permeable programmable small-molecule heterocyclic amino acid oligomers that can be designed...The original specific aims are below: Specific Aim#1. Design and synthesize a TWIST1-inhibitory specific Pyrrole -Imidazole Polyamides (PIP

Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis

DTIC Science & Technology

2012-01-01

Breast Cancer Metastasis PRINCIPAL INVESTIGATOR: Mark Adam Eckert CONTRACTING...2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis 5b. GRANT NUMBER W81XWH-09-1...an important mediator of breast cancer metastasis by driving the epithelial-mesenchymal transition. We find that Twist1 promotes metastasis by

AHPCRC - Army High Performance Computing Research Center

DTIC Science & Technology

2008-01-01

University) Birds and insects use complex flapping and twisting wing motions to maneuver, hover, avoid obstacles, and maintain or regain their...vehicles for use in sensing, surveillance, and wireless communications. HPC simulations examine plunging, pitching, and twisting motions of aeroelastic...wings, to optimize the amplitudes and frequencies of flapping and twisting motions for the maximum amount of thrust. Several methods of calculation

Trace of the Twisted Heisenberg Category

NASA Astrophysics Data System (ADS)

Oğuz, Can Ozan; Reeks, Michael

2017-12-01

We show that the trace decategorification, or zeroth Hochschild homology, of the twisted Heisenberg category defined by Cautis and Sussan is isomorphic to a quotient of {W^-}, a subalgebra of W_{1+∞} defined by Kac, Wang, and Yan. Our result is a twisted analogue of that by Cautis, Lauda, Licata, and Sussan relating W_{1+∞} and the trace decategorification of the Heisenberg category.

Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities.

PubMed

Alencar, Thonimar V; von Dreifus, Driele; Gabriela Cota Moreira, Maria; Eliel, Gomes S N; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A; Malard, Leandro M; Maria de Paula, Ana

2018-05-02

We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities

NASA Astrophysics Data System (ADS)

Alencar, Thonimar V.; von Dreifus, Driele; Cota Moreira, Maria Gabriela; Eliel, Gomes S. N.; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A.; Malard, Leandro M.; de Paula, Ana Maria

2018-05-01

We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

Radiative capture of cold neutrons by protons and deuteron photodisintegration with twisted beams

NASA Astrophysics Data System (ADS)

Afanasev, Andrei; Serbo, Valeriy G.; Solyanik, Maria

2018-05-01

We consider two basic nuclear reactions: capture of neutrons by protons, n + p → γ + d, and its time-reversed counterpart, photodisintegration of the deuteron, γ + d → n + p. In both of these cases we assume that the incoming beam of neutrons or photons is ‘twisted’ by having an azimuthal phase dependence, i.e., it carries an additional angular momentum along its direction of propagation. Taking a low-energy limit of these reactions, we derive relations between corresponding transition amplitudes and cross sections with plane-wave beams and twisted beams. Implications for experiments with twisted cold neutrons and twisted photon beams are discussed.

Wing Twist Measurements at the National Transonic Facility

NASA Technical Reports Server (NTRS)

Burner, Alpheus W.; Wahls, Richard A.; Goad, William K.

1996-01-01

A technique for measuring wing twist currently in use at the National Transonic Facility is described. The technique is based upon a single camera photogrammetric determination of two dimensional coordinates with a fixed (and known) third dimensional coordinate. The wing twist is found from a conformal transformation between wind-on and wind-off 2-D coordinates in the plane of rotation. The advantages and limitations of the technique as well as the rationale for selection of this particular technique are discussed. Examples are presented to illustrate run-to-run and test-to-test repeatability of the technique in air mode. Examples of wing twist in cryogenic nitrogen mode are also presented.

Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review.

PubMed

Budinski, Vedran; Donlagic, Denis

2017-02-23

Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation.Invited Paper.

Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review †

PubMed Central

Budinski, Vedran; Donlagic, Denis

2017-01-01

Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation. PMID:28241510

The Twist Tensor Nuclear Norm for Video Completion.

PubMed

Hu, Wenrui; Tao, Dacheng; Zhang, Wensheng; Xie, Yuan; Yang, Yehui

2017-12-01

In this paper, we propose a new low-rank tensor model based on the circulant algebra, namely, twist tensor nuclear norm (t-TNN). The twist tensor denotes a three-way tensor representation to laterally store 2-D data slices in order. On one hand, t-TNN convexly relaxes the tensor multirank of the twist tensor in the Fourier domain, which allows an efficient computation using fast Fourier transform. On the other, t-TNN is equal to the nuclear norm of block circulant matricization of the twist tensor in the original domain, which extends the traditional matrix nuclear norm in a block circulant way. We test the t-TNN model on a video completion application that aims to fill missing values and the experiment results validate its effectiveness, especially when dealing with video recorded by a nonstationary panning camera. The block circulant matricization of the twist tensor can be transformed into a circulant block representation with nuclear norm invariance. This representation, after transformation, exploits the horizontal translation relationship between the frames in a video, and endows the t-TNN model with a more powerful ability to reconstruct panning videos than the existing state-of-the-art low-rank models.

Twist drill craniostomy with closed drainage for chronic subdural haematoma in the elderly: an effective method.

PubMed

Ramnarayan, R; Arulmurugan, B; Wilson, Paul M; Nayar, Rani

2008-09-01

Chronic subdural haematoma is a disease of the elderly and surgery in these patients carries a much higher risk. The common surgical procedures for chronic subdural haematoma include twist drill craniostomy, burr hole evacuation or craniotomy. The aim of this study was to analyse the results of twist drill craniostomy with drainage in elderly patients with chronic subdural haematoma. Forty-two elderly patients (>65 years) with radiologically proven chronic subdural haematoma were analysed. All the patients underwent twist drill craniostomy and continuous drainage of the haematoma under local anaesthesia and total intravenous anaesthesia (TIVA). There were 24 males and 18 females. Headache and cognitive decline was seen in 50% and weakness of limbs in 60% of patients. CT scan was done in all cases. All patients underwent twist drill 2-3 cm in front of the parietal eminence under local anaesthesia. The drain was left for 24-72 h depending on the drainage. At 1 week, 88% of patients had a good outcome. Twist drill craniostomy with drainage under local anaesthesia is a safe and effective procedure for chronic subdural haematoma in the elderly and could be used as the first and only option in these people.

Strain, curvature, and twist measurements in digital holographic interferometry using pseudo-Wigner-Ville distribution based method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajshekhar, G.; Gorthi, Sai Siva; Rastogi, Pramod

2009-09-15

Measurement of strain, curvature, and twist of a deformed object play an important role in deformation analysis. Strain depends on the first order displacement derivative, whereas curvature and twist are determined by second order displacement derivatives. This paper proposes a pseudo-Wigner-Ville distribution based method for measurement of strain, curvature, and twist in digital holographic interferometry where the object deformation or displacement is encoded as interference phase. In the proposed method, the phase derivative is estimated by peak detection of pseudo-Wigner-Ville distribution evaluated along each row/column of the reconstructed interference field. A complex exponential signal with unit amplitude and the phasemore » derivative estimate as the argument is then generated and the pseudo-Wigner-Ville distribution along each row/column of this signal is evaluated. The curvature is estimated by using peak tracking strategy for the new distribution. For estimation of twist, the pseudo-Wigner-Ville distribution is evaluated along each column/row (i.e., in alternate direction with respect to the previous one) for the generated complex exponential signal and the corresponding peak detection gives the twist estimate.« less

A Geometric Construction of Cyclic Cocycles on Twisted Convolution Algebras

NASA Astrophysics Data System (ADS)

Angel, Eitan

2010-09-01

In this thesis we give a construction of cyclic cocycles on convolution algebras twisted by gerbes over discrete translation groupoids. In his seminal book, Connes constructs a map from the equivariant cohomology of a manifold carrying the action of a discrete group into the periodic cyclic cohomology of the associated convolution algebra. Furthermore, for proper étale groupoids, J.-L. Tu and P. Xu provide a map between the periodic cyclic cohomology of a gerbe twisted convolution algebra and twisted cohomology groups. Our focus will be the convolution algebra with a product defined by a gerbe over a discrete translation groupoid. When the action is not proper, we cannot construct an invariant connection on the gerbe; therefore to study this algebra, we instead develop simplicial notions related to ideas of J. Dupont to construct a simplicial form representing the Dixmier-Douady class of the gerbe. Then by using a JLO formula we define a morphism from a simplicial complex twisted by this simplicial Dixmier-Douady form to the mixed bicomplex of certain matrix algebras. Finally, we define a morphism from this complex to the mixed bicomplex computing the periodic cyclic cohomology of the twisted convolution algebras.

SET8 promotes epithelial–mesenchymal transition and confers TWIST dual transcriptional activities

PubMed Central

Yang, Fen; Sun, Luyang; Li, Qian; Han, Xiao; Lei, Liandi; Zhang, Hua; Shang, Yongfeng

2012-01-01

SET8 is implicated in transcriptional regulation, heterochromatin formation, genomic stability, cell-cycle progression, and development. As such, it is predicted that SET8 might be involved in the development and progression of tumour. However, whether and how SET8 might be implicated in tumourigenesis is currently unknown. Here, we report that SET8 is physically associated with TWIST, a master regulator of epithelial–mesenchymal transition (EMT). We demonstrated that SET8 and TWIST are functionally interdependent in promoting EMT and enhancing the invasive potential of breast cancer cells in vitro and in vivo. We showed that SET8 acts as a dual epigenetic modifier on the promoters of the TWIST target genes E-cadherin and N-cadherin via its H4K20 monomethylation activity. Significantly, in breast carcinoma samples, SET8 expression is positively correlated with metastasis and the expression of TWIST and N-cadherin and negatively correlated with E-cadherin. Together, our experiments revealed a novel role for SET8 in tumour invasion and metastasis and provide a molecular mechanism underlying TWIST-promoted EMT, suggesting SET8 as a potential target for intervention of the metastasis of breast cancer. PMID:21983900

AKT-ions with a TWIST between EMT and MET.

PubMed

Tang, Huifang; Massi, Daniela; Hemmings, Brian A; Mandalà, Mario; Hu, Zhengqiang; Wicki, Andreas; Xue, Gongda

2016-09-20

The transcription factor Twist is an important regulator of cranial suture during embryogenesis. Closure of the neural tube is achieved via Twist-triggered cellular transition from an epithelial to mesenchymal phenotype, a process known as epithelial-mesenchymal transition (EMT), characterized by a remarkable increase in cell motility. In the absence of Twist activity, EMT and associated phenotypic changes in cell morphology and motility can also be induced, albeit moderately, by other transcription factor families, including Snail and Zeb. Aberrant EMT triggered by Twist in human mammary tumour cells was first reported to drive metastasis to the lung in a metastatic breast cancer model. Subsequent analysis of many types of carcinoma demonstrated overexpression of these unique EMT transcription factors, which statistically correlated with worse outcome, indicating their potential as biomarkers in the clinic. However, the mechanisms underlying their activation remain unclear. Interestingly, increasing evidence indicates they are selectively activated by distinct intracellular kinases, thereby acting as downstream effectors facilitating transduction of cytoplasmic signals into nucleus and reprogramming EMT and mesenchymal-epithelial transition (MET) transcription to control cell plasticity. Understanding these relationships and emerging data indicating differential phosphorylation of Twist leads to complex and even paradoxical functionalities, will be vital to unlocking their potential in clinical settings.

Linear signaling in the Toll-Dorsal pathway of Drosophila: activated Pelle kinase specifies all threshold outputs of gene expression while the bHLH protein Twist specifies a subset.

PubMed

Stathopoulos, Angelike; Levine, Michael

2002-07-01

Differential activation of the Toll receptor leads to the formation of a broad Dorsal nuclear gradient that specifies at least three patterning thresholds of gene activity along the dorsoventral axis of precellular embryos. We investigate the activities of the Pelle kinase and Twist basic helix-loop-helix (bHLH) transcription factor in transducing Toll signaling. Pelle functions downstream of Toll to release Dorsal from the Cactus inhibitor. Twist is an immediate-early gene that is activated upon entry of Dorsal into nuclei. Transgenes misexpressing Pelle and Twist were introduced into different mutant backgrounds and the patterning activities were visualized using various target genes that respond to different thresholds of Toll-Dorsal signaling. These studies suggest that an anteroposterior gradient of Pelle kinase activity is sufficient to generate all known Toll-Dorsal patterning thresholds and that Twist can function as a gradient morphogen to establish at least two distinct dorsoventral patterning thresholds. We discuss how the Dorsal gradient system can be modified during metazoan evolution and conclude that Dorsal-Twist interactions are distinct from the interplay between Bicoid and Hunchback, which pattern the anteroposterior axis.

Finite element and analytical models for twisted and coiled actuator

NASA Astrophysics Data System (ADS)

Tang, Xintian; Liu, Yingxiang; Li, Kai; Chen, Weishan; Zhao, Jianguo

2018-01-01

Twisted and coiled actuator (TCA) is a class of recently discovered artificial muscle, which is usually made by twisting and coiling polymer fibers into spring-like structures. It has been widely studied since discovery due to its impressive output characteristics and bright prospects. However, its mathematical models describing the actuation in response to the temperature are still not fully developed. It is known that the large tensile stroke is resulted from the untwisting of the twisted fiber when heated. Thus, the recovered torque during untwisting is a key parameter in the mathematical model. This paper presents a simplified model for the recovered torque of TCA. Finite element method is used for evaluating the thermal stress of the twisted fiber. Based on the results of the finite element analyses, the constitutive equations of twisted fibers are simplified to develop an analytic model of the recovered torque. Finally, the model of the recovered torque is used to predict the deformation of TCA under varying temperatures and validated against experimental results. This work will enhance our understanding of the deformation mechanism of TCAs, which will pave the way for the closed-loop position control.

[Expression and mechanism of Twist2 in glioma].

PubMed

Wang, L Z; Wang, W J; Xiong, Y F; Xu, S; Wang, S S; Tu, Y; Wang, Z Y; Yan, X L; Mei, J H; Wang, C L

2017-12-08

Objective: To investigate the significance of Twist2 in glioma and whether it is involved in the malignant transformation of glioma by epithelial-mesenchymal transition (EMT). Methods: Using immunohistochemical method detected the expression level of Twist2 in 60 cases of gliomas (including WHO grades Ⅱ, Ⅲ and Ⅳ, each for 20 cases) and 20 cases of non-tumor brain tissues. Real-time fluorescence quantitative PCR and Western blot were used to detect the expression level of Twist2 mRNA and protein in 61 cases of fresh glioma tissue (WHO grade Ⅱ 16 cases, Ⅲ 21 cases, Ⅳ 24 cases) and 12 cases of adjacent tissues, and the expression levels of E-cadherin, N-cadherin and vimentin were also investigated in fresh glioma tissue. Results: Immunohistochemistry results showed that the percentages of Twist2 expression in glioma was 90%(54/60) compared with 30%(6/20) in non-tumor brain tissues( P <0.01). The percentages of Twist2 expression were 75% (15/20), 95% (19/20), and 100% (20/20) in the WHO gradesⅡ, Ⅲ and Ⅳ gliomas, respectively. WHO grades Ⅳ and Ⅲ were significantly higher than that of WHO grade Ⅱ ( P <0.01). There was no significant difference between WHO grade Ⅳand WHO Ⅲ glioma ( P >0.05). Real-time fluorescence quantitative PCR and Western blot showed that the expression level of Twist 2 in gliomas was significantly higher than that in para-cancerous tissues ( P <0.01), and those in WHO grades Ⅳ and Ⅲ gliomas were significantly higher than that in WHO grade Ⅱ glioma ( P <0.01). There was no significant difference between WHO grade Ⅳand grade Ⅲ glioma ( P >0.05). Detection of key protein expression in EMT by Western blot displayed that the expression of E-cadherin was negatively associated with Twist2 in glioma ( r =-0.972, P <0.01). The expression of N-cadherin and vimentin was positively associated with Twist2 in glioma( r =0.971, P <0.01; r =0.968, P <0.01). Conclusions: The expression of Twist2 in human glioma is positively correlated with the malignant grade of glioma, which may be involved in the malignant progression of glioma by EMT.

Coordination of hand shape.

PubMed

Pesyna, Colin; Pundi, Krishna; Flanders, Martha

2011-03-09

The neural control of hand movement involves coordination of the sensory, motor, and memory systems. Recent studies have documented the motor coordinates for hand shape, but less is known about the corresponding patterns of somatosensory activity. To initiate this line of investigation, the present study characterized the sense of hand shape by evaluating the influence of differences in the amount of grasping or twisting force, and differences in forearm orientation. Human subjects were asked to use the left hand to report the perceived shape of the right hand. In the first experiment, six commonly grasped items were arranged on the table in front of the subject: bottle, doorknob, egg, notebook, carton, and pan. With eyes closed, subjects used the right hand to lightly touch, forcefully support, or imagine holding each object, while 15 joint angles were measured in each hand with a pair of wired gloves. The forces introduced by supporting or twisting did not influence the perceptual report of hand shape, but for most objects, the report was distorted in a consistent manner by differences in forearm orientation. Subjects appeared to adjust the intrinsic joint angles of the left hand, as well as the left wrist posture, so as to maintain the imagined object in its proper spatial orientation. In a second experiment, this result was largely replicated with unfamiliar objects. Thus, somatosensory and motor information appear to be coordinated in an object-based, spatial-coordinate system, sensitive to orientation relative to gravitational forces, but invariant to grasp forcefulness.

In vitro structural properties of braided tendon grafts.

PubMed

Nicklin, S; Waller, C; Walker, P; Chung, W K; Walsh, W R

2000-01-01

In an effort to increase strength in hamstring tendon grafts for anterior cruciate ligament reconstruction, braiding or weaving of the tendons has been suggested. The purpose of this study was to examine the biomechanical properties of two braiding techniques compared with a four-stranded tendon graft using a sheep model. Digital extensor tendons from 5 adult sheep were harvested in 28 matched pairs and randomly allocated to French plait or four-stranded weave. The grafts were tested in a hydraulic testing machine with the tendons secured in brass grips frozen with liquid carbon dioxide. The tendons were preconditioned to a distraction of 1 mm for 10 cycles followed by testing to failure at 50 mm/sec, with a data acquisition rate of 1,000 Hz. The stiffness, ultimate load to failure, and the mode of failure were recorded. All braided samples failed at the midsubstance, while the four-stranded controls failed at the grip interface. There was a significant reduction in strength and stiffness of the braided samples compared with the controls. This study demonstrated that braiding decreases the strength and stiffness of a four-stranded tendon graft by up to 54% and 85%, respectively. This finding is supported by the work of Hearle et al. (1969), who demonstrated that the decrease in strength of fiber bundles is equal to the square of the cosine of the twist angle. The twist angle in our samples was approximately 45 degrees, which equates to a decrease in strength of 50%.

Reversible Twisting of Primary Amides via Ground State N-C(O) Destabilization: Highly Twisted Rotationally Inverted Acyclic Amides.

PubMed

Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

2018-01-17

Since the seminal studies by Pauling in 1930s, planarity has become the defining characteristic of the amide bond. Planarity of amides has central implications for the reactivity and chemical properties of amides of relevance to a range of chemical disciplines. While the vast majority of amides are planar, nonplanarity has a profound effect on the properties of the amide bond, with the most common method to restrict the amide bond relying on the incorporation of the amide function into a rigid cyclic ring system. In a major departure from this concept, here, we report the first class of acyclic twisted amides that can be prepared, reversibly, from common primary amides in a single, operationally trivial step. Di-tert-butoxycarbonylation of the amide nitrogen atom yields twisted amides in which the amide bond exhibits nearly perpendicular twist. Full structural characterization of a range of electronically diverse compounds from this new class of twisted amides is reported. Through reactivity studies we demonstrate unusual properties of the amide bond, wherein selective cleavage of the amide bond can be achieved by a judicious choice of the reaction conditions. Through computational studies we evaluate structural and energetic details pertaining to the amide bond deformation. The ability to selectively twist common primary amides, in a reversible manner, has important implications for the design and application of the amide bond nonplanarity in structural chemistry, biochemistry and organic synthesis.

Design and simulation of the micromixer with chaotic advection in twisted microchannels.

PubMed

Jen, Chun-Ping; Wu, Chung-Yi; Lin, Yu-Cheng; Wu, Ching-Yi

2003-05-01

Chaotic mixers with twisted microchannels were designed and simulated numerically in the present study. The phenomenon whereby a simple Eulerian velocity field may generate a chaotic response in the distribution of a Lagrangian marker is termed chaotic advection. Dynamic system theory indicates that chaotic particle motion can occur when a velocity field is either two-dimensional and time-dependent, or three-dimensional. In the present study, micromixers with three-dimensional structures of the twisted microchannel were designed in order to induce chaotic mixing. In addition to the basic T-mixer, three types of micromixers with inclined, oblique and wavelike microchannels were investigated. In the design of each twisted microchannel, the angle of the channels' bottoms alternates in each subsection. When the fluids enter the twisted microchannels, the flow sways around the varying structures within the microchannels. The designs of the twisted microchannels provide a third degree of freedom to the flow field in the microchannel. Therefore, chaotic regimes that lead to chaotic mixing may arise. The numerical results indicate that mixing occurs in the main channel and progressively larger mixing lengths are required as the Peclet number increased. The swaying of the flow in the twisted microchannel causes chaotic advection. Among the four micromixer designs, the micromixer with the inclined channel most improved mixing. Furthermore, using the inclined mixer with six subsections yielded optimum performance, decreasing the mixing length by up to 31% from that of the basic T-mixer.

Wear characteristics of UHMW polyethylene by twist method

NASA Astrophysics Data System (ADS)

Chișiu, G.; Popescu, A. M.; Tudor, A.; Petrescu, A. M.; Stoica, G. F.; Subhi, K. A.

2018-01-01

A wear test of the twist movement was performed as a new method to estimate the in vivo wear behavior of an acetabular cup material for total knee replacements. A series of UHMWPE samples was used to evaluate the dynamic coefficient of friction in twist movement in contact with steel. The experimental data were conducted to validate the related theoretical model developed in the present study.

Study of Spin through Gluon Poles

NASA Astrophysics Data System (ADS)

Anikin, I. V.; Szymanowski, L.; Teryaev, O. V.; Volchanskiy, N.

2017-12-01

Based on the use of contour gauge and collinear factorization, we propose a new set of single spin asymmetry which can be measured in polarized Drell-Yan process by SPD@NICA. We stress that all of discussed single spin asymmetries exist owing to the gluon poles manifesting in the twist-3 or twist-2⊗twist-3 parton distributions related to the transverse-polarized Drell-Yan process.

Twisted Radio Waves and Twisted Thermodynamics

PubMed Central

Kish, Laszlo B.; Nevels, Robert D.

2013-01-01

We present and analyze a gedanken experiment and show that the assumption that an antenna operating at a single frequency can transmit more than two independent information channels to the far field violates the Second Law of Thermodynamics. Transmission of a large number of channels, each associated with an angular momenta ‘twisted wave’ mode, to the far field in free space is therefore not possible. PMID:23424647

Deformed D1D5 CFT: A Holographic Probe of Quantum Gravity

NASA Astrophysics Data System (ADS)

Jardine, Ian Theodore

One of the big unsolved questions in gravity research is the black hole information problem. This problem, which pits the unitarity of quantum field theory against smooth classical spacetime, must have a solution in a complete theory of quantum gravity. This thesis will explore aspects of one approach to this problem in the context of string theory. The approach imagines black hole microstates as string theoretic objects. We look at a prototype system, the D1D5 system, and exploit holography to examine the dual conformal field theory (CFT). Specifically, we examine the CFT deformed from the free orbifold point, dual to a very stringy bulk, using a twisted operator that will take us towards the point with the supergravity description. The effects of twisted operators in the CFT are key to understanding physical processes such as emission and thermalization in black hole microstates. We will propose a component twist method for examining the effects of bare twist operators for higher twists in the continuum limit. Our method builds higher twists from simple 2-cycle twists, whose effects are known. We will find that, in this limit, the coefficients describing general states will follow a conjectured general functional form. We then explore the deformed CFT directly by examining operator mixing for untwisted operators. We will exploit the operator product expansion on the covering space, where twist operators of the orbifold are resolved. We use this to examine the mixing of a general supergravity operator, specifically examine the dilaton, and finish with the mixing of a non-supersymmetric candidate operator. We conjecture that this method could be extended to include twisted operators. We will also examine the mixing of the non-supersymmetric candidate operator by examining three point functions. To automate the lengthy and repetitive computations, we wrote a Mathematica package to compute correlation functions and OPEs in the D1D5 CFT. We will explain some of the main functions of this package and how it can be applied to computations. Finally, we will end with a short discussion on future directions.

Magnetoelectric Transverse Gradient Sensor with High Detection Sensitivity and Low Gradient Noise

PubMed Central

2017-01-01

We report, theoretically and experimentally, the realization of a high detection performance in a novel magnetoelectric (ME) transverse gradient sensor based on the large ME effect and the magnetic field gradient (MFG) technique in a pair of magnetically-biased, electrically-shielded, and mechanically-enclosed ME composites having a transverse orientation and an axial separation. The output voltage of the gradient sensor is directly obtained from the transverse MFG-induced difference in ME voltage between the two ME composites and is calibrated against transverse MFGs to give a high detection sensitivity of 0.4–30.6 V/(T/m), a strong common-mode magnetic field noise rejection rate of <−14.5 dB, a small input-output nonlinearity of <10 ppm, and a low gradient noise of 0.16–620 nT/m/Hz in a broad frequency range of 1 Hz–170 kHz under a small baseline of 35 mm. An analysis of experimental gradient noise spectra obtained in a magnetically-unshielded laboratory environment reveals the domination of the pink (1/f) noise, dielectric loss noise, and power-frequency noise below 3 kHz, in addition to the circuit noise above 3 kHz, in the gradient sensor. The high detection performance, together with the added merit of passive and direct ME conversion by the large ME effect in the ME composites, makes the gradient sensor suitable for the passive, direct, and broadband detection of transverse MFGs. PMID:29068428

Magnetoelectric Transverse Gradient Sensor with High Detection Sensitivity and Low Gradient Noise.

PubMed

Zhang, Mingji; Or, Siu Wing

2017-10-25

We report, theoretically and experimentally, the realization of a high detection performance in a novel magnetoelectric (ME) transverse gradient sensor based on the large ME effect and the magnetic field gradient (MFG) technique in a pair of magnetically-biased, electrically-shielded, and mechanically-enclosed ME composites having a transverse orientation and an axial separation. The output voltage of the gradient sensor is directly obtained from the transverse MFG-induced difference in ME voltage between the two ME composites and is calibrated against transverse MFGs to give a high detection sensitivity of 0.4-30.6 V/(T/m), a strong common-mode magnetic field noise rejection rate of <-14.5 dB, a small input-output nonlinearity of <10 ppm, and a low gradient noise of 0.16-620 nT/m/ Hz in a broad frequency range of 1 Hz-170 kHz under a small baseline of 35 mm. An analysis of experimental gradient noise spectra obtained in a magnetically-unshielded laboratory environment reveals the domination of the pink (1/ f ) noise, dielectric loss noise, and power-frequency noise below 3 kHz, in addition to the circuit noise above 3 kHz, in the gradient sensor. The high detection performance, together with the added merit of passive and direct ME conversion by the large ME effect in the ME composites, makes the gradient sensor suitable for the passive, direct, and broadband detection of transverse MFGs.

The Acquisition of Development of Advanced Processing Techniques for CCD Arrays.

DTIC Science & Technology

1981-01-01

E57B 96 x 2048 TDI imager production run. A minor change was incorporated on wafers #1-3; an in situ doped-polysilicon technique was used instead of the...2047, - 10 - Ab-A~ and 2048 . In some cases charge collection extends beyond these pixels. The excess signal is measured here as a percentage (Table...amount of spurious charge in pixels #2047 and 2048 is always greater than for pixels #2 and 1, respectively. This is because there is more unshielded area

Department of Defense Standard Family of Tactical Shelters (Rigid/Soft/Hybrid)

DTIC Science & Technology

2012-05-01

01-092-0892 Shelter, Electrical Equipment, S-280(C)/G, EMI Shielded 5411-01-304-3069 Shelter, Electrical Equipment, Lightweight, S-788/G Type I 5411...Electrical Equipment, S-250/G, Unshielded 5411-00-999-4935 Shelter, Electrical Equipment, S-250/G, EMI Shielded 5411-00-489-6076 MARINE CORPS (LEGACY) ISO...10 Foot, General Purpose 5411-01-287-4341 ISO, 10 Foot, EMI Shielded 5411-01-206-6079 ISO, 20 Foot, General Purpose 5411-01-209-3451 ISO, 20 Foot

Some gamma-ray shielding measurements made at altitudes greater than 115000 feet using large Ge(Li) detectors

NASA Technical Reports Server (NTRS)

Chapman, G. T.; Cumby, R. P.; Gibbons, J. H.; Macklin, R. L.; Parker, H. W.

1972-01-01

A series of balloon-flight experiments at altitudes greater than 115,000 feet were conducted to gain information relative to the use of composite shields (passive and/or active) for shielding large-volume, lithium-drifted, germanium (Ge(Li)) detectors used in gamma-ray spectrometers. Data showing the pulse-height spectra of the environmental gamma radiation as measured at 5.3 and 3.8 gms sq cm residual atmosphere with an unshielded diode detector are also presented.

The Air-Shower Experiment KASCADE-Grande

NASA Astrophysics Data System (ADS)

Haungs, A.; Apel, W. D.; Arteaga, J. C.; Badea, F.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Brüggemann, M.; Buchholz, P.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; di Pierro, F.; Doll, P.; Engel, R.; Engler, J.; Finger, M.; Fuhrmann, D.; Ghia, P. L.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Heck, D.; Hörandel, J. R.; Huege, T.; Isar, P. G.; Kampert, K.-H.; Kang, D.; Kickelbick, D.; Klages, H. O.; Kolotaev, Y.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Navarra, G.; Nehls, S.; Oehlschläger, J.; Ostapchenko, S.; Over, S.; Petcu, M.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schröder, F.; Sima, O.; Stümpert, M.; Toma, G.; Trinchero, G.; Ulrich, H.; Walkowiak, W.; Weindl, A.; Wochele, J.; Wommer, M.; Zabierowski, J.; KASCADE-Grande Collaboration

2009-12-01

KASCADE-Grande is an extensive air shower experiment at the Forschungszentrum Karlsruhe, Germany. Main parts of the experiment are the Grande array spread over an area of 700×700 m, the original KASCADE array covering 200×200 m with unshielded and shielded detectors, and additional muon tracking devices. This multi-detector system allows to investigate the energy spectrum, composition, and anisotropies of cosmic rays in the energy range up to 1 EeV. An overview on the performance of the apparatus and first results will be given.

Basic EMC Technology Advancement for C(3) Systems - SHIELD. Volume IV B. A Digital Computer Program for Computing Crosstalk between Shielded Cables

DTIC Science & Technology

1982-11-01

your organization , please notify RADC OBCT) Griffiss AFB NY 13441. This will assist us in maintaining a current mailing list. Do not return copies of...RMING ORGANIZATION NAME r AND ADDRESS 10. PROGRAM ELEMENT. PROJECT. TASK Southeastern Center for Electrical AREA6WORKUNITNUMBERS Engineering Education...The program requires that the input data groups be organized as shown in Table 1 where the number of unshielded wires is U and the number of shielded

Hyperbolic-cosine waveguide tapers and oversize rectangular waveguide for reduced broadband insertion loss in W-band electron paramagnetic resonance spectroscopy. II. Broadband characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sidabras, Jason W.; Anderson, James R.; Mainali, Laxman

Experimental results have been reported on an oversize rectangular waveguide assembly operating nominally at 94 GHz. It was formed using commercially available WR28 waveguide as well as a pair of specially designed tapers with a hyperbolic-cosine shape from WR28 to WR10 waveguide [R. R. Mett et al., Rev. Sci. Instrum. 82, 074704 (2011)]. The oversize section reduces broadband insertion loss for an Electron Paramagnetic Resonance (EPR) probe placed in a 3.36 T magnet. Hyperbolic-cosine tapers minimize reflection of the main mode and the excitation of unwanted propagating waveguide modes. Oversize waveguide is distinguished from corrugated waveguide, overmoded waveguide, or quasi-opticmore » techniques by minimal coupling to higher-order modes. Only the TE{sub 10} mode of the parent WR10 waveguide is propagated. In the present work, a new oversize assembly with a gradual 90° twist was implemented. Microwave power measurements show that the twisted oversize waveguide assembly reduces the power loss in the observe and pump arms of a W-band bridge by an average of 2.35 dB and 2.41 dB, respectively, over a measured 1.25 GHz bandwidth relative to a straight length of WR10 waveguide. Network analyzer measurements confirm a decrease in insertion loss of 2.37 dB over a 4 GHz bandwidth and show minimal amplitude distortion of approximately 0.15 dB. Continuous wave EPR experiments confirm these results. The measured phase variations of the twisted oversize waveguide assembly, relative to an ideal distortionless transmission line, are reduced by a factor of two compared to a straight length of WR10 waveguide. Oversize waveguide with proper transitions is demonstrated as an effective way to increase incident power and the return signal for broadband EPR experiments. Detailed performance characteristics, including continuous wave experiment using 1 μM 2,2,6,6-tetramethylpiperidine-1-oxyl in aqueous solution, provided here serve as a benchmark for other broadband low-loss probes in millimeter-wave EPR bridges.« less

Src-homology 2 domain-containing tyrosine phosphatase 2 promotes oral cancer invasion and metastasis

PubMed Central

2014-01-01

Background Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet to be elucidated. We propose that SHP2 is involved in the progression of oral cancer toward metastasis. Methods SHP2 expression was evaluated in paired oral cancer tissues by using immunohistochemical staining and real-time reverse transcription polymerase chain reaction. Isogenic highly invasive oral cancer cell lines from their respective low invasive parental lines were established using a Boyden chamber assay, and changes in the hallmarks of the epithelial-mesenchymal transition (EMT) were assessed to evaluate SHP2 function. SHP2 activity in oral cancer cells was reduced using si-RNA knockdown or enforced expression of a catalytically deficient mutant to analyze migratory and invasive ability in vitro and metastasis toward the lung in mice in vivo. Results We observed the significant upregulation of SHP2 in oral cancer tissues and cell lines. Following SHP2 knockdown, the oral cancer cells markedly attenuated migratory and invasion ability. We observed similar results in phosphatase-dead SHP2 C459S mutant expressing cells. Enhanced invasiveness was associated with significant upregulation of E-cadherin, vimentin, Snail/Twist1, and matrix metalloproteinase-2 in the highly invasive clones. In addition, we determined that SHP2 activity is required for the downregulation of phosphorylated ERK1/2, which modulates the downstream effectors, Snail and Twist1 at a transcript level. In lung tissue sections of mice, we observed that HSC3 tumors with SHP2 deletion exhibited significantly reduced metastatic capacity, compared with tumors administered control si-RNA. Conclusions Our data suggest that SHP2 promotes the invasion and metastasis of oral cancer cells. These results provide a rationale for further investigating the effects of small-molecule SHP2 inhibitors on the progression of oral cancer, and indicate a previously unrecognized SHP2-ERK1/2-Snail/Twist1 pathway that is likely to play a crucial role in oral cancer invasion and metastasis. PMID:24931737

Tilted-ring models of the prolate spiral galaxies NGC 5033 and 5055

NASA Technical Reports Server (NTRS)

Christodoulou, Dimitris M.; Tohline, Joel E.; Steiman-Cameron, Thomas Y.

1988-01-01

Observations of the kinematics of H I in the disks of spiral galaxies have shown that isovelocity contours often exhibit a twisted pattern. The shape of a galaxy's gravitational potential well (whether due to luminous matter or dark matter) can be determined from the direction of the twist. If this twist is a manifestation of the precession of a nonsteady-state disk, it is shown that the twists of NGC 5033 and 5055 imply an overall prolate shape, with the major axis of the potential well aligned along the rotation axis of the disk. Therefore, the luminous disks of these galaxies must be embedded in dark halos that are prolate spheroids or prolatelike triaxial figures.

Optics of twisted nematic and supertwisted nematic liquid-crystal displays

NASA Astrophysics Data System (ADS)

Leenhouts, F.; Schadt, M.

1986-11-01

For the first time calculations of the off-state transmission of twisted nematic liquid-crystal displays (LCD's) are presented which exhibit twist angles greater than the conventional 90 °. The transmission has been calculated using a treatment introduced by Priestley. In addition, the CIE (Commission Internationale d'Eclairage) color coordinates were evaluated which, together with the brightness, determine the optical appearance of an LCD. The finite efficiency of the polarizers was taken into account. The results are compared with those obtained for conventional 90 ° twisted nematic LCD's. From the calculations follow the conditions required to obtain optimal contrast and steep electro-optical characteristics in 180 ° supertwisted LCD's designed for high information content applications.

Mechanical strain energy shuttle for aircraft morphing via wing twist or structural deformation

NASA Astrophysics Data System (ADS)

Clingman, Dan J.; Ruggeri, Robert T.

2004-07-01

Direct structural deformation to achieve aerodynamic benefit is difficult because large actuators must supply energy for structural strain and aerodynamic loads. This ppaer presents a mechanism that allows most of the energy required to twist or deform a wing to be stored in descrete springs. When this device is used, only sufficient energy is provided to control the position of the wing. This concept allows lightweight actuators to perform wing twisting and other structural distortions, and it reduces the onboard mass of the wing-twist system. The energy shuttle can be used with any actuator and it has been adapted for used with shape memory alloy, piezoelectric, and electromagnetic actuators.

Defects in crystalline packings of twisted filament bundles. I. Continuum theory of disclinations.

PubMed

Grason, Gregory M

2012-03-01

We develop the theory of the coupling between in-plane order and out-of-plane geometry in twisted, two-dimensionally ordered filament bundles based on the nonlinear continuum elasticity theory of columnar materials. We show that twisted textures of filament backbones necessarily introduce stresses into the cross-sectional packing of bundles and that these stresses are formally equivalent to the geometrically induced stresses generated in thin elastic sheets that are forced to adopt spherical curvature. As in the case of crystalline order on curved membranes, geometrically induced stresses couple elastically to the presence of topological defects in the in-plane order. We derive the effective theory of multiple disclination defects in the cross section of bundle with a fixed twist and show that above a critical degree of twist, one or more fivefold disclinations is favored in the elastic energy ground state. We study the structure and energetics of multidisclination packings based on models of equilibrium and nonequilibrium cross-sectional order.

The prediction of pressure distributions on an arrow-wing configuration including the effect of camber, twist, and a wing fin

NASA Technical Reports Server (NTRS)

Bobbitt, P. J.; Manro, M. E.; Kulfan, R. M.

1980-01-01

Wind tunnel tests of an arrow wing body configuration consisting of flat, twisted, and cambered twisted wings were conducted at Mach numbers from 0.40 to 2.50 to provide an experimental data base for comparison with theoretical methods. A variety of leading and trailing edge control surface deflections were included in these tests, and in addition, the cambered twisted wing was tested with an outboard vertical fin to determine its effect on wing and control surface loads. Theory experiment comparisons show that current state of the art linear and nonlinear attached flow methods were adequate at small angles of attack typical of cruise conditions. The incremental effects of outboard fin, wing twist, and wing camber are most accurately predicted by the advanced panel method PANAIR. Results of the advanced panel separated flow method, obtained with an early version of the program, show promise that accurate detailed pressure predictions may soon be possible for an aeroelasticity deformed wing at high angles of attack.

Quantification of a Helical Origami Fold

NASA Astrophysics Data System (ADS)

Dai, Eric; Han, Xiaomin; Chen, Zi

2015-03-01

Origami, the Japanese art of paper folding, is traditionally viewed as an amusing pastime and medium of artistic expression. However, in recent years, origami has served as a source of inspiration for innovations in science and engineering. Here, we present the geometric and mechanical properties of a twisting origami fold. The origami structure created by the fold exhibits several interesting properties, including rigid foldibility, local bistability and finely tunable helical coiling, with control over pitch, radius and handedness of the helix. In addition, the pattern generated by the fold closely mimics the twist buckling patterns shown by thin materials, for example, a mobius strip. We use six parameters of the twisting origami pattern to generate a fully tunable graphical model of the fold. Finally, we present a mathematical model of the local bistability of the twisting origami fold. Our study elucidates the mechanisms behind the helical coiling and local bistability of the twisting origami fold, with potential applications in robotics and deployable structures. Acknowledgment to Branco Weiss Fellowship for funding.

Design and analysis of adaptive Super-Twisting sliding mode control for a microgyroscope.

PubMed

Feng, Zhilin; Fei, Juntao

2018-01-01

This paper proposes a novel adaptive Super-Twisting sliding mode control for a microgyroscope under unknown model uncertainties and external disturbances. In order to improve the convergence rate of reaching the sliding surface and the accuracy of regulating and trajectory tracking, a high order Super-Twisting sliding mode control strategy is employed, which not only can combine the advantages of the traditional sliding mode control with the Super-Twisting sliding mode control, but also guarantee that the designed control system can reach the sliding surface and equilibrium point in a shorter finite time from any initial state and avoid chattering problems. In consideration of unknown parameters of micro gyroscope system, an adaptive algorithm based on Lyapunov stability theory is designed to estimate the unknown parameters and angular velocity of microgyroscope. Finally, the effectiveness of the proposed scheme is demonstrated by simulation results. The comparative study between adaptive Super-Twisting sliding mode control and conventional sliding mode control demonstrate the superiority of the proposed method.

All-fiber dynamic gain equalizer based on a twisted long-period grating written by high-frequency CO2 laser pulses.

PubMed

Zhu, T; Rao, Y J; Wang, J L

2007-01-20

A novel dynamic gain equalizer for flattening Er-doped fiber amplifiers based on a twisted long-period fiber grating (LPFG) induced by high-frequency CO(2) laser pulses is reported for the first time to our knowledge. Experimental results show that its transverse-load sensitivity is up to 0.34 dB/(g.mm(-1)), while the twist ratio of the twisted LPFG is approximately 20 rad/m, which is 7 times higher than that of a torsion-free LPFG. In addition, it is found that the strong orientation dependence of the transverse-load sensitivity of the torsion-free LPFG reported previously has been weakened considerably. Therefore such a dynamic gain equalizer based on the unique transverse-load characteristics of the twisted LPFG provides a much larger adjustable range and makes packaging of the gain equalizer much easier. A demonstration has been carried out to flatten an Er-doped fiber amplifier to +/-0.5 dB over a 32 nm bandwidth.

Adaptive twisting sliding mode algorithm for hypersonic reentry vehicle attitude control based on finite-time observer.

PubMed

Guo, Zongyi; Chang, Jing; Guo, Jianguo; Zhou, Jun

2018-06-01

This paper focuses on the adaptive twisting sliding mode control for the Hypersonic Reentry Vehicles (HRVs) attitude tracking issue. The HRV attitude tracking model is transformed into the error dynamics in matched structure, whereas an unmeasurable state is redefined by lumping the existing unmatched disturbance with the angular rate. Hence, an adaptive finite-time observer is used to estimate the unknown state. Then, an adaptive twisting algorithm is proposed for systems subject to disturbances with unknown bounds. The stability of the proposed observer-based adaptive twisting approach is guaranteed, and the case of noisy measurement is analyzed. Also, the developed control law avoids the aggressive chattering phenomenon of the existing adaptive twisting approaches because the adaptive gains decrease close to the disturbance once the trajectories reach the sliding surface. Finally, numerical simulations on the attitude control of the HRV are conducted to verify the effectiveness and benefit of the proposed approach. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

A zero torsional stiffness twist morphing blade as a wind turbine load alleviation device

NASA Astrophysics Data System (ADS)

Lachenal, X.; Daynes, S.; Weaver, P. M.

2013-06-01

This paper presents the design, analysis and realization of a zero stiffness twist morphing wind turbine blade. The morphing blade is designed to actively twist as a means of alleviating the gust loads which reduce the fatigue life of wind turbine blades. The morphing structure exploits an elastic strain energy balance within the blade to enable large twisting deformations with modest actuation requirements. While twist is introduced using the warping of the blade skin, internal pre-stressed members ensure that a constant strain energy balance is achieved throughout the deformation, resulting in a zero torsional stiffness structure. The torsional stability of the morphing blade is characterized by analysing the elastic strain energy in the device. Analytical models of the skin, the pre-stressed components and the complete blade are compared to their respective finite element models as well as experimental results. The load alleviation potential of the adaptive structure is quantified using a two-dimensional steady flow aerodynamic model which is experimentally validated with wind tunnel measurements.

Further Examination of the Vibratory Loads Reduction Results from the NASA/ARMY/MIT Active Twist Rotor Test

NASA Technical Reports Server (NTRS)

Wilbur, Matthew L.; Yeager, William T., Jr.; Sekula, Martin K.

2002-01-01

The vibration reduction capabilities of a model rotor system utilizing controlled, strain-induced blade twisting are examined. The model rotor blades, which utilize piezoelectric active fiber composite actuators, were tested in the NASA Langley Transonic Dynamics Tunnel using open-loop control to determine the effect of active-twist on rotor vibratory loads. The results of this testing have been encouraging, and have demonstrated that active-twist rotor designs offer the potential for significant load reductions in future helicopter rotor systems. Active twist control was found to use less than 1% of the power necessary to operate the rotor system and had a pronounced effect on both rotating- and fixed-system loads, offering reductions in individual harmonic loads of up to 100%. A review of the vibration reduction results obtained is presented, which includes a limited set of comparisons with results generated using the second-generation version of the Comprehensive Analytical Model of Rotorcraft Aerodynamics and Dynamics (CAMRAD II) rotorcraft comprehensive analysis.

Structural and electronic transformation in low-angle twisted bilayer graphene

NASA Astrophysics Data System (ADS)

Gargiulo, Fernando; Yazyev, Oleg V.

2018-01-01

Experiments on bilayer graphene unveiled a fascinating realization of stacking disorder where triangular domains with well-defined Bernal stacking are delimited by a hexagonal network of strain solitons. Here we show by means of numerical simulations that this is a consequence of a structural transformation of the moiré pattern inherent to twisted bilayer graphene taking place at twist angles θ below a crossover angle θ\\star=1.2\\circ . The transformation is governed by the interplay between the interlayer van der Waals interaction and the in-plane strain field, and is revealed by a change in the functional form of the twist energy density. This transformation unveils an electronic regime characteristic of vanishing twist angles in which the charge density converges, though not uniformly, to that of ideal bilayer graphene with Bernal stacking. On the other hand, the stacking domain boundaries form a distinct charge density pattern that provides the STM signature of the hexagonal solitonic network.

Photo-switchable bistable twisted nematic liquid crystal optical switch.

PubMed

Wang, Chun-Ta; Wu, Yueh-Chi; Lin, Tsung-Hsien

2013-02-25

This work demonstrates a photo-switchable bistable optical switch that is based on an azo-chiral doped liquid crystal (ACDLC). The photo-induced isomerization of the azo-chiral dopant can change the chirality of twisted nematic liquid crystal and the gap/pitch ratio of an ACDLC device, enabling switching between 0° and 180° twist states in a homogeneous aligned cell. The bistable 180° and 0° twist states of the azo-chiral doped liquid crystal between crossed polarizers correspond to the ON and OFF states of a light shutter, respectively, and they can be maintained stably for tens of hours. Rapid switching between 180° and 0° twist states can be carried out using 408 and 532 nm addressing light. Such a photo-controllable optical switch requires no specific asymmetric alignment layer or precise control of the cell gap/pitch ratio, so it is easily fabricated and has the potential for use in optical systems.

Left ventricular twisting mechanics and exercise in healthy individuals: a systematic review

PubMed Central

Drury, C Taylor; Bredin, Shannon SD; Phillips, Aaron A; Warburton, Darren ER

2012-01-01

The aim of this study was to review systematically the effects of exercise on left ventricular (LV) twisting mechanics in healthy individuals. Literature searches were conducted in electronic databases for articles reporting measures of LV twisting mechanics in healthy individuals before and during/after exercise. Upon review, 18 articles were analyzed. Studies were separated by exercise type into the following four categories to allow for detailed comparisons: submaximal, prolonged endurance, maximal, and chronic endurance. Despite an overall methodological quality of low to moderate and within-group variations in exercise intensity, duration, and subject characteristics, important trends in the literature emerged. Most important, the coupling of LV systolic twisting and diastolic untwisting was present in all exercise types, as both were either improved or impaired concomitantly, highlighting the linkage between systole and diastole provided through LV twist. In addition, trends regarding the effects of age, training status, and cardiac loading also became apparent within different exercise types. Furthermore, a potential dose-response relationship between exercise duration and the degree of impairment to LV twisting mechanics was found. Although some disagreement existed in results, the observed trends provide important directions for future research. Future investigations should be of higher methodological quality and should include consistent exercise protocols and subject populations in order to minimize the variability between investigations. PMID:24198592

The effect of twisted-tape width on heat transfer and pressure drop for fully developed laminar flow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakroun, W.M.; Al-Fahed, S.F.

1996-07-01

A series of experiments was conducted to study the effect of twisted-tape width on the heat transfer and pressure drop with laminar flow in tubes. Data for three twisted-tape wavelengths, each with five different widths, have been collected with constant wall temperature boundary condition. Correlations for the friction factor and Nusselt number are also available. The correlations predict the experimental data to within 10 to 15 percent for the heat transfer and friction factor, respectively. The presence of the twisted tape has caused the friction factor to increase by a factor of 3 to 7 depending on Reynolds number andmore » the twisted-tape geometry. Heat transfer results have shown an increase of 1.5 to 3 times that of plain tubes depending on the flow conditions and the twisted-tape geometry. The width shows no effect on friction factor and heat transfer in the low range of Reynolds number but has a more pronounced effect on heat transfer at the higher range of Reynolds number. It is recommended to use loose-fit tapes for low Reynolds number flows instead of tight-fit in the design of heat exchangers because they are easier to install and remove for cleaning purposes.« less

Twisted MoSe 2 bilayers with variable local stacking and interlayer coupling revealed by low-frequency Raman spectroscopy

DOE PAGES

Puretzky, Alexander A.; Liang, Liangbo; Li, Xufan; ...

2016-01-14

Unique twisted bilayers of MoSe 2 with multiple stacking orientations and interlayer couplings in the narrow range of twist angles, 60 ± 3°, are revealed by low-frequency Raman spectroscopy and theoretical analysis. The slight deviation from 60 allows the concomitant presence of patches featuring all three high-symmetry stacking configurations (2H or AA', AB', A'B) in one unique bilayer system. In this case, the periodic arrangement of the patches and their size strongly depend on the twist angle. Ab initio modeling predicts significant changes in frequencies and intensities of low-frequency modes versus stacking and twist angle. Experimentally, the variable stacking andmore » coupling across the interface is revealed by the appearance of two breathing modes corresponding to the mixture of the high-symmetry stacking configurations and unaligned regions of monolayers. Only one breathing mode is observed outside the narrow range of twist angles. This indicates a stacking transition to unaligned monolayers with mismatched atom registry without the in-plane restoring force required to generate a shear mode. As a result, the variable interlayer coupling and spacing in transition metal dichalcogenide bilayers revealed in this study may provide a new platform for optoelectronic applications of these materials.« less

Twisted MoSe 2 bilayers with variable local stacking and interlayer coupling revealed by low-frequency Raman spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Puretzky, Alexander A.; Liang, Liangbo; Li, Xufan

Unique twisted bilayers of MoSe 2 with multiple stacking orientations and interlayer couplings in the narrow range of twist angles, 60 ± 3°, are revealed by low-frequency Raman spectroscopy and theoretical analysis. The slight deviation from 60 allows the concomitant presence of patches featuring all three high-symmetry stacking configurations (2H or AA', AB', A'B) in one unique bilayer system. In this case, the periodic arrangement of the patches and their size strongly depend on the twist angle. Ab initio modeling predicts significant changes in frequencies and intensities of low-frequency modes versus stacking and twist angle. Experimentally, the variable stacking andmore » coupling across the interface is revealed by the appearance of two breathing modes corresponding to the mixture of the high-symmetry stacking configurations and unaligned regions of monolayers. Only one breathing mode is observed outside the narrow range of twist angles. This indicates a stacking transition to unaligned monolayers with mismatched atom registry without the in-plane restoring force required to generate a shear mode. As a result, the variable interlayer coupling and spacing in transition metal dichalcogenide bilayers revealed in this study may provide a new platform for optoelectronic applications of these materials.« less

ADAM12 induction by Twist1 promotes tumor invasion and metastasis via regulation of invadopodia and focal adhesions

PubMed Central

Eckert, Mark A.; Santiago-Medina, Miguel; Lwin, Thinzar M.; Kim, Jihoon; Courtneidge, Sara A.

2017-01-01

ABSTRACT The Twist1 transcription factor promotes tumor invasion and metastasis by inducing epithelial–mesenchymal transition (EMT) and invadopodia-mediated extracellular matrix (ECM) degradation. The critical transcription targets of Twist1 for mediating these events remain to be uncovered. Here, we report that Twist1 strongly induces expression of a disintegrin and metalloproteinase 12 (ADAM12). We observed that the expression levels of Twist1 mRNA and ADAM12 mRNA are tightly correlated in human breast tumors. Knocking down ADAM12 blocked cell invasion in a 3D mammary organoid culture. Suppression of ADAM12 also inhibited Twist1-induced tumor invasion and metastasis in human breast tumor xenografts, without affecting primary tumor formation. Mechanistically, knockdown of ADAM12 in breast cancer cells significantly reduced invadopodia formation and matrix degradation, and simultaneously increased overall cell adhesion to the ECM. Live-imaging analysis showed that knockdown of ADAM12 significantly inhibited focal adhesion turnover. Mechanistically, both the disintegrin and metalloproteinase domains of ADAM12 are required for its function at invadopodia, whereas the metalloproteinase domain is dispensable for its function at focal adhesions. Taken together, these data suggest that ADAM12 plays a crucial role in tumor invasion and metastasis by regulating both invadopodia and focal adhesions. PMID:28468988

On exact correlation functions of chiral ring operators in 2 d N=(2, 2) SCFTs via localization

NASA Astrophysics Data System (ADS)

Chen, Jin

2018-03-01

We study the extremal correlation functions of (twisted) chiral ring operators via superlocalization in N=(2, 2) superconformal field theories (SCFTs) with central charge c ≥ 3, especially for SCFTs with Calabi-Yau geometric phases. We extend the method in arXiv: 1602.05971 with mild modifications, so that it is applicable to disentangle operators mixing on S 2 in nilpotent (twisted) chiral rings of 2 d SCFTs. With the extended algorithm and technique of localization, we compute exactly the extremal correlators in 2 d N=(2, 2) (twisted) chiral rings as non-holomorphic functions of marginal parameters of the theories. Especially in the context of Calabi-Yau geometries, we give an explicit geometric interpretation to our algorithm as the Griffiths transversality with projection on the Hodge bundle over Calabi-Yau complex moduli. We also apply the method to compute extremal correlators in Kähler moduli, or say twisted chiral rings, of several interesting Calabi-Yau manifolds. In the case of complete intersections in toric varieties, we provide an alternative formalism for extremal correlators via localization onto Higgs branch. In addition, as a spinoff we find that, from the extremal correlators of the top element in twisted chiral rings, one can extract chiral correlators in A-twisted topological theories.

Gerbes, M5-Brane Anomalies and E8 Gauge Theory

NASA Astrophysics Data System (ADS)

Aschieri, Paolo; Jurco, Branislav

2004-10-01

Abelian gerbes and twisted bundles describe the topology of the NS 3-form gauge field strength H. We review how they have been usefully applied to study and resolve global anomalies in open string theory. Abelian 2-gerbes and twisted nonabelian gerbes describe the topology of the 4-form field strength G of M-theory. We show that twisted nonabelian gerbes are relevant in the study and resolution of global anomalies of multiple coinciding M5-branes. Global anomalies for one M5-brane have been studied by Witten and by Diaconescu, Freed and Moore. The structure and the differential geometry of twisted nonabelian gerbes (i.e. modules for 2-gerbes) is defined and studied. The nonabelian 2-form gauge potential living on multiple coinciding M5-branes arises as curving (curvature) of twisted nonabelian gerbes. The nonabelian group is in general tilde OmegaE8, the central extension of the E8 loop group. The twist is in general necessary to cancel global anomalies due to the nontriviality of the 11-dimensional 4-form field strength G and due to the possible torsion present in the cycles the M5-branes wrap. Our description of M5-branes global anomalies leads to the D4-branes one upon compactification of M-theory to Type IIA theory.

How Well Can the Observed Flux Ropes in the Solar Wind be Fitted by a Uniform-twist Flux Rope Model?

NASA Astrophysics Data System (ADS)

Wang, Y.

2015-12-01

In the solar wind, flux ropes, e.g., magnetic clouds (MCs), are a frequently observational phenomenon. Their magnetic field configuration or the way that the field lines wind around the flux rope axis is one of the most important information to understand the formation and evolution of the observed flux ropes. Most MCs are believed to be in the force-free state, and widely modeled by the Lundquist force-free solution, in which the twist of the field line increases from zero at the axis to infinity at the boundary. However, Lundquist solution is not the only form of a force-free magnetic field. Some studies based on suprathermal electron observations and models have shown that MCs may carry magnetic field lines more likely to be uniformly twisted. The nonlinear force-free field extrapolation of solar magnetic field also suggests that the field lines of a flux rope twist limitedly. In this study, we have developed a velocity-modified uniform-twist force-free flux rope model, and fit observed MCs with this model. By using this approach, we test how well the observed MCs can be fitted into a uniform-twist flux rope. Some interesting results will be given in this presentation.