Sample records for updated 18s rrna

  1. Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

    PubMed Central

    Mishima, Y; Mitsuma, T; Ogata, K

    1985-01-01

    An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

  2. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  3. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  4. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    PubMed Central

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  5. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  6. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    PubMed

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or translation factors, and areas related to translation fidelity, were found to undergo significant metal-induced conformational alterations, leading either to loosening of their structure or to more compact folding. These modifications were associated with parallel alterations in the translation process at multiple levels, a fact suggesting that structural perturbations in ribosomes, caused by metals, pose significant hurdles in translational efficiency and fidelity. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

    PubMed Central

    Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

    2018-01-01

    Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches in the expansion segments 7, 15, and 27 of human 28S rRNA appear as candidates for general interaction with mRNAs, especially those associated with intracellular matrices such as the endoplasmic reticulum. PMID:29563925

  8. A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

    PubMed

    Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

    2017-11-06

    Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

  9. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    PubMed

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  12. 5S ribosomal RNA database Y2K

    PubMed Central

    Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

  13. 5S ribosomal RNA database Y2K.

    PubMed

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  14. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

    PubMed

    Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

    2006-01-01

    Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

  16. Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

    PubMed

    Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

    2015-06-01

    Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation between spliced rRNA expression levels, possibly due to changes in rRNA processing, which requires further investigation.

  17. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

    PubMed Central

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

    PubMed

    Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

    2008-01-15

    The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

  20. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  1. Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

    PubMed

    He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

    2012-06-01

    The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

  2. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    PubMed

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  4. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

    PubMed

    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  5. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  6. Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea)

    PubMed Central

    Vd’ačný, Peter; Bourland, William A.; Orsi, William; Epstein, Slava S.; Foissner, Wilhelm

    2012-01-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria + Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763

  7. Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea).

    PubMed

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2012-11-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria+Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. [Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

    PubMed

    Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

    2005-01-01

    Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

  9. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

  10. Phylogeny of Theileria buffeli genotypes identified in the South African buffalo (Syncerus caffer) population.

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C

    2014-08-29

    Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic.

    PubMed

    Hamšíková, Zuzana; Silaghi, Cornelia; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, Lenka; Slovák, Mirko; Mendel, Jan; Blažejová, Hana; Berthová, Lenka; Kocianová, Elena; Hubálek, Zdeněk; Schnittger, Leonhard; Kazimírová, Mária

    2016-10-01

    By amplification and sequencing of 18S rRNA gene fragments, Hepatozoon spp. DNA was detected in 0.08 % (4/5057) and 0.04 % (1/2473) of questing Ixodes ricinus ticks from Slovakia and Czech Republic, respectively. Hepatozoon spp. DNA was also detected in spleen and/or lungs of 4.45 % (27/606) of rodents from Slovakia. Prevalence of infection was significantly higher in Myodes glareolus (11.45 %) than in Apodemus spp. (0.28 %) (P < 0.001). Sequencing of 18S rRNA Hepatozoon spp. gene amplicons from I. ricinus showed 100 % identity with Hepatozoon canis isolates from red foxes or dogs in Europe. Phylogenetic analysis showed that at least two H. canis 18S rRNA genotypes exist in Slovakia of which one was identified also in the Czech Republic. The finding of H. canis in questing I. ricinus suggests the geographical spread of the parasite and a potential role of other ticks as its vectors in areas where Rhipicephalus sanguineus is not endemic. Sequencing of 18S rRNA gene amplicons from M. glareolus revealed the presence of two closely related genetic variants, Hepatozoon sp. SK1 and Hepatozoon sp. SK2, showing 99-100 % identity with isolates from M. glareolus from other European countries. Phylogenetic analysis demonstrates that 18S rRNA variants SK1 and SK2 correspond to previously described genotypes UR1 and UR2 of H. erhardovae, respectively. The isolate from Apodemus flavicollis (Hepatozoon sp. SK3b) was 99 % identical with isolates from reptiles in Africa and Asia. Further studies are necessary to identify the taxonomic status of Hepatozoon spp. parasitizing rodents in Europe and the host-parasite interactions in natural foci.

  13. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  14. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

  15. Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

    PubMed

    Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

    2011-02-01

    Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

  16. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    PubMed

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  17. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  18. Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

    PubMed

    Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

    2008-10-31

    A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  19. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  20. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    PubMed

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  1. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  2. Stability of a biogas-producing bacterial, archaeal and fungal community degrading food residues.

    PubMed

    Bengelsdorf, Frank R; Gerischer, Ulrike; Langer, Susanne; Zak, Manuel; Kazda, Marian

    2013-04-01

    The resident microbiota was analyzed in a mesophilic, continuously operating biogas plant predominantly utilizing food residues, stale bread, and other waste cosubstrates together with pig manure and maize silage. The dominating bacterial, archaeal, and eukaryotic community members were characterized by two different 16S/18S rRNA gene culture-independent approaches. Prokaryotic 16S rRNA gene and eukaryotic 18S rRNA gene clone libraries were constructed and further analyzed by restriction fragment length polymorphism (RFLP), 16S/18S rRNA gene sequencing, and phylogenetic tree reconstruction. The most dominant bacteria belonged to the phyla Bacteriodetes, Chloroflexus, and Firmicutes. On the family level, the bacterial composition confirmed high differences among biogas plants studied so fare. In contrast, the methanogenic archaeal community was similar to that of other studied biogas plants. Furthermore, it was possible to identify fungi at the genus level, namely Saccharomyces and Mucor. Both genera, which are important for microbial degradation of complex compounds, were up to now not found in biogas plants. The results revealed their long-term presence as indicated by denaturating gradient gel electrophoresis (DGGE). The DGGE method confirmed that the main members of the microbial community were constantly present over more than one-year period. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Molecular confirmation of Hepatozoon canis in Mauritius.

    PubMed

    Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

    2018-01-01

    In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  5. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via activation of p53, caspases and cathepsins. ► DON- and anisomycin-triggered rRNA cleavage is p38-dependent. ► SG- and ricin-induced rRNA cleavage is p38-independent.« less

  6. Association of nonribosomal nucleolar proteins in ribonucleoprotein complexes during interphase and mitosis.

    PubMed

    Piñol-Roma, S

    1999-01-01

    rRNA precursors are bound throughout their length by specific proteins, as the pre-rRNAs emerge from the transcription machinery. The association of pre-rRNA with proteins as ribonucleoprotein (RNP) complexes persists during maturation of 18S, 5.8S, and 28S rRNA, and through assembly of ribosomal subunits in the nucleolus. Preribosomal RNP complexes contain, in addition to ribosomal proteins, an unknown number of nonribosomal nucleolar proteins, as well as small nucleolar RNA-ribonucleoproteins (sno-RNPs). This report describes the use of a specific, rapid, and mild immunopurification approach to isolate and analyze human RNP complexes that contain nonribosomal nucleolar proteins, as well as ribosomal proteins and rRNA. Complexes immunopurified with antibodies to nucleolin-a major nucleolar RNA-binding protein-contain several distinct specific polypeptides that include, in addition to nucleolin, the previously identified nucleolar proteins B23 and fibrillarin, proteins with electrophoretic mobilities characteristic of ribosomal proteins including ribosomal protein S6, and a number of additional unidentified proteins. The physical association of these proteins with one another is mediated largely by RNA, in that the complexes dissociate upon digestion with RNase. Complexes isolated from M-phase cells are similar in protein composition to those isolated from interphase cell nuclear extracts. Therefore, the predominant proteins that associate with nucleolin in interphase remain in RNP complexes during mitosis, despite the cessation of rRNA synthesis and processing in M-phase. In addition, precursor rRNA, as well as processed 18S and 28S rRNA and candidate rRNA processing intermediates, is found associated with the immunopurified complexes. The characteristics of the rRNP complexes described here, therefore, indicate that they represent bona fide precursors of mature cytoplasmic ribosomal subunits.

  7. Inventory and update on argasid ticks and associated pathogens in Algeria.

    PubMed

    Lafri, I; Benredjem, W; Neffah-Baaziz, F; Lalout, R; Abdelouahed, K; Gassen, B; Bakhouch, S; Chergui, M; Karakellah, M; Adjmi-Hamoudi, H; Bitam, I

    2018-05-01

    Argasid ticks include vectors of relapsing fevers caused by Borrelia spp. in humans, and they can transmit arboviruses and other bacterial pathogens. Knowledge about soft ticks ( Ixodida: Argasidae ) in Algeria is incomplete, and distribution data need to be updated. Here we report a series of entomologic investigations that we conducted in five different areas in Algeria between 2012 and 2015. Ticks were identified by entomologic keys and molecular tools (16S rRNA gene). Six distinct species belonging to two genera were identified, including Ornithodoros capensis s.s., Ornithodoros rupestris, Ornithodoros occidentalis, Ornithodoros erraticus, Ornithodoros sonrai and Argas persicus. The present study highlights the distribution of soft ticks, the establishment of an update inventory with nine species and associated pathogens detected in argasid ticks in Algeria.

  8. Defining the RNA-Protein Interactions in the Trypanosome Preribosomal Complex

    PubMed Central

    Wang, Lei; Ciganda, Martin

    2013-01-01

    In eukaryotes, 5S rRNA is transcribed in the nucleoplasm and requires the ribosomal protein L5 to deliver it to the nucleolus for ribosomal assembly. The trypanosome-specific proteins P34 and P37 form a novel preribosomal complex with the eukaryotic conserved L5-5S rRNA complex in the nucleoplasm. Previous results suggested that P34 acts together with L5 to bridge the interaction with 5S rRNA and thus to stabilize 5S rRNA, an important role in the early steps of ribosomal biogenesis. Here, we have delineated the domains of the two protein components, L5 and P34, and regions of the RNA partner, 5S rRNA, that are critical for protein-RNA interactions within the complex. We found that the L18 domain of L5 and the N terminus and RNA recognition motif of P34 bind 5S rRNA. We showed that Trypanosoma brucei L5 binds the β arm of 5S rRNA, while P34 binds loop A/stem V of 5S rRNA. We demonstrated that 5S rRNA is able to enhance the association between the protein components of the complex, L5 and P34. Both loop A/stem V and the β arm of 5S rRNA can separately enhance the protein-protein association, but their effects are neither additive nor synergistic. Domains in the two proteins for protein-protein and protein-RNA interactions overlap or are close to each other. This suggests that 5S rRNA binding might cause conformational changes in L5 and P34 and might also bridge the interactions, thus enhancing binding between the protein partners of this novel complex. PMID:23397568

  9. The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

    PubMed Central

    Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

    1981-01-01

    We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

  10. Variability of ribosomal RNA genes in Rauwolfia species: parallelism between tissue culture-induced rearrangements and interspecies polymorphism.

    PubMed

    Andreev, I O; Spiridonova, K V; Solovyan, V T; Kunakh, V A

    2005-01-01

    An analysis of 18S-25S and 5S rRNA genes in intact plants and cultured tissues of some Rauwolfia species was performed to compare these sequences variability occurred as a result of the species evolution in nature and that induced by tissue culture. The restriction fragment length polymorphism of 18S-25S and 5S rDNA was found both in intact plants of various Rauwolfia species and in long-term Rauwolfia serpentina tissue cultures. In addition, changes in the amount of 18S-25S rRNA genes were observed in long-term R. serpentina tissue cultures. The results demonstrate that rDNA variability observed in intact plants as well as in long-term cultures is attributed to differences in the same regions of ribosomal RNA genes.

  11. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  12. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  13. The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

    PubMed Central

    Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

    2010-01-01

    The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

  14. Root-knot nematodes in golf course greens of the western United States

    USDA-ARS?s Scientific Manuscript database

    A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...

  15. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  16. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

    PubMed Central

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

  17. 18S rRNA data indicate that Aschelminthes are polyphyletic in origin and consist of at least three distinct clades.

    PubMed

    Winnepenninckx, B; Backeljau, T; Mackey, L Y; Brooks, J M; De Wachter, R; Kumar, S; Garey, J R

    1995-11-01

    The Aschelminthes is a collection of at least eight animal phyla, historically grouped together because the absence of a true body cavity was perceived as a pseudocoelom. Analyses of 18S rRNA sequences from six Aschelminth phyla (including four previously unpublished sequences) support polyphyly for the Aschelminthes. At least three distinct groups of Aschelminthes were detected: the Priapulida among the protostomes, the Rotifera-Acanthocephala as a sister group to the protostomes, and the Nematoda as a basal group to the triploblastic Eumetazoa.

  18. Diversity of cultured photosynthetic flagellates in the North East Pacific and Arctic Oceans in summer

    NASA Astrophysics Data System (ADS)

    Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

    2012-06-01

    During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

  19. Diversity of cultured photosynthetic flagellates in the northeast Pacific and Arctic Oceans in summer

    NASA Astrophysics Data System (ADS)

    Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

    2012-11-01

    During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

  20. Housekeeping while brain's storming Validation of normalizing factors for gene expression studies in a murine model of traumatic brain injury

    PubMed Central

    Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie

    2008-01-01

    Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first-intention normalizing factor with a broad field of applications is highlighted. Pros and cons of the three methods of normalization factors selection are discussed. A generic time- and cost-effective procedure for normalization factor validation is proposed. PMID:18611280

  1. Shifts in soil biodiversity-A forensic comparison between Sus scrofa domesticus and vegetation decomposition.

    PubMed

    Olakanye, Ayodeji O; Thompson, Tim; Ralebitso-Senior, T Komang

    2015-12-01

    In a forensic context, microbial-mediated cadaver decomposition and nutrient recycling cannot be overlooked. As a result, forensic ecogenomics research has intensified to gain a better understanding of cadaver/soil ecology interactions as a powerful potential tool for forensic practitioners. For this study, domestic pig (Sus scrofa domesticus) (4g) and grass (Agrostis/Festuca spp) cuttings (4g) were buried (July 2013 to July 2014) in sandy clay loam (80 g) triplicates in sealed microcosms (127 ml; 50 × 70 cm) with parallel soil only controls. The effects of the two carbon sources were determined by monitoring key environmental factors and changes in soil bacterial (16S rRNA gene) and fungal (18S rRNA gene) biodiversity. Soil pH changes showed statistically significant differences (p<0.05) between the treatments. The measured ecological diversity indices (Shannon-Wiener, HꞋ; Simpson, D; and richness, S) of the 16S rRNA and 18S rRNA gene profiles also revealed differences between the treatments, with bacterial and fungal community dominance recorded in the presence of S. scrofa domesticus and grass trimming decomposition, respectively. In contrast, no statistically significant difference in evenness (p>0.05) was observed between the treatments. Copyright © 2015 The Chartered Society of Forensic Sciences. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    PubMed

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  3. Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

    PubMed

    Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

    2017-11-01

    Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

  4. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    PubMed

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  5. Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

    PubMed Central

    Thomas, Matthew C.; Selinger, L. Brent

    2012-01-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

  6. A meta-analysis of bacterial diversity in the feces of cattle

    USDA-ARS?s Scientific Manuscript database

    In this study, we conducted a meta-analysis on 16S rRNA gene sequences of bovine fecal origin that are publicly available in the RDP database. A total of 13663 sequences including 603 isolate sequences were identified in the RDP database (Release 11, Update 1), where 13447 sequences were assigned t...

  7. Characterization and Screening of Native Scenedesmus sp. Isolates Suitable for Biofuel Feedstock.

    PubMed

    Gour, Rakesh Singh; Chawla, Aseem; Singh, Harvinder; Chauhan, Rajinder Singh; Kant, Anil

    2016-01-01

    In current study isolates of two native microalgae species were screened on the basis of growth kinetics and lipid accumulation potential. On the basis of data obtained on growth parameters and lipid accumulation, it is concluded that Scenedesmus dimorphus has better potential as biofuel feedstock. Two of the isolates of Scenedesmus dimorphus performed better than other isolates with respect to important growth parameters with lipid content of ~30% of dry biomass. Scenedesmus dimorphus was found to be more suitable as biodiesel feedstock candidate on the basis of cumulative occurrence of five important biodiesel fatty acids, relative occurrence of SFA (53.04%), MUFA (23.81%) and PUFA (19.69%), and more importantly that of oleic acid in its total lipids. The morphological observations using light and Scanning Electron Microscope and molecular characterization using amplified 18S rRNA gene sequences of microalgae species under study were also performed. Amplified 18S rRNA gene fragments of the microalgae species were sequenced, annotated at the NCBI website and phylogenetic analysis was done. We have published eight 18S rRNA gene sequences of microalgae species in NCBI GenBank.

  8. Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

    PubMed

    Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

    2018-01-01

    Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

  9. Spatial and temporal dynamics of the microbial community in the Hanford unconfined aquifer

    PubMed Central

    Lin, Xueju; McKinley, James; Resch, Charles T; Kaluzny, Rachael; Lauber, Christian L; Fredrickson, James; Knight, Rob; Konopka, Allan

    2012-01-01

    Pyrosequencing analysis of 16S rRNA genes was used to study temporal dynamics of groundwater bacteria and archaea over 10 months within three well clusters separated by ∼30 m and located 250 m from the Columbia River on the Hanford Site, WA. Each cluster contained three wells screened at different depths ranging from 10 to 17 m that differed in hydraulic conductivities. Representative samples were selected for analyses of prokaryotic 16S and eukaryotic 18S rRNA gene copy numbers. Temporal changes in community composition occurred in all nine wells over the 10-month sampling period. However, there were particularly strong effects near the top of the water table when the seasonal rise in the Columbia River caused river water intrusion at the top of the aquifer. The occurrence and disappearance of some microbial assemblages (such as Actinobacteria ACK-M1) were correlated with river water intrusion. This seasonal impact on microbial community structure was greater in the shallow saturated zone than deeper zone in the aquifer. Spatial and temporal patterns for several 16S rRNA gene operational taxonomic units associated with particular physiological functions (for example, methane oxidizers and metal reducers) suggests dynamic changes in fluxes of electron donors and acceptors over an annual cycle. In addition, temporal dynamics in eukaryotic 18S rRNA gene copies and the dominance of protozoa in 18S clone libraries suggest that bacterial community dynamics could be affected not only by the physical and chemical environment but also by top-down biological control. PMID:22456444

  10. Spatial and temporal dynamics of the microbial community in the Hanford unconfined aquifer.

    PubMed

    Lin, Xueju; McKinley, James; Resch, Charles T; Kaluzny, Rachael; Lauber, Christian L; Fredrickson, James; Knight, Rob; Konopka, Allan

    2012-09-01

    Pyrosequencing analysis of 16S rRNA genes was used to study temporal dynamics of groundwater bacteria and archaea over 10 months within three well clusters separated by ~30 m and located 250 m from the Columbia River on the Hanford Site, WA. Each cluster contained three wells screened at different depths ranging from 10 to 17 m that differed in hydraulic conductivities. Representative samples were selected for analyses of prokaryotic 16S and eukaryotic 18S rRNA gene copy numbers. Temporal changes in community composition occurred in all nine wells over the 10-month sampling period. However, there were particularly strong effects near the top of the water table when the seasonal rise in the Columbia River caused river water intrusion at the top of the aquifer. The occurrence and disappearance of some microbial assemblages (such as Actinobacteria ACK-M1) were correlated with river water intrusion. This seasonal impact on microbial community structure was greater in the shallow saturated zone than deeper zone in the aquifer. Spatial and temporal patterns for several 16S rRNA gene operational taxonomic units associated with particular physiological functions (for example, methane oxidizers and metal reducers) suggests dynamic changes in fluxes of electron donors and acceptors over an annual cycle. In addition, temporal dynamics in eukaryotic 18S rRNA gene copies and the dominance of protozoa in 18S clone libraries suggest that bacterial community dynamics could be affected not only by the physical and chemical environment but also by top-down biological control.

  11. Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

    PubMed

    Habibi, Gh

    2012-01-01

    Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

  12. A comparison of various "housekeeping" probes for northern analysis of normal and osteoarthritic articular cartilage RNA.

    PubMed

    Matyas, J R; Huang, D; Adams, M E

    1999-01-01

    Several approaches are commonly used to normalize variations in RNA loading on Northern blots, including: ethidium bromide (EthBr) fluorescence of 18S or 28S rRNA or autoradiograms of radioactive probes hybridized with constitutively expressed RNAs such as elongation factor-1alpha (ELF), glyceraldehyde-3-phosphate dehydrogenase (G3PDH), actin, 18S or 28S rRNA, or others. However, in osteoarthritis (OA) the amount of total RNA changes significantly and none of these RNAs has been clearly demonstrated to be expressed at a constant level, so it is unclear if any of these approaches can be used reliably for normalizing RNA extracted from osteoarthritic cartilage. Total RNA was extracted from normal and osteoarthritic cartilage and assessed by EthBr fluorescence. RNA was then transferred to a nylon membrane hybridized with radioactive probes for ELF, G3PDH, Max, actin, and an oligo-dT probe. The autoradiographic signal across the six lanes of a gel was quantified by scanning densitometry. When compared on the basis of total RNA, the coefficient of variation was lowest for 28S ethidium bromide fluorescence and oligo-dT (approximately 7%), followed by 18S ethidium bromide fluorescence and G3PDH (approximately 13%). When these values were normalized to DNA concentration, the coefficient of variation exceeded 50% for all signals. Total RNA and the signals for 18S, 28S rRNA, and oligo-dT all correlated highly. These data indicate that osteoarthritic chondrocytes express similar ratios of mRNA to rRNA and mRNA to total RNA as do normal chondrocytes. Of all the "housekeeping" probes, G3PDH correlated best with the measurements of RNA. All of these "housekeeping" probes are expressed at greater levels by osteoarthritic chondrocytes when compared with normal chondrocytes. Thus, while G3PDH is satisfactory for evaluating the amount of RNA loaded, its level of expression is not the same in normal and osteoarthritic chondrocytes.

  13. Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation.

    PubMed

    Briggs, M W; Burkard, K T; Butler, J S

    1998-05-22

    The eukaryotic 25 S, 18 S, and 5.8 S rRNAs are synthesized as a single transcript with two internal transcribed spacers (ITS1 and ITS2), which are removed by endo- and exoribonucleolytic steps to produce mature rRNA. Genetic selection for suppressors of a polyadenylation defect yielded two cold-sensitive alleles of a gene that we named RRP6 (ribosomal RNA processing). Molecular cloning of RRP6 revealed its homology to a 100-kDa human, nucleolar PM-Scl autoantigen and to Escherichia coli RNase D, a 3'-5' exoribonuclease. Recessive mutations in rrp6 result in the accumulation of a novel 5. 8 S rRNA processing intermediate, called 5.8 S*, which has normal 5' ends, but retains approximately 30 nucleotides of ITS2. Pulse-chase analysis of 5.8 S rRNA processing in an rrp6- strain revealed a precursor-product relationship between 5.8 S* and 5.8 S rRNAs, suggesting that Rrp6p plays a role in the removal of the last 30 nucleotides of ITS2 from 5.8 S precursors. A portion of 5.8 S* rRNA assembles into 60 S ribosomes which form polyribosomes, suggesting that they function in protein synthesis. These findings indicate that Rrp6p plays a role in 5.8 S rRNA 3' end formation, and they identify a functional intermediate in the rRNA processing pathway.

  14. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

    PubMed Central

    Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

    2009-01-01

    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

  15. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

  16. Giardia duodenalis and Cryptosporidium occurrence in Australian sea lions (Neophoca cinerea) exposed to varied levels of human interaction

    PubMed Central

    Delport, Tiffany C.; Asher, Amy J.; Beaumont, Linda J.; Webster, Koa N.; Harcourt, Robert G.; Power, Michelle L.

    2014-01-01

    Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations. PMID:25426423

  17. Giardia duodenalis and Cryptosporidium occurrence in Australian sea lions (Neophoca cinerea) exposed to varied levels of human interaction.

    PubMed

    Delport, Tiffany C; Asher, Amy J; Beaumont, Linda J; Webster, Koa N; Harcourt, Robert G; Power, Michelle L

    2014-12-01

    Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations.

  18. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    PubMed

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  19. Four new species of Metschnikowia and the transfer of seven Candida species to Metschnikowia and Clavispora as new combinations

    USDA-ARS?s Scientific Manuscript database

    From comparisons of ITS1-5.8S-ITS2 and gene sequences for nuclear D1/D2 LSU rRNA, nuclear SSU (18S) rRNA, translation elongation factor 1-a (EF1-a) and RNA polymerase II subunit 2 (RPB2), the following four new ascosporogenous yeast species were resolved and are described as Metschnikowia anglica (N...

  20. A new genotype of Cryptosporidium from giant panda (Ailuropoda melanoleuca) in China.

    PubMed

    Liu, Xuehan; He, Tingmei; Zhong, Zhijun; Zhang, Hemin; Wang, Rongjun; Dong, Haiju; Wang, Chengdong; Li, Desheng; Deng, Jiabo; Peng, Guangneng; Zhang, Longxian

    2013-10-01

    Fifty-seven fecal samples were collected from giant pandas (Ailuropoda melanoleuca) in the China Conservation and Research Centre for the Giant Panda (CCRCGP) in Sichuan and examined for Cryptosporidium oocysts by Sheather's sugar flotation technique. An 18-year-old male giant panda was Cryptosporidium positive, with oocysts of an average size of 4.60×3.99 μm (n=50). The isolate was genetically analyzed using the partial 18S rRNA, 70 kDa heat shock protein (HSP70), Cryptosporidium oocyst wall protein (COWP) and actin genes. Multi-locus genetic characterization indicated that the present isolate was different from known Cryptosporidium species and genotypes. The closest relative was the Cryptosporidium bear genotype, with 11, 10, and 6 nucleotide differences in the 18S rRNA, HSP70, and actin genes, respectively. Significant differences were also observed in the COWP gene compared to Cryptosporidium mongoose genotype. The homology to the bear genotype at the 18S rRNA locus was 98.6%, which is comparable to that between Cryptosporidium parvum and Cryptosporidium hominis (99.2%), or between Cryptosporidium muris and Cryptosporidium andersoni (99.4%). Therefore, the Cryptosporidium in giant pandas in this study is considered as a new genotype: the Cryptosporidium giant panda genotype. © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria.

    PubMed

    Sasaki, Mizuki; Omobowale, Olutayo; Ohta, Kaisaku; Tozuka, Morito; Matsuu, Aya; Hirata, Haruyuki; Nottidge, Helen Oyebukola; Ikadai, Hiromi; Oyamada, Takashi

    2008-07-01

    The prevalence of Hepatozoon canis infections in dogs in Nigeria was surveyed using molecular methods. DNA was extracted from blood samples obtained from 400 dogs. A primer set that amplified the Babesia canis 18S rRNA gene, which has high similarity to the H. canis 18S rRNA gene, was used for the PCR. As a result, samples from 81 dogs (20.3%) produced 757 bp bands, which differed from the 698 bp band that corresponded to B. canis infection. The sequence of the PCR products of 10 samples were determined, all of which corresponded with the H. canis sequence.

  2. Characterization and Screening of Native Scenedesmus sp. Isolates Suitable for Biofuel Feedstock

    PubMed Central

    Gour, Rakesh Singh; Chawla, Aseem; Singh, Harvinder; Chauhan, Rajinder Singh; Kant, Anil

    2016-01-01

    In current study isolates of two native microalgae species were screened on the basis of growth kinetics and lipid accumulation potential. On the basis of data obtained on growth parameters and lipid accumulation, it is concluded that Scenedesmus dimorphus has better potential as biofuel feedstock. Two of the isolates of Scenedesmus dimorphus performed better than other isolates with respect to important growth parameters with lipid content of ~30% of dry biomass. Scenedesmus dimorphus was found to be more suitable as biodiesel feedstock candidate on the basis of cumulative occurrence of five important biodiesel fatty acids, relative occurrence of SFA (53.04%), MUFA (23.81%) and PUFA (19.69%), and more importantly that of oleic acid in its total lipids. The morphological observations using light and Scanning Electron Microscope and molecular characterization using amplified 18S rRNA gene sequences of microalgae species under study were also performed. Amplified 18S rRNA gene fragments of the microalgae species were sequenced, annotated at the NCBI website and phylogenetic analysis was done. We have published eight 18S rRNA gene sequences of microalgae species in NCBI GenBank. PMID:27195694

  3. Protistan diversity and activity inferred from RNA and DNA at a coastal ocean site in the eastern North Pacific.

    PubMed

    Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A

    2016-04-01

    Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

    PubMed

    Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

    2018-03-01

    Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

  5. RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

    PubMed

    Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

    2013-05-01

    The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  6. Leucobacter salsicius sp. nov., from a salt-fermented food.

    PubMed

    Yun, Ji-Hyun; Roh, Seong Woon; Kim, Min-Soo; Jung, Mi-Ja; Park, Eun-Jin; Shin, Kee-Sun; Nam, Young-Do; Bae, Jin-Woo

    2011-03-01

    Strain M1-8(T) was isolated from jeotgal, a Korean salt-fermented food. Cells were aerobic, non-motile, Gram-reaction-positive and rod-shaped. Colonies were cream-coloured and circular with entire margins. Strain M1-8(T) exhibited optimal growth at 25-30 °C and pH 7.0-8.0 and in 0-4  % (w/v) NaCl. The strain tolerated up to 10.0 mM Cr(VI). Phylogenetic analyses of 16S rRNA gene sequences indicated that strain M1-8(T) represents a novel species in the genus Leucobacter. The 16S rRNA gene sequence of M1-8(T) exhibited 98.1  % similarity to that of Leucobacter chromiireducens subsp. chromiireducens L-1(T). The new isolate was clustered with Leucobacter species on a 16S rRNA gene sequence-based phylogenetic tree. The chromosomal DNA G+C content of strain M1-8(T) was 62.8 %. Its cell-wall peptidoglycan contained 2,4-diaminobutyric acid, glutamic acid, alanine, glycine and γ-aminobutyric acid. The major menaquinone was MK-11 and the predominant fatty acids were anteiso-C₁₅:₀ (63.6 %), anteiso-C₁₇:₀ (16.7 %) and iso-C₁₆:₀ (14.2  %). The polar lipid profile of strain M1-8(T) contained diphosphatidylglycerol and one unknown glycolipid. Significant genotypic and phenotypic differences were found between strain M1-8(T) and other Leucobacter species. These differentiating characteristics indicate that strain M1-8(T) represents a novel species of the genus Leucobacter, for which the name Leucobacter salsicius sp. nov. is proposed. The type strain is M1-8(T) (=KACC 21127(T) =JCM 16362(T)).

  7. Kinetic analysis of pre-ribosome structure in vivo

    PubMed Central

    Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David

    2012-01-01

    Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724

  8. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  9. Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

    PubMed Central

    Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

    2018-01-01

    The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

  10. Genetic characterization of Strongyloides spp. from captive, semi-captive and wild Bornean orangutans (Pongo pygmaeus) in Central and East Kalimantan, Borneo, Indonesia.

    PubMed

    Labes, E M; Nurcahyo, W; Wijayanti, N; Deplazes, P; Mathis, A

    2011-09-01

    Orangutans (Pongo spp.), Asia's only great apes, are threatened in their survival due to habitat loss, hunting and infections. Nematodes of the genus Strongyloides may represent a severe cause of death in wild and captive individuals. In order to better understand which Strongyloides species/subspecies infect orangutans under different conditions, larvae were isolated from fecal material collected in Indonesia from 9 captive, 2 semi-captive and 9 wild individuals, 18 captive groups of Bornean orangutans and from 1 human working with wild orangutans. Genotyping was done at the genomic rDNA locus (part of the 18S rRNA gene and internal transcribed spacer 1, ITS1) by sequencing amplicons. Thirty isolates, including the one from the human, could be identified as S. fuelleborni fuelleborni with 18S rRNA gene identities of 98·5-100%, with a corresponding published sequence. The ITS1 sequences could be determined for 17 of these isolates revealing a huge variability and 2 main clusters without obvious pattern with regard to attributes of the hosts. The ITS1 amplicons of 2 isolates were cloned and sequenced, revealing considerable variability indicative of mixed infections. One isolate from a captive individual was identified as S. stercoralis (18S rRNA) and showed 99% identity (ITS1) with S. stercoralis sequences from geographically distinct locations and host species. The findings are significant with regard to the zoonotic nature of these parasites and might contribute to the conservation of remaining orangutan populations.

  11. Molecular Characterization of a Non–Babesia divergens Organism Causing Zoonotic Babesiosis in Europe

    PubMed Central

    Cacciò, Simone; Gherlinzoni, Filippo; Aspöck, Horst; Slemenda, Susan B.; Piccaluga, PierPaolo; Martinelli, Giovanni; Edelhofer, Renate; Hollenstein, Ursula; Poletti, Giovanni; Pampiglione, Silvio; Löschenberger, Karin; Tura, Sante; Pieniazek, Norman J.

    2003-01-01

    In Europe, most reported human cases of babesiosis have been attributed, without strong molecular evidence, to infection with the bovine parasite Babesia divergens. We investigated the first known human cases of babesiosis in Italy and Austria, which occurred in two asplenic men. The complete 18S ribosomal RNA (18S rRNA) gene was amplified from specimens of their whole blood by polymerase chain reaction (PCR). With phylogenetic analysis, we compared the DNA sequences of the PCR products with those for other Babesia spp. The DNA sequences were identical for the organism from the two patients. In phylogenetic analysis, the organism clusters with B. odocoilei, a parasite of white-tailed deer; these two organisms form a sister group with B. divergens. This evidence indicates the patients were not infected with B. divergens but with an organism with previously unreported molecular characteristics for the 18S rRNA gene. PMID:12967491

  12. Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

    PubMed Central

    Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

    2017-01-01

    Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

  13. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    PubMed

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  14. Molecular characterization of trichomonads from feces of dogs with diarrhea.

    PubMed

    Gookin, Jody L; Birkenheuer, Adam J; St John, Victoria; Spector, Michelle; Levy, Michael G

    2005-08-01

    Trichomonads are occasionally observed in the feces of dogs with diarrhea. On the basis of superficial morphological appearance, these infections have been attributed to opportunistic overgrowth of the commensal, Pentatrichomonas hominis. However, molecular characterization of canine trichomonads has never been reported. This study was performed to determine, by means of rRNA gene sequence analysis, the identity of trichomonads observed in feces from dogs with diarrhea. Total DNA was isolated from fecal samples obtained from a 3-mo-old mixed breed dog and litter of German Shepherd puppies having profuse liquid diarrhea containing numerous trichomonads. Total DNA was subject to PCR amplification of partial 18S rRNA gene or 5.8S, ITS1, ITS2, and partial 18S and 28S rRNA genes using species-specific and universal primers, respectively. Products of 642 and 1864 base-pair length were amplified and cloned. On the basis of rRNA gene sequence, the trichomonads observed in the single dog and the litter of puppies shared 100% identity with Tritrichomonas foetus and P. hominis, respectively. The present study is the first to establish the molecular identity of trichomonads infecting dogs with diarrhea. These studies validate the longstanding assumption that canine trichomoniasis may be attributed to P. hominis. Importantly, these studies additionally recognize that canine trichomoniasis may also be caused by infection with T. foetus.

  15. Selection of reference genes for expression analysis in the entomophthoralean fungus Pandora neoaphidis.

    PubMed

    Chen, Chun; Xie, Tingna; Ye, Sudan; Jensen, Annette Bruun; Eilenberg, Jørgen

    2016-01-01

    The selection of suitable reference genes is crucial for accurate quantification of gene expression and can add to our understanding of host-pathogen interactions. To identify suitable reference genes in Pandora neoaphidis, an obligate aphid pathogenic fungus, the expression of three traditional candidate genes including 18S rRNA(18S), 28S rRNA(28S) and elongation factor 1 alpha-like protein (EF1), were measured by quantitative polymerase chain reaction at different developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae), and under different nutritional conditions. We calculated the expression stability of candidate reference genes using four algorithms including geNorm, NormFinder, BestKeeper and Delta Ct. The analysis results revealed that the comprehensive ranking of candidate reference genes from the most stable to the least stable was 18S (1.189), 28S (1.414) and EF1 (3). The 18S was, therefore, the most suitable reference gene for real-time RT-PCR analysis of gene expression under all conditions. These results will support further studies on gene expression in P. neoaphidis. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  16. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

    PubMed

    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

    2015-01-01

    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  18. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  19. Ruminococcus champanellensis sp. nov., a cellulose-degrading bacterium from human gut microbiota.

    PubMed

    Chassard, Christophe; Delmas, Eve; Robert, Céline; Lawson, Paul A; Bernalier-Donadille, Annick

    2012-01-01

    A strictly anaerobic, cellulolytic strain, designated 18P13(T), was isolated from a human faecal sample. Cells were Gram-positive non-motile cocci. Strain 18P13(T) was able to degrade microcrystalline cellulose but the utilization of soluble sugars was restricted to cellobiose. Acetate and succinate were the major end products of cellulose and cellobiose fermentation. 16S rRNA gene sequence analysis revealed that the isolate belonged to the genus Ruminococcus of the family Ruminococcaceae. The closest phylogenetic relative was the ruminal cellulolytic strain Ruminococcus flavefaciens ATCC 19208(T) (<95% 16S rRNA gene sequence similarity). The DNA G+C content of strain 18P13(T) was 53.05±0.7 mol%. On the basis of phylogenetic analysis, and morphological and physiological data, strain 18P13(T) can be differentiated from other members of the genus Ruminococcus with validly published names. The name Ruminococcus champanellensis sp. nov. is proposed, with 18P13(T) (=DSM 18848(T)=JCM 17042(T)) as the type strain.

  20. Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics.

    PubMed

    Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L

    2018-01-01

    Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  1. Detection and molecular status of Isospora sp. from the domestic pigeon (Columba livia domestica).

    PubMed

    Matsubara, Ryuma; Fukuda, Yasuhiro; Murakoshi, Fumi; Nomura, Osamu; Suzuki, Toru; Tada, Chika; Nakai, Yutaka

    2017-10-01

    The domestic pigeon, Columba livia domestica, is reared for meat production, as a pet, or for racing. Few reports have characterized the parasitic protists from the genus Isospora isolated from Columbiformes. We detected Isospora-like oocysts from C. livia reared for racing. The oocyst contained two sporocysts, and each sporocyst included four sporozoites. The sporulated oocysts (n=4) were spherical; their mean diameters were 25.6 (24.0-27.2)×24.7 (23.4-26.0) μm. Micropyles, polar granules, and oocyst residuum were absent. The mean length and width of the sporocysts (n=8) were 19.5 (18.5-20.5) and 11.2 (10.2-12.1) μm, respectively. Stieda and sub-Stieda bodies were observed. Single-oocyst PCR revealed two different 18S rRNA gene sequences and one 28S rRNA gene sequence in a single oocyst of Isospora sp. Based on a phylogenetic analysis of the 18S rRNA gene, the two sequences made a group which fell within a cluster of known avian Isospora species. A tree based on the 28S rRNA gene sequence indicated that sequences from the pigeon Isospora sp. fell within a cluster of avian Isospora species. Both trees failed to clarify the phylogenetic relationships among the avian Isospora species due to limited resolution. Because the morphological description of Isospora sp. is based on only four oocysts, Isospora sp. is not proposed as a novel species here. This is the first description of Isospora sp. isolated from the domestic pigeon C. livia. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    PubMed

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  3. New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain.

    PubMed

    Criado-Fornelio, A; Rey-Valeiron, C; Buling, A; Barba-Carretero, J C; Jefferies, R; Irwin, P

    2007-03-31

    The prevalence of hematozoan infections (Hepatozoon canis and Babesia sp., particularly Babesia canis vogeli) in canids from Venezuela, Thailand and Spain was studied by amplification and sequencing of the 18S rRNA gene. H. canis infections caused simultaneously by two different isolates were confirmed by RFLP analysis in samples from all the geographic regions studied. In Venezuela, blood samples from 134 dogs were surveyed. Babesia infections were found in 2.24% of the dogs. Comparison of sequences of the 18S rRNA gene indicated that protozoan isolates were genetically identical to B. canis vogeli from Japan and Brazil. H. canis infected 44.77 per cent of the dogs. A representative sample of Venezuelan H. canis isolates (21.6% of PCR-positives) was sequenced. Many of them showed 18S rRNA gene sequences identical to H. canis Spain 2, albeit two less frequent genotypes were found in the sample studied. In Thailand, 20 dogs were analyzed. No infections caused by Babesia were diagnosed, whereas 30 per cent of the dogs were positive to hematozoan infection. Two protozoa isolates showing 99.7-100% identity to H. canis Spain 2 were found. In Spain, 250 dogs were studied. B. canis vogeli infected 0.01% of the animals. The sequence of the 18S rRNA gene in Spanish isolates of this protozoa was closely related to those previously deposited in GenBank (> 99% identity). Finally, 20 red foxes were screened for hematozoans employing semi-nested PCR and primers designed to detect Babesia/Theileria. Fifty percent of the foxes were positive to Theileria annae. In addition, it was found that the PCR assay was able as well to detect Hepatozoon infections. Thirty five percent of the foxes were infected with two different H. canis isolates showing 99.8-100% identity to Curupira 1 from Brazil.

  4. Effects of Histone Deacetylase Inhibitor (HDACi); Trichostatin-A (TSA) on the expression of housekeeping genes.

    PubMed

    Mogal, Ashish; Abdulkadir, Sarki A

    2006-04-01

    In quantitative RT-PCR (qRT-PCR), analysis of gene expression is dependent on normalization using housekeeping genes such as 18S rRNA, GAPDH and beta actin. However, variability in their expression has been reported to be caused by factors like drug treatment, pathological states and cell-cycle phase. An emerging area of cancer research focuses on identifying the role of epigenetic alterations such as histone modifications and DNA methylation in the initiation and progression of cancer. Histone acetylation is the best studied modification so far and has been probed through the use of histone deacetylase inhibitors (HDACi). Further, modulation of histone acetylation is currently being explored as a therapeutic strategy in the treatment of cancer and HDACis have shown promise in inhibiting tumorigenesis and metastasis. Trichostatin-A (TSA) is the most widely used HDACi. Therefore, we were driven to identify a suitable internal control for RT-PCR following TSA treatment. We performed quantitative RT-PCR analysis using mouse prostate tissue explants, human prostate cancer (LNCaP) cells and human breast cancer (T-47D and ZR-75-1) cells following TSA treatment. Expression of housekeeping genes including 18S rRNA, beta actin, GAPDH and ribosomal highly-basic 23-kDa protein (rb 23-kDa, RPL13A) were compared in vehicle versus TSA treated samples. Our results showed marked variations in 18S rRNA, beta actin mRNA and GAPDH mRNA levels in mouse prostate explants and a human prostate cancer (LNCaP) cell line following TSA treatment. Furthermore, in two human breast cancer cell lines (T-47D and ZR-75-1) 18S rRNA, beta actin mRNA and GAPDH mRNA levels varied significantly. However, RPL13A mRNA levels remained constant in all the conditions tested. Therefore, we recommend use of RPL13A as a standard for normalization during TSA treatment.

  5. Genotypic variations in field isolates of Theileria species infecting giraffes (Giraffa camelopardalis tippelskirchi and Giraffa camelopardalis reticulata) in Kenya.

    PubMed

    Githaka, Naftaly; Konnai, Satoru; Skilton, Robert; Kariuki, Edward; Kanduma, Esther; Murata, Shiro; Ohashi, Kazuhiko

    2013-10-01

    Recently, mortalities among giraffes, attributed to infection with unique species of piroplasms were reported in South Africa. Although haemoparasites are known to occur in giraffes of Kenya, the prevalence, genetic diversity and pathogenicity of these parasites have not been investigated. In this study, blood samples from 13 giraffes in Kenya were investigated microscopically and genomic DNA extracted. PCR amplicons of the hyper-variable region 4 (V4) of Theileria spp. small subunit ribosomal RNA (18S rRNA) gene were hybridized to a panel of genus- and species-specific oligonucleotide probes by reverse line blot (RLB). Two newly designed oligonucleotide probes specific for previously identified Theileria spp. of giraffes found single infections in eight of the specimens and mixed infections in the remaining five samples. Partial 18S rRNA genes were successfully amplified from 9 samples and the PCR amplicons were cloned. A total of 28 plasmid clones representing the Kenyan isolates were analyzed in the present study and compared with those of closely-related organisms retrieved from GenBank. In agreement with RLB results, the nucleotide sequence alignment indicated the presence of mixed infections in the giraffes. In addition, sequence alignment with the obtained 18S rRNA gene sequences revealed extensive microheterogeneities within and between isolates, characterized by indels in the V4 regions and point mutations outside this region. Phylogeny with 18S rRNA gene sequences from the detected parasites and those of related organisms places Theileria of giraffes into two major groups, within which are numerous clades that include the isolates reported in South Africa. Collectively, these data suggest the existence of at least two distinct Theileria species among giraffes, and extensive genetic diversity within the two parasite groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    PubMed Central

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  7. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

  8. Psychromicrobium silvestre gen. nov., sp. nov., an actinobacterium isolated from alpine forest soils.

    PubMed

    Schumann, Peter; Zhang, De-Chao; França, Luís; Albuquerque, Luciana; da Costa, Milton S; Margesin, Rosa

    2017-03-01

    Two Gram-stain-variable, non-motile, catalase-positive and cytochrome c oxidase-negative bacteria, designated AK20-18 T and AM20-54, were isolated from forest soil samples collected in the Italian Alps. Growth occurred at a temperature range of 5-30 °C, at pH 6-9 and in the presence of 0-5 % (w/v) NaCl. The 16S rRNA gene sequence similarity between strains AK20-18 T and AM20-54 was 100 %. Phylogenetic analysis based on 16S rRNA gene sequence showed that strain AK20-18 T had highest 16S rRNA gene sequence similarity with the type strain of Arthrobacter psychrochitiniphilus (96.9 %). The cell-wall peptidoglycan structure of strain AK20-18 T was of the type A3alpha l-Lys-l-Thr-l-Ala2 (A11.27). The whole-cell sugars were galactose, ribose and lesser amounts of mannose. The major respiratory quinone of the two strains was menaquinone 9(H2) [MK-9(H2)], whereas MK-10(H2) was a minor component. The polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and unknown glycolipids. The major cellular fatty acids were anteiso-C15 : 0, iso-C15 : 0, iso-C16 : 0 and anteiso-C17 : 0. The genomic DNA G+C content was 59.9 mol%. Combined data of phylogenetic, phenotypic and chemotaxonomic analyses demonstrated that strains AK20-18 T and AM20-54 represent a novel genus and species, for which the name Psychromicrobium silvestre gen. nov., sp. nov. is proposed. The type strain of Psychromicrobium silvestregen. nov., sp. nov. is AK20-18 T (=DSM 102047 T =LMG 29369 T ).

  9. Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

    PubMed

    Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

    2005-06-01

    We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

  10. Phylogeny of Kinorhyncha Based on Morphology and Two Molecular Loci

    PubMed Central

    Sørensen, Martin V.; Dal Zotto, Matteo; Rho, Hyun Soo; Herranz, Maria; Sánchez, Nuria; Pardos, Fernando; Yamasaki, Hiroshi

    2015-01-01

    The phylogeny of Kinorhyncha was analyzed using morphology and the molecular loci 18S rRNA and 28S rRNA. The different datasets were analyzed separately and in combination, using maximum likelihood and Bayesian Inference. Bayesian inference of molecular sequence data in combination with morphology supported the division of Kinorhyncha into two major clades: Cyclorhagida comb. nov. and Allomalorhagida nom. nov. The latter clade represents a new kinorhynch class, and accommodates Dracoderes, Franciscideres, a yet undescribed genus which is closely related with Franciscideres, and the traditional homalorhagid genera. Homalorhagid monophyly was not supported by any analyses with molecular sequence data included. Analysis of the combined molecular and morphological data furthermore supported a cyclorhagid clade which included all traditional cyclorhagid taxa, except Dracoderes that no longer should be considered a cyclorhagid genus. Accordingly, Cyclorhagida is divided into three main lineages: Echinoderidae, Campyloderidae, and a large clade, ‘Kentrorhagata’, which except for species of Campyloderes, includes all species with a midterminal spine present in adult individuals. Maximum likelihood analysis of the combined datasets produced a rather unresolved tree that was not regarded in the following discussion. Results of the analyses with only molecular sequence data included were incongruent at different points. However, common for all analyses was the support of several major clades, i.e., Campyloderidae, Kentrorhagata, Echinoderidae, Dracoderidae, Pycnophyidae, and a clade with Paracentrophyes + New Genus and Franciscideres (in those analyses where the latter was included). All molecular analyses including 18S rRNA sequence data furthermore supported monophyly of Allomalorhagida. Cyclorhagid monophyly was only supported in analyses of combined 18S rRNA and 28S rRNA (both ML and BI), and only in a restricted dataset where taxa with incomplete information from 28S rRNA had been omitted. Analysis of the morphological data produced results that were similar with those from the combined molecular and morphological analysis. E.g., the morphological data also supported exclusion of Dracoderes from Cyclorhagida. The main differences between the morphological analysis and analyses based on the combined datasets include: 1) Homalorhagida appears as monophyletic in the morphological tree only, 2) the morphological analyses position Franciscideres and the new genus within Cyclorhagida near Zelinkaderidae and Cateriidae, whereas analyses including molecular data place the two genera inside Allomalorhagida, and 3) species of Campyloderes appear in a basal trichotomy within Kentrorhagata in the morphological tree, whereas analysis of the combined datasets places species of Campyloderes as a sister clade to Echinoderidae and Kentrorhagata. PMID:26200115

  11. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters.

    PubMed

    Subbotin, Sergei A; Ragsdale, Erik J; Mullens, Teresa; Roberts, Philip A; Mundo-Ocampo, Manuel; Baldwin, James G

    2008-08-01

    The root lesion nematodes of the genus Pratylenchus Filipjev, 1936 are migratory endoparasites of plant roots, considered among the most widespread and important nematode parasites in a variety of crops. We obtained gene sequences from the D2 and D3 expansion segments of 28S rRNA partial and 18S rRNA from 31 populations belonging to 11 valid and two unidentified species of root lesion nematodes and five outgroup taxa. These datasets were analyzed using maximum parsimony and Bayesian inference. The alignments were generated using the secondary structure models for these molecules and analyzed with Bayesian inference under the standard models and the complex model, considering helices under the doublet model and loops and bulges under the general time reversible model. The phylogenetic informativeness of morphological characters is tested by reconstruction of their histories on rRNA based trees using parallel parsimony and Bayesian approaches. Phylogenetic and sequence analyses of the 28S D2-D3 dataset with 145 accessions for 28 species and 18S dataset with 68 accessions for 15 species confirmed among large numbers of geographical diverse isolates that most classical morphospecies are monophyletic. Phylogenetic analyses revealed at least six distinct major clades of examined Pratylenchus species and these clades are generally congruent with those defined by characters derived from lip patterns, numbers of lip annules, and spermatheca shape. Morphological results suggest the need for sophisticated character discovery and analysis for morphology based phylogenetics in nematodes.

  12. Molecular detection of feline hemoplasmas in feral cats in Korea.

    PubMed

    Yu, Do-Hyeon; Kim, Hyun-Wook; Desai, Atul R; Han, In-Ae; Li, Ying-Hua; Lee, Mi-Jin; Kim, In-Shik; Chae, Joon-Seok; Park, Jinho

    2007-12-01

    The purpose of this study was to determine if Mycoplasma haemofelis, 'Candidatus Mycoplasma haemominutum' exist in Korea. Three hundreds and thirty one feral cats were evaluated by using PCR assay targeting 16S rRNA gene sequence. Fourteen cats (4.2%) were positive for M. haemofelis, 34 cats (10.3%) were positive for 'Candidatus M. haemominutum' and 18 cats (5.4%) were positive for both species. Partial 16S rRNA gene sequences were closely (>98%) related to those from other countries. This is the first molecular detection of feline hemoplasmas in Korea.

  13. [Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

    PubMed

    Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

    2014-03-01

    In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

  14. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    PubMed

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. Culturing Heterotrophic Protists from the Baltic Sea: Mostly the "Usual Suspects" but a Few Novelties as Well.

    PubMed

    Weber, Felix; Mylnikov, Alexander P; Jürgens, Klaus; Wylezich, Claudia

    2017-03-01

    The study of cultured strains has a long tradition in protistological research and has greatly contributed to establishing the morphology, taxonomy, and ecology of many protist species. However, cultivation-independent techniques, based on 18S rRNA gene sequences, have demonstrated that natural protistan assemblages mainly consist of hitherto uncultured protist lineages. This mismatch impedes the linkage of environmental diversity data with the biological features of cultured strains. Thus, novel taxa need to be obtained in culture to close this knowledge gap. In this study, traditional cultivation techniques were applied to samples from coastal surface waters and from deep oxygen-depleted waters of the Baltic Sea. Based on 18S rRNA gene sequencing, 126 monoclonal cultures of heterotrophic protists were identified. The majority of the isolated strains were affiliated with already cultured and described taxa, mainly chrysophytes and bodonids. This was likely due to "culturing bias" but also to the eutrophic nature of the Baltic Sea. Nonetheless, ~ 12% of the isolates in our culture collection showed highly divergent 18S rRNA gene sequences compared to those of known organisms and thus may represent novel taxa, either at the species level or at the genus level. Moreover, we also obtained evidence that some of the isolated taxa are ecologically relevant, under certain conditions, in the Baltic Sea. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  16. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'

    PubMed Central

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum (‘Ca. P. prunorum’) detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor ‘Ca. P. prunorum’ infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect ‘Ca. P. prunorum’ and Plum pox virus (PPV) in Prunus. PMID:26742106

  17. A new version of the RDP (Ribosomal Database Project)

    NASA Technical Reports Server (NTRS)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  18. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    PubMed Central

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (−8, −6, −4, −2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens. PMID:25585250

  19. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

    PubMed

    Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

    2014-01-01

    Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

  1. Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

    PubMed

    Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

    2017-10-06

    Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

  2. Microbial Diversity and Biochemical Analysis of Suanzhou: A Traditional Chinese Fermented Cereal Gruel

    PubMed Central

    Qin, Huibin; Sun, Qinghui; Pan, Xuewei; Qiao, Zhijun; Yang, Hongjiang

    2016-01-01

    Suanzhou as a traditional Chinese gruel is fermented from proso millet and millet. The biochemical analysis showed Suanzhou had relatively high concentrations of lactic acid, acetic acid, and free amino acids. The metagenomics of Suanzhou were studied, with the analysis of the V4 region of 16S rRNA gene, the genera Lactobacillus and Acetobacter were found dominant with the average abundance of 58.2 and 24.4%, respectively; and with the analysis of the ITS1 region between 18S and 5.8S rRNA genes, 97.3% of the fungal community was found belonging to the genus Pichia and 2.7% belonging to five other genera. Moreover, the isolates recovered from 59 Suanzhou samples with various media were identified with the 16S rRNA or 18S rRNA gene analyses. Lactobacillus fermentum (26.9%), L. pentosus (19.4%), L. casei (17.9%), and L. brevis (16.4%) were the four dominant Lactobacillus species; Acetobacter lovaniensis (38.1%), A. syzygii (16.7%), A. okinawensis (16.7%), and A. indonesiensis (11.9%) were the four dominant Acetobacter species; and Pichia kudriavzevii (55.8%) and Galactomyces geotrichum (23.1%) were the two dominant fungal species. Additionally, L. pentosus p28-c and L. casei h28-c1 were selected for the fermentations mimicking the natural process. Collectively, our data demonstrate that Suanzhou is a nutritional food high in free amino acids and organic acids. Diverse Lactobacillus, Acetobacter, and yeast species are identified as the dominant microorganisms in Suanzhou. The isolated strains can be further characterized and used as starters for the industrial production of Suanzhou safely. PMID:27610102

  3. Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

    PubMed Central

    Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

    2016-01-01

    Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

  4. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639

  5. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  6. Molecular phylogeny of Babesia poelea from brown boobies (Sula leucogaster) from Johnston Atoll, Central Pacific

    USGS Publications Warehouse

    Yabsley, Michael J.; Work, Thierry M.; Rameyer, Robert A.

    2006-01-01

    The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial ß-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial ß-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the ß-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.

  7. Molecular phylogeny of Babesia poelea from brown boobies (Sula leucogaster) from Johnston Atoll, central Pacific.

    PubMed

    Yabsley, Michael J; Work, Thierry M; Rameyer, Robert A

    2006-04-01

    The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial beta-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial beta-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the beta-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.

  8. Oscheius onirici sp. n. (Nematoda: Rhabditidae): a new entomopathogenic nematode from an Italian cave.

    PubMed

    Torrini, Giulia; Mazza, Giuseppe; Carletti, Beatrice; Benvenuti, Claudia; Roversi, Pio Federico; Fanelli, Elena; De Luca, Francesca; Troccoli, Alberto; Tarasco, Eustachio

    2015-03-26

    Oscheius onirici sp. n. (Nematoda: Rhabditidae) was isolated from a karst cave soil of Central Italy. Molecular and morphological analyses were performed. Total DNA was extracted from individual nematodes and the mitochondrial COI, the ITS containing region, the D2-D3 expansion domains of the 28S rRNA gene and the 18S rRNA gene were amplified and sequenced. BLAST search at NCBI by using all molecular markers revealed that this taxon is similar to Oscheius species. Phylogenetic trees of ITS, 28S and 18S rDNA revealed that O. onirici sp. n. belongs to Dolichura-group. Oscheius onirici sp. n. is characterized by small body size and stoma rhabditoid type. Female reproductive system is amphidelphic. Males are rare with peloderan bursa, spicules slender and small, nine pairs of papillae of different lengths, arranged in a 1+1+1/3+3 pattern. Entomopathogenicity bioassay revealed that this nematode is capable of infecting larvae of Galleria mellonella and Tenebrio molitor.

  9. Diversity in the 18S SSU rRNA V4 hyper-variable region of Theileria spp. in Cape buffalo (Syncerus caffer) and cattle from southern Africa.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Latif, Abdalla A; Potgieter, Fred T

    2011-05-01

    Sequence variation within the 18S SSU rRNA V4 hyper-variable region can affect the accuracy of real-time hybridization probe-based diagnostics for the detection of Theileria spp. infections. This is relevant for assays that use non-specific primers, such as the real-time hybridization assay for T. parva (Sibeko et al. 2008). To assess the effect of sequence variation on this test, the Theileria 18S gene from 62 buffalo and 49 cattle samples was cloned and ∼1000 clones sequenced. Twenty-six genotypes were detected which included known and novel genotypes for the T. buffeli, T. mutans, T. taurotragi and T. velifera clades. A novel genotype related to T. sp. (sable) was also detected in 1 bovine sample. Theileria genotypic diversity was higher in buffalo compared to cattle. Polymorphism within the T. parva hyper-variable region was confirmed by aberrant real-time melting peaks and supported by sequencing of the S5 ribosomal gene. Analysis of the S5 gene suggests that this gene can be a marker for species differentiation. T. parva, T. sp. (buffalo) and T. sp. (bougasvlei) remain the only genotypes amplified by the primer set of the hybridization assay. Therefore, the 18S sequence diversity observed does not seem to affect the current real-time hybridization assay for T. parva.

  10. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    PubMed

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  11. Redescription and molecular phylogeny of the type species for two main metopid genera, Metopus es (Müller, 1776) Lauterborn, 1916 and Brachonella contorta (Levander, 1894) Jankowski, 1964 (Metopida, Ciliophora), based on broad geographic sampling.

    PubMed

    Bourland, William; Rotterova, Johana; Čepička, Ivan

    2017-06-01

    Metopid ciliates occupy terrestrial, freshwater, and marine habitats worldwide, playing important roles as predominant consumers of bacteria, flagellates, algae, and diatoms in hypoxic environments. Metopus and Brachonella are the most species-rich metopid genera, however most of their species have not been studied by modern methods Here, we report the morphologic, morphometric and molecular characterization, and phylogeny of Metopus es and Brachonella contorta, both types of their respective genera, collected in a broad global sampling effort. Five strains of M. es and three strains of B. contorta were studied in detail, providing the first correlation of morphology, morphometrics, and 18S rRNA gene sequencing for both. We submitted 29 new 18S rRNA gene sequences to GenBank. Phylogenetic analyses yielded trees of similar topology. A strongly supported Metopus es clade is sister to the Brachonella contorta clade. Our analysis shows genus Metopus is not monophyletic. The monophyly of Brachonella cannot yet be determined due to lack of sequences for other species of this genus in molecular databases. Both species appear to have a global distribution. Metopus es was not found in Africa, probably reflecting low sampling effort. Strains of both species showed low 18S rRNA gene sequence divergence despite wide geographic separation. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

    PubMed

    Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

    2008-06-01

    Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

  13. Genetic diversity of Trichomonas vaginalis clinical isolates from Henan province in central China.

    PubMed

    Mao, Meng; Liu, Hui Li

    2015-07-01

    Trichomonas vaginalis is a flagellated protozoan parasite that infects the human urogenital tract, causing the most common non-viral, sexually transmitted disease worldwide. In this study, genetic variants of T. vaginalis were identified in Henan Province, China. Fragments of the small subunit of nuclear ribosomal RNA (18S rRNA) were amplified from 32 T. vaginalis isolates obtained from seven regions of Henan Province. Overall, 18 haplotypes were determined from the 18S rRNA sequences. Each sampled population and the total population displayed high haplotype diversity (Hd), accompanied by very low nucleotide diversity (Pi). In these molecular genetic variants, 91.58% genetic variation was derived from intra-regions. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. Demographic analysis supported population expansion of T. vaginalis isolates from central China. Our findings showing moderate-to-high genetic variations in the 32 isolates of T. vaginalis provide useful knowledge for monitoring changes in parasite populations for the development of future control strategies.

  14. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    NASA Astrophysics Data System (ADS)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

    2015-07-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  15. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.

  16. [Isolation and identification of cow-origin Cryptosporidium isolates in Hefei].

    PubMed

    Sun, Tao; Liu, Wei; Wang, Ju-Hua; Xue, Xiu-Heng; Zhao, Chang-Cheng; Li, Pei-Ying

    2011-12-01

    To isolate cow-origin Cryptosporidium in Hefei, and identify its species. 285 dairy cattle fecal samples collected from a farm in Hefei were examined by using floating saturated solution of sucrose and modified acid-fast staining. Cryptosporidium oocysts were isolated and purified from positive fecal samples. Genetic DNA was extracted to be the template. According to the sequence of 18S rRNA gene and HSP70 gene from Cryptosporidium sp., the primers were designed and synthesized. The PCR products were amplified by PCR and nested-PCR. The nested PCR products were cloned and sequenced. Homology searches and phylogenic tree construction were done by DNAStar software. Five fecal samples were positive by morphological methods with an infection rate of 1.8% (5/285). Oocysts from the 5 positive fecal samples were elliptical or ovoid detected by using floating saturated solution of sucrose and modified acid-fast staining with the size of 7.37 microm x 6.13 microm and 7.58 microm x 6.20 microm, and a shape index of 1.20 and 1.22, respectively. Nested-PCR resulted in a 18S rRNA and HSP70 gene fragments with approximately 250 bp and 325 bp, respectively. The five isolates showed a high level of nucleic acid identity with sequence data of the 18S rRNA gene of Cryptosporidium andersoni (DQ989573), and they were clustered in the same clade. The highest HSP70 gene sequence identity was found among the five isolates and other reported C. andersoni isolates (AY954892 and DQ989576), and they were placed into the same clade. The cow-origin Cryptosporidium isolates derived from Hefei is Cryptosporidium andersoni.

  17. Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

    PubMed

    Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

    2017-03-01

    Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

  18. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    PubMed

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

  19. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    PubMed Central

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

  20. Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana▿

    PubMed Central

    Lange, Heike; Holec, Sarah; Cognat, Valérie; Pieuchot, Laurent; Le Ret, Monique; Canaday, Jean; Gagliardi, Dominique

    2008-01-01

    Yeast Rrp6p and its human counterpart, PM/Scl100, are exosome-associated proteins involved in the degradation of aberrant transcripts and processing of precursors to stable RNAs, such as the 5.8S rRNA, snRNAs, and snoRNAs. The activity of yeast Rrp6p is stimulated by the polyadenylation of its RNA substrates. We identified three RRP6-like proteins in Arabidopsis thaliana: AtRRP6L3 is restricted to the cytoplasm, whereas AtRRP6L1 and -2 have different intranuclear localizations. Both nuclear RRP6L proteins are functional, since AtRRP6L1 complements the temperature-sensitive phenotype of a yeast rrp6Δ strain and mutation of AtRRP6L2 leads to accumulation of an rRNA maturation by-product. This by-product corresponds to the excised 5′ part of the 18S-5.8S-25S rRNA precursor and accumulates as a polyadenylated transcript, suggesting that RRP6L2 is involved in poly(A)-mediated RNA degradation in plant nuclei. Interestingly, the rRNA maturation by-product is a substrate of AtRRP6L2 but not of AtRRP6L1. This result and the distinctive subcellular distribution of AtRRP6L1 to -3 indicate a specialization of RRP6-like proteins in Arabidopsis. PMID:18285452

  1. First molecular characterization of canine hepatozoonosis in Argentina: evaluation of asymptomatic Hepatozoon canis infection in dogs from Buenos Aires.

    PubMed

    Eiras, Diego Fernando; Basabe, Julia; Scodellaro, Carla F; Banach, Diana B; Matos, María L; Krimer, Alejandro; Baneth, Gad

    2007-11-10

    Canine hepatozoonosis is an expanding tick-borne disease in Argentina. Hepatozoonosis was studied during 1 year in six dogs from the same household in Buenos Aires. Blood parasitemia with Hepatozoon gamonts was found in five dogs and all six were positive by PCR for Hepatozoon sp. Although the levels of parasitemia fluctuated during the year, no clinical signs of disease were detected during the follow up period. Amplification and sequencing of a 650 bases fragment of the 18S rRNA gene from all six dogs yielded fragments that were 99% identical to H. canis. The results of the partial 18S rRNA genotyping with the sub-clinical course of infection and lack of severe hematological abnormalities are compatible with clinical and molecular descriptions of Hepatozoon canis infection from other areas of the world. This is the first molecular characterization of Hepatozoon from Argentina.

  2. Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil.

    PubMed

    Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura

    2011-01-01

    The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co‑infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

  3. [Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

    PubMed

    Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

    2015-02-01

    To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

  4. DIVERSITY OF THE TYPE 1 INTRON-ITS REGION OF THE 18S rRNA GENE IN PSEUDOGYMNOASCUS SPECIES FROM THE RED HILLS OF KANSAS.

    PubMed

    Chen, Xi; Crupper, Scott S

    2016-09-01

    Gypsum caves found throughout the Red Hills of Kansas have the state's most diverse and largest population of cave-roosting bats. White-nose syndrome (WNS), a disease caused by the fungus Pseudogymnoascus destructans, which threatens all temperate bat species, has not been previously detected in the gypsum caves as this disease moves westward from the eastern United States. Cave soil was obtained from the gypsum caves, and using the polymerase chain reaction, a 624-nucleotide DNA fragment specific to the Type 1 intron-internal transcribed spacer region of the 18S rRNA gene from Pseudogymnoascus species was amplified. Subsequent cloning and DNA sequencing indicated P. destructans DNA was present, along with 26 uncharacterized Pseudogymnoascus DNA variants. However, no evidence of WNS was observed in bat populations residing in these caves.

  5. Molecular Organization of the 25S–18S rDNA IGS of Fagus sylvatica and Quercus suber: A Comparative Analysis

    PubMed Central

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5′-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5′-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5′-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  6. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    PubMed Central

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  7. Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

    PubMed

    Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

    2017-07-01

    In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

  8. Field evaluation of the photo-induced electron transfer fluorogenic primers (PET) real-time PCR for the detection of Plasmodium falciparum in Tanzania.

    PubMed

    Talundzic, Eldin; Maganga, Mussa; Masanja, Irene M; Peterson, David S; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2014-01-27

    Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country's diagnostic laboratory; and, (ii) determine the assay's sensitivity and specificity compared to a nested 18S rRNA PCR. Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings.

  9. Field evaluation of the photo-induced electron transfer fluorogenic primers (PET) real-time PCR for the detection of Plasmodium falciparum in Tanzania

    PubMed Central

    2014-01-01

    Background Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country’s diagnostic laboratory; and, (ii) determine the assay’s sensitivity and specificity compared to a nested 18S rRNA PCR. Methods Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Results Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. Conclusion The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings. PMID:24467985

  10. National Hydropower Plant Dataset, Version 1 (Update FY18Q2)

    DOE Data Explorer

    Samu, Nicole; Kao, Shih-Chieh; O'Connor, Patrick; Johnson, Megan; Uria-Martinez, Rocio; McManamay, Ryan

    2016-09-30

    The National Hydropower Plant Dataset, Version 1, Update FY18Q2, includes geospatial point-level locations and key characteristics of existing hydropower plants in the United States that are currently online. These data are a subset extracted from NHAAP’s Existing Hydropower Assets (EHA) dataset, which is a cornerstone of NHAAP’s EHA effort that has supported multiple U.S. hydropower R&D research initiatives related to market acceleration, environmental impact reduction, technology-to-market activities, and climate change impact assessment.

  11. Host-associated bacterial taxa from Chlorobi, Chloroflexi, GN02, Synergistetes, SR1, TM7, and WPS-2 Phyla/candidate divisions

    PubMed Central

    Camanocha, Anuj; Dewhirst, Floyd E.

    2014-01-01

    Background and objective In addition to the well-known phyla Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Spirochaetes, Fusobacteria, Tenericutes, and Chylamydiae, the oral microbiomes of mammals contain species from the lesser-known phyla or candidate divisions, including Synergistetes, TM7, Chlorobi, Chloroflexi, GN02, SR1, and WPS-2. The objectives of this study were to create phyla-selective 16S rDNA PCR primer pairs, create selective 16S rDNA clone libraries, identify novel oral taxa, and update canine and human oral microbiome databases. Design 16S rRNA gene sequences for members of the lesser-known phyla were downloaded from GenBank and Greengenes databases and aligned with sequences in our RNA databases. Primers with potential phylum level selectivity were designed heuristically with the goal of producing nearly full-length 16S rDNA amplicons. The specificity of primer pairs was examined by making clone libraries from PCR amplicons and determining phyla identity by BLASTN analysis. Results Phylum-selective primer pairs were identified that allowed construction of clone libraries with 96–100% specificity for each of the lesser-known phyla. From these clone libraries, seven human and two canine novel oral taxa were identified and added to their respective taxonomic databases. For each phylum, genome sequences closest to human oral taxa were identified and added to the Human Oral Microbiome Database to facilitate metagenomic, transcriptomic, and proteomic studies that involve tiling sequences to the most closely related taxon. While examining ribosomal operons in lesser-known phyla from single-cell genomes and metagenomes, we identified a novel rRNA operon order (23S-5S-16S) in three SR1 genomes and the splitting of the 23S rRNA gene by an I-CeuI-like homing endonuclease in a WPS-2 genome. Conclusions This study developed useful primer pairs for making phylum-selective 16S rRNA clone libraries. Phylum-specific libraries were shown to be useful for identifying previously unrecognized taxa in lesser-known phyla and would be useful for future environmental and host-associated studies. PMID:25317252

  12. Applied Genomics: Data Mining Reveals Species-Specific Malaria Diagnostic Targets More Sensitive than 18S rRNA▿†‡

    PubMed Central

    Demas, Allison; Oberstaller, Jenna; DeBarry, Jeremy; Lucchi, Naomi W.; Srinivasamoorthy, Ganesh; Sumari, Deborah; Kabanywanyi, Abdunoor M.; Villegas, Leopoldo; Escalante, Ananias A.; Kachur, S. Patrick; Barnwell, John W.; Peterson, David S.; Udhayakumar, Venkatachalam; Kissinger, Jessica C.

    2011-01-01

    Accurate and rapid diagnosis of malaria infections is crucial for implementing species-appropriate treatment and saving lives. Molecular diagnostic tools are the most accurate and sensitive method of detecting Plasmodium, differentiating between Plasmodium species, and detecting subclinical infections. Despite available whole-genome sequence data for Plasmodium falciparum and P. vivax, the majority of PCR-based methods still rely on the 18S rRNA gene targets. Historically, this gene has served as the best target for diagnostic assays. However, it is limited in its ability to detect mixed infections in multiplex assay platforms without the use of nested PCR. New diagnostic targets are needed. Ideal targets will be species specific, highly sensitive, and amenable to both single-step and multiplex PCRs. We have mined the genomes of P. falciparum and P. vivax to identify species-specific, repetitive sequences that serve as new PCR targets for the detection of malaria. We show that these targets (Pvr47 and Pfr364) exist in 14 to 41 copies and are more sensitive than 18S rRNA when utilized in a single-step PCR. Parasites are routinely detected at levels of 1 to 10 parasites/μl. The reaction can be multiplexed to detect both species in a single reaction. We have examined 7 P. falciparum strains and 91 P. falciparum clinical isolates from Tanzania and 10 P. vivax strains and 96 P. vivax clinical isolates from Venezuela, and we have verified a sensitivity and specificity of ∼100% for both targets compared with a nested 18S rRNA approach. We show that bioinformatics approaches can be successfully applied to identify novel diagnostic targets and improve molecular methods for pathogen detection. These novel targets provide a powerful alternative molecular diagnostic method for the detection of P. falciparum and P. vivax in conventional or multiplex PCR platforms. PMID:21525225

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients

    PubMed Central

    da Silva, Marcos Vinicius; Criado, Paulo Ricardo; Luiz, Olinda do Carmo; Vicentini, Adriana Pardini

    2018-01-01

    Background Although early and rapid detection of histoplasmosis is essential to prevent morbidity and mortality, few diagnostic tools are available in resource-limited areas, especially where it is endemic and HIV/AIDS is also epidemic. Thus, we compared conventional and molecular methods to detect Histoplasma capsulatum in sera and blood from HIV/AIDS patients. Methodology We collected a total of 40 samples from control volunteers and patients suspected of histoplasmosis, some of whom were also infected with other pathogens. Samples were then analyzed by mycological, serological, and molecular methods, and stratified as histoplasmostic with (group I) or without AIDS (group II), uninfected (group III), and infected with HIV and other pathogens only (group IV). All patients were receiving treatment for histoplasmosis and other infections at the time of sample collection. Results Comparison of conventional methods with nested PCR using primers against H. capsulatum 18S rRNA (HC18S), 5.8S rRNA ITS (HC5.8S-ITS), and a 100 kDa protein (HC100) revealed that sensitivity against sera was highest for PCR with HC5.8S-ITS, followed by immunoblotting, double immunodiffusion, PCR with HC18S, and PCR with HC100. Specificity was equally high for double immunodiffusion, immunoblotting and PCR with HC100, followed for PCR with HC18S and HC5.8-ITS. Against blood, sensitivity was highest for PCR with HC5.8S-ITS, followed by PCR with HC18S, Giemsa staining, and PCR with HC100. Specificity was highest for Giemsa staining and PCR with HC100, followed by PCR with HC18S and HC5.8S-ITS. PCR was less efficient in patients with immunodeficiency due to HIV/AIDS and/or related diseases. Conclusion Molecular techniques may detect histoplasmosis even in cases with negative serology and mycology, potentially enabling early diagnosis. PMID:29342162

  15. Methane production and methanogen levels in steers that differ in residual gain.

    PubMed

    Freetly, H C; Lindholm-Perry, A K; Hales, K E; Brown-Brandl, T M; Kim, M; Myer, P R; Wells, J E

    2015-05-01

    Methane (CH4) gas released by cattle isa product of fermentation in the digestive tract. The 2 primary sites of CH4 production in ruminants are the reticulum-rumen complex and the cecum. Methane release from cattle represents a 2% to 12% loss of the energy intake. Reducing the proportion of feed energy lost as CH4 has the potential of improving feed efficiency as well as decreasing the contribution of cattle to greenhouse gas production. Feed intake and growth were measured on 132 fall-born steers for 70 d. Seven steers with extreme positive residual gain (RG) and 7 steers with extreme negative RG whose DMI was within 0.32 SD of the mean intake were selected for subsequent measurements. Enteric CH4 production was measured via indirect calorimetry. Rumen, cecum, and rectal contents were obtained from steers at slaughter for measurement of in vitro CH4 production and methanogen 16S rRNA levels. Enteric CH4 production did not differ (P = 0.11) between the positive RG (112 ± 13 L/d)and the negative RG (74 ± 13 L/d) steers. In vitro rumen methane production did not differ between positive RG(64.26 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (61.49 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1)DM∙min(-1); P = 0.86). In vitro cecum methane production did not differ between positive RG (4.24 ×10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (4.35 × 10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1); P = 0.97). Methanogen 16S rRNA as a percentage of the total bacteria16S rRNA did not differ between RG groups (P = 0.18). The methanogen 16S rRNA as a percentage of rumen fluid total bacteria 16S rRNA (5.3% ±3.1%) did not differ from the methanogen 16S rRNA asa percentage of cecum content total bacteria 16S rRNA(11.8% ± 3.1%; P = 0.14). The methanogen 16S rRNA as a percentage of the rectum content total bacteria 16SrRNA (0.7% ± 3.1%) was not different from the rumen content (P = 0.29) but was less than the cecum content(P = 0.01). Methanomicrobiales 16S rRNA as a percentage of total methanogen 16S rRNA did not differ across sample sites (P = 0.81); however, steers with positive RG (10.5% ± 1.6%) were more numerous than steers with negative RG (5.1% ± 1.6%; P = 0.02). Cattle that differ in RG at the same DMI do not differ in characteristics associated with CH4 production.

  16. Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

    PubMed Central

    Umaer, Khan; Ciganda, Martin

    2014-01-01

    Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

  17. Using secondary structure to identify ribosomal numts: cautionary examples from the human genome.

    PubMed

    Olson, Link E; Yoder, Anne D

    2002-01-01

    The identification of inadvertently sequenced mitochondrial pseudogenes (numts) is critical to any study employing mitochondrial DNA sequence data. Failure to discriminate numts correctly can confound phylogenetic reconstruction and studies of molecular evolution. This is especially problematic for ribosomal mtDNA genes. Unlike protein-coding loci, whose pseudogenes tend to accumulate diagnostic frameshift or premature stop mutations, functional ribosomal genes are not constrained to maintain a reading frame and can accumulate insertion-deletion events of varying length, particularly in nonpairing regions. Several authors have advocated using structural features of the transcribed rRNA molecule to differentiate functional mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA gene and three known 12S numts from the human genome in the context of anthropoid phylogeny and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts exhibits striking concordance with secondary structure models, with little, if any, indication of their pseudogene status, and would likely escape detection based on structural criteria alone. Furthermore, we show that the unwitting inclusion of a particularly ancient (18-25 Myr old) and surprisingly cryptic human numt in a phylogenetic analysis would yield a well-supported but dramatically incorrect conclusion regarding anthropoid relationships. Though we endorse the use of secondary structure models for inferring positional homology wholeheartedly, we caution against reliance on structural criteria for the discrimination of rRNA numts, given the potential fallibility of this approach.

  18. Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

    PubMed

    Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

    2017-02-01

    To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

  19. Outbreak of Human Infection with Sarcocystis nesbitti, Malaysia, 2012

    PubMed Central

    Teoh, Boon-Teong; Sam, Sing-Sin; Chang, Li-Yen; Johari, Jefree; Hooi, Poh-Sim; Lakhbeer-Singh, Harvinder-Kaur; Italiano, Claire M.; Omar, Sharifah F. Syed; Wong, Kum-Thong; Ramli, Norlisah; Tan, Chong-Tin

    2013-01-01

    An outbreak of fever associated with myalgia and myositis occurred in 2012 among 89 of 92 college students and teachers who visited Pangkor Island, Malaysia. The Sarcocystis nesbitti 18S rRNA gene and sarcocysts were obtained from muscle tissues of 2 students. Our findings indicate emergence of S. nesbitti infections in humans in Malaysia. PMID:24274071

  20. Streptobacillus moniliformis as the causative agent in spondylodiscitis and psoas abscess after rooster scratches.

    PubMed

    Dubois, Damien; Robin, Frédéric; Bouvier, Damien; Delmas, Julien; Bonnet, Richard; Lesens, Olivier; Hennequin, Claire

    2008-08-01

    We report a case of Streptobacillus moniliformis spondylodiscitis accompanied by a psoas abscess in an 80-year-old man scratched by a rooster. S. moniliformis was identified from abscess fluid by use of 16S rRNA gene sequencing. After 18 weeks of antimicrobial therapy, the clinical condition of the patient improved.

  1. Molecular characterization of Hepatozoon sp. in cats from São Luís Island, Maranhão, Northeastern Brazil.

    PubMed

    de Bortoli, Caroline P; André, Marcos R; Braga, Maria do Socorro C; Machado, Rosangela Zacarias

    2011-10-01

    Few molecular studies have been done concerning the molecular characterization of Hepatozoon species among domestic and wild felids. The present work aimed to characterize molecularly the presence of Hepatozoon sp. DNA in cat blood samples from São Luís Island, Maranhão state, Northeastern Brazil. EDTA-whole blood samples were collected from 200 domestic cats with outdoor and wood areas access from São Luís, Maranhão, Brazil. Each sample of extracted DNA was used as a template in PCR reactions aiming to amplify a partial sequence of 18S rRNA of Hepatozoon spp. We also performed sequence alignment to establish the identity of the parasite species infecting these animals using DNA sequences based on 18S rRNA. From 200 sampled cats, Hepatozoon DNA was only found in one animal (0.5%). The found Hepatozoon DNA showed 97% of identity with Hemobartonella felis isolates 1 and 2 from Spain. When analyzing the phylogenetic tree, the found Hepatozoon DNA was in the same clade than H. felis isolates. Our findings suggest that more than one species of Hepatozoon could infect felids in Brazil.

  2. Differentiation and classification of phytoplasmas in the pigeon pea witches'-broom group (16SrIX): an update based on multiple gene sequence analysis.

    PubMed

    Lee, I-M; Bottner-Parker, K D; Zhao, Y; Bertaccini, A; Davis, R E

    2012-09-01

    The pigeon pea witches'-broom phytoplasma group (16SrIX) comprises diverse strains that cause numerous diseases in leguminous trees and herbaceous crops, vegetables, a fruit, a nut tree and a forest tree. At least 14 strains have been reported worldwide. Comparative phylogenetic analyses of the highly conserved 16S rRNA gene and the moderately conserved rplV (rpl22)-rpsC (rps3) and secY genes indicated that the 16SrIX group consists of at least six distinct genetic lineages. Some of these lineages cannot be readily differentiated based on analysis of 16S rRNA gene sequences alone. The relative genetic distances among these closely related lineages were better assessed by including more variable genes [e.g. ribosomal protein (rp) and secY genes]. The present study demonstrated that virtual RFLP analyses using rp and secY gene sequences allowed unambiguous identification of such lineages. A coding system is proposed to designate each distinct rp and secY subgroup in the 16SrIX group.

  3. Capturing diversity of marine heterotrophic protists: one cell at a time

    PubMed Central

    Heywood, Jane L; Sieracki, Michael E; Bellows, Wendy; Poulton, Nicole J; Stepanauskas, Ramunas

    2011-01-01

    Recent applications of culture-independent, molecular methods have revealed unexpectedly high diversity in a variety of functional and phylogenetic groups of microorganisms in the ocean. However, none of the existing research tools are free from significant limitations, such as PCR and cloning biases, low phylogenetic resolution and others. Here, we employed novel, single-cell sequencing techniques to assess the composition of small (<10 μm diameter), heterotrophic protists from the Gulf of Maine. Single cells were isolated by flow cytometry, their genomes amplified, and 18S rRNA marker genes were amplified and sequenced. We compared the results to traditional environmental PCR cloning of sorted cells. The diversity of heterotrophic protists was significantly higher in the library of single amplified genomes (SAGs) than in environmental PCR clone libraries of the 18S rRNA gene, obtained from the same coastal sample. Libraries of SAGs, but not clones contained several recently discovered, uncultured groups, including picobiliphytes and novel marine stramenopiles. Clone, but not SAG, libraries contained several large clusters of identical and nearly identical sequences of Dinophyceae, Cercozoa and Stramenopiles. Similar results were obtained using two alternative primer sets, suggesting that PCR biases may not be the only explanation for the observed patterns. Instead, differences in the number of 18S rRNA gene copies among the various protist taxa probably had a significant role in determining the PCR clone composition. These results show that single-cell sequencing has the potential to more accurately assess protistan community composition than previously established methods. In addition, the creation of SAG libraries opens opportunities for the analysis of multiple genes or entire genomes of the uncultured protist groups. PMID:20962875

  4. Quantitative Detection of the Free-Living Amoeba Hartmannella vermiformis in Surface Water by Using Real-Time PCR†

    PubMed Central

    Kuiper, Melanie W.; Valster, Rinske M.; Wullings, Bart A.; Boonstra, Harry; Smidt, Hauke; van der Kooij, Dick

    2006-01-01

    A real-time PCR-based method targeting the 18S rRNA gene was developed for the quantitative detection of Hartmannella vermiformis, a free-living amoeba which is a potential host for Legionella pneumophila in warm water systems and cooling towers. The detection specificity was validated using genomic DNA of the closely related amoeba Hartmannella abertawensis as a negative control and sequence analysis of amplified products from environmental samples. Real-time PCR detection of serially diluted DNA extracted from H. vermiformis was linear for microscopic cell counts between 1.14 × 10−1 and 1.14 × 104 cells per PCR. The genome of H. vermiformis harbors multiple copies of the 18S rRNA gene, and an average number (with standard error) of 1,330 ± 127 copies per cell was derived from real-time PCR calibration curves for cell suspensions and plasmid DNA. No significant differences were observed between the 18S rRNA gene copy numbers for trophozoites and cysts of strain ATCC 50237 or between the copy numbers for this strain and strain KWR-1. The developed method was applied to water samples (200 ml) collected from a variety of lakes and rivers serving as sources for drinking water production in The Netherlands. Detectable populations were found in 21 of the 28 samples, with concentrations ranging from 5 to 75 cells/liter. A high degree of similarity (≥98%) was observed between sequences of clones originating from the different surface waters and between these clones and the reference strains. Hence, H. vermiformis, which is highly similar to strains serving as hosts for L. pneumophila, is a common component of the microbial community in fresh surface water. PMID:16957190

  5. New data on epizootiology and genetics of piroplasms based on sequences of small ribosomal subunit and cytochrome b genes.

    PubMed

    Criado, A; Martinez, J; Buling, A; Barba, J C; Merino, S; Jefferies, R; Irwin, P J

    2006-12-20

    As a continuation of our studies on molecular epizootiology of piroplasmosis in Spain and other countries, we present in this contribution the finding of new hosts for some piroplasms, as well as information on their 18S rRNA gene sequences. Genetic data were complemented with sequences of apocytochrome b gene (whenever possible). The following conclusions were drawn from these molecular studies: Theileria annulata is capable of infecting dogs, since it was diagnosed in a symptomatic animal. According to cytochrome b sequences, isolates from cows and dog present slight differences. The same isolates showed, however, identical sequence in the 18S rRNA gene. This exemplifies well the usefulness of the mitochondrial gene for examining infra-specific variation. Babesia bovis is an occasional parasite of equines, since it was detected in two symptomatic horses. We found evidence of genetic polymorphism occurring in the 18S rRNA gene of Spanish T. equi-like and B. ovis isolates. B. bennetti from Spanish seagull is loosely related to B. ovis, and might represent a genetically distinct branch of babesids. A partial sequence of a cytochrome b pseudogene was obtained for the first time in Babesia canis rossi from South Africa. The pseudogene is distantly related to B. bigemina cytochrome b gene. These new findings confirm the ability of some piroplasms to infect multiple hosts, as well as the existence of a relatively wide genetic polymorphisms with respect to the cytochrome b gene. On the other hand, the existence of mtDNA-like pseudogenes of possible nuclear location in piroplasms is interesting due to their possible impact on molecular phylogeny studies.

  6. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  8. Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines.

    PubMed

    Mapalo, Marc A; Stec, Daniel; Mirano-Bascos, Denise; Michalczyk, Łukasz

    2016-06-20

    The limnoterrestrial tardigrade fauna of the Philippines is completely unknown. In this paper, we describe the first ever limnoterrestrial water bear species from this southeast Asian country, Mesobiotus philippinicus sp. nov., found in a moss sample collected in Quezon City. Apart from morphometrics and imaging in light microscopy, we also analysed the new species under scanning electron microscope and sequenced four DNA markers differing in mutation rates, three nuclear (18S rRNA, 28S rRNA, and ITS-2) and one mitochondrial (COI). This allowed not only a detailed description but also provided barcodes to aid future species identification. The new species belongs to the harmsworthi group and is most similar to M. diffusus (Binda & Pilato, 1987), M. pseudocoronatus (Pilato et al., 2006), M. montanus (Murray, 1910) and M. mottai (Binda & Pilato, 1994), but differs from these species by whorled egg processes and dimensions of some morphometric traits. The 28S rRNA, ITS-2 and COI sequences presented in this paper are the first published DNA sequences for the genus Mesobiotus.

  9. Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

    PubMed

    Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

    2014-01-01

    Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

  10. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  11. U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

    PubMed

    Morrissey, J P; Tollervey, D

    1997-06-01

    The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

  12. Molecular characterization of Hepatozoon felis in Rhipicephalus sanguineus ticks infested on captive lions (Panthera leo).

    PubMed

    Bhusri, Benjaporn; Sariya, Ladawan; Mongkolphan, Chalisa; Suksai, Parut; Kaewchot, Supakarn; Changbunjong, Tanasak

    2017-09-01

    Hepatozoon spp. are protozoan parasites that infect a wide range of domestic and wild animals. The infection occurs by ingestion of an infected tick. This study was carried out to detect and characterize Hepatozoon spp. in ticks collected from captive lions ( Panthera leo ) in Thailand based on the partial 18S rRNA gene sequence. A total of 30 ticks were collected and identified as Rhipicephalus sanguineus . The collected ticks were separated into 10 tick pools by sex and life stages. Of the 10 tick pools examined, only one (10%) was found to be infected with the Hepatozoon species. Sequencing and phylogenetic analysis showed a clustering of the partial 18S rRNA gene sequence like that of H. felis from the GenBank database. This is the first report of H. felis in R. sanguineus ticks collected from captive lions in Thailand. Our results indicated that R. sanguineus may be a possible vector of feline Hepatozoon in Thailand.

  13. Babesia lengau sp. nov., a novel Babesia species in cheetah (Acinonyx jubatus, Schreber, 1775) populations in South Africa.

    PubMed

    Bosman, Anna-Mari; Oosthuizen, Marinda C; Peirce, Michael A; Venter, Estelle H; Penzhorn, Barend L

    2010-08-01

    In a previous paper, we reported on a large number of cheetah blood specimens that gave positive signals only for Babesia and/or Theileria genus-specific probes on the reverse line blot (RLB) assay, indicating the presence of a novel species or variant of an existing species. Some of these specimens were investigated further by microscopic, serological, sequencing, and phylogenetic analyses. The near-full-length 18S rRNA genes of 13 samples, as well as the second internal transcribed spacer (ITS2) region, were amplified, cloned, and sequenced. A species-specific RLB probe, designed to target the hypervariable V4 region of the 18S rRNA gene for detection of the novel Babesia sp., was used to screen an additional 137 cheetah blood specimens for the presence of the species. The prevalence of infection was 28.5%. Here we describe the morphology and phylogenetic relationships of the novel species, which we have named Babesia lengau sp. nov.

  14. Babesia lengau sp. nov., a Novel Babesia Species in Cheetah (Acinonyx jubatus, Schreber, 1775) Populations in South Africa ▿

    PubMed Central

    Bosman, Anna-Mari; Oosthuizen, Marinda C.; Peirce, Michael A.; Venter, Estelle H.; Penzhorn, Barend L.

    2010-01-01

    In a previous paper, we reported on a large number of cheetah blood specimens that gave positive signals only for Babesia and/or Theileria genus-specific probes on the reverse line blot (RLB) assay, indicating the presence of a novel species or variant of an existing species. Some of these specimens were investigated further by microscopic, serological, sequencing, and phylogenetic analyses. The near-full-length 18S rRNA genes of 13 samples, as well as the second internal transcribed spacer (ITS2) region, were amplified, cloned, and sequenced. A species-specific RLB probe, designed to target the hypervariable V4 region of the 18S rRNA gene for detection of the novel Babesia sp., was used to screen an additional 137 cheetah blood specimens for the presence of the species. The prevalence of infection was 28.5%. Here we describe the morphology and phylogenetic relationships of the novel species, which we have named Babesia lengau sp. nov. PMID:20519464

  15. Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.

    PubMed

    Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C

    2007-12-25

    With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).

  16. Serological detection and molecular characterization of piroplasmids in equids in Brazil.

    PubMed

    Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

    2018-03-01

    Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Detection and characterization of feline Bartonella henselae in the Czech Republic.

    PubMed

    Melter, O; Hercík, K; Weyant, R S; Janecek, J; Nemec, A; Mecera, J; Gonzorová, L'; Branny, P

    2003-05-29

    The aims of the study were to characterize isolates of Bartonella henselae and to determine the prevalence of bacteremic domestic cats in urban and suburban parts of Prague, Czech Republic. Five (18%) gram-negative fastidious bacterial single-cat isolates were recovered from 27 hemocultures incubated without previous freezing. Four of these isolates originated from flea infested stray cats (n=6) and one from a shelter cat without any ectoparasites (n=21). None of the 34 previously frozen specimens from flea free pet cats yielded any bacteria. All five isolates were catalase and oxidase negative. Their enzymatic activity, RFLP profile of citrate synthetase gene (gltA) and DNA-DNA hybridization results were typical of B. henselae. According to their PvuII and BglI ribotypes the isolates could be allocated to two homogeneous groups. Ribotype HindIII and RFLP of 16S-23S rRNA spacer region analysis gave unique profiles different from those of Bartonella quintana, Bartonella elizabethae and Bartonella clarridgeiae. The 16S rRNA type-specific amplification revealed an identical profile typical of B. henselae genotype II for all the cat isolates studied. Pulsed-field gel electrophoresis (PFGE) assigned a different profile to each of the isolates studied. Determination of the enzymatic activity, RFLP of gltA gene, RFLP of 16S-23S rRNA spacer region, and HindIII ribotype could be efficient tools for identification of B. henselae isolates. Ribotyping (PvuII, BglI), 16S rRNA typing and PFGE may be useful methods to prospect ecology and epidemiology of the agent.

  18. Streptobacillus moniliformis as the Causative Agent in Spondylodiscitis and Psoas Abscess after Rooster Scratches▿

    PubMed Central

    Dubois, Damien; Robin, Frédéric; Bouvier, Damien; Delmas, Julien; Bonnet, Richard; Lesens, Olivier; Hennequin, Claire

    2008-01-01

    We report a case of Streptobacillus moniliformis spondylodiscitis accompanied by a psoas abscess in an 80-year-old man scratched by a rooster. S. moniliformis was identified from abscess fluid by use of 16S rRNA gene sequencing. After 18 weeks of antimicrobial therapy, the clinical condition of the patient improved. PMID:18562588

  19. Genetic characterization of theileria equi infecting horses in North America: evidence for a limited source of U.S. introductions

    USDA-ARS?s Scientific Manuscript database

    Theileria equi is a tick-borne Apicomplexan hemoparasite that causes equine piroplasmosis (EP). This parasite has a worldwide distribution, but until recent outbreaks the United States has been considered to be free of EP. Maximum parsimony analysis of 18S rRNA gene sequences of North American T. eq...

  20. Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Jun; McCann, Kathleen L.; Qiu, Chen

    Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less

  1. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    PubMed

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  2. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    PubMed

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  3. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  4. Peptoniphilus catoniae sp. nov., isolated from a human faecal sample from a traditional Peruvian coastal community.

    PubMed

    Patel, Nisha B; Tito, Raul Y; Obregón-Tito, Alexandra J; O'Neal, Lindsey; Trujillo-Villaroel, Omar; Marin-Reyes, Luis; Troncoso-Corzo, Luzmila; Guija-Poma, Emilio; Lewis, Cecil M; Lawson, Paul A

    2016-05-01

    A novel Gram-stain-positive, coccus-shaped, obligately anaerobic bacterium was isolated from a faecal sample obtained from an individual in a traditional community located off the southern coast of Peru. Comparative 16S rRNA gene sequence analysis showed the novel bacterium belonged to the genus Peptoniphilus but showed no particular relationship with any species, demonstrating less than 91 % 16S rRNA gene sequence similarity with all members of the genus. The major cellular fatty acids of the novel isolate were determined to be C10 : 0, C14 : 0, C16 : 0, C18 : 1ω9c and C18 : 2ω6,9c/anteiso-C18 : 0. The DNA G+C content was 34.4 mol%. End-products of metabolism from peptone-yeast-glucose broth (PYG) were determined to be acetate and butyrate. Based on the phenotypic, chemotaxonomic and phylogenetic results, the organism represents a novel species of the genus Peptoniphilus, for which the name Peptoniphilus catoniae sp. nov. is proposed. The type strain is M6.X2DT ( = DSM 29874T = CCUG 66798T).

  5. Morphological and molecular characterization of Eurytrema cladorchis parasitizing cattle (Bos indicus) in Bangladesh.

    PubMed

    Mohanta, Uday Kumar; Ichikawa-Seki, Madoka; Hayashi, Kei; Itagaki, Tadashi

    2015-06-01

    There is always controversy regarding identification of different species in the genus Eurytrema. Identification has been based mainly on morphology, which can be misleading and subject to differing interpretation among the scientists. Therefore, the aim of this study was to identify Eurytrema flukes both by morphology and molecular properties on the basis of 18-subunit ribosomal RNA (18S rRNA) gene as well as internal transcribed spacer 2 (ITS2) to clarify their phylogenetic status. Among six different agroecological areas of Bangladesh, 22 Eurytrema flukes were recovered from the bile ducts of 22 cattle in Bandarban, a hill district. The flukes were identified as Eurytrema cladorchis through morphometric and morphological studies. Phylogenetic analyses were conducted by neighbor-joining phylogram inferred from both 18S rRNA (1784 bp) gene and ITS2 (229 bp) sequences. A monophyletic clade was constructed by the E. cladorchis from Bangladesh; however, the clade was distinct from those formed by Eurytrema pancreaticum and Eurytrema coelomaticum. This study first described the existence of E. cladorchis from Bangladesh and may provide useful information for both morphological and molecular properties that may further help to clarify phylogenetic relationships within the genus Eurytrema and also for other digeneans.

  6. Vertical stratification of bacteria and archaea in sediments of a boreal stratified humic lake

    NASA Astrophysics Data System (ADS)

    Rissanen, Antti J.; Mpamah, Promise; Peura, Sari; Taipale, Sami; Biasi, Christina; Nykänen, Hannu

    2015-04-01

    Boreal stratified humic lakes, with steep redox gradients in the water column and in the sediment, are important sources of methane (CH4) to the atmosphere. CH4 flux from these lakes is largely controlled by the balance between CH4-production (methanogenesis), which takes place in the organic rich sediment and in the deepest water layers, and CH4-consumption (methanotrophy), which takes place mainly in the water column. While there is already some published information on the activity, diversity and community structure of bacteria in the water columns of these lakes, such information on sediment microbial communities is very scarce. This study aims to characterize the vertical variation patterns in the diversity and the structure of microbial communities in sediment of a boreal stratified lake. Particular focus is on microbes with the potential to contribute to methanogenesis (fermentative bacteria and methanogenic archaea) and to methanotrophy (methanotrophic bacteria and archaea). Two sediment cores (26 cm deep), collected from the deepest point (~6 m) of a small boreal stratified lake during winter-stratification, were divided into depth sections of 1 to 2 cm for analyses. Communities were studied from DNA extracted from sediment samples by next-generation sequencing (Ion Torrent) of polymerase chain reaction (PCR) - amplified bacterial and archaeal 16S rRNA gene amplicons. The abundance of methanogenic archaea was also specifically studied by quantitative-PCR of methyl coenzyme-M reductase gene (mcrA) amplicons. Furthermore, the community structure and the abundance of bacteria were studied by phospholipid fatty acid (PLFA) analysis. Dominant potential fermentative bacteria belonged to families Syntrophaceae, Clostridiaceae and Peptostreptococcaceae. There were considerable differences in the vertical distribution among these groups. The relative abundance of Syntrophaceae started to increase from the sediment surface, peaked at depth layer from 5 to 10 cm (up to 21 % of bacterial 16S rRNA gene amplicons) and decreased gradually towards deeper layers while the relative abundances of Clostridiaceae and Peptostreptococcaceae started to increase at deeper depths, at 5 cm and 10 cm, respectively, both peaking at depth layer from 20 to 26 cm (Clostridiaceae up to 13 % and Peptostreptococcaceae up to 11 % of bacterial 16S rRNA amplicons). Methanogenic community was dominated by acetoclastic methanogens (genus Methanosaeta), which were most abundant at depth layer from sediment surface to 10 cm (up to 87 % of archaeal 16S rRNA gene amplicons) and decreased drastically until the depth of 18 cm having quite stable relative abundance from 18 to 26 cm (5 to 11 % of archaeal 16S rRNA gene amplicons). Hydrogenotrophic methanogens (Methanoregula, Methanolinea, Methanospirillum, Methanocella) (3 to 11 % of archaeal 16S rRNA gene amplicons) did not show any specific depth patterns. The proportion of methanotrophic microbes was very low and they consisted almost completely of type II methanotrophic bacteria (family Methylocystaceae), which had highest relative abundance at depth layer from 5 to 10 cm (up to 3 % of bacterial 16S rRNA gene amplicons) and were almost absent below 15 cm. Anaerobic methanotrophic archaea were not detected. These findings will be discussed with results from PLFA and q-PCR analyses.

  7. New data on Neodiplostomum americanum Chandler and Rausch, 1947 (Digenea: Diplostomidae), in the Great Horned Owl Bubo virginianus Gmelin, 1788 and the Eastern Screech Owl Megascops asio Linnaeus, 1758 in Mississippi, USA.

    PubMed

    Woodyard, Ethan T; Rosser, Thomas G; Griffin, Matt J

    2017-08-01

    Neodiplostomum americanum Chandler and Rausch, 1947 has been reported from six species of owls in North America. At present, there are no molecular data for this species and gene sequence data from Neodiplostomum Railliet, 1919 are limited. A freshly deceased specimen of the Great Horned Owl Bubo virginianus Gmelin, 1788 and a freshly deceased specimen of the Eastern Screech Owl Megascops asio Linnaeus, 1758 were collected in Oktibbeha County, Mississippi in 2014 and 2016, respectively. Neodiplostomum americanum were recovered from both hosts. Herein, updated morphological descriptions are supplemented with gene sequence data from conserved (18S, ITS1-5.8S, ITS2, and 28S rRNA) and fast-evolving (cytochrome c oxidase subunit 1 mtDNA) regions. Preliminary phylogenetic analysis of the genus based on cytochrome c oxidase subunit 1 gene sequence data supports the placement of N. americanum within a discrete phylogroup of the family Diplostomidae. The life history of N. americanum is unknown and currently limited to the description of the adult stage in avian hosts. The molecular data generated in this study offer insight into the phylogenetic placement of N. americanum within the Diplostomatidae and will aid in identifying different life stages in putative intermediate hosts.

  8. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    PubMed

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira.

    PubMed

    Carrillo-Casas, Erika Margarita; Hernández-Castro, Rigoberto; Suárez-Güemes, Francisco; de la Peña-Moctezuma, Alejandro

    2008-06-01

    Analysis of gene expression requires sensitive, precise, and reproducible measurements for specific mRNA sequences. To avoid bias, real-time RT-PCR is referred to one or several internal control genes. Here, we sought to identify a gene to be used as normalizer by analyzing three functional distinct housekeeping genes (lipL41, flaB, and 16S rRNA) for their expression level and stability in temperature treated Leptospira cultures. Leptospira interrogans serovar Hardjo subtype Hardjoprajitno was cultured at 30 degrees C for 7 days until a density of 10(6) cells/ml was reached and then shifted to physiological temperatures (37 degrees C and 42 degrees C) and to environmental temperatures (25 degrees C and 30 degrees C) during a 24 h period. cDNA was amplified by quantitative PCR using SYBR Green I technology and gene-specific primers for lipL41, flaB, and 16S rRNA. Expression stability (M) was assessed by geNorm and Normfinder v.18. 16S rRNA registered an average expression stability of M = 1.1816, followed by flaB (M = 1.682) and lipL41 (M = 1.763). 16S rRNA was identified as the most stable gene and can be used as a normalizer, as it showed greater expression stability than lipL41 and flaB in the four temperature treatments. Hence, comparisons of gene expression will have a higher sensitivity and specificity.

  10. Molecular Fingerprint and Dominant Environmental Factors of Nitrite-Dependent Anaerobic Methane-Oxidizing Bacteria in Sediments from the Yellow River Estuary, China.

    PubMed

    Yan, Pengze; Li, Mingcong; Wei, Guangshan; Li, Han; Gao, Zheng

    2015-01-01

    Nitrite-dependent anaerobic methane oxidation (n-damo) is performed by "Candidatus Methylomirabilis oxyfera" (M. oxyfera), which connects the carbon and nitrogen global nutrient cycles. In the present study, M. oxyfera-like bacteria sequences were successfully recovered from Yellow River Estuary sediments using specific primers for 16S rRNA and pmoA genes. A M. oxyfera-like sequences analysis based on the 16S rRNA gene revealed greater diversity compared with the pmoA gene; the 16S rRNA gene sequences retrieved from the Yellow River Estuary sediments belong to groups A as well as B and were mainly found in freshwater habitats. Quantitative PCR showed that 16S rRNA gene abundance varied from 9.28±0.11×10(3) to 2.10±0.13×10(5) copies g(-1) (dry weight), and the pmoA gene abundance ranged from 8.63±0.50×10(3) to 1.83±0.18×10(5) copies g(-1) (dry weight). A correlation analysis showed that the total organic carbon (TOC) and ammonium (NH4(+)) as well as the ratio of total phosphorus to total nitrogen (TP/TN) influenced the M. oxyfera-like bacteria distribution in the Yellow River Estuary sediments. These findings will aid in understanding the n-damo bacterial distribution pattern as well as their correlation with surrounding environmental factors in temperate estuarine ecosystems.

  11. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

    PubMed

    Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

    2013-09-15

    Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    PubMed Central

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  13. Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

    PubMed

    Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

    2009-04-01

    Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

  14. Literature Reference for Entamoeba histolytica (Journal of Clinical Microbiology. 2005. 43(11): 5491–5497)

    EPA Pesticide Factsheets

    Procedures are described for analysis of clinical samples and may be adapted for assessment of solid, particulate, liquid and water samples. The method is a real-time PCR assay that targets the 18S rRNA gene sequence of Entamoeba histolytica.

  15. The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.

    PubMed

    Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

    2005-07-15

    Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.

  16. Pelagibacterium montanilacus sp. nov., an alkaliphilic bacterium isolated from Lake Cuochuolong on the Tibetan Plateau.

    PubMed

    Lu, Huibin; Xing, Peng; Phurbu, Dorji; Tang, Qian; Wu, Qinglong

    2018-05-11

    A Gram-stain negative, alkaliphilic and halotolerant bacterium, designated CCL18 T , was isolated from Lake Cuochuolong on the Tibetan Plateau. The strain was aerobic, short rod-shaped, catalase- and oxidase-positive, and motile by means of several polar flagella. Phylogenetic analysis based on 16S rRNA gene sequencing indicated that strain CCL18 T belongs to the genus Pelagibacterium, with its two closest neighbours being Pelagibacterium halotolerans B2 T (96.6 %, 16S rRNA gene sequence similarity) and Pelagibacterium luteolum 1_C16_27 T (96.1 %). The predominant respiratory quinone of strain CCL18 T was Q-10, with Q-9 as a minor component. The major fatty acids were C18 : 1ω6c/C18 : 1ω7c (60.4 %), C19 : 0cyclo ω8c (8.1 %) and C18 : 0 (6.8 %). The polar lipids included phosphatidylglycerol, diphosphatidylglycerol, seven kinds of unidentified lipids and three kinds of glycolipids. The DNA G+C content was 60.1 mol%. DNA-DNA hybridization showed 35.2 % relatedness between strain CCL18 T and P. halotolerans B2 T and 24.6 % relatedness to P. luteolum 1_C16_27 T . Based on phylogenetic analysis, DNA-DNA hybridization and a range of physiological and biochemical characteristics, strain CCL18 T was clearly distinguishable from the other strains of the genus Pelagibacterium. It was evident that strain CCL18 T could be classified as a novel species of the genus Pelagibacterium, for which the name Pelagibacterium montanilacus sp. nov. is proposed. The type strain is CCL18 T (=CGMCC 1.16231 T =KCTC 62030 T ).

  17. Identification and molecular survey of Borrelia burgdorferi sensu lato in sika deer (Cervus nippon) from Jilin Province, north-eastern China.

    PubMed

    Zhai, Bintao; Niu, Qingli; Yang, Jifei; Liu, Zhijie; Liu, Junlong; Yin, Hong; Zeng, Qiaoying

    2017-02-01

    Lyme disease caused by Borrelia burgdorferi sensu lato (s.l.) is a common disease of domestic animals and wildlife worldwide. Sika deer is first-grade state-protected wildlife animals in China and have economic consequences for humans. It is reported that sika deer may serve as an important reservoir host for several species of B. burgdorferi s.l. and may transmit these species to humans and animals. However, little is known about the presence of Borrelia pathogens in sika deer in China. In this study, the existence and prevalence of Borrelia sp. in sika deer from four regions of Jilin Province in China was assessed. Seventy-one blood samples of sika deer were collected and tested by nested-PCRs based on 16S ribosomal RNA (16S rRNA), outer surface protein A (OspA), flagenllin (fla), and 5S-23S rRNA intergenic spacer (5S-23S rRNA) genes of B. burgdorferi s.l. Six (8.45%) samples were positive for Borrelia sp. based on sequences of 4 genes. The positive samples were detected 18 for 16S rRNA, 10 for OspA, 16 for fla and 6 for 5S-23S, with the positive rates 25.35% (95% CI=3.8-35.6), 14.08% (95% CI=3.0-21.6), 22.54% (95% CI=4.3-36.9) and 8.45% (95% CI=1.7-22.9), respectively. Sequence analysis of the positive PCR products revealed that the partial 4 genes sequences in this study were all most similar to the sequences of B. garinii and B. burgdorferi sensu stricto (s.s.), no other Borrelia genospecies were found. This is the first report of Borrelia pathogens in sika deer in China. The findings in this study indicated that sika deer as potential natural host and may spread Lyme disease pathogen to animals, ticks, and even humans. Copyright © 2016. Published by Elsevier B.V.

  18. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  19. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    PubMed

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  20. Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

    PubMed Central

    Wieckowski, Yana; Schiefelbein, John

    2012-01-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

  1. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  2. Microbial Characterization of Qatari Barchan Sand Dunes

    PubMed Central

    Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.

    2016-01-01

    This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399

  3. Diversity analysis of lactic acid bacteria in takju, Korean rice wine.

    PubMed

    Jin, Jianbo; Kim, So-Young; Jin, Qing; Eom, Hyun-Ju; Han, Nam Soo

    2008-10-01

    To investigate the lactic acid bacterial population in Korean traditional rice wines, biotyping was performed using cell morphology and whole-cell protein pattern analysis by SDSPAGE, and then the isolates were identified by 16S rRNA sequencing analysis. Based on the morphological characteristics, 103 LAB isolates were detected in wine samples, characterized by whole-cell protein pattern analysis, and they were then divided into 18 patterns. By gene sequencing of 16S rRNA, the isolates were identified as Lactobacillus paracasei, Lb. arizonensis, Lb. plantarum, Lb. harbinensis, Lb. parabuchneri, Lb. brevis, and Lb. hilgardii when listed by their frequency of occurrence. It was found that the difference in bacterial diversity between rice and grape wines depends on the raw materials, especially the composition of starch and glucose.

  4. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  5. The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

    PubMed

    Sardana, Richa; White, Joshua P; Johnson, Arlen W

    2013-06-01

    Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

  6. Morphology and Phylogeny of the Soil Ciliate Metopus yantaiensis n. sp. (Ciliophora, Metopida), with Identification of the Intracellular Bacteria.

    PubMed

    Omar, Atef; Zhang, Qianqian; Zou, Songbao; Gong, Jun

    2017-11-01

    The morphology and infraciliature of a new ciliate, Metopus yantaiensis n. sp., discovered in coastal soil of northern China, were investigated. It is distinguished from its congeners by a combination of the following features: nuclear apparatus situated in the preoral dome; 18-21 somatic ciliary rows, of which three extend onto the preoral dome (dome kineties); three to five distinctly elongated caudal cilia, and 21-29 adoral polykinetids. The 18S rRNA genes of this new species and two congeners, Metopus contortus and Metopus hasei, were sequenced and phylogenetically analyzed. The new species is more closely related to M. hasei and the clevelandellids than to other congeners; both the genus Metopus and the order Metopida are not monophyletic. In addition, the digestion-resistant bacteria in the cytoplasm of M. yantaiensis were identified, using a 16S rRNA gene clone library, sequencing, and fluorescence in situ hybridization. The detected intracellular bacteria are affiliated with Sphingomonadales, Rhizobiales, Rickettsiales (Alphaproteobacteria), Pseudomonas (Gammaproteobacteria), Rhodocyclales (Betaproteobacteria), Clostridiales (Firmicutes), and Flavobacteriales (Bacteroidetes). © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  7. Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.

    PubMed

    Chao, Shiou-Huei; Wu, Ruei-Jie; Watanabe, Koichi; Tsai, Ying-Chieh

    2009-11-15

    Fu-tsai and suan-tsai are spontaneously fermented mustard products traditionally prepared by the Hakka tribe of Taiwan. We chose 5 different processing stages of these products for analysis of the microbial community of lactic acid bacteria (LAB) by 16S rRNA gene sequencing. From 500 LAB isolates we identified 119 representative strains belonging to 5 genera and 18 species, including Enterococcus (1 species), Lactobacillus (11 species), Leuconostoc (3 species), Pediococcus (1 species), and Weissella (2 species). The LAB composition of mustard fermented for 3 days, known as the Mu sample, was the most diverse, with 11 different LAB species being isolated. We used sequence analysis of the 16S rRNA gene to identify the LAB strains and analysis of the dnaA, pheS, and rpoA genes to identify 13 LAB strains for which identification by 16S rRNA gene sequences was not possible. These 13 strains were found to belong to 5 validated known species: Lactobacillus farciminis, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Weissella cibaria, and Weissella paramesenteroides, and 5 possibly novel Lactobacillus species. These results revealed that there is a high level of diversity in LAB at the different stages of fermentation in the production of suan-tsai and fu-tsai.

  8. The effect of ethionine on ribonucleic acid synthesis in rat liver.

    PubMed Central

    Swann, P F

    1975-01-01

    1. By 1h after administration of ethionine to the female rat the appearance of newly synthesized 18SrRNA in the cytoplasm is completely inhibited. This is not caused by inhibition of RNA synthesis, for the synthesis of the large ribosomal precursor RNA (45S) and of tRNA continues. Cleavage of 45S RNA to 32S RNA also occurs, but there was no evidence for the accumulation of mature or immature rRNA in the nucleus. 2. The effect of ethionine on the maturation of rRNA was not mimicked by an inhibitor of protein synthesis (cycloheximide) or an inhibitor of polyamine synthesis [methylglyoxal bis(guanylhydrazone)]. 3. Unlike the ethionine-induced inhibition of protein synthesis, this effect was not prevented by concurrent administration of inosine. A similar effect could be induced in HeLa cells by incubation for 1h in a medium lacking methionine. The ATP concentration in these cells was normal. From these two observations it was concluded that the effect of etionine on rRNA maturation is not caused by an ethionine-induced lack of ATP. It is suggested that ethionine, by lowering the hepatic concentration of S-adenosylmethionine, prevents methylation of the ribosomal precursor. The methylation is essential for the correct maturation of the molecule; without methylation complete degradation occurs. PMID:1212195

  9. Detection and Molecular Identification of Sarcocystis rileyi (Apicomplexa: Sarcocystidae) From a Northern Shoveler (Anas clypeata) in Mexico.

    PubMed

    Padilla-Aguilar, Patricia; Romero-Callejas, Evangelina; Osorio-Sarabia, David; Ramírez-Lezama, José; Cigarroa-Toledo, Nohemi; Machain-Williams, Carlos; Manterola, Carlos; Zarza, Heliot

    2016-10-01

    We detected macroscopic Sarcocystis cysts in a Northern Shoveler ( Anas clypeata ) in the Lerma Marshes, State of Mexico, Mexico in February 2014. The 5.0×2.0-mm macrocysts in the breast muscle of the duck were ovoid and yellow. Using an optical microscope, we saw parasitic forms of a Sarcocystis sp. among muscular fibers; the cysts measured 3.5×1.1 mm. The external wall had a smooth surface and the internal wall had a spongy texture. We identified the macrocysts as Sarcocystis rileyi according to sequences of the 18S rRNA gene, 28S rRNA gene, and ITS-1 region. Sarcocystosis should be considered in similar assessments in wild waterfowl in Mexico. Awareness of S. rileyi among anatids in the Lerma Marshes will contribute to more-effective conservation and management actions.

  10. Occurrence of Cryptosporidium andersoni in Brazilian cattle

    USDA-ARS?s Scientific Manuscript database

    Feces were collected from 68 cattle, 1 to 12 mo of age, on 12 farms in the municipality of Campos dos Goytacazes, Rio de Janeiro, Brazil, and examined for the presence of Cryptosporidium sp. All samples were subjected to molecular analysis by polymerase chain reaction (nested PCR) of the 18S rRNA. F...

  11. Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus).

    PubMed

    Pawar, Rahul Mohanchandra; Poornachandar, Anantula; Arun, Attur Shanmugam; Manikandan, Santhanam; Shivaji, Sisinthy

    2011-12-15

    Hepatozoon species are parasites that infect a wide variety of domestic and wild animals. The objective of the study was to detect the occurrence of Hepatozoon ursi in Indian sloth bears and to characterize the parasite based on phylogenetic analysis of the partial 18S rRNA gene sequence. Hepatozoon infection could be detected in 38 (70%) out of fifty-four blood samples of Indian sloth bears (captive and wild), suggestive of high prevalence of Hepatozoon infection in Indian sloth bears. Sequencing of partial 18S rRNA gene of the positive samples and BLAST analysis indicated that the nearest phylogenetic neighbour was H. ursi with which they exhibited 99-100% similarity. Additionally, Hepatozoon sp. isolated from wild sloth bears of India were identical to those in captive sloth bears and phylogenetically related to H. ursi reported from Japanese black bears from Japan. To our knowledge, this is the first report on the molecular characterization of H. ursi infection in Indian sloth bears. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. First molecular detection and characterization of Hepatozoon and Sarcocystis spp. in field mice and voles from Japan.

    PubMed

    Moustafa, Mohamed Abdallah Mohamed; Shimozuru, Michito; Mohamed, Wessam; Taylor, Kyle Rueben; Nakao, Ryo; Sashika, Mariko; Tsubota, Toshio

    2017-08-01

    Sarcocystis and Hepatozoon species are protozoan parasites that are frequently detected in domestic and wild animals. Rodents are considered common intermediate and paratenic hosts for several Sarcocystis and Hepatozoon species. Here, blood DNA samples from a total of six rodents, including one Myodes rutilus, one Myodes rufocanus, and four Apodemus speciosus, collected from Hokkaido, Japan, were shown by conventional PCR of the 18S ribosomal RNA (rRNA) gene to contain Sarcocystis and Hepatozoon DNA. Sequencing of the DNA detected one Sarcocystis sp. in the M. rufocanus sample and two different Hepatozoon spp. in the M. rutilus and A. speciosus samples. Phylogenetic analysis showed that the detected Sarcocystis sp. sequence grouped with GenBank Sarcocystis sequences from rodents, snakes, and raccoons from Japan and China. The 18S rRNA partial gene sequences of both detected Hepatozoon spp. clustered with GenBank Hepatozoon sequences from snakes, geckos and voles in Europe, Africa, and Asia. This study provides evidence that wild rodents have a role in the maintenance of Sarcocystis and Hepatozoon species on the island of Hokkaido.

  13. Hepatozoon caimani in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil.

    PubMed

    Bouer, Andréa; André, Marcos Rogério; Gonçalves, Luiz Ricardo; Luzzi, Mayara de Cássia; Oliveira, Juliana Paula de; Rodrigues, Adriana Carlos; Varani, Alessandro de Melo; Miranda, Vitor Fernandes Oliveira de; Perles, Lívia; Werther, Karin; Machado, Rosangela Zacarias

    2017-01-01

    Hepatozoon species are the most common intracellular hemoparasite found in reptiles. Hepatozoon caimani, whose vectors are Culex mosquitoes, has been detected in a high prevalence among caimans in Brazil by blood smears examinations. The present work aimed to detect and characterize the Hepatozoon spp. found in 33 caimans (24 free-ranging and 9 captive; 28 males and 5 females) (Caiman crocodilus yacare) sampled at Poconé, North Pantanal, state of Mato Grosso, Brazil, using blood smears examinations and molecular techniques. Hepatozoon spp.-gametocytes were found in 70.8% (17/24) and 88.8% (8/9) of blood smears from free-ranging and captive caimans, respectively. Hepatozoon spp. 18S rRNA DNA was found in 79.2% (19/24) and 88.8% (8/9) of free-ranging and captive caimans, respectively. Comparative analysis of parasitized and non-parasitized erythrocytes showed that all analyzed features were significantly different (P<0.05) for both linear and area dimensions. Phylogenetic analysis based on 18S rRNA sequences grouped the Hepatozoon spp. sequences detected in the present study together with H. caimani, recently detected in caimans in southern Pantanal.

  14. Hepatozoon canis infection in Slovakia: imported or autochthonous?

    PubMed

    Majláthová, Viktória; Hurníková, Zuzana; Majláth, Igor; Petko, Branislav

    2007-01-01

    Tissue samples from nine red foxes (four samples of striated muscle tissue and five samples of heart tissue) that originated from the Michalovce district (Slovakia), an area with endemic occurrence of canine babesiosis were examined by PCR method using primers amplifying a fragment of the 18S rRNA spanning the V4 region of Babesia and Theileria. An unexpected determination of 450 bp DNA fragment of Hepatozoon canis was found in four samples. Partial sequences of the 18S rRNA gene from the H. canis showed 100% similarity with the sequence from Brasil isolate of H. canis from a pampas fox (Pseudalopex gymnocercus) (AY471615) as well as from a fox in Spain (AY150067) and from a dog in Brazil (AY864677). In the present study, we report the first PCR detection of Hepatozoon canis in a naturally infected red fox from Slovakia, a Rhipicephalus sanguineus-free region. We assume that the infection was spread by infected R. sanguineus that might have been brought to Slovakia by travelers, by golden jackals, or by foxes migrating because of expansion of golden jackals and environmental and climate changes.

  15. Molecular characterization of Trichuris serrata.

    PubMed

    Ketzis, Jennifer K; Verma, Ashutosh; Burgess, Graham

    2015-05-01

    Trichuris serrata, a whipworm of cats, can cause inflammation in the cecum and upper portion of the large intestine. It is unknown if the virulence and pathology of T. serrata differ from Trichuris campanula, the other species in cats. Distinguishing the species based on egg size is challenging. In addition, Trichuris eggs can be difficult to distinguish from Capillaria spp. This paper presents the first molecular description of T. serrata. The 18S ribosomal RNA (rRNA) gene was sequenced from male adult worms sourced from two unrelated cats on St. Kitts. Based on the analysis of 651 base pairs, T. serrata was found to be different than any other Trichuris species for which published sequencing of the 18S rRNA gene is available. A dendrogram was developed using Molecular Evolutionary Genetics Analysis version 6.0, and evolutionary history was inferred using the minimum evolution method. T. serrata was found to be most closely related to Trichuris vulpis, the Trichuris of dogs. Further development of the methodology could enable distinguishing T. serrata, T. campanula, and Capillaria spp. infections in cats and aid in diagnosis.

  16. The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.

    PubMed

    Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C

    1994-12-01

    Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.

  17. Roseomonas wooponensis sp. nov., isolated from wetland freshwater.

    PubMed

    Lee, Ji Hee; Kim, Mi Sun; Baik, Keun Sik; Kim, Hyang Mi; Lee, Kang Hyun; Seong, Chi Nam

    2015-11-01

    A non-motile, cocobacilli-shaped and pink-pigmented bacterium, designated strain WW53T, was isolated from wetland freshwater (Woopo wetland, Republic of Korea). Cells were Gram-stain-negative, catalase- and oxidase-positive. The major fatty acids were C18 : 1ω7c/C18 : 1ω6c and C16 : 0.The predominant quinone and polyamine were ubiquinone 10 (Q-10) and spermidine, respectively. The DNA G+C content was 71 mol%. The major polar lipids were phosphatidylethanolamine, phosphatidylcholine and an unknown aminolipid. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain WW53T belongs to the family Acetobacteraceae, and is related to the genus Roseomonas. Strain WW53T was most closely related to Roseomonas stagni HS-69T (95.3 % 16S rRNA gene sequence similarity). Results of a polyphasic taxonomy study suggested that the isolate represents a novel species in the genus Roseomonas, for which the name Roseomonas wooponensis sp. nov. is proposed. The type strain is WW53T ( = KCTC 32534T = JCM 19527T).

  18. Ancient Mitochondrial DNA Analyses of Ascaris Eggs Discovered in Coprolites from Joseon Tomb

    PubMed Central

    Oh, Chang Seok; Seo, Min; Hong, Jong Ha; Chai, Jong-Yil; Oh, Seung Whan; Park, Jun Bum; Shin, Dong Hoon

    2015-01-01

    Analysis of ancient DNA (aDNA) extracted from Ascaris is very important for understanding the phylogenetic lineage of the parasite species. When aDNAs obtained from a Joseon tomb (SN2-19-1) coprolite in which Ascaris eggs were identified were amplified with primers for cytochrome b (cyt b) and 18S small subunit ribosomal RNA (18S rRNA) gene, the outcome exhibited Ascaris specific amplicon bands. By cloning, sequencing, and analysis of the amplified DNA, we obtained information valuable for comprehending genetic lineage of Ascaris prevalent among pre-modern Joseon peoples. PMID:25925186

  19. Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

    PubMed Central

    Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

    2014-01-01

    Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

  20. The gut mycobiome of the Human Microbiome Project healthy cohort.

    PubMed

    Nash, Andrea K; Auchtung, Thomas A; Wong, Matthew C; Smith, Daniel P; Gesell, Jonathan R; Ross, Matthew C; Stewart, Christopher J; Metcalf, Ginger A; Muzny, Donna M; Gibbs, Richard A; Ajami, Nadim J; Petrosino, Joseph F

    2017-11-25

    Most studies describing the human gut microbiome in healthy and diseased states have emphasized the bacterial component, but the fungal microbiome (i.e., the mycobiome) is beginning to gain recognition as a fundamental part of our microbiome. To date, human gut mycobiome studies have primarily been disease centric or in small cohorts of healthy individuals. To contribute to existing knowledge of the human mycobiome, we investigated the gut mycobiome of the Human Microbiome Project (HMP) cohort by sequencing the Internal Transcribed Spacer 2 (ITS2) region as well as the 18S rRNA gene. Three hundred seventeen HMP stool samples were analyzed by ITS2 sequencing. Fecal fungal diversity was significantly lower in comparison to bacterial diversity. Yeast dominated the samples, comprising eight of the top 15 most abundant genera. Specifically, fungal communities were characterized by a high prevalence of Saccharomyces, Malassezia, and Candida, with S. cerevisiae, M. restricta, and C. albicans operational taxonomic units (OTUs) present in 96.8, 88.3, and 80.8% of samples, respectively. There was a high degree of inter- and intra-volunteer variability in fungal communities. However, S. cerevisiae, M. restricta, and C. albicans OTUs were found in 92.2, 78.3, and 63.6% of volunteers, respectively, in all samples donated over an approximately 1-year period. Metagenomic and 18S rRNA gene sequencing data agreed with ITS2 results; however, ITS2 sequencing provided greater resolution of the relatively low abundance mycobiome constituents. Compared to bacterial communities, the human gut mycobiome is low in diversity and dominated by yeast including Saccharomyces, Malassezia, and Candida. Both inter- and intra-volunteer variability in the HMP cohort were high, revealing that unlike bacterial communities, an individual's mycobiome is no more similar to itself over time than to another person's. Nonetheless, several fungal species persisted across a majority of samples, evidence that a core gut mycobiome may exist. ITS2 sequencing data provided greater resolution of the mycobiome membership compared to metagenomic and 18S rRNA gene sequencing data, suggesting that it is a more sensitive method for studying the mycobiome of stool samples.

  1. Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens.

    PubMed

    Lewis, William H; Sendra, Kacper M; Embley, T Martin; Esteban, Genoveva F

    2018-01-01

    Many anaerobic ciliated protozoa contain organelles of mitochondrial ancestry called hydrogenosomes. These organelles generate molecular hydrogen that is consumed by methanogenic Archaea, living in endosymbiosis within many of these ciliates. Here we describe a new species of anaerobic ciliate, Trimyema finlayi n. sp., by using silver impregnation and microscopy to conduct a detailed morphometric analysis. Comparisons with previously published morphological data for this species, as well as the closely related species, Trimyema compressum , demonstrated that despite them being similar, both the mean cell size and the mean number of somatic kineties are lower for T. finlayi than for T. compressum , which suggests that they are distinct species. This was also supported by analysis of the 18S rRNA genes from these ciliates, the sequences of which are 97.5% identical (6 substitutions, 1479 compared bases), and in phylogenetic analyses these sequences grouped with other 18S rRNA genes sequenced from previous isolates of the same respective species. Together these data provide strong evidence that T. finlayi is a novel species of Trimyema , within the class Plagiopylea. Various microscopic techniques demonstrated that T. finlayi n. sp. contains polymorphic endosymbiotic methanogens, and analysis of the endosymbionts' 16S rRNA gene showed that they belong to the genus Methanocorpusculum , which was confirmed using fluorescence in situ hybridization with specific probes. Despite the degree of similarity and close relationship between these ciliates, T. compressum contains endosymbiotic methanogens from a different genus, Methanobrevibacter . In phylogenetic analyses of 16S rRNA genes, the Methanocorpusculum endosymbiont of T. finlayi n. sp. grouped with sequences from Methanomicrobia, including the endosymbiont of an earlier isolate of the same species, ' Trimyema sp.,' which was sampled approximately 22 years earlier, at a distant (∼400 km) geographical location. Identification of the same endosymbiont species in the two separate isolates of T. finlayi n. sp. provides evidence for spatial and temporal stability of the Methanocorpusculum-T. finlayi n. sp. endosymbiosis. T. finlayi n. sp. and T. compressum provide an example of two closely related anaerobic ciliates that have endosymbionts from different methanogen genera, suggesting that the endosymbionts have not co-speciated with their hosts.

  2. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

    PubMed

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  3. Simple Real-Time PCR and Amplicon Sequencing Method for Identification of Plasmodium Species in Human Whole Blood.

    PubMed

    Lefterova, Martina I; Budvytiene, Indre; Sandlund, Johanna; Färnert, Anna; Banaei, Niaz

    2015-07-01

    Malaria is the leading identifiable cause of fever in returning travelers. Accurate Plasmodium species identification has therapy implications for P. vivax and P. ovale, which have dormant liver stages requiring primaquine. Compared to microscopy, nucleic acid tests have improved specificity for species identification and higher sensitivity for mixed infections. Here, we describe a SYBR green-based real-time PCR assay for Plasmodium species identification from whole blood, which uses a panel of reactions to detect species-specific non-18S rRNA gene targets. A pan-Plasmodium 18S rRNA target is also amplified to allow species identification or confirmation by sequencing if necessary. An evaluation of assay accuracy, performed on 76 clinical samples (56 positives using thin smear microscopy as the reference method and 20 negatives), demonstrated clinical sensitivities of 95.2% for P. falciparum (20/21 positives detected) and 100% for the Plasmodium genus (52/52), P. vivax (20/20), P. ovale (9/9), and P. malariae (6/6). The sensitivity of the P. knowlesi-specific PCR was evaluated using spiked whole blood samples (100% [10/10 detected]). The specificities of the real-time PCR primers were 94.2% for P. vivax (49/52) and 100% for P. falciparum (51/51), P. ovale (62/62), P. malariae (69/69), and P. knowlesi (52/52). Thirty-three specimens were used to test species identification by sequencing the pan-Plasmodium 18S rRNA PCR product, with correct identification in all cases. The real-time PCR assay also identified two samples with mixed P. falciparum and P. ovale infection, which was confirmed by sequencing. The assay described here can be integrated into a malaria testing algorithm in low-prevalence areas, allowing definitive Plasmodium species identification shortly after malaria diagnosis by microscopy. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

    PubMed

    Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

    2002-12-01

    The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

  5. Sequencing and Validation of Reference Genes to Analyze Endogenous Gene Expression and Quantify Yellow Dwarf Viruses Using RT-qPCR in Viruliferous Rhopalosiphum padi

    PubMed Central

    Wu, Keke; Liu, Wenwen; Mar, Thithi; Liu, Yan; Wu, Yunfeng; Wang, Xifeng

    2014-01-01

    The bird cherry-oat aphid (Rhopalosiphum padi), an important pest of cereal crops, not only directly sucks sap from plants, but also transmits a number of plant viruses, collectively the yellow dwarf viruses (YDVs). For quantifying changes in gene expression in vector aphids, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a touchstone method, but the selection and validation of housekeeping genes (HKGs) as reference genes to normalize the expression level of endogenous genes of the vector and for exogenous genes of the virus in the aphids is critical to obtaining valid results. Such an assessment has not been done, however, for R. padi and YDVs. Here, we tested three algorithms (GeNorm, NormFinder and BestKeeper) to assess the suitability of candidate reference genes (EF-1α, ACT1, GAPDH, 18S rRNA) in 6 combinations of YDV and vector aphid morph. EF-1α and ACT1 together or in combination with GAPDH or with GAPDH and 18S rRNA could confidently be used to normalize virus titre and expression levels of endogenous genes in winged or wingless R. padi infected with Barley yellow dwarf virus isolates (BYDV)-PAV and BYDV-GAV. The use of only one reference gene, whether the most stably expressed (EF-1α) or the least stably expressed (18S rRNA), was not adequate for obtaining valid relative expression data from the RT-qPCR. Because of discrepancies among values for changes in relative expression obtained using 3 regions of the same gene, different regions of an endogenous aphid gene, including each terminus and the middle, should be analyzed at the same time with RT-qPCR. Our results highlight the necessity of choosing the best reference genes to obtain valid experimental data and provide several HKGs for relative quantification of virus titre in YDV-viruliferous aphids. PMID:24810421

  6. Micromonospora halotolerans sp. nov., isolated from the rhizosphere of a Pisum sativum plant.

    PubMed

    Carro, Lorena; Pukall, Rüdiger; Spröer, Cathrin; Kroppenstedt, Reiner M; Trujillo, Martha E

    2013-06-01

    A filamentous actinomycete strain designated CR18(T) was isolated on humic acid agar from the rhizosphere of a Pisum sativum plant collected in Spain. This isolate was observed to grow optimally at 28 °C, pH 7.0 and in the presence of 5 % NaCl. Phylogenetic analyses based on the 16S rRNA gene sequence indicated a close relationship with the type strains of Micromonospora chersina and Micromonospora endolithica. A further analysis based on a concatenated DNA sequence stretch of 4,523 bp that included partial sequences of the atpD, gyrB, recA, rpoB and 16S rRNA genes clearly differentiated the new strain from recognized Micromonospora species compared. DNA-DNA hybridization studies further supported the taxonomic position of strain CR18(T) as a novel genomic species. Chemotaxonomic analyses which included whole cell sugars, polar lipids, fatty acid profiles and menaquinone composition confirmed the affiliation of the new strain to the genus Micromonospora and also highlighted differences at the species level. These studies were finally complemented with an array of physiological tests to help differentiate between the new strain and its phylogenetic neighbours. Consequently, strain CR18(T) (= CECT 7890(T) = DSM 45598(T)) is proposed as the type strain of a novel species, Micromonospora halotolerans sp. nov.

  7. Peptoniphilus catoniae sp. nov., isolated from a human faecal sample from a traditional Peruvian coastal community

    PubMed Central

    Patel, Nisha B.; Tito, Raul Y.; Obregón-Tito, Alexandra J.; O'Neal, Lindsey; Trujillo-Villaroel, Omar; Marin-Reyes, Luis; Troncoso-Corzo, Luzmila; Guija-Poma, Emilio; Lewis, Cecil M.

    2016-01-01

    A novel Gram-stain-positive, coccus-shaped, obligately anaerobic bacterium was isolated from a faecal sample obtained from an individual in a traditional community located off the southern coast of Peru. Comparative 16S rRNA gene sequence analysis showed the novel bacterium belonged to the genus Peptoniphilus but showed no particular relationship with any species, demonstrating less than 91 % 16S rRNA gene sequence similarity with all members of the genus. The major cellular fatty acids of the novel isolate were determined to be C10 : 0, C14 : 0, C16 : 0, C18 : 1ω9c and C18 : 2ω6,9c/anteiso-C18 : 0. The DNA G+C content was 34.4 mol%. End-products of metabolism from peptone-yeast-glucose broth (PYG) were determined to be acetate and butyrate. Based on the phenotypic, chemotaxonomic and phylogenetic results, the organism represents a novel species of the genus Peptoniphilus, for which the name Peptoniphilus catoniae sp. nov. is proposed. The type strain is M6.X2DT ( = DSM 29874T = CCUG 66798T). PMID:26907921

  8. Mixed heterolobosean and novel gregarine lineage genes from culture ATCC 50646: Long-branch artefacts, not lateral gene transfer, distort α-tubulin phylogeny.

    PubMed

    Cavalier-Smith, Thomas

    2015-04-01

    Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.

  9. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    PubMed

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  10. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    USDA-ARS?s Scientific Manuscript database

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  11. Streptococcus pharyngis sp. nov., a novel streptococcal species isolated from the respiratory tract of wild rabbits.

    PubMed

    Vela, Ana I; Casas-Díaz, Encarna; Lavín, Santiago; Domínguez, Lucas; Fernández-Garayzábal, Jose F

    2015-09-01

    Four isolates of an unknown Gram-stain-positive, catalase-negative coccus-shaped organism, isolated from the pharynx of four wild rabbits, were characterized by phenotypic and molecular genetic methods. The micro-organisms were tentatively assigned to the genus Streptococcus based on cellular morphological and biochemical criteria, although the organisms did not appear to correspond to any species with a validly published name. Comparative 16S rRNA gene sequencing confirmed their identification as members of the genus Streptococcus, being most closely related phylogenetically to Streptococcus porcorum 682-03(T) (96.9% 16S rRNA gene sequence similarity). Analysis of rpoB and sodA gene sequences showed divergence values between the novel species and S. porcorum 682-03(T) (the closest phylogenetic relative determined from 16S rRNA gene sequences) of 18.1 and 23.9%, respectively. The novel bacterial isolate could be distinguished from the type strain of S. porcorum by several biochemical characteristics, such as the production of glycyl-tryptophan arylamidase and α-chymotrypsin, and the non-acidification of different sugars. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be assigned to a novel species of the genus Streptococcus, and named Streptococcus pharyngis sp. nov. The type strain is DICM10-00796B(T) ( = CECT 8754(T) = CCUG 66496(T)).

  12. Sarcocystis spp. in domestic sheep in Kunming City, China: prevalence, morphology, and molecular characteristics.

    PubMed

    Hu, Jun-Jie; Huang, Si; Wen, Tao; Esch, Gerald W; Liang, Yu; Li, Hong-Liang

    2017-01-01

    Sheep (Ovis aries) are intermediate hosts for at least six named species of Sarcocystis: S. tenella, S. arieticanis, S. gigantea, S. medusiformis, S. mihoensis, and S. microps. Here, only two species, S. tenella and S. arieticanis, were found in 79 of 86 sheep (91.9%) in Kunming, China, based on their morphological characteristics. Four genetic markers, i.e., 18S rRNA gene, 28S rRNA gene, mitochondrial cox1 gene, and ITS-1 region, were sequenced and characterized for the two species of Sarcocystis. Sequences of the three former markers for S. tenella shared high identities with those of S. capracanis in goats, i.e., 99.0%, 98.3%, and 93.6%, respectively; the same three marker sequences of S. arieticanis shared high identities with those of S. hircicanis in goats, i.e., 98.5%, 96.5%, and 92.5%, respectively. No sequences in GenBank were found to significantly resemble the ITS-1 regions of S. tenella and S. arieticanis. Identities of the four genetic markers for S. tenella and S. arieticanis were 96.3%, 95.4%, 82.5%, and 66.2%, respectively. © J.-J. Hu et al., published by EDP Sciences, 2017.

  13. Active fungi amidst a marine subsurface RNA paleome

    NASA Astrophysics Data System (ADS)

    Orsi, W.; Biddle, J.; Edgcomb, V.

    2012-12-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Since extracellular DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA signatures by amplicon pyrosequencing, metazoan, plant, and diatom rRNA signatures were recovered from marine sediments up to 2.7 million years old, suggesting that rRNA may be much more stable than previously considered in the marine subsurface. This finding confirms the concept of a paleome, extending it to include rRNA. Within the same dataset, unique profiles of fungi were found across a range of marine subsurface provinces exhibiting statistically significant correlations with total organic carbon (TOC), sulfide, and dissolved inorganic carbon (DIC). Sequences from metazoans, plants and diatoms showed different correlation patterns, consistent with a depth-controlled paleome. The fungal correlations with geochemistry allow the inference that some fungi are active and adapted for survival in the marine subsurface. A metatranscriptomic analysis of fungal derived mRNA confirms that fungi are metabolically active and utilize a range of organic and inorganic substrates in the marine subsurface.

  14. Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

    PubMed Central

    Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

    2017-01-01

    The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the periphery of nucleoli. PMID:29190286

  15. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    PubMed Central

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  16. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    PubMed

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  17. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

    PubMed

    Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

    2017-11-02

    One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

  19. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  20. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  1. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    PubMed

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Nutrient and Rainfall Additions Shift Phylogenetically Estimated Traits of Soil Microbial Communities.

    PubMed

    Gravuer, Kelly; Eskelinen, Anu

    2017-01-01

    Microbial traits related to ecological responses and functions could provide a common currency facilitating synthesis and prediction; however, such traits are difficult to measure directly for all taxa in environmental samples. Past efforts to estimate trait values based on phylogenetic relationships have not always distinguished between traits with high and low phylogenetic conservatism, limiting reliability, especially in poorly known environments, such as soil. Using updated reference trees and phylogenetic relationships, we estimated two phylogenetically conserved traits hypothesized to be ecologically important from DNA sequences of the 16S rRNA gene from soil bacterial and archaeal communities. We sampled these communities from an environmental change experiment in California grassland applying factorial addition of late-season precipitation and soil nutrients to multiple soil types for 3 years prior to sampling. Estimated traits were rRNA gene copy number, which contributes to how rapidly a microbe can respond to an increase in resources and may be related to its maximum growth rate, and genome size, which suggests the breadth of environmental and substrate conditions in which a microbe can thrive. Nutrient addition increased community-weighted mean estimated rRNA gene copy number and marginally increased estimated genome size, whereas precipitation addition decreased these community means for both estimated traits. The effects of both treatments on both traits were associated with soil properties, such as ammonium, available phosphorus, and pH. Estimated trait responses within several phyla were opposite to the community mean response, indicating that microbial responses, although largely consistent among soil types, were not uniform across the tree of life. Our results show that phylogenetic estimation of microbial traits can provide insight into how microbial ecological strategies interact with environmental changes. The method could easily be applied to any of the thousands of existing 16S rRNA sequence data sets and offers potential to improve our understanding of how microbial communities mediate ecosystem function responses to global changes.

  3. Eukarya associated with the stony coral Oculina patagonica from the Mediterranean Sea.

    PubMed

    Rubio-Portillo, Esther; Souza-Egipsy, Virginia; Ascaso, Carmen; de Los Rios Murillo, Asunción; Ramos-Esplá, Alfonso A; Antón, Josefa

    2014-10-01

    Oculina patagonica is a putative alien scleractinian coral from the Southwest Atlantic that inhabits across the Mediterranean Sea. Here, we have addressed the diversity of Eukarya associated with this coral and its changes related to the environmental conditions and coral status. A total of 46 colonies of O. patagonica were taken from Alicante coast (Spain) and Pietra Ligure coast (Italy) and analyzed using denaturing gradient gel electrophoresis (DGGE) of the small-subunit 18S rRNA and 16S plastid rRNA genes, internal transcribed spacer region 2 (ITS 2) analyses, and electron microscopy. Our results show that Eukarya and plastid community associated to O. patagonica change with environmental conditions and coral status. Cryptic species, which can be difficult to identify by optical methods, were distinguished by 18S rRNA gene DGGE: the barnacle Megatrema anglicum, which was detected at two locations, and two boring sponges related to Cliona sp. and Siphonodictyon coralliphagum detected in samples from Tabarca and Alicante Harbour, respectively. Eukaryotic phototrophic community from the skeletal matrix of healthy corals was dominated by Ochrosphaera sp. while bleached corals from the Harbour and Tabarca were associated to different uncultured phototrophic organism. Differences in ultrastructural morphologies of the zooxanthellae between healthy and bleached corals were observed. Nevertheless, no differences were found in Symbiodinium community among time, environments, coral status and location, showing that O. patagonica hosted only one genotype of Symbiodinium belonging to clade B2. The fact that this clade has not been previously detected in other Mediterranean corals and is more frequent in the tropical Western Atlantic, is a new evidence that O. patagonica is an alien species in the Mediterranean Sea. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Iron encrustations on filamentous algae colonized by Gallionella-related bacteria in a metal-polluted freshwater stream

    NASA Astrophysics Data System (ADS)

    Mori, J. F.; Neu, T. R.; Lu, S.; Händel, M.; Totsche, K. U.; Küsel, K.

    2015-09-01

    Filamentous macroscopic algae were observed in slightly acidic to circumneutral (pH 5.9-6.5), metal-rich stream water that leaked out from a former uranium mining district (Ronneburg, Germany). These algae differed in color and morphology and were encrusted with Fe-deposits. To elucidate their potential interaction with Fe(II)-oxidizing bacteria (FeOB), we collected algal samples at three time points during summer 2013 and studied the algae-bacteria-mineral compositions via confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM), Fourier transform infrared (FTIR) spectra, and a 16S and 18S rRNA gene-based bacterial and algae community analysis. Surprisingly, sequencing analysis of 18S rRNA gene regions of green and brown algae revealed high homologies with the freshwater algae Tribonema (99.9-100 %). CLSM imaging indicated a loss of active chloroplasts in the algae cells, which may be responsible for the change in color in

  5. Identification of RNA species in the RNA-toxin complex and structure of the complex in Clostridium botulinum type E.

    PubMed

    Kitamura, Masaru

    2002-02-15

    Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).

  6. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  7. Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

    PubMed

    Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

    2017-12-01

    To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

  8. Lucinidae/sulfur-oxidizing bacteria: ancestral heritage or opportunistic association? Further insights from the Bohol Sea (the Philippines).

    PubMed

    Brissac, Terry; Merçot, Hervé; Gros, Olivier

    2011-01-01

    The first studies of the 16S rRNA gene diversity of the bacterial symbionts found in lucinid clams did not clarify how symbiotic associations had evolved in this group. Indeed, although species-specific associations deriving from a putative ancestral symbiotic association have been described (coevolution scenario), associations between the same bacterial species and various host species (opportunistic scenario) have also been described. Here, we carried out a comparative molecular analysis of hosts, based on 18S and 28S rRNA gene sequences, and of symbionts, based on 16S rRNA gene sequences, to determine as to which evolutionary scenario led to modern lucinid/symbiont associations. For all sequences analyzed, we found only three bacterial symbiont species, two of which are harbored by lucinids colonizing mangrove swamps. The last symbiont is the most common and was found to be independent of biotope or depth. Another interesting feature is the similarity of ctenidial organization of lucinids from the Philippines to those described previously, with the exception that two bacterial morphotypes were observed in two different species (Gloverina rectangularis and Myrtea flabelliformis). Thus, there is apparently no specific association between Lucinidae and their symbionts, the association taking place according to which bacterial species is present in the environment. FEMS Microbiology Ecology © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. No claim to original French government works.

  9. Whole transcriptome analysis of the poultry red mite Dermanyssus gallinae (De Geer, 1778).

    PubMed

    Schicht, Sabine; Qi, Weihong; Poveda, Lucy; Strube, Christina

    2014-03-01

    SUMMARY Although the poultry red mite Dermanyssus gallinae (De Geer, 1778) is the major parasitic pest in poultry farming causing substantial economic losses every year, nucleotide data are rare in the public databases. Therefore, de novo sequencing covering the transcriptome of D. gallinae was carried out resulting in a dataset of 232 097 singletons and 42 130 contiguous sequences (contigs) which were subsequently clustered into 24 140 isogroups consisting of 35 788 isotigs. After removal of sequences possibly originating from bacteria or the chicken host, 267 464 sequences (231 657 singletons, 56 contigs and 35 751 isotigs) remained, of which 10·3% showed homology to proteins derived from other organisms. The most significant Blast top-hit species was the mite Metaseiulus occidentalis followed by the tick Ixodes scapularis. To gain functional knowledge of D. gallinae transcripts, sequences were mapped to Gene Ontology terms, Kyoto Encyclopedia of Gene and Genomes (KEGG) pathways and parsed to InterProScan. The transcriptome dataset provides new insights in general mite genetics and lays a foundation for future studies on stage-specific transcriptomics as well as genomic, proteomic, and metabolomic explorations and might provide new perspectives to control this parasitic mite by identifying possible drug targets or vaccine candidates. It is also worth noting that in different tested species of the class Arachnida no 28S rRNA was detectable in the rRNA profile, indicating that 28S rRNA might consists of two separate, hydrogen-bonded fragments, whose (heat-induced) disruption may led to co-migration with 18S rRNA.

  10. Bilingual/E.S.L. Materials Development, Grades 1-8, 1987. OREA Report.

    ERIC Educational Resources Information Center

    Berney, Tomi D.; Friedman, Grace Ibanez

    New York City's program in Bilingual/E.S.L. Materials Development, Grade 1-8 was established to develop and/or update curricula and informational materials relevant to bilingual and English-as-a-Second-Language instruction. Curriculum development teams worked on independent activities. The project had 10 proposed curriculum initiatives, but the…

  11. Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

    NASA Technical Reports Server (NTRS)

    Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

    1996-01-01

    A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

  12. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

    PubMed

    Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

    2002-10-15

    Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

  13. Acinetobacter apis sp. nov., isolated from the intestinal tract of a honey bee, Apis mellifera.

    PubMed

    Kim, Pil Soo; Shin, Na-Ri; Kim, Joon Yong; Yun, Ji-Hyun; Hyun, Dong-Wook; Bae, Jin-Woo

    2014-08-01

    A novel Gram-negative, obligate aerobic, non-motile, and both coccobacillus- and bacillus-shaped bacterium, designated strain HYN18(T), was isolated from the intestinal tract of a honey bee (Apis mellifera). The isolate was oxidase-negative and catalase-positive. Strain HYN18(T) showed optimum growth at 25°C, pH 6-7, and in the presence of 1% (w/v) NaCl in trypticase soy broth medium. The isolate was negative for hydrolyses of starch, casein, gelatin and urea, indole production from tryptone and hemolysis on sheep blood agar. A phylogenetic analysis based on the 16S rRNA gene and rpoB gene sequence showed that strain HYN18(T) was most closely related to Acinetobacter nectaris SAP 763.2(T) and A. boissieri SAP 284.1(T) with 98.3% and 98.1% similarity (16S rRNA gene), respectively, and 84.4% similarity with Acinetobacter nectaris SAP 763.2(T) (rpoB gene). The major cellular fatty acids were summed features 3 (comprising C16:1ω7c /C16:1ω6c ), C12:0 and C16:0. The main isoprenoid quinone was ubiquinone-9 (Q-9). The polar lipids of strain HYN18(T) were phosphatidylethanolamine, three unidentified lipids, an unidentified phospholipid and an unidentified glycolipid. The DNA G+C content was 40.6 mol%. DNA-DNA hybridization experiments indicated less than 33 ± 10% relatedness to the closest phylogenetic species, Acinetobacter nectaris SAP 763.2(T). Thus, the phenotypic, phylogenetic and genotypic analyses indicate that strain HYN18(T) is a novel species within the genus Acinetobacter, for which the name Acinetobacter apis is proposed. The type strain is HYN18(T) (=KACC 16906(T) =JCM 18575(T)).

  14. Soil fungal community shift evaluation as a potential cadaver decomposition indicator.

    PubMed

    Chimutsa, Monica; Olakanye, Ayodeji O; Thompson, Tim J U; Ralebitso-Senior, T Komang

    2015-12-01

    Fungi metabolise organic matter in situ and so alter both the bio-/physico-chemical properties and microbial community structure of the ecosystem. In particular, they are responsible reportedly for specific stages of decomposition. Therefore, this study aimed to extend previous bacteria-based forensic ecogenomics research by investigating soil fungal community and cadaver decomposition interactions in microcosms with garden soil (20 kg, fresh weight) and domestic pig (Sus scrofa domesticus) carcass (5 kg, leg). Soil samples were collected at depths of 0-10 cm, 10-20 cm and 20-30 cm on days 3, 28 and 77 in the absence (control -Pg) and presence (experimental +Pg) of Sus scrofa domesticus and used for total DNA extraction and nested polymerase chain reaction and denaturing gradient gel electrophoresis (PCR-DGGE) profiling of the 18S rRNA gene. The Shannon-Wiener (H') community diversity indices were 1.25±0.21 and 1.49±0.30 for the control and experimental microcosms, respectively, while comparable Simpson species dominance (S) values were 0.65±0.109 and 0.75±0.015. Generally, and in contrast to parallel studies of the bacterial 16S rRNA and 16S rDNA profiles, statistical analysis (t-test) of the 18S dynamics showed no mathematically significant shifts in fungal community diversity (H'; p=0.142) and dominance (S; p=0.392) during carcass decomposition, necessitating further investigations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Molecular diversity of the rumen microbiome of Norwegian reindeer on natural summer pasture.

    PubMed

    Sundset, Monica A; Edwards, Joan E; Cheng, Yan Fen; Senosiain, Roberto S; Fraile, Maria N; Northwood, Korinne S; Praesteng, Kirsti E; Glad, Trine; Mathiesen, Svein D; Wright, André-Denis G

    2009-02-01

    The molecular diversity of the rumen microbiome was investigated in five semi-domesticated adult female Norwegian reindeer (Rangifer tarandus tarandus) grazing on natural summer pastures on the coast of northern Norway (71.00 degrees N, 25.30 degrees E). Mean population densities (numbers per gram wet weight) of methanogenic archaea, rumen bacteria and ciliate protozoa, estimated using quantitative real-time polymerase chain reaction (PCR), were 3.17x10(9), 5.17x10(11) and 4.02x10(7), respectively. Molecular diversity of rumen methanogens was revealed using a 16S rRNA gene library (54 clones) constructed using pooled PCR products from the whole rumen contents of the five individual reindeer. Based upon a similarity criterion of <97%, a total of 19 distinct operational taxonomic units (OTUs) were identified, nine of which are potential new species. The 16S rRNA sequences generated from the reindeer rumen exhibited a high degree of sequence similarity to methanogens affiliated with the families Methanobacteriaceae (14 OTUs) and Methanosarcinaceae (one OTU). Four of the OTUs detected belonged to a group of uncultivated archaea previously found in domestic ruminants and thought to be dominant in the rumen together with Methanobrevibacter spp. Denaturing gradient gel electrophoresis profiling of the rumen bacterial 16S rRNA gene and the protozoal 18S rRNA gene indicated a high degree of animal variation, although some bands were common to all individuals. Automated ribosomal intergenic spacer analysis (ARISA) profiling of the ruminal Neocallimastigales population indicated that the reindeer are likely to contain more than one type of anaerobic fungus. The ARISA profile from one animal was distinct from the other four. This is the first molecular investigation of the ruminal methanogenic archaea in reindeer, revealing higher numbers than expected based on methane emission data available. Also, many of the reindeer archaeal 16S rRNA gene sequences were similar to those reported in domesticated ruminants in Australia, Canada, China, New Zealand and Venezuela, supporting previous findings that there seems to be no host type or geographical effect on the methanogenic archaea community structure in ruminants.

  16. Cyanobacterial endobionts within a major marine planktonic calcifier (Globigerina bulloides, Foraminifera) revealed by 16S rRNA metabarcoding

    NASA Astrophysics Data System (ADS)

    Bird, Clare; Darling, Kate F.; Russell, Ann D.; Davis, Catherine V.; Fehrenbacher, Jennifer; Free, Andrew; Wyman, Michael; Ngwenya, Bryne T.

    2017-02-01

    We investigated the possibility of bacterial symbiosis in Globigerina bulloides, a palaeoceanographically important, planktonic foraminifer. This marine protist is commonly used in micropalaeontological investigations of climatically sensitive subpolar and temperate water masses as well as wind-driven upwelling regions of the world's oceans. G. bulloides is unusual because it lacks the protist algal symbionts that are often found in other spinose species. In addition, it has a large offset in its stable carbon and oxygen isotopic compositions compared to other planktonic foraminifer species, and also that predicted from seawater equilibrium. This is suggestive of novel differences in ecology and life history of G. bulloides, making it a good candidate for investigating the potential for bacterial symbiosis as a contributory factor influencing shell calcification. Such information is essential to evaluate fully the potential response of G. bulloides to ocean acidification and climate change. To investigate possible ecological interactions between G. bulloides and marine bacteria, 18S rRNA gene sequencing, fluorescence microscopy, 16S rRNA gene metabarcoding and transmission electron microscopy (TEM) were performed on individual specimens of G. bulloides (type IId) collected from two locations in the California Current. Intracellular DNA extracted from five G. bulloides specimens was subjected to 16S rRNA gene metabarcoding and, remarkably, 37-87 % of all 16S rRNA gene sequences recovered were assigned to operational taxonomic units (OTUs) from the picocyanobacterium Synechococcus. This finding was supported by TEM observations of intact Synechococcus cells in both the cytoplasm and vacuoles of G. bulloides. Their concentrations were up to 4 orders of magnitude greater inside the foraminifera than those reported for the California Current water column and approximately 5 % of the intracellular Synechococcus cells observed were undergoing cell division. This suggests that Synechococcus is an endobiont of G. bulloides type IId, which is the first report of a bacterial endobiont in the planktonic foraminifera. We consider the potential roles of Synechococcus and G. bulloides within the relationship and the need to determine how widespread the association is within the widely distributed G. bulloides morphospecies. The possible influence of Synechococcus respiration on G. bulloides shell geochemistry is also explored.

  17. Prevalence and Molecular Characterization of Cyclospora cayetanensis, Henan, China

    PubMed Central

    Zhou, Yang; Lv, Biao; Wang, Qiang; Wang, Rongjun; Jian, Fuchun; Ning, Changshen; Fu, Kanda; Wang, Yaqiang; Qi, Meng; Yao, Huixia; Zhao, Jinfeng; Zhang, Xiaoshan; Sun, Yanru; Shi, Ke; Arrowood, Michael J.; Xiao, Lihua

    2011-01-01

    To determine prevalence of Cyclospora cayetanensis infection in Henan, China, we conducted a study of 11,554 hospital patients. Prevalence was 0.70% (95% confidence interval 0.70% ± 0.15%), with all age groups infected. Most cases were found in the summer. Minor sequence polymorphisms were observed in the 18S rRNA gene of 35 isolates characterized. PMID:22000362

  18. An Unusual Accumulation of Ribosomal Multigene Families and Microsatellite DNAs in the XX/XY Sex Chromosome System in the Trans-Andean Catfish Pimelodella cf. chagresi (Siluriformes:Heptapteridae).

    PubMed

    Conde-Saldaña, Cristhian Camilo; Barreto, Cynthia Aparecida Valiati; Villa-Navarro, Francisco Antonio; Dergam, Jorge Abdala

    2018-02-01

    This work constitutes the first cytogenetic characterization of a trans-Andean species of Heptapteridae. The catfish Pimelodella cf. chagresi from the Upper Rio Magdalena was studied, applying standard cytogenetic techniques (Giemsa, C-banding, and argyrophilic nucleolar organizer region [Ag-NOR]) and fluorescence in situ hybridization techniques using repetitive DNA probes: microsatellites (CA 15 and GA 15 ) and ribosomal RNA (rRNA) multigene families (18S and 5S recombinant DNA [rDNA] probes). The species showed a unique diploid chromosome number 2n = 50 (32m [metacentrics] +14sm [submetacentrics] +4st [subtelocentrics]) and a XX/XY sex chromosomal system, where the heteromorphic Y-chromosome revealed a conspicuous accumulation of all the assayed domains of repetitive DNA. P. cf. chagresi karyotype shares common features with other Heptapteridae, such as the predominance of metacentric and submetacentric chromosomes, and one pair of subtelomeric nucleolar organizer regions (NORs). These results reflect an independent karyological identity of a trans-Andean species and the relevance of repetitive DNA sequences in the process of sex chromosome differentiation in fish; it is the first case of syntenic accumulation of rRNA multigene families (18S and 5S rDNA) and microsatellite sequences (CA 15 and GA 15 ) in a differentiated sex chromosome in Neotropical fish.

  19. Molecular characterization of Hepatozoon canis from farm dogs in Pakistan.

    PubMed

    Ahmad, Abdullah S; Saeed, Muhammad A; Rashid, Imran; Ashraf, Kamran; Shehzad, Wasim; Traub, Rebecca J; Baneth, Gad; Jabbar, Abdul

    2018-04-01

    Hepatozoon canis is a tick-borne pathogen of canids, which is distributed worldwide. However, very little is known about this protozoan parasite in Pakistan. This study provides the first molecular evidence of H. canis from farm dogs from three agro-ecological zones of Punjab, Pakistan. A conventional PCR targeting the 18S rRNA gene was used to characterize H. canis from farm dogs from three districts, namely Kasur, Rawalpindi, and Muzaffargarh, in Punjab. Of 341 blood samples tested, 155 (45.5%) were positive for H. canis, 73 (61.3%) from Kasur, 46 (42.5%) from Rawalpindi, and 36 (31.5%) from Muzaffargarh. Phylogenetic analyses revealed that 18S rRNA sequences of H. canis from this study clustered in three clades with those of H. canis from previously published studies to the exclusion of all other Hepatozoon spp. included in the analysis. This study provides the first insight into H. canis from farm dogs in Pakistan. Furthermore, it lays a foundation for future studies of the parasite to assess the impact of canine hepatozoonosis in dogs from various agro-ecological zones in Pakistan where pet ownership of dogs is increasing.

  20. Agaricicola taiwanensis gen. nov., sp. nov., an alphaproteobacterium isolated from the edible mushroom Agaricus blazei.

    PubMed

    Chu, Jiunn-Nan; Arun, A B; Chen, Wen-Ming; Chou, Jui-Hsing; Shen, Fo-Ting; Rekha, P D; Kämpfer, P; Young, Li-Sen; Lin, Shih-Yao; Young, Chiu-Chung

    2010-09-01

    A Gram-negative, beige-pigmented, aerobic, motile, club-shaped bacterium, designated strain CC-SBABM117(T), was isolated from the stipe of the edible mushroom Agaricus blazei Murrill. 16S rRNA gene sequence analysis demonstrated that the strain shared <93 % similarity with the type strains of species in the genera Pannonibacter, Methylopila, Nesiotobacter and Stappia. The organism was unable to produce acid from carbohydrates, but utilized a number of organic acids and amino acids. Ubiquinone 10 (Q-10) was the major respiratory quinone and C(18 : 1) ω 7c, C(19 : 0) cyclo ω 8c, C(16 : 0) and C(18 : 0) were the predominant fatty acids. The predominant polar lipids were diphosphatidylglycerol, phosphatidylcholine, phosphatidylglycerol and phosphatidylethanolamine. The DNA G+C content of strain CC-SBABM117(T) was 62.7 mol%. On the basis of 16S rRNA gene sequence analysis and chemotaxonomic and physiological data, strain CC-SBABM117(T) is considered to represent a novel species of a new genus, for which the name Agaricicola taiwanensis gen. nov., sp. nov. is proposed. The type strain of Agaricicola taiwanensis is CC-SBABM117(T) (=BCRC 17964(T) =CCM 7684(T)).

  1. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.

    PubMed

    Triadó-Margarit, Xavier; Casamayor, Emilio O

    2015-12-01

    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Molecular identification and characterization of piroplasm species in Hokkaido sika deer (Cervus nippon yesoensis), Japan.

    PubMed

    Elbaz, Elzahara; Moustafa, Mohamed Abdallah Mohamed; Lee, Kyunglee; Mohamed, Wessam Mohamed Ahmed; Nakao, Ryo; Shimozuru, Michito; Sashika, Mariko; Younis, Emad Elsayed Ahmed; El-Khodery, Sabry Ahmed; Tsubota, Toshio

    2017-08-01

    Babesia and Theileria species are tick-borne protozoan parasites that have a veterinary and zoonotic importance. In order to investigate the prevalence and genetic diversity of these parasites, a total of 269 sika deer blood DNA samples collected from Hokkaido, Japan, were examined for Babesia and Theileria species by touch-down PCR targeting the 18S rRNA gene. Reverse line blot (RLB) hybridization was then used to detect 12 piroplasm species. The results revealed that 95.5% (257/269), 94.1% (253/269), 14.1% (38/269), 87.7% (236/269) and 11.5% (31/269) of the examined PCR products hybridized with the probes which were designed to detect all Babesia and Theileria spp., all Theileria spp., all Babesia spp., Theileria sp. Thrivae and Babesia divergens-like, respectively. The 18S rRNA gene partial sequences were divided into Theileria sp. Thrivae, T. capreoli, B. divergens-like and an undescribed Babesia species. This study showed the first detection of the undescribed Babesia sp. from Japan. Therefore, more studies are required to understand the ecology of the newly detected tick-borne pathogens in Hokkaido. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. Estimating biodiversity of fungi in activated sludge communities using culture-independent methods.

    PubMed

    Evans, Tegan N; Seviour, Robert J

    2012-05-01

    Fungal diversity of communities in several activated sludge plants treating different influent wastes was determined by comparative sequence analyses of their 18S rRNA genes. Methods for DNA extraction and choice of primers for PCR amplification were both optimised using denaturing gradient gel electrophoresis profile patterns. Phylogenetic analysis revealed that the levels of fungal biodiversity in some communities, like those treating paper pulp wastes, were low, and most of the fungi detected in all communities examined were novel uncultured representatives of the major fungal subdivisions, in particular, the newly described clade Cryptomycota. The fungal populations in activated sludge revealed by these culture-independent methods were markedly different to those based on culture-dependent data. Members of the genera Penicillium, Cladosporium, Aspergillus and Mucor, which have been commonly identified in mixed liquor, were not identified in any of these plant communities. Non-fungal eukaryotic 18S rRNA genes were also amplified with the primer sets used. This is the first report where culture-independent methods have been applied to flocculated activated sludge biomass samples to estimate fungal community composition and, as expected, the data obtained gave a markedly different view of their population biodiversity compared to that based on culture-dependent methods.

  4. Molecular identification and real-time quantitative PCR (qPCR) for rapid detection of Thelohanellus kitauei, a Myxozoan parasite causing intestinal giant cystic disease in the Israel carp.

    PubMed

    Seo, Jung Soo; Jeon, Eun Ji; Kim, Moo Sang; Woo, Sung Ho; Kim, Jin Do; Jung, Sung Hee; Park, Myoung Ae; Jee, Bo Young; Kim, Jin Woo; Kim, Yi-Cheong; Lee, Eun Hye

    2012-06-01

    Intestinal giant-cystic disease (IGCD) of the Israel carp (Cyprinus carpio nudus) has been recognized as one of the most serious diseases afflicting inland farmed fish in the Republic of Korea, and Thelohanellus kitauei has been identified as the causative agent of the disease. Until now, studies concerning IGCD caused by T. kitauei in the Israel carp have been limited to morphological and histopathological examinations. However, these types of diagnostic examinations are relatively time-consuming, and the infection frequently cannot be detected in its early stages. In this study, we cloned the full-length 18S rRNA gene of T. kitauei isolated from diseased Israel carps, and carried out molecular identification by comparing the sequence with those of other myxosporeans. Moreover, conventional PCR and real-time quantitative PCR (qPCR) using oligonucleotide primers for the amplification of 18S rRNA gene fragment were established for further use as methods for rapid diagnosis of IGCD. Our results demonstrated that both the conventional PCR and real-time quantitative PCR systems applied herein are effective for rapid detection of T. kitauei spores in fish tissues and environmental water.

  5. Developing an Apicomplexan DNA Barcoding System to Detect Blood Parasites of Small Coral Reef Fishes.

    PubMed

    Renoux, Lance P; Dolan, Maureen C; Cook, Courtney A; Smit, Nico J; Sikkel, Paul C

    2017-08-01

    Apicomplexan parasites are obligate parasites of many species of vertebrates. To date, there is very limited understanding of these parasites in the most-diverse group of vertebrates, actinopterygian fishes. While DNA barcoding targeting the eukaryotic 18S small subunit rRNA gene sequence has been useful in identifying apicomplexans in tetrapods, identification of apicomplexans infecting fishes has relied solely on morphological identification by microscopy. In this study, a DNA barcoding method was developed that targets the 18S rRNA gene primers for identifying apicomplexans parasitizing certain actinopterygian fishes. A lead primer set was selected showing no cross-reactivity to the overwhelming abundant host DNA and successfully confirmed 37 of the 41 (90.2%) microscopically verified parasitized fish blood samples analyzed in this study. Furthermore, this DNA barcoding method identified 4 additional samples that screened negative for parasitemia, suggesting this molecular method may provide improved sensitivity over morphological characterization by microscopy. In addition, this PCR screening method for fish apicomplexans, using Whatman FTA preserved DNA, was tested in efforts leading to a more simplified field collection, transport, and sample storage method as well as a streamlining sample processing important for DNA barcoding of large sample sets.

  6. Investigation into potential transmission sources of Giardia duodenalis in a threatened marsupial (Petrogale penicillata).

    PubMed

    Vermeulen, Elke T; Ashworth, Deborah L; Eldridge, Mark D B; Power, Michelle L

    2015-07-01

    Assemblages of the protozoan parasite Giardia duodenalis common in humans and domestic species are increasingly identified in wildlife species, raising concern about the spill-over of pathogens from humans and domestic animals into wildlife. Here, the identity and prevalence of G. duodenalis in populations of a threatened marsupial, the brush-tailed rock-wallaby (Petrogale penicillata), was investigated. Identification of G. duodenalis isolates, across three loci (18S rRNA, β-giardin and gdh), from rock-wallaby fecal samples (n = 318) identified an overall detection rate of 6.3%. No significant difference in G. duodenalis detection was found among captive, wild and supplemented populations. Isolates were assigned to the zoonotic assemblages A and B at 18S rRNA, with sub-assemblages AI and BIV identified at the β-giardin and gdh loci, respectively. Assemblages AI and BIV have previously been identified in human clinical cases, but also in domestic animals and wildlife. The identification of these assemblages in brush-tailed rock-wallabies suggests there are transmission routes of G. duodenalis from humans or other animals to Australian wildlife, both in captivity and in the wild. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Evolutionary relationships among pathogenic Candida species and relatives.

    PubMed Central

    Barns, S M; Lane, D J; Sogin, M L; Bibeau, C; Weisburg, W G

    1991-01-01

    Small subunit rRNA sequences have been determined for 10 of the most clinically important pathogenic species of the yeast genus Candida (including Torulopsis [Candida] glabrata and Yarrowia [Candida] lipolytica) and for Hansenula polymorpha. Phylogenetic analyses of these sequences and those of Saccharomyces cerevisiae, Kluyveromyces marxianus var. lactis, and Aspergillus fumigatus indicate that Candida albicans, C. tropicalis, C. parapsilosis, and C. viswanathii form a subgroup within the genus. The remaining significant pathogen, T. glabrata, falls into a second, distinct subgroup and is specifically related to S. cerevisiae and more distantly related to C. kefyr (psuedotropicalis) and K. marxianus var. lactis. The 18S rRNA sequence of Y. lipolytica has evolved rapidly in relation to the other Candida sequences examined and appears to be only distantly related to them. As anticipated, species of several other genera appear to bear specific relationships to members of the genus Candida. PMID:2007550

  8. Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

    PubMed Central

    Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

    2017-01-01

    In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

  9. Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

    NASA Technical Reports Server (NTRS)

    Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

    1992-01-01

    A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

  10. mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.

    PubMed

    Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G

    2006-07-01

    Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.

  11. Molecular identification of Sarcocystis lutrae in the European otter (Lutra lutra) and the European badger (Meles meles) from the Czech Republic.

    PubMed

    Máca, Ondřej

    2018-03-01

    Muscular sarcosporidial infections by Sarcocystis lutrae (Apicomplexa: Sarcocystidae) from the otter (Lutra lutra) and badger (Meles meles) (Carnivora: Mustelidae) were found in the Czech Republic. As part of a diversity evaluation of Sarcocystis in wild carnivores during 2016-2017, samples of diaphragm, tongue and hind-limb muscles were collected from nine districts, examined by compression and characterized molecularly. Cyst walls were thin, with no visible protrusions, and histological sections of infected muscle tissue showed no host responses. Fourteen of 17 badgers (82% prevalence) and one otter (100% prevalence) were positive for sarcocysts. Sequence analyses at four loci (18S rRNA, 28S rRNA, ITS1 and cox1) confirmed the identity as S. lutrae. This is also the first report of a co-infection with muscular sarcocystosis and Trichinella in badger. The finding of Trichinella is important from the zoonotic point of view, since badgers are used for meat consumption. Similar and future monitoring of both parasitic taxa are needed.

  12. A new species of Drepanocephalus Dietz, 1909 (Digenea: Echinostomatidae) from the double-crested cormorant Phalacrocorax auritus (Lesson) (Aves: Phalacrocoracidae) in North America.

    PubMed

    Kudlai, Olena; Kostadinova, Aneta; Pulis, Eric E; Tkach, Vasyl V

    2015-03-01

    Drepanocephalus auritus n. sp. is described based on specimens from the double-crested cormorant Phalacrocorax auritus (Lesson) in North America. The new species differs from its congeners in its very narrow, elongate body, long uterine field and widely separated testes. Sequences of the nuclear rRNA gene cluster, spanning the 3' end of the nuclear ribosomal 18S rRNA gene, internal transcribed spacer region (ITS1+5.8S gene+ITS2) and partial 28S gene (2,345 bp), were identical in specimens collected from North Dakota, Minnesota and Mississippi, USA. Sequences of the 651 bp long fragment of the mitochondrial cox1 gene exhibited very low intraspecific variability (< 1%). Comparisons of the newly-generated sequences with those available in the GenBank indicate that the sequences from North America published under the name D. spathans Dietz, 1909 in fact represent D. auritus n. sp.

  13. Pulmonary embolization of immature Fascioloides magna causing fatal hemothorax confirmed by molecular technique in a heifer in the United States.

    PubMed

    Lee, Jung Keun; Rosser, Thomas Graham; Cooley, Jim

    2016-09-01

    The current report describes the use of a molecular technique to identify immature Fascioloides magna An 18-month-old Brangus heifer was found dead in the field without any prior clinical signs. The cause of death was exsanguination into the thoracic cavity associated with pulmonary embolization and infection by immature Fascioloides magna resulting in 2 large foci of pulmonary necrosis and focal arteriolar and lung rupture. The liver had a few random migratory tracts with typical iron and porphyrin fluke exhaust, but no identified fluke larvae. A single immature fluke was found in the lungs, and species level identification as F. magna was confirmed by DNA sequence analysis of the ribosomal internal transcribed spacer regions (ITS1 region, 5.8S rRNA gene, and ITS2) and of partial 28S rRNA gene sequence. This is one of only a few pulmonary fascioloidiasis cases associated with hemothorax in the veterinary literature. © 2016 The Author(s).

  14. Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

    PubMed Central

    O’Farrell, Katrina A.; Janssen, Peter H.

    1999-01-01

    Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

  15. Accurate analysis of prevalence of coccidiosis in individually identified wild cranes in inhabiting and migrating populations in Japan.

    PubMed

    Honma, Hajime; Suyama, Yoshihisa; Watanabe, Yuki; Matsumoto, Fumio; Nakai, Yutaka

    2011-11-01

    Eimeria gruis and E. reichenowi cause coccidiosis, a major parasitic disease of cranes. By non-invasive molecular approaches, we investigated the prevalence and genetic characterization of pathogens in two Japanese crane habitats; one is Hokkaido inhabited by the endangered red-crowned crane, and the other is Izumi in Kyushu where populations that consist mainly of vulnerable hooded and white-naped cranes migrate in winter. The non-invasively collected faecal samples from each wintering population were first subjected to host genomic DNA-targeted analyses to determine the sample origin and avoid sample redundancy. Extremely high prevalence was observed in the Izumi populations (> 90%) compared with the Hokkaido population (18-30%) by examining 470 specimens by microscopy and PCR-based capillary electrophoresis (PCR-CE), using genetic markers in the second internal transcribed spacer (ITS2). Correspondence analysis of PCR-CE data revealed differences in community composition of coccidia between hooded and white-naped cranes. 18S rRNA and ITS2 sequences were determined from single oocysts excreted by red-crowned and hooded cranes. Phylogenetic analysis of 18S rRNA suggested that E. reichenowi was polyphyletic while E. gruis was monophyletic. Together with PCR-CE data, these results indicate different host specificity among the E. reichenowi type. Our data suggest that E. reichenowi comprises multiple species. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  16. Prevalence of filarioid nematodes and trypanosomes in American robins and house sparrows, Chicago USA.

    PubMed

    Hamer, Gabriel L; Anderson, Tavis K; Berry, Garrett E; Makohon-Moore, Alvin P; Crafton, Jeffrey C; Brawn, Jeffrey D; Dolinski, Amanda C; Krebs, Bethany L; Ruiz, Marilyn O; Muzzall, Patrick M; Goldberg, Tony L; Walker, Edward D

    2013-12-01

    Hosts are commonly infected with a suite of parasites, and interactions among these parasites can affect the size, structure, and behavior of host-parasite communities. As an important step to understanding the significance of co-circulating parasites, we describe prevalence of co-circulating hemoparasites in two important avian amplification hosts for West Nile virus (WNV), the American robin (Turdus migratorius) and house sparrow (Passer domesticus), during the 2010-2011 in Chicago, Illinois, USA. Rates of nematode microfilariemia were 1.5% of the robins (n = 70) and 4.2% of the house sparrows (n = 72) collected during the day and 11.1% of the roosting robins (n = 63) and 0% of the house sparrows (n = 11) collected at night. Phylogenetic analysis of nucleotide sequences of the 18S rRNA and cytochrome oxidase subunit I (COI) genes from these parasites resolved two clades of filarioid nematodes. Microscopy revealed that 18.0% of American robins (n = 133) and 16.9% of house sparrows (n = 83) hosted trypanosomes in the blood. Phylogenetic analysis of nucleotide sequences from the 18s rRNA gene revealed that the trypanosomes fall within previously described avian trypanosome clades. These results document hemoparasites in the blood of WNV hosts in a center of endemic WNV transmission, suggesting a potential for direct or indirect interactions with the virus.

  17. Exploration of RNA structure spaces

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1991-01-01

    In order to understand the structure of real structure spaces, we are studying the 5S rRNA structure space experimentally. A plasmid containing a synthetic 5S rRNA gene, two rRNA promoters, and transcription terminators has been assembled. Assays are conducted to determine if the foreign 5S rRNA is expressed, and to see whether or not it is incorporated into ribosomes. Evolutionary competition is used to determine the relative fitness of strains containing the foreign 5S rRNA and a control 5S rRNA. By using site directed mutagenesis, a number of mutants can be made in order to study the boundaries of the structure space and how sharply defined they are. By making similar studies in the vicinity of structure space, it will be possible to determine how homogeneous the 5S rRNA structure space is. Useable experimental protocols have been developed, and a number of mutants have already been studied. Initial results suggest an explanation of why single stranded regions of the RNA are less subject to mutation than double stranded regions.

  18. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  19. Cleanups In My Community (CIMC) - Removals/Responses, National Layer

    EPA Pesticide Factsheets

    This data layer provides access to Removal/Response sites as part of the CIMC web service. Removals are hazardous substance releases that require immediate or short-term response actions. These are generally addressed under the Emergency Response program and are initially tracked centrally by the federal government's National Reporting Center. Cleanups in My Community maps and lists removals that are included in EPA??s epaosc.org site, and provides direct links to information on these sites. CIMC obtains updated removal data through a web service from epaosc.org just before the 18th of each month.The CIMC web service was initially published in 2013, but the data are updated on the 18th of each month. The full schedule for data updates in CIMC is located here: http://iaspub.epa.gov/enviro/data_update_v2.

  20. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  1. Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

    PubMed

    Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

    2012-04-01

    Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

  2. Two distinct extracellular RNA signatures released by a single cell type identified by microarray and next-generation sequencing

    PubMed Central

    Lässer, Cecilia; Shelke, Ganesh Vilas; Yeri, Ashish; Kim, Dae-Kyum; Crescitelli, Rossella; Raimondo, Stefania; Sjöstrand, Margareta; Gho, Yong Song; Van Keuren Jensen, Kendall; Lötvall, Jan

    2017-01-01

    ABSTRACT Cells secrete extracellular RNA (exRNA) to their surrounding environment and exRNA has been found in many body fluids such as blood, breast milk and cerebrospinal fluid. However, there are conflicting results regarding the nature of exRNA. Here, we have separated 2 distinct exRNA profiles released by mast cells, here termed high-density (HD) and low-density (LD) exRNA. The exRNA in both fractions was characterized by microarray and next-generation sequencing. Both exRNA fractions contained mRNA and miRNA, and the mRNAs in the LD exRNA correlated closely with the cellular mRNA, whereas the HD mRNA did not. Furthermore, the HD exRNA was enriched in lincRNA, antisense RNA, vault RNA, snoRNA, and snRNA with little or no evidence of full-length 18S and 28S rRNA. The LD exRNA was enriched in mitochondrial rRNA, mitochondrial tRNA, tRNA, piRNA, Y RNA, and full-length 18S and 28S rRNA. The proteomes of the HD and LD exRNA-containing fractions were determined with LC-MS/MS and analyzed with Gene Ontology term finder, which showed that both proteomes were associated with the term extracellular vesicles and electron microscopy suggests that at least a part of the exRNA is associated with exosome-like extracellular vesicles. Additionally, the proteins in the HD fractions tended to be associated with the nucleus and ribosomes, whereas the LD fraction proteome tended to be associated with the mitochondrion. We show that the 2 exRNA signatures released by a single cell type can be separated by floatation on a density gradient. These results show that cells can release multiple types of exRNA with substantial differences in RNA species content. This is important for any future studies determining the nature and function of exRNA released from different cells under different conditions. PMID:27791479

  3. Sphaerisporangium dianthi sp. nov., an endophytic actinomycete isolated from a root of Dianthus chinensis L.

    PubMed

    Xing, Jia; Liu, Chongxi; Zhang, Yuejing; He, Hairong; Zhou, Ying; Li, Lianjie; Zhao, Junwei; Liu, Shuanghe; Wang, Xiangjing; Xiang, Wensheng

    2015-01-01

    A novel actinomycete, designated strain NEAU-CY18(T), was isolated from the root of a Chinese medicinal plant Dianthus chinensis L and subjected to a polyphasic taxonomic study. The novel strain was found to develop spherical sporangia with non-motile spores on aerial mycelium. The cell-wall peptidoglycan was found to contain meso-diaminopimelic acid. The whole-cell sugars were identified as madurose, mannose, ribose, galactose and glucose. The phospholipid profile was found to contain diphosphatidylglycerol, phosphatidylmethylethanolamine, phosphatidylethanolamine, hydroxy-phosphatidylmethylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylinositol mannosides and an unidentified phospholipid. The predominant menaquinones were identified as MK-9(H4), MK-9(H2) and MK-9(H6). The major fatty acids were identified as C17:0 10-methyl, iso-C16:0 and C16:0. EzTaxon-e analysis of the 16S rRNA gene sequence indicated that the strain belongs to the genus Sphaerisporangium and was most closely related to Sphaerisporangium cinnabarinum JCM 3291(T) (98.9 %) and Sphaerisporangium melleum JCM 13064(T) (98.3 %). Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain NEAU-CY18(T) forms a monophyletic clade with S. cinnabarinum JCM 3291(T), an association that was supported by a bootstrap value of 97 % in the neighbour-joining tree and also recovered with the maximum-likelihood algorithm. Comparisons of some phenotypic properties and low DNA-DNA relatedness values enabled the strain to be differentiated from S. cinnabarinum JCM 3291(T) and S. melleum JCM 13064(T). Therefore, it is concluded that strain NEAU-CY18(T) represents a novel Sphaerisporangium species, for which the name Sphaerisporangium dianthi sp. nov. is proposed. The type strain is NEAU-CY18(T) ( = CGMCC 4.7132(T) = DSM 46736(T)).

  4. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  5. Molecular analysis of tick-borne protozoan and rickettsial pathogens in small ruminants from two South African provinces.

    PubMed

    Ringo, Aaron Edmond; Adjou Moumouni, Paul Franck; Taioe, Moeti; Jirapattharasate, Charoonluk; Liu, Mingming; Wang, Guanbo; Gao, Yang; Guo, Huanping; Lee, Seung-Hun; Zheng, Weiqing; Efstratiou, Artemis; Li, Jixu; Inoue, Noboru; Suzuki, Hiroshi; Thekisoe, Oriel; Xuan, Xuenan

    2018-04-01

    Tick-borne protozoan and rickettsial diseases are a major threat to livestock in tropical and sub-tropical regions of Africa. In this study we investigated the presence and distribution of Theileria spp., Babesia ovis, Anaplasma ovis, Anaplasma phagocytophilum, Ehrlichia ruminantium and SFG Rickettsia in sheep and goats from Free State and KwaZulu-Natal provinces. A total of 91 blood samples were screened in this study, 61 from goats and 30 from sheep. PCR assay was conducted using primers based on Theileria spp. 18S rRNA, Babesia ovis (BoSSU rRNA), Anaplasma ovis (AoMSP4), Anaplasma phagocytophilum epank1, Ehrlichia ruminantium pCS20 and SFG Rickettsia OmpA. Overall infection rates of Theileria spp., Anaplasma ovis and Ehrlichia ruminantium were 18 (19.8%), 33 (36.3%) and 13 (14.3%), respectively. The co-infection of two pathogens were detected in 17/91 (18.7%) of all samples, goats having higher rates of co-infection compared to sheep. Phylogenetic tree analysis sequence of pCS20 gene of E. ruminantium of this study was found to be in the same clade with Kumm2 and Riverside strains both from South Africa. The phylogram of SSU rRNA of Theileria ovis had longer branch length compared to all other sequences most of which were from Asia and Middle East. This study provides important data for understanding the tick-borne diseases occurrence in the study area and it is expected to improve the approach for the diagnosis and control of these diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  7. Elaeophora in the meninges of a Malayan sambar (Rusa unicolor equina).

    PubMed

    Bernard, Jennifer; Grunenwald, Caroline; Stalis, Ilse H; Varney, Megan; Zuba, Jeff; Gerhold, Richard

    2016-11-01

    An adult nematode was grossly identified in the meninges of a Malayan sambar (Rusa unicolor equina), with numerous microfilariae associated with encephalitis and vasculitis on histopathology. The nematode was confirmed to be Elaeophora schneideri by sequencing a portion of the 18S rRNA gene. Our report highlights the potential for aberrant migration of E. schneideri in exotic deer species and the use of advanced testing to specifically identify this metazoan parasite, avoiding misidentification of Parelaphostrongylus tenuis. © 2016 The Author(s).

  8. [Ultrastructural observation on nymphal Armillifer sp. by scanning electron microscopy and phylogenetic analysis based on 18S rRNA].

    PubMed

    Li, Jian; Shi, Yun-Liang; Shi, Wei; Fang, Fang; Zhou, Qing-An; Li, Wen-Wen; He, Guo-Sheng; Huang, Wei-Yi

    2012-04-30

    To observe the ultrastructure of nymphal Armillifer sp. isolated from Macaca fascicularis by using scanning electron microscope (SEM), and analyze the phylogenetic relationships based on 18S rRNA gene sequences. The parasite samples stored in 70% alcohol were fixed by glutaraldehyde and osmium peroxide. Ultrastructural characters of those samples were observed under SEM. Amplification and sequencing of the 18S rRNA gene were performed following the extraction of total genome DNA. Sequence analysis was performed based on multiple alignment using ClustalX1.83, while phylogenetic analysis was made by Neighbor-Joining method using MEGA4.0. The nymphs were in cylindrical shape, the body slightly claviform tapering to posterior end. Abdominal annuli were gradually widened from anterior to posterior parts, the 12th-13th abdominal annuli of which were similar in width. The annuli ranged closer in the front half body, whereas in the latter part there were certain gaps between them. The circular-shaped mouth located in the middle of head ventrally. Folds were seen in inner margin of the mouth with a pair of curved hooks on both sides above it which practically disposed in a straight line. Two pairs of large sensory papillae were observed symmetrically over the last thoracic annulus of cephalothoraxs lying below the outer hook, and the first abdominal annulus was near the median ventral line. The number of abdominal annuli was 29, not including 2 incomplete terminal annuli. Rounded sensory papillae were fully distributed on the body surface, except the dorsal side of head and the ventral part of the terminal annulus. Agglomerate-like anus opening was observed at the end of ventral abdominal annuli and distinctly sub-terminal. These morphological features demonstrated that the nymphs were highly similar with that of Armillifer moniliformis Diesing, 1835. A fragment of 18SrRNA gene (1 836 bp) sequences was obtained by PCR combined with sequencing, and was registered to the GeneBank database with an accession number HM048870. The phylogenetic tree indicated that A. moniliformis, A.agkistrodon and A.armillatus were at the same clade with a bootstrap value at 95%, and A. moniliformis and A. agkistrodon were solo at a clade with a bootstrap value of 75%. The nymphs isolated from Macaca fascicularis are identified as A. moniliformis temporarily.

  9. Myxobolus lepomis n. sp. (Cnidaria: Myxobolidae), a gill myxozoan infecting Lepomis marginatus Holbrook and Lepomis miniatus Jordan (Perciformes: Centrarchidae), in the Big Thicket National Preserve, Texas, USA.

    PubMed

    Rosser, Thomas G; Baumgartner, Wes A; Barger, Michael A; Griffin, Matt J

    2017-05-01

    A parasitological survey of freshwater fishes in the Big Thicket National Preserve in southeast Texas revealed myxozoan infections in two species of sunfish, Lepomis marginatus Holbrook and Lepomis miniatus Jordan (Perciformes: Centrarchidae). Pseudocysts were elongate-oval, 988 × 485 µm (ex L. marginatus) and 800 × 606 µm (ex L. miniatus) and demonstrated a predilection to the edge of the primary gill lamellae. Myxospores consistent with the genus Myxobolus were oblong, 16.8-21.3 (19.0 ± 0.9) µm long, 7.0-8.8 (7.9 ± 0.5) µm wide and 5.3-6.1 (5.8 ± 0.3) µm thick (ex L. marginatus) and 17.2-20.3 (18.8 ± 0.7) µm long, 7.5-9.9 (8.7 ± 0.6) µm wide, and 6.8-7.2 (7.0 ± 0.2) µm thick (ex L. miniatus); with 2 pyriform polar capsules 8.3-9.8 (9.0 ± 0.5) µm long, 2.2-2.7 (2.5 ± 0.2) µm wide (ex L. marginatus) and 9.2-10.5 (10.0 ± 0.4) µm long, 2.2-3.0 (2.8 ± 0.2) µm wide (ex L. miniatus). Statistically, the measurements of spore body width, polar capsule length, and polar capsule width were significantly different between myxospores from L. marginatus and L. miniatus. However, intraspecific genetic variability between isolates at the 18S rRNA gene was negligible, with < 0.8% variability across > 2,000 bp of sequence. The isolates shared no significant sequence similarity with any myxozoan deposited in the GenBank nucleotide database. Phylogenetic analysis inferred from the 18S rRNA gene from both L. marginatus and L. miniatus placed the isolates within a clade of myxozoan parasites of perciform fishes. Based on shared tissue and host family tropism, overlapping morphological characters and high degrees of sequence conservation at the 18S rRNA gene, we propose these isolates as morphologically distinct, genetically conspecific representatives of M. lepomis n. sp. from the gills of L. marginatus and L. miniatus in the Big Thicket National Preserve in Texas, USA.

  10. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  11. Hepatozoon parasites (Apicomplexa: Adeleorina) in bats.

    PubMed

    Pinto, C Miguel; Helgen, Kristofer M; Fleischer, Robert C; Perkins, Susan L

    2013-08-01

    We provide the first evidence of Hepatozoon parasites infecting bats. We sequenced a short fragment of the 18S rRNA gene (~600 base pairs) of Hepatozoon parasites from 3 Hipposideros cervinus bats from Borneo. Phylogenies inferred by model-based methods place these Hepatozoon within a clade formed by parasites of reptiles, rodents, and marsupials. We discuss the scenario that bats might be common hosts of Hepatozoon.

  12. Cryptosporidium canis in Two Mexican Toddlers.

    PubMed

    González-Díaz, Mariana; Urrea-Quezada, Alejandro; Villegas-Gómez, Isaac; Durazo, María; Garibay-Escobar, Adriana; Hernández, Jesús; Xiao, Lihua; Valenzuela, Olivia

    2016-11-01

    Cryptosporidium canis is reported for the first time in 2 toddlers in Northwestern Mexico. The 2 toddlers (33 and 34 months old) were symptomatic at diagnosis, presenting diarrhea and fever, and 1 case presented chronic malnutrition. Both toddlers were HIV-negative. C. canis was identified by SspI and VspI restriction enzyme digestion of the 18S rRNA polymerase chain reaction products and confirmed by sequence analysis.

  13. Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

    PubMed Central

    Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank; Al-Soud, Waleed Abu; Brejnrod, Asker; Sørensen, Søren Johannes; Lassen, Jan; Løvendahl, Peter; Højberg, Ole

    2017-01-01

    Dairy cows experience dramatic changes in host physiology from gestation to lactation period and dietary switch from high-forage prepartum diet to high-concentrate postpartum diet over the transition period (parturition +/- three weeks). Understanding the community structure and activity of the rumen microbiota and its associative patterns over the transition period may provide insight for e.g. improving animal health and production. In the present study, rumen samples from ten primiparous Holstein dairy cows were collected over seven weeks spanning the transition period. Total RNA was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community was dominated by three phyla, showing significant changes in relative abundance range over the transition period: Firmicutes (from prepartum 57% to postpartum 35%), Bacteroidetes (from prepartum 22% to postpartum 18%) and Proteobacteria (from prepartum 7% to postpartum 32%). For the archaea, qPCR analysis of 16S rRNA transcript number, revealed a significant prepartum to postpartum increase in Methanobacteriales, in accordance with an observed increase (from prepartum 80% to postpartum 89%) in relative abundance of 16S rRNA transcript amplicons allocated to this order. On the other hand, a significant prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over the transition period. According to T-RFLP analysis of the mcrA transcripts, two Methanobacteriales genera, Methanobrevibacter and Methanosphaera (represented by the T-RFs 39 and 267 bp), represented more than 70% of the metabolically active methanogens, showing no significant changes over the transition period; minor T-RFs, likely to represent members of the order Methanomassiliicoccales and with a relative abundance below 5% in total, decreased significantly over the transition period. In accordance with the T-RFLP analysis, the mcrA transcript amplicon sequencing revealed Methanobacteriales to cover 99% of the total reads, dominated by the genera Methanobrevibacter (75%) and Methanosphaera (24%), whereas the Methanomassiliicoccales order covered only 0.2% of the total reads. In conclusion, the present study showed that the structure of the metabolically active bacterial and archaeal rumen communities changed over the transition period, likely in response to the dramatic changes in physiology and nutritional factors like dry matter intake and feed composition. It should be noted however that for the methanogens, the observed community changes were influenced by the analyzed gene (mcrA or 16S rRNA). PMID:29117259

  14. Reclassification of Theileria annae as Babesia vulpes sp. nov.

    PubMed

    Baneth, Gad; Florin-Christensen, Monica; Cardoso, Luís; Schnittger, Leonhard

    2015-04-08

    Theileria annae is a tick-transmitted small piroplasmid that infects dogs and foxes in North America and Europe. Due to disagreement on its placement in the Theileria or Babesia genera, several synonyms have been used for this parasite, including Babesia Spanish dog isolate, Babesia microti-like, Babesia (Theileria) annae, and Babesia cf. microti. Infections by this parasite cause anemia, thrombocytopenia, and azotemia in dogs but are mostly subclinical in red foxes (Vulpes vulpes). Furthermore, high infection rates have been detected among red fox populations in distant regions strongly suggesting that these canines act as the parasite's natural host. This study aims to reassess and harmonize the phylogenetic placement and binomen of T. annae within the order Piroplasmida. Four molecular phylogenetic trees were constructed using a maximum likelihood algorithm based on DNA alignments of: (i) near-complete 18S rRNA gene sequences (n = 76 and n = 93), (ii) near-complete and incomplete 18S rRNA gene sequences (n = 92), and (iii) tubulin-beta gene sequences (n = 32) from B. microti and B. microti-related parasites including those detected in dogs and foxes. All phylogenetic trees demonstrate that T. annae and its synonyms are not Theileria parasites but are most closely related with B. microti. The phylogenetic tree based on the 18S rRNA gene forms two separate branches with high bootstrap value, of which one branch corresponds to Babesia species infecting rodents, humans, and macaques, while the other corresponds to species exclusively infecting carnivores. Within the carnivore group, T. annae and its synonyms from distant regions segregate into a single clade with a highly significant bootstrap value corroborating their separate species identity. Phylogenetic analysis clearly shows that T. annae and its synonyms do not pertain to Theileria and can be clearly defined as a separate species. Based on the facts that T. annae and its synonyms have not been shown to have a leukocyte stage, as expected in Theileria, do not infect humans and rodents as B. microti, and cluster phylogenetically as a separate species, this study proposes to name this parasite Babesia vulpes sp. nov., after its natural host, the red fox V. vulpes.

  15. Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

    PubMed Central

    Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

    2003-01-01

    The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

  16. Ubiquity and Diversity of Human-Associated Demodex Mites

    PubMed Central

    Thoemmes, Megan S.; Fergus, Daniel J.; Urban, Julie; Trautwein, Michelle; Dunn, Robert R.

    2014-01-01

    Demodex mites are a group of hair follicle and sebaceous gland-dwelling species. The species of these mites found on humans are arguably the animals with which we have the most intimate interactions. Yet, their prevalence and diversity have been poorly explored. Here we use a new molecular method to assess the occurrence of Demodex mites on humans. In addition, we use the 18S rRNA gene (18S rDNA) to assess the genetic diversity and evolutionary history of Demodex lineages. Within our samples, 100% of people over 18 years of age appear to host at least one Demodex species, suggesting that Demodex mites may be universal associates of adult humans. A phylogenetic analysis of 18S rDNA reveals intraspecific structure within one of the two named human-associated Demodex species, D. brevis. The D. brevis clade is geographically structured, suggesting that new lineages are likely to be discovered as humans from additional geographic regions are sampled. PMID:25162399

  17. Helicobacter pylori Infection in Rural and Urban Dyspeptic Patients from Venezuela

    PubMed Central

    Contreras, Monica; Fernández-Delgado, Milagro; Reyes, Nelson; García-Amado, María Alexandra; Rojas, Héctor; Michelangeli, Fabian

    2015-01-01

    The goal of this work was to assess the Helicobacter pylori prevalence in a rural mestizo population and compare it to an urban population from Venezuela. The study was performed in gastric juice samples of 71 dyspeptic patients from Caracas (urban) and 39 from Tucupita (rural), in the Orinoco Delta region. Helicobacter pylori was detected by amplification of 16S rRNA, glmM, and ureA genes in 55.0% patients from urban and 87.2% from rural populations. cagA was found positive in 51% and 62% urban and rural patients, respectively. Non-H. pylori Helicobacter species were not detected in the urban population, but was found in 7.7% of patients in the rural study site. Frequency values of the 16S rRNA, glmM, and ureA genes were higher in the rural population. The odds ratio for each gene was 15.18 for 16S rRNA, 2.34 for glmM, 2.89 for ureA, and 1.53 cagA, showing significant differences except for cagA when gene frequency was compared in both populations. These results demonstrate a higher frequency of H. pylori and gastric non-H. pylori Helicobacter infection in a rural mestizo population with low hygienic standards as compared with city dwellers, representing a potential risk for the development of gastroduodenal diseases. PMID:26195456

  18. Gaetbulicola byunsanensis gen. nov., sp. nov., isolated from tidal flat sediment.

    PubMed

    Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang

    2010-01-01

    A Gram-negative, non-motile and pleomorphic bacterial strain, SMK-114(T), which belongs to the class Alphaproteobacteria, was isolated from a tidal flat sample collected in Byunsan, Korea. Strain SMK-114(T) grew optimally at pH 7.0-8.0 and 25-30 degrees C and in the presence of 2 % (w/v) NaCl. A neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showed that strain SMK-114(T) formed a cluster with Octadecabacter species, with which it exhibited 16S rRNA gene sequence similarity values of 95.2-95.4 %. This cluster was part of the clade comprising Thalassobius species with a bootstrap resampling value of 76.3 %. Strain SMK-114(T) exhibited 16S rRNA gene sequence similarity values of 95.1-96.3 % to members of the genus Thalassobius. It contained Q-10 as the predominant ubiquinone and C(18 : 1)omega7c as the major fatty acid. The DNA G+C content was 60.0 mol%. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-114(T) is considered to represent a novel species in a new genus for which the name Gaetbulicola byunsanensis gen. nov., sp. nov. is proposed. The type strain of Gaetbulicola byunsanensis is SMK-114(T) (=KCTC 22632(T) =CCUG 57612(T)).

  19. Characterization of a new marine nitrite oxidizing bacterium, Nitrospina watsonii sp. nov., a member of the newly proposed phylum "Nitrospinae".

    PubMed

    Spieck, Eva; Keuter, Sabine; Wenzel, Thilo; Bock, Eberhard; Ludwig, Wolfgang

    2014-05-01

    Nitrite oxidizing bacteria are an integral part of the nitrogen cycle in marine waters, but the knowledge about their diversity is limited. Recently, a high abundance of Nitrospina-like 16S rRNA gene sequences has been detected in oceanic habitats with low oxygen content by molecular methods. Here, we describe a new strain of Nitrospina, which was sampled in 100m depth from the Black Sea. It coexisted with a not-yet cultivated chemoorganotrophic gammaproteobacterium and could be purified by classical isolation methods including Percoll density gradient centrifugation. The new Nitrospina-like bacterium grew lithoautotrophically at 28°C in diluted seawater supplemented with inorganic salts and nitrite. Gram-negative rods were characterized morphologically, physiologically and partly biochemically. The 16S rRNA gene of the new strain of Nitrospina is 97.9% similar to the described species N. gracilis and DNA/DNA hybridization experiments revealed a relatedness of 30.0%. The data from both Nitrospina species and environmental clones were used for an extensive 16S rRNA based phylogenetic study applying high quality filtering. Treeing analyses confirm the newly defined phylum status for "Nitrospinae" [18]. The results of phylogenetic and genotypic analyses support the proposal of a novel species Nitrospina watsonii sp. nov. (type strain 347(T), LMG 27401(T), NCIMB 14887(T)). Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. Diversity and population structure of Marine Group A bacteria in the Northeast subarctic Pacific Ocean.

    PubMed

    Allers, Elke; Wright, Jody J; Konwar, Kishori M; Howes, Charles G; Beneze, Erica; Hallam, Steven J; Sullivan, Matthew B

    2013-02-01

    Marine Group A (MGA) is a candidate phylum of Bacteria that is ubiquitous and abundant in the ocean. Despite being prevalent, the structural and functional properties of MGA populations remain poorly constrained. Here, we quantified MGA diversity and population structure in relation to nutrients and O(2) concentrations in the oxygen minimum zone (OMZ) of the Northeast subarctic Pacific Ocean using a combination of catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) and 16S small subunit ribosomal RNA (16S rRNA) gene sequencing (clone libraries and 454-pyrotags). Estimates of MGA abundance as a proportion of total bacteria were similar across all three methods although estimates based on CARD-FISH were consistently lower in the OMZ (5.6%±1.9%) than estimates based on 16S rRNA gene clone libraries (11.0%±3.9%) or pyrotags (9.9%±1.8%). Five previously defined MGA subgroups were recovered in 16S rRNA gene clone libraries and five novel subgroups were defined (HF770D10, P262000D03, P41300E03, P262000N21 and A714018). Rarefaction analysis of pyrotag data indicated that the ultimate richness of MGA was very nearly sampled. Spearman's rank analysis of MGA abundances by CARD-FISH and O(2) concentrations resulted in significant correlation. Analyzed in more detail by 16S rRNA pyrotag sequencing, MGA operational taxonomic units affiliated with subgroups Arctic95A-2 and A714018 comprised 0.3-2.4% of total bacterial sequences and displayed strong correlations with decreasing O(2) concentration. This study is the first comprehensive description of MGA diversity using complementary techniques. These results provide a phylogenetic framework for interpreting future studies on ecotype selection among MGA subgroups, and suggest a potentially important role for MGA in the ecology and biogeochemistry of OMZs.

  1. Pricia antarctica gen. nov., sp. nov., a member of the family Flavobacteriaceae, isolated from Antarctic intertidal sediment.

    PubMed

    Yu, Yong; Li, Hui-Rong; Zeng, Yin-Xin; Sun, Kun; Chen, Bo

    2012-09-01

    A yellow-coloured, rod-shaped, Gram-reaction- and Gram-staining-negative, non-motile and aerobic bacterium, designated strain ZS1-8(T), was isolated from a sample of sandy intertidal sediment collected from the Antarctic coast. Flexirubin-type pigments were absent. In phylogenetic analyses based on 16S rRNA gene sequences, strain ZS1-8(T) formed a distinct phyletic line and the results indicated that the novel strain should be placed in a new genus within the family Flavobacteriaceae. In pairwise comparisons between strain ZS1-8(T) and recognized species, the levels of 16S rRNA gene sequence similarity were all <93.3 %. The strain required Ca(2+) and K(+) ions as well as NaCl for growth. Optimal growth was observed at pH 7.5-8.0, 17-19 °C and with 2-3 % (w/v) NaCl. The major fatty acids were iso-C(15 : 1) G, iso-C(15 : 0), summed feature 3 (iso-C(15 : 0) 2-OH and/or C(16 : 1)ω7c), an unknown acid with an equivalent chain-length of 13.565 and iso-C(17 : 0) 3-OH. The major respiratory quinone was MK-6. The predominant polar lipid was phosphatidylethanolamine. The genomic DNA G+C content was 43.9 mol%. Based on the phylogenetic, phenotypic and chemotaxonomic data, strain ZS1-8(T) represents a novel species in a new genus in the family Flavobacteriaceae for which the name Pricia antarctica gen. nov., sp. nov. is proposed. The type strain of the type species is ZS1-8(T) (= JCM 17291(T) = DSM 23421(T)).

  2. Guanchochroma wildpretii gen. et spec. nov. (Ochrophyta) Provides New Insights into the Diversification and Evolution of the Algal Class Synchromophyceae

    PubMed Central

    Schmidt, Maria; Horn, Susanne; Ehlers, Katrin; Wilhelm, Christian; Schnetter, Reinhard

    2015-01-01

    A new relative of the chrysophyte genus Chrysopodocystis was found in Tenerife and termed Guanchochroma wildpretii. This unicellular alga was most noticeably discernible from Chrysopodocystis socialis (the only species of this genus) by the presence of a cyst-like stage with a multilayered lorica, which also functions as a dispersal unit and shows secondary wall growth. Secondary expansion of loricae (cell casings not involved in cell division, usually with a more or less pronounced opening) has never been observed previously and marks a unique feature of the new taxon. Plastids are non-randomly distributed within cells of G. wildpretii. 18S rRNA gene analyses identified the two species as sister lineages and placed them in a monophyletic group with the Synchromophyceae, a heterokont algal (Ochrophyta) class characterized by the presence of chloroplast complexes. Yet, neither Chrysopodocystis nor Guanchochroma showed this feature in ultrastructure analyses. Additionally, their 18S rRNA genes possessed distinct inserts, the highest GC-content known for Ochrophyta and exceptionally long branches on the Ochrophyta 18S rDNA phylogenetic tree, suggesting substantially increased substitution rates along their branch compared to Synchromophyceae. Plastid marker data (rbcL) recovered a monophyletic clade of Chrysopodocystis, Guanchochroma and Synchromophyceae as well, yet with lower supports for internal split order due to limited resolution of the marker. Evidence for the sequence of events leading to the formation of the plastid complex of Synchromophyceae still remains ambiguous because of the apparently short timeframe in which they occurred. PMID:26135124

  3. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

    PubMed

    Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

    1989-10-20

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

  4. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  5. Validation of housekeeping genes as internal controls for studying gene expression during Pacific oyster (Crassostrea gigas) development by quantitative real-time PCR.

    PubMed

    Du, Yishuai; Zhang, Linlin; Xu, Fei; Huang, Baoyu; Zhang, Guofan; Li, Li

    2013-03-01

    Hatchery-reared larvae of the Pacific oyster (Crassostrea gigas) often suffer from massive mortality induced by Ostreid herpesvirus 1 (OsHV-1) infection, indicating the importance of better understanding of oyster immune defense systems. The accuracy of measurements of gene expression levels based on quantitative real-time PCR assays relies on the use of housekeeping genes as internal controls; however, few studies have focused on the selection of such internal controls. In this study, we conducted a comprehensive investigation of internal control genes during oyster development in virus-infected and uninfected samples. Transcriptome data for 38 developmental stages were downloaded and the gene expression patterns were classified into 30 clusters. A total of 317 orthologs of classical housekeeping genes in the oyster genome were annotated. After combining the expression profiles and oyster housekeeping gene dataset, 14 candidate internal controls were selected for further investigation: Elongation factor-1α (EF-1α), 18S rRNA (18S), 28S rRNA (28S), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-actin (ACT), Ribosomal protein L7 (RL7), Ribosomal protein L27 (RL27), Ribosomal protein L36 (RL36), Ribosomal protein S18 (RS18), Heterogeneous nuclear ribonucleoprotein A2/B1 (RO21), Eukaryotic translation elongation factor 2 (EF2), Ubiquitin-conjugating enzyme E2D2 (UBCD1), S-phase kinase-associated protein 1 (SKP1) and Heterogeneous nuclear ribonucleoprotein Q (HNRPQ). RNA was extracted from oyster larvae infected with OsHV-1 (group A; GA), and OsHV-1 free larvae (group B; GB). The expression levels of the 14 candidate internal controls were studied in GA and GB larvae by real-time PCR. Their expression stabilities were further analyzed using the GeNorm program. RL7 and RS18 were the most stable genes in both OsHV-1 infected (GA) and uninfected (GB) larvae. These results suggest that RL7 and RS18 could be used as internal controls for studying gene expression in normal growing oyster larvae and in OsHV-1 infected larvae. These high quality internal controls will be a valuable resource in future studies of oyster larval mortality. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  7. Selection of reference genes for quantitative real-time RT-PCR assays in different morphological forms of dimorphic zygomycetous fungus Benjaminiella poitrasii.

    PubMed

    Pathan, Ejaj K; Ghormade, Vandana; Deshpande, Mukund V

    2017-01-01

    Benjaminiella poitrasii, a dimorphic non-pathogenic zygomycetous fungus, exhibits a morphological yeast (Y) to hypha (H) reversible transition in the vegetative phase, sporangiospores (S) in the asexual phase and zygospores (Z) in the sexual phase. To study the gene expression across these diverse morphological forms, suitable reference genes are required. In the present study, 13 genes viz. ACT, 18S rRNA, eEF1α, eEF-Tu,eIF-1A, Tub-α, Tub-b, Ubc, GAPDH, Try, WS-21, NADGDH and NADPGDH were evaluated for their potential as a reference, particularly for studying gene expression during the Y-H reversible transition and also for other asexual and sexual life stages of B. poitrasii. Analysis of RT-qPCR data using geNorm, normFinder and BestKeeper software revealed that genes such as Ubc, 18S rRNA and WS-21 were expressed at constant levels in each given subset of RNA samples from all the morphological phases of B. poitrasii. Therefore, these reference genes can be used to elucidate the role of morpho-genes in B. poitrasii. Further, use of the two most stably expressed genes (Ubc and WS-21) to normalize the expression of the ornithine decarboxylase gene (Bpodc) in different morphological forms of B. poitrasii, generated more reliable results, indicating that our selection of reference genes was appropriate.

  8. The E. coli 16S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein.

    PubMed Central

    Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C

    1988-01-01

    We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025

  9. Eimeria collieie n. sp. (Apicomplexa:Eimeriidae) from the western long-necked turtle (Chelodina colliei).

    PubMed

    Yang, Rongchang; Brice, Belinda; Elloit, Aileen; Lee, Elvina; Ryan, Una

    2015-07-01

    A new species, Eimeria collieie n. sp., is described from the western long-necked turtle (Chelodina colliei). Sporulated oocysts (n = 35) are spherical to subspherical, with colourless single layer oocyst wall, 0.6 ± 0.2 (0.4-0.7) µm thick. Oocyst with elongated ellipsoid sporocysts. Oocyst length, 29.8 ± 0.4 (28.2-31.0) µm; oocyst width, 29.4 ± 0.3 (28.0-30.8) µm; oocyst length/width (L/W) ratio, 1.0 ± 0.03 (1.0-1.05). Micropyle, oocyst residuum and polar granule were absent. Sporocysts with sporocyst residuum and 2 sporozoites. Sporocyst length, 21.6 ± 0.4 (21.2-22.0) µm; sporocyst width, 6.0 ± 0.3 (5.7-6.3) µm; sporocyst L/W ratio, 3.6 ± 0.2 (3.4-3.8). Stieda, parastieda and substieda bodies were absent. Sporozoite length, 14.0 ± 0.2 (13.8-14.2) µm; sporozoite width, 2.6 ± 0.2 (2.4-2.8) µm; sporozoite L/W ratio, 5.46 ± 0.10 (5.4-5.6). Molecular analysis was conducted at three loci: the 18S and 28S ribosomal RNA (rRNA), and the mitochondrial cytochrome oxidase gene (COI). At the 18S rRNA locus, E. collieie n. sp. shared 96.4% and 98.3% genetic similarity to E. ranae (GenBank accession number: EU717219) and E. arnyi (AY613853) respectively. At the 28S rRNA locus, E. collieie n. sp. shared 91.6% genetic similarity to E. papillata (GenBank accession number: GU593706) and phylogenetic analysis at this locus placed E. collieie n. sp. in aseparateclade. At the COI locus, E. collieie n. sp. shared 92.7% genetic similarity to Eimeria setonicis (GenBankaccession number: KF225638) from a quokka (Setonix brachyurus) in Western Australia. Reptile-derived sequences were not available for the 28S rRNA and the COI loci. Based on morphological and molecular data, this isolate is a new species of coccidian parasite that, to date, has only been found in western long-necked turtles. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  10. SERC 2014 2018 Technical Plan: 2016 Update

    DTIC Science & Technology

    2016-02-18

    Contract Number: HQ0034-13-D-0004 February 18, 2016 SERC 2014-2018 Technical Plan Update SERC 2014-2018 Technical Plan: 2016 Update...UNCLASSIFIED / APPROVED FOR PUBLIC RELEASE Contract Number: HQ0034-13-D-0004 February 18, 2016 SERC 2014-2018 Technical Plan Update ii...18, 2016 SERC 2014-2018 Technical Plan Update iii TABLE OF CONTENTS Table of Contents

  11. Cytochemical features common to nucleoli and cytoplasmic nucleoloids of Olea europaea meiocytes: detection of rRNA by in situ hybridization.

    PubMed

    Alché, J D; Fernández, M C; Rodríguez-García, M I

    1994-02-01

    We used light and electron microscopic techniques to study the composition of cytoplasmic nucleoloids during meiotic division in Olea europaea. Nucleoloids were found in two clearly distinguishable morphological varieties: one similar in morphology to the nucleolus, and composed mainly of dense fibrillar component, and another surrounded by many ribosome-like particles. Cytochemical and immunocytochemical techniques showed similar reactivities in nucleoloids and the nucleolus: both are ribonucleoproteic in nature, and possess argyrophillic, argentaffinic and highly phosphorylated proteins. Immunohistochemical techniques failed to detect DNA in either structure. In situ hybridization to a 18 S rRNA probe demonstrated the presence of ribosomal transcripts in both the nucleolus and nucleoloids. These similarities in morphology and composition may reflect similar functionalities.

  12. Characterization of Selenaion koniopes n. gen., n. sp., an amoeba that represents a new major lineage within heterolobosea, isolated from the Wieliczka salt mine.

    PubMed

    Park, Jong Soo; De Jonckheere, Johan F; Simpson, Alastair G B

    2012-01-01

    A new heterolobosean amoeba, Selenaion koniopes n. gen., n. sp., was isolated from 73‰ saline water in the Wieliczka salt mine, Poland. The amoeba had eruptive pseudopodia, a prominent uroid, and a nucleus without central nucleolus. Cysts had multiple crater-like pore plugs. No flagellates were observed. Transmission electron microscopy revealed several typical heterolobosean features: flattened mitochondrial cristae, mitochondria associated with endoplasmic reticulum, and an absence of obvious Golgi dictyosomes. Two types of larger and smaller granules were sometimes abundant in the cytoplasm--these may be involved in cyst formation. Mature cysts had a fibrous endocyst that could be thick, plus an ectocyst that was covered with small granules. Pore plugs had a flattened dome shape, were bipartite, and penetrated only the endocyst. Phylogenies based on the 18S rRNA gene and the presence of 18S rRNA helix 17_1 strongly confirmed assignment to Heterolobosea. The organism was not closely related to any described genus, and instead formed the deepest branch within the Heterolobosea clade after Pharyngomonas, with support for this deep-branching position being moderate (i.e. maximum likelihood bootstrap support--67%; posterior probability--0.98). Cells grew at 15-150‰ salinity. Thus, S. koniopes is a halotolerant, probably moderately halophilic heterolobosean, with a potentially pivotal evolutionary position within this large eukaryote group. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

  13. Molecular Approach to the Identification of Fish in the South China Sea

    PubMed Central

    Zhang, Junbin; Hanner, Robert

    2012-01-01

    Background DNA barcoding is one means of establishing a rapid, accurate, and cost-effective system for the identification of species. It involves the use of short, standard gene targets to create sequence profiles of known species against sequences of unknowns that can be matched and subsequently identified. The Fish Barcode of Life (FISH-BOL) campaign has the primary goal of gathering DNA barcode records for all the world's fish species. As a contribution to FISH-BOL, we examined the degree to which DNA barcoding can discriminate marine fishes from the South China Sea. Methodology/Principal Findings DNA barcodes of cytochrome oxidase subunit I (COI) were characterized using 1336 specimens that belong to 242 species fishes from the South China Sea. All specimen provenance data (including digital specimen images and geospatial coordinates of collection localities) and collateral sequence information were assembled using Barcode of Life Data System (BOLD; www.barcodinglife.org). Small intraspecific and large interspecific differences create distinct genetic boundaries among most species. In addition, the efficiency of two mitochondrial genes, 16S rRNA (16S) and cytochrome b (cytb), and one nuclear ribosomal gene, 18S rRNA (18S), was also evaluated for a few select groups of species. Conclusions/Significance The present study provides evidence for the effectiveness of DNA barcoding as a tool for monitoring marine biodiversity. Open access data of fishes from the South China Sea can benefit relative applications in ecology and taxonomy. PMID:22363454

  14. Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

    PubMed

    Vacek, A T; Bourque, D P

    1980-09-01

    Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

  15. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  16. Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

    PubMed

    Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

    2007-03-01

    In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

  17. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    PubMed

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  18. Improved Differentiation of Streptococcus pneumoniae and Other S. mitis Group Streptococci by MALDI Biotyper Using an Improved MALDI Biotyper Database Content and a Novel Result Interpretation Algorithm.

    PubMed

    Harju, Inka; Lange, Christoph; Kostrzewa, Markus; Maier, Thomas; Rantakokko-Jalava, Kaisu; Haanperä, Marjo

    2017-03-01

    Reliable distinction of Streptococcus pneumoniae and viridans group streptococci is important because of the different pathogenic properties of these organisms. Differentiation between S. pneumoniae and closely related Sreptococcus mitis species group streptococci has always been challenging, even when using such modern methods as 16S rRNA gene sequencing or matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. In this study, a novel algorithm combined with an enhanced database was evaluated for differentiation between S. pneumoniae and S. mitis species group streptococci. One hundred one clinical S. mitis species group streptococcal strains and 188 clinical S. pneumoniae strains were identified by both the standard MALDI Biotyper database alone and that combined with a novel algorithm. The database update from 4,613 strains to 5,627 strains drastically improved the differentiation of S. pneumoniae and S. mitis species group streptococci: when the new database version containing 5,627 strains was used, only one of the 101 S. mitis species group isolates was misidentified as S. pneumoniae , whereas 66 of them were misidentified as S. pneumoniae when the earlier 4,613-strain MALDI Biotyper database version was used. The updated MALDI Biotyper database combined with the novel algorithm showed even better performance, producing no misidentifications of the S. mitis species group strains as S. pneumoniae All S. pneumoniae strains were correctly identified as S. pneumoniae with both the standard MALDI Biotyper database and the standard MALDI Biotyper database combined with the novel algorithm. This new algorithm thus enables reliable differentiation between pneumococci and other S. mitis species group streptococci with the MALDI Biotyper. Copyright © 2017 American Society for Microbiology.

  19. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    PubMed Central

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  20. Fecal microbiota of lambs fed purple prairie clover (Dalea purpurea Vent.) and alfalfa (Medicago sativa).

    PubMed

    Huang, Qianqian; Holman, Devin B; Alexander, Trevor; Hu, Tianming; Jin, Long; Xu, Zhongjun; McAllister, Tim A; Acharya, Surya; Zhao, Guoqi; Wang, Yuxi

    2018-01-01

    The present study assessed the effect of purple prairie clover (PPC) and PPC condensed tannins (CT) on the fecal microbiota of lambs using high-throughput 16S rRNA gene pyrosequencing. A total of 18 individual lambs were randomly divided into three groups and fed either green chop alfalfa (Alf), a 40:60 (DM basis; Mix) mixture of Alf and PPC, or Mix supplemented with polyethylene glycol (Mix-P) for 18 days. Fecal samples were collected on days 13 through 18 using digital rectal retrieval. The DNA of fecal samples was extracted and the microbial 16S rRNA gene amplicons were sequenced using 454 pyrosequencing. Regardless of diet, the bacterial community was dominated by Firmicutes and Bacteroidetes with many sequences unclassified at the genus level. Forage type and CT had no effect on the fecal microbial composition at the phylum level or on α-diversity. Compared to the Alf diet, the Mix diet reduced the relative abundance of Akkermansia (P = 0.03) and Asteroleplasma (P = 0.05). Fecal microbial populations in Alf and Mix-P clustered separately from each other when assessed using unweighted UniFrac (P < 0.05). These results indicate that PPC CT up to 36 g/kg DM in the diet had no major effect on fecal microbial flora at the phyla level and exerted only minor effects on the genera composition of fecal microbiota in lambs.

  1. Prevalence of filarioid nematodes and trypanosomes in American robins and house sparrows, Chicago USA☆

    PubMed Central

    Hamer, Gabriel L.; Anderson, Tavis K.; Berry, Garrett E.; Makohon-Moore, Alvin P.; Crafton, Jeffrey C.; Brawn, Jeffrey D.; Dolinski, Amanda C.; Krebs, Bethany L.; Ruiz, Marilyn O.; Muzzall, Patrick M.; Goldberg, Tony L.; Walker, Edward D.

    2012-01-01

    Hosts are commonly infected with a suite of parasites, and interactions among these parasites can affect the size, structure, and behavior of host–parasite communities. As an important step to understanding the significance of co-circulating parasites, we describe prevalence of co-circulating hemoparasites in two important avian amplification hosts for West Nile virus (WNV), the American robin (Turdus migratorius) and house sparrow (Passer domesticus), during the 2010–2011 in Chicago, Illinois, USA. Rates of nematode microfilariemia were 1.5% of the robins (n = 70) and 4.2% of the house sparrows (n = 72) collected during the day and 11.1% of the roosting robins (n = 63) and 0% of the house sparrows (n = 11) collected at night. Phylogenetic analysis of nucleotide sequences of the 18S rRNA and cytochrome oxidase subunit I (COI) genes from these parasites resolved two clades of filarioid nematodes. Microscopy revealed that 18.0% of American robins (n = 133) and 16.9% of house sparrows (n = 83) hosted trypanosomes in the blood. Phylogenetic analysis of nucleotide sequences from the 18s rRNA gene revealed that the trypanosomes fall within previously described avian trypanosome clades. These results document hemoparasites in the blood of WNV hosts in a center of endemic WNV transmission, suggesting a potential for direct or indirect interactions with the virus. PMID:24533314

  2. Genetic and Antigenic Evidence Supports the Separation of Hepatozoon canis and Hepatozoon americanum at the Species Level

    PubMed Central

    Baneth, Gad; Barta, John R.; Shkap, Varda; Martin, Donald S.; Macintire, Douglass K.; Vincent-Johnson, Nancy

    2000-01-01

    Recognition of Hepatozoon canis and Hepatozoon americanum as distinct species was supported by the results of Western immunoblotting of canine anti-H. canis and anti-H. americanum sera against H. canis gamonts. Sequence analysis of 368 bases near the 3′ end of the 18S rRNA gene from each species revealed a pairwise difference of 13.59%. PMID:10699047

  3. A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey.

    PubMed

    Karagenc, Tulin Ilhan; Pasa, Serdar; Kirli, Gulcan; Hosgor, Murat; Bilgic, Huseyin Bilgin; Ozon, Yavuz Hakan; Atasoy, Abidin; Eren, Hasan

    2006-01-30

    Canine hepatozoonosis is caused by the tick-borne protozoon Hepatozoon spp. The prevalence of the infection in the Aegean coast of Turkey was investigated by examination of blood smear parasitology and polymerase chain reaction (PCR) using blood samples from 349 dogs collected from Central Aydin, Kusadasi, Selcuk, Central Manisa, Bodrum and Marmaris within the Aegean coast of Turkey. The indirect fluorescent antibody test (IFAT) for the detection of Hepatozoon canis antibodies was also used to detect the exposure rate to H. canis. PCR amplifying a 666bp fragment of 18S rRNA gene of Hepatozoon spp. was used in the epidemiological survey. The prevalence of Hepatozoon spp. infection was 10.6% by blood smear parasitology and 25.8% by PCR. IFAT revealed that 36.8% of serum samples were positive for antibodies reactive with Hepatozoon spp. The PCR products of 18S rRNA gene of Hepatozoon spp. isolated from six infected dogs, one isolate originating from each of the six different locations, were sequenced. The results of sequence analysis indicate that they are closely related to Indian and Japanese isolates of H. canis. This is the first epidemiological study on the prevalence of H. canis infection in the dog, in Turkey.

  4. Limnobacter litoralis sp. nov., a thiosulfate-oxidizing, heterotrophic bacterium isolated from a volcanic deposit, and emended description of the genus Limnobacter.

    PubMed

    Lu, Hongsheng; Sato, Yoshinori; Fujimura, Reiko; Nishizawa, Tomoyasu; Kamijo, Takashi; Ohta, Hiroyuki

    2011-02-01

    A Gram-negative, aerobic, heterotrophic bacterium, designated KP1-19(T), was isolated from a 22-year-old volcanic deposit at a site lacking vegetation on the island of Miyake, Japan. Strain KP1-19(T) was able to use thiosulfate (optimum concentration 10 mM) as an additional energy source. 16S rRNA gene sequence analysis indicated that strain KP1-19(T) was closely related to Limnobacter thiooxidans CS-K2(T) within the class Betaproteobacteria (97.7 % 16S rRNA gene sequence similarity). The cellular fatty acid profile was characteristic of the genus Limnobacter: the major fatty acids (>5 %) were C(16 : 0), C(16 : 1)ω7c and C(18 : 1)ω7c and minor amounts of C(10 : 0) 3-OH were also found. DNA-DNA relatedness between strain KP1-19(T) and L. thiooxidans LMG 19593(T) was 18 %. Therefore, strain KP1-19(T) represents a novel species, for which the name Limnobacter litoralis sp. nov. is proposed. The type strain is KP1-19(T) (=LMG 24869(T) =NBRC 105857(T) =CIP 109929(T)).

  5. Unexpected Importance of Potential Parasites in the Composition of the Freshwater Small-Eukaryote Community▿

    PubMed Central

    Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

    2008-01-01

    The diversity of small eukaryotes (0.2 to 5 μm) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types. PMID:18359836

  6. Unexpected importance of potential parasites in the composition of the freshwater small-eukaryote community.

    PubMed

    Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

    2008-05-01

    The diversity of small eukaryotes (0.2 to 5 mum) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types.

  7. Geographic distance and ecosystem size determine the distribution of smallest protists in lacustrine ecosystems.

    PubMed

    Lepère, Cécile; Domaizon, Isabelle; Taïb, Najwa; Mangot, Jean-François; Bronner, Gisèle; Boucher, Delphine; Debroas, Didier

    2013-07-01

    Understanding the spatial distribution of aquatic microbial diversity and the underlying mechanisms causing differences in community composition is a challenging and central goal for ecologists. Recent insights into protistan diversity and ecology are increasing the debate over their spatial distribution. In this study, we investigate the importance of spatial and environmental factors in shaping the small protists community structure in lakes. We analyzed small protists community composition (beta-diversity) and richness (alpha-diversity) at regional scale by different molecular methods targeting the gene coding for 18S rRNA gene (T-RFLP and 454 pyrosequencing). Our results show a distance-decay pattern for rare and dominant taxa and the spatial distribution of the latter followed the prediction of the island biogeography theory. Furthermore, geographic distances between lakes seem to be the main force shaping the protists community composition in the lakes studied here. Finally, the spatial distribution of protists was discussed at the global scale (11 worldwide distributed lakes) by comparing these results with those present in the public database. UniFrac analysis showed 18S rRNA gene OTUs compositions significantly different among most of lakes, and this difference does not seem to be related to the trophic status. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Protistan Diversity in the Arctic: A Case of Paleoclimate Shaping Modern Biodiversity?

    PubMed Central

    Stoeck, Thorsten; Kasper, Jennifer; Bunge, John; Leslin, Chesley; Ilyin, Valya; Epstein, Slava

    2007-01-01

    Background The impact of climate on biodiversity is indisputable. Climate changes over geological time must have significantly influenced the evolution of biodiversity, ultimately leading to its present pattern. Here we consider the paleoclimate data record, inferring that present-day hot and cold environments should contain, respectively, the largest and the smallest diversity of ancestral lineages of microbial eukaryotes. Methodology/Principal Findings We investigate this hypothesis by analyzing an original dataset of 18S rRNA gene sequences from Western Greenland in the Arctic, and data from the existing literature on 18S rRNA gene diversity in hydrothermal vent, temperate sediments, and anoxic water column communities. Unexpectedly, the community from the cold environment emerged as one of the richest observed to date in protistan species, and most diverse in ancestral lineages. Conclusions/Significance This pattern is consistent with natural selection sweeps on aerobic non-psychrophilic microbial eukaryotes repeatedly caused by low temperatures and global anoxia of snowball Earth conditions. It implies that cold refuges persisted through the periods of greenhouse conditions, which agrees with some, although not all, current views on the extent of the past global cooling and warming events. We therefore identify cold environments as promising targets for microbial discovery. PMID:17710128

  9. Molecular detection of tick-borne protozoan parasites in a population of domestic cats in midwestern Brazil.

    PubMed

    Braga, Ísis Assis; de Souza Ramos, Dirceu Guilherme; Marcili, Arlei; Melo, Andréia Lima Tomé; Taques, Isis Indaiara Gonçalves Granjeiro; Amude, Alexandre Mendes; Chitarra, Cristiane Silva; Nakazato, Luciano; Dutra, Valéria; de Campos Pacheco, Richard; Aguiar, Daniel Moura

    2016-07-01

    Some tick-borne pathogens that infect domestic cats have been considered emergent in veterinary medicine. Occurrences of Hepatozoon spp., Babesia spp. and Cytauxzoon spp. have been described in several regions of Brazil. This paper offers a comprehensive analysis of the 18S rRNA gene of a Hepatozoon sp. strain detected in domestic cats in the metropolitan area of Cuiabá, in Midwestern Brazil. Based on a molecular analysis, we detected the presence of Hepatozoon species circulating among cats in this region. The aforementioned strain is closely related to other isolates of H. felis detected in wild felids. Moreover, a phylogenetic analysis indicates that this genotype is grouped into a clade of 18S rRNA sequences previously described for the genus Hepatozoon in wild felids around the world. Hepatozoon felis strains detected in cats from Spain and Israel showed, respectively, 98% and 97% identity to our sequence and are clustered on a separate branch of the phylogenetic tree. This finding suggests a high diversity of Hepatozoon genotypes occurring in cats in Europe and South America. None of the analyzed cats were positive for Babesia spp. or Cytauxzoon spp. by PCR analysis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. Microscopic and Molecular Detection of Cryptosporidium andersoni and Cryptosporidium xiaoi in Wastewater Samples of Tehran Province, Iran

    PubMed Central

    HATAM-NAHAVANDI, Kareem; MOHEBALI, Mehdi; MAHVI, Amir-Hossein; KESHAVARZ, Hossein; NAJAFIAN, Hamid-Reza; MIRJALALI, Hamed; REZAEI, Sasan; REZAEIAN, Mostafa

    2016-01-01

    Background: As a waterborne pathogen, Cryptosporidium is one of the most common causes of gastroenteritis in human and hoofed livestock animals. This study aimed to investigate the distribution of Cryptosporidium spp. in human and livestock wastewaters in Iran, by the 18S rRNA sequence analysis. Methods: A total of 54 raw wastewater samples collected from three urban treatment plants and two slaughterhouses during 2014–2015 in Tehran, Iran. The presence of the Cryptosporidium oocysts was assessed by immunofluorescence with monoclonal antibodies. To characterize the oocysts at the molecular level, the 18S rRNA gene of Cryptosporidium was PCR amplified and sequenced. Results: Of the 54 wastewater samples examined, 34 (62.9%) were positive for Cryptosporidium oocysts using the IFA. Of these, 70.5% (24/34) were positive by PCR, that 91.6% (22/24) were successfully sequenced. The species of C. andersoni (95.4%) and C. xiaoi (4.6%) were detected in livestock wastewater samples. Conclusion: C. andersoni was the major Cryptosporidium sp. found in the aquatic environmental wastewater samples. The high rate of detection of C. andersoni in domestic wastewater was probably the result of the predominancy of this species in cattle herds in Iran. The current study is the first report of C. xiaoi in Iran. PMID:28127361

  11. First report of Rangelia vitalii infection (canine rangeliosis) in Argentina.

    PubMed

    Eiras, Diego Fernando; Craviotto, María Belén; Baneth, Gad; Moré, Gastón

    2014-10-01

    A 12-year old mixed breed neutered bitch from Misiones, Argentina, was presented with a history of fever and epistaxis. Blood, bone marrow, and lymph node samples were collected for hematology and cytology. Mild regenerative anemia was recorded and large, round, poorly stained piroplasms (>2.5 μm) were found within erythrocytes in blood and lymph node smears. Nested PCR-RFLP on blood and bone marrow samples was positive for piroplasm DNA. The 18S rRNA gene of piroplasms was targeted. A restriction pattern of a previously unreported piroplasm was observed. The PCR product was sequenced, and the sequence obtained had 99% identity with the Rangelia vitalii sequences from Brazil when compared by BLAST analysis. Further characterization of the detected piroplasm consisted of nearly full-length sequencing (1668 bp) of the 18S rRNA gene of this organism. Those sequences were deposited in GenBank. A phylogenetic analysis indicated that they clustered together with R. vitalii from Brazil but separately from large Babesia species of dogs such as Babesia canis, and from species of Theileria of dogs as well. This is the first report of R. vitalii infection in Argentina, and the first case of canine rangeliosis diagnosed outside Brazil. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Microbial eukaryotic distributions and diversity patterns in a deep-sea methane seep ecosystem.

    PubMed

    Pasulka, Alexis L; Levin, Lisa A; Steele, Josh A; Case, David H; Landry, Michael R; Orphan, Victoria J

    2016-09-01

    Although chemosynthetic ecosystems are known to support diverse assemblages of microorganisms, the ecological and environmental factors that structure microbial eukaryotes (heterotrophic protists and fungi) are poorly characterized. In this study, we examined the geographic, geochemical and ecological factors that influence microbial eukaryotic composition and distribution patterns within Hydrate Ridge, a methane seep ecosystem off the coast of Oregon using a combination of high-throughput 18S rRNA tag sequencing, terminal restriction fragment length polymorphism fingerprinting, and cloning and sequencing of full-length 18S rRNA genes. Microbial eukaryotic composition and diversity varied as a function of substrate (carbonate versus sediment), activity (low activity versus active seep sites), sulfide concentration, and region (North versus South Hydrate Ridge). Sulfide concentration was correlated with changes in microbial eukaryotic composition and richness. This work also revealed the influence of oxygen content in the overlying water column and water depth on microbial eukaryotic composition and diversity, and identified distinct patterns from those previously observed for bacteria, archaea and macrofauna in methane seep ecosystems. Characterizing the structure of microbial eukaryotic communities in response to environmental variability is a key step towards understanding if and how microbial eukaryotes influence seep ecosystem structure and function. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Phylogeny and classification of the Litostomatea (Protista, Ciliophora), with emphasis on free-living taxa and the 18S rRNA gene.

    PubMed

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2011-05-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of species ranging from aerobic, free-living predators to anaerobic endocommensals. This is traditionally reflected by classifying the Litostomatea into the subclasses Haptoria and Trichostomatia. The morphological classifications of the Haptoria conflict with the molecular phylogenies, which indicate polyphyly and numerous homoplasies. Thus, we analyzed the genealogy of 53 in-group species with morphological and molecular methods, including 12 new sequences from free-living taxa. The phylogenetic analyses and some strong morphological traits show: (i) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea and (ii) three distinct lineages (subclasses): the Rhynchostomatia comprising Tracheliida and Dileptida; the Haptoria comprising Lacrymariida, Haptorida, Didiniida, Pleurostomatida and Spathidiida; and the Trichostomatia. The curious Homalozoon cannot be assigned to any of the haptorian orders, but is basal to a clade containing the Didiniida and Pleurostomatida. The internal relationships of the Spathidiida remain obscure because many of them and some "traditional" haptorids form separate branches within the basal polytomy of the order, indicating one or several radiations and convergent evolution. Due to the high divergence in the 18S rRNA gene, the chaeneids and cyclotrichiids are classified incertae sedis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Identifying protist consumers of photosynthetic picoeukaryotes in the surface ocean using stable isotope probing.

    PubMed

    Orsi, William D; Wilken, Susanne; Del Campo, Javier; Heger, Thierry; James, Erick; Richards, Thomas A; Keeling, Patrick J; Worden, Alexandra Z; Santoro, Alyson E

    2018-02-01

    Photosynthetic picoeukaryotes contribute a significant fraction of primary production in the upper ocean. Micromonas pusilla is an ecologically relevant photosynthetic picoeukaryote, abundantly and widely distributed in marine waters. Grazing by protists may control the abundance of picoeukaryotes such as M. pusilla, but the diversity of the responsible grazers is poorly understood. To identify protists consuming photosynthetic picoeukaryotes in a productive North Pacific Ocean region, we amended seawater with living 15 N, 13 C-labelled M. pusilla cells in a 24-h replicated bottle experiment. DNA stable isotope probing, combined with high-throughput sequencing of V4 hypervariable regions from 18S rRNA gene amplicons (Tag-SIP), identified 19 operational taxonomic units (OTUs) of microbial eukaryotes that consumed M. pusilla. These OTUs were distantly related to cultured taxa within the dinoflagellates, ciliates, stramenopiles (MAST-1C and MAST-3 clades) and Telonema flagellates, thus, far known only from their environmental 18S rRNA gene sequences. Our discovery of eukaryotic prey consumption by MAST cells confirms that their trophic role in marine microbial food webs includes grazing upon picoeukaryotes. Our study provides new experimental evidence directly linking the genetic identity of diverse uncultivated microbial eukaryotes to the consumption of picoeukaryotic phytoplankton in the upper ocean. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

    PubMed Central

    Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

    2006-01-01

    Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

  16. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water

    PubMed Central

    Staley, C.; Sadowsky, M. J.; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.

    2015-01-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650

  17. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    PubMed

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  18. Identification of vector-borne pathogens in dogs and cats from Southern Brazil.

    PubMed

    Malheiros, J; Costa, M M; do Amaral, R B; de Sousa, K C M; André, M R; Machado, R Z; Vieira, M I B

    2016-07-01

    Dogs and cats are often infected with vector-borne pathogens and play a crucial role as reservoirs and hosts in their life cycles. The aim of the present study was to investigate the occurrence of vector-borne pathogens among dogs and cats in the northwestern region of Rio Grande do Sul (RS) State, Brazil. One hundred and ten blood samples were collected from dogs (n=80) and cats (n=30). Laboratory analysis were carried out through stained blood smears, indirect enzyme-linked immunosorbent assay (ELISA) for Babesia vogeli and Ehrlichia canis (only for dogs) and polymerase chain reaction (PCR) aiming the detection of pathogens. The following pathogens were screened by PCR among dogs and cats: Babesia spp. and Hepatozoon spp. (18S rRNA gene), Anaplasma spp. (16S rRNA gene), and Ehrlichia spp. (dsb gene for dogs and 16S rRNA gene for cats) and Bartonella spp. (nuoG gene only for cats). Using blood smears structures morphologically compatible with piroplasms were found in 5.45% (6/110) of the samples. Anti-B. vogeli and anti-E. canis antibodies were detected in 91% (73/80) and 9% (7/80) of the dogs, respectively. All the seropositive dogs to E. canis were also to B. vogeli. Nineteen (17.3%) animals were positive to hemoparasites by PCR. After sequencing Rangelia vitalii 6/80 (7.5%), B. vogeli 3/80 (4%), Hepatozoon spp. 1/80 (1%), and Anaplasma spp. 1/80 (1%) were found in the dogs, and B. vogeli 2/30 (7%) and Bartonella spp. 6/30 (20%) were detected in the screened cats. No sample was positive for genes dsb and 16S rRNA of Ehrlichia spp. Only those animals which were positive for R. vitalii showed findings compatible with rangeliosis, such as anemia (100%), thrombocytopenia (67%), jaundice (50%), external bleeding (50%), and anorexia (50%). This is the first time that B. vogeli detected among cats in Southern Brazil. Copyright © 2016 Elsevier GmbH. All rights reserved.

  19. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  20. Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

    PubMed Central

    Heilek, G M; Noller, H F

    1996-01-01

    Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

  1. Comparison of synovial fluid culture and 16S rRNA PCR in dogs with suspected septic arthritis.

    PubMed

    Scharf, V F; Lewis, D D; Wellehan, J F; Wamsley, H L; Richardson, R

    2015-06-01

    To prospectively compare the sensitivity and specificity of 16S rRNA PCR with culture for identifying the causative organism in synovial fluid obtained from dogs with suspected septic arthritis. Synovial fluid cytology, PCR analysis and aerobic, anaerobic and Mycoplasma culture of samples from the affected joints of 18 dogs presenting with suspected septic arthritis were performed. Synovial fluid samples from the corresponding contralateral joints of 7 dogs were also analysed as negative controls. There was no significant difference between the sensitivity of bacterial detection via culture (63.2%) versus PCR (73.7%) of synovial fluid (P=0.728) or between culture and combined PCR and culture (89.5%) of synovial fluid (P=0.124). The specificity of PCR (42.9%) was significantly lower than culture specificity (100%) (P=0.07). Although 16S PCR may hold potential as an ancillary diagnostic test for identifying the causative organism in dogs with septic arthritis, our study failed to demonstrate improved accuracy compared with traditional synovial fluid culture. © 2015 Australian Veterinary Association.

  2. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  3. Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.

    PubMed

    Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

    2007-03-01

    A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).

  4. Fungal community and cellulose-degrading genes in the composting process of Chinese medicinal herbal residues.

    PubMed

    Tian, Xueping; Yang, Tao; He, Jingzhong; Chu, Qian; Jia, Xiaojun; Huang, Jun

    2017-10-01

    The fungal community and the population of 16S rRNA, 18S rRNA and cellulose-degrading genes during the 30-day composting process of Chinese medicinal herbal residues were investigated using Illumina MiSeq and quantitative real-time PCR. An obvious succession of fungal communities occurred during the composting process. Unidentified fungi predominated in the raw materials. As composting progressed, Ascomycota became the most dominant phylum, with Aspergillus being the most dominant genus, and Aspergillus fumigatus making up 99.65% of that genus. Because of the inoculation of cellulolytic fungi in the mature stage, the cellulose degradation rate in inoculation groups was faster and the relative abundances of Aspergillus and the glycoside hydrolase family 7 genes were significantly higher than those in the control groups. These indicated that the fungal inoculants facilitated the degradation of cellulose, increased cellulolytic fungi and optimized the community structure. Copyright © 2017. Published by Elsevier Ltd.

  5. Two new species in the Echinoderes coulli group (Echinoderidae, Cyclorhagida, Kinorhyncha) from the Ryukyu Islands, Japan

    PubMed Central

    Yamasaki, Hiroshi; Fujimoto, Shinta

    2014-01-01

    Abstract Two new species belonging to the Echinoderes coulli group are described with their external morphologies and sequences of nuclear 18S rRNA and 28S rRNA genes, and mitochondrial COI gene. The first species, Echinoderes komatsui sp. n., is characterized by absence of acicular spines, and presence of lateroventral tubules on segments 5 and 8, laterodorsal tubules on segment 10, inverted triangle or wide oval shaped large sieve plates, lateral terminal accessory spines in female, and short tips of ventral pectinate fringe on segment 10. The second species, Echinoderes hwiizaa sp. n., is characterized by absence of acicular spines, and presence of lateroventral tubules on segments 5 and 7–9, midlateral tubules on segment 8, laterodorsal tubules on segment 10, large narrow oval shaped sieve plates on segment 9, and thick, short and blunt lateral terminal spines about 10–15% of trunk length. The diagnostic characters and key to species of E. coulli group are provided as well. PMID:24624018

  6. Effect of gamma irradiation on hyperthermal composting microorganisms for feasible application in space

    NASA Astrophysics Data System (ADS)

    Yoon, Minchul; Choi, Jong-il; Yamashita, Masamichi

    2013-05-01

    The composting system is the most efficient method for processing organic waste in space; however, the composting activity of microorganisms can be altered by cosmic rays. In this study, the effect of ionizing irradiation on composting bacteria was investigated. Sequence analyses of amplified 16S rRNA, 18S rRNA, and amoA genes were used to identify hyperthermal composting microorganisms. The viability of microorganisms in compost soil after gamma irradiation was directly determined using LIVE/DEAD BacLight viability kit. The dominant bacterial genera were Weissella cibaria and Leuconostoc sp., and the fungal genera were Metschnikowia bicuspidata and Pichia guilliermondii. Gamma irradiation up to a dose of 10 kGy did not significantly alter the microbial population. Furthermore, amylase and cellulase activities were maintained after high-dose gamma irradiation. Our results show that hyperthermal microorganisms can be used to recycle agricultural and fermented material in space stations and other human-inhabiting facilities on the Moon, Mars, and other planets.

  7. Co-occurrence Networks Among Bacteria and Microbial Eukaryotes of Lake Baikal During a Spring Phytoplankton Bloom.

    PubMed

    Mikhailov, Ivan S; Zakharova, Yulia R; Bukin, Yuri S; Galachyants, Yuri P; Petrova, Darya P; Sakirko, Maria V; Likhoshway, Yelena V

    2018-06-07

    The pelagic zone of Lake Baikal is an ecological niche where phytoplankton bloom causes increasing microbial abundance in spring which plays a key role in carbon turnover in the freshwater lake. Co-occurrence patterns revealed among different microbes can be applied to predict interactions between the microbes and environmental conditions in the ecosystem. We used 454 pyrosequencing of 16S rRNA and 18S rRNA genes to study bacterial and microbial eukaryotic communities and their co-occurrence patterns at the pelagic zone of Lake Baikal during a spring phytoplankton bloom. We found that microbes within one domain mostly correlated positively with each other and are highly interconnected. The highly connected taxa in co-occurrence networks were operational taxonomic units (OTUs) of Actinobacteria, Bacteroidetes, Alphaproteobacteria, and autotrophic and unclassified Eukaryota which might be analogous to microbial keystone taxa. Constrained correspondence analysis revealed the relationships of bacterial and microbial eukaryotic communities with geographical location.

  8. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

    PubMed Central

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

    2018-01-01

    Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

  9. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    PubMed

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  10. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

    PubMed Central

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

    2009-01-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

  11. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.

    PubMed

    Kim, Jeong-Soon; Wang, Nian

    2009-03-06

    Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  12. Does updating improve the methodological and reporting quality of systematic reviews?

    PubMed

    Shea, Beverley; Boers, Maarten; Grimshaw, Jeremy M; Hamel, Candyce; Bouter, Lex M

    2006-06-13

    Systematic reviews (SRs) must be of high quality. The purpose of our research was to compare the methodological and reporting quality of original versus updated Cochrane SRs to determine whether updating had improved these two quality dimensions. We identified updated Cochrane SRs published in issue 4, 2002 of the Cochrane Library. We assessed the updated and original versions of the SRs using two instruments: the 10 item enhanced Overview Quality Assessment Questionnaire (OQAQ), and an 18-item reporting quality checklist and flow chart based upon the Quality of Reporting of Meta-analyses (QUOROM) statement. At least two reviewers extracted data and assessed quality. We calculated the percentage (with a 95% confidence interval) of 'yes' answers to each question. We calculated mean differences in percentage, 95% confidence intervals and p-values for each of the individual items and the overall methodological quality score of the updated and pre-updated versions using OQAQ. We assessed 53 SRs. There was no significant improvement in the global quality score of the OQAQ (mean difference 0.11 (-0.28; 0.70 p = 0.52)). Updated reviews showed a significant improvement of 18.9 (7.2; 30.6 p < .01) on the OQAQ item assessing whether the conclusions drawn by the author(s) were supported by the data and/or analysis presented in the SR. The QUOROM statement showed that the quality of reporting of Cochrane reviews improved in some areas with updating. Improvements were seen on the items relating to data sources reported in the abstract, with a significant difference of 17.0 (9.8; 28.7 p = 0.01), review methods, reported in the abstract 35 (24.1; 49.1 p = 0.00), searching methods 18.9 (9.7; 31.6 p = 0.01), and data abstraction 18.9 (11.7; 30.9 p = 0.00). The overall quality of Cochrane SRs is fair-to-good. Although reporting quality improved on certain individual items there was no overall improvement seen with updating and methodological quality remained unchanged. Further improvement of quality of reporting is possible. There is room for improvement of methodological quality as well. Authors updating reviews should address identified methodological or reporting weaknesses. We recommend to give full attention to both quality domains when updating SRs.

  13. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  14. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  15. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  16. Morphometric and molecular data on two mitochondrial genes of a newly discovered chimaeran fish ( Hydrolagus melanophasma, Chondrichthyes)

    NASA Astrophysics Data System (ADS)

    De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio

    2012-06-01

    Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.

  17. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    PubMed

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  19. From sea to land and beyond – New insights into the evolution of euthyneuran Gastropoda (Mollusca)

    PubMed Central

    2008-01-01

    Background The Euthyneura are considered to be the most successful and diverse group of Gastropoda. Phylogenetically, they are riven with controversy. Previous morphology-based phylogenetic studies have been greatly hampered by rampant parallelism in morphological characters or by incomplete taxon sampling. Based on sequences of nuclear 18S rRNA and 28S rRNA as well as mitochondrial 16S rRNA and COI DNA from 56 taxa, we reconstructed the phylogeny of Euthyneura utilising Maximum Likelihood and Bayesian inference methods. The evolution of colonization of freshwater and terrestrial habitats by pulmonate Euthyneura, considered crucial in the evolution of this group of Gastropoda, is reconstructed with Bayesian approaches. Results We found several well supported clades within Euthyneura, however, we could not confirm the traditional classification, since Pulmonata are paraphyletic and Opistobranchia are either polyphyletic or paraphyletic with several clades clearly distinguishable. Sacoglossa appear separately from the rest of the Opisthobranchia as sister taxon to basal Pulmonata. Within Pulmonata, Basommatophora are paraphyletic and Hygrophila and Eupulmonata form monophyletic clades. Pyramidelloidea are placed within Euthyneura rendering the Euthyneura paraphyletic. Conclusion Based on the current phylogeny, it can be proposed for the first time that invasion of freshwater by Pulmonata is a unique evolutionary event and has taken place directly from the marine environment via an aquatic pathway. The origin of colonisation of terrestrial habitats is seeded in marginal zones and has probably occurred via estuaries or semi-terrestrial habitats such as mangroves. PMID:18294406

  20. Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

    PubMed Central

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

    2013-01-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

  1. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    PubMed

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  2. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    PubMed

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  3. Isolation & characterization of Brucella melitensis isolated from patients suspected for human brucellosis in India

    PubMed Central

    Barua, Anita; Kumar, Ashu; Thavaselvam, Duraipandian; Mangalgi, Smita; Prakash, Archana; Tiwari, Sapana; Arora, Sonia; Sathyaseelan, Kannusamy

    2016-01-01

    Background & objectives: Brucellosis is endemic in the southern part of India. A combination of biochemical, serological and molecular methods is required for identification and biotyping of Brucella. The present study describes the isolation and biochemical, molecular characterization of Brucella melitensis from patients suspected for human brucellosis. Methods: The blood samples were collected from febrile patients suspected to have brucellosis. A total of 18 isolates were obtained from 102 blood samples subjected to culture. The characterization of these 18 isolates was done by growth on Brucella specific medium, biochemical reactions, CO2 requirement, H2S production, agglutination with A and M mono-specific antiserum, dye sensitivity to basic fuchsin and thionin. Further, molecular characterization of the isolates was done by amplification of B. melitensis species specific IS711 repetitive DNA fragment and 16S (rRNA) sequence analysis. PCR-restriction fragment length polymorphism (RFLP) analysis of omp2 locus and IS711 gene was also done for molecular characterization. Results: All 102 suspected samples were subjected to bacteria isolation and of these, 18 isolates could be recovered on blood culture. The biochemical, PCR and PCR-RFLP and 16s rRNA sequencing revealed that all isolates were of B. melitensis and matched exactly with reference strain B. melitensis 16M. Interpretation & conclusions: The present study showed an overall isolation rate of 17.64 per cent for B. melitensis. There is a need to establish facilities for isolation and characterization of Brucella species for effective clinical management of the disease among patients as well as surveillance and control of infection in domestic animals. Further studies are needed from different geographical areas of the country with different level of endemicity to plan and execute control strategies against human brucellosis. PMID:27488010

  4. Microvirga soli sp. nov., an alphaproteobacterium isolated from soil.

    PubMed

    Dahal, Ram Hari; Kim, Jaisoo

    2017-01-01

    An aerobic, Gram-stain-negative, catalase-positive and oxidase-negative, non-motile, non-spore-forming, rod-shaped, pink-pigmented bacterium designated strain R491T was isolated from soil. Flexirubin-type pigments were absent. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain R491T formed a lineage within the family Methylobacteriaceae of the phylum Proteobacteria that was distinct from various species of the genus Microvirga, including Microvirgaaerilata 5420S-16T (97.83 % 16S rRNA gene sequence similarity), Microvirga zambiensis WSM3693T (97.76 %), Microvirga flocculans ATCC BAA-817T (97.41 %), and Microvirga lupini Lut6T, Microvirga subterranea DSM 14364T, Microvirga vignae BR3299T, and Microvirga guangxiensis 25BT (96.99 %). The major polar lipids of strain R491T were phosphatidylcholine, phosphatidylglycerol and phosphatidylethanolamine. The major cellular fatty acids were summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c; 71.2 %), C16 : 0 (12.0 %), summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c; 4.7 %), and C18 : 0 (4.2 %). The DNA G+C content of strain R491T was 61.8 mol%. DNA-DNA hybridization values between strain R491T and other members of the genus Microvirga ranged from 27 to 57 %. On the basis of phenotypic, genotypic and phylogenetic analyses, strain R491T represents a novel species of the genus Microvirga, for which the name Microvirga soli sp. nov. is proposed. The type strain is R491T (=KEMB 9005-408T=KACC 18969T=NBRC 112417T).

  5. Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

    PubMed Central

    Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

    2010-01-01

    N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

  6. Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

    PubMed

    Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

    2007-02-23

    N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

  7. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Liotrix

    MedlinePlus

    (lye' oh trix)Statement from Forest Laboratories Re: Availability of Thyrolar:[Posted 5/18/2012] U.S. Pharmacopeia, ... condition, and check for future updates on the availability of Thyrolar through the Forest product availability toll- ...

  9. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    PubMed

    Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

    1999-12-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  10. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  11. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

    PubMed Central

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-01

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

  12. Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

    PubMed

    Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

    2013-03-01

    Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

  13. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  14. Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

    PubMed Central

    Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID:22685540

  15. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  16. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  17. Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

    PubMed Central

    Dalmay, Tamas

    2018-01-01

    RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

  18. Free-living and captive turtles and tortoises as carriers of new Chlamydia spp.

    PubMed Central

    Niemczuk, Krzysztof; Zaręba, Kinga; Zając, Magdalena; Laroucau, Karine; Szymańska-Czerwińska, Monika

    2017-01-01

    A variety of Chlamydia species belonging to the Chlamydiaceae family have been reported in reptilian hosts but scarce data about their occurrence in turtles and tortoises are available. In this study, research was conducted to acquire information on invasive alien species (IAS) of turtles and indigenous turtles and tortoises, living both free and in captivity, as possible reservoirs of Chlamydiaceae. Analysis of specimens (pharyngeal and cloacal swabs and tissues) from 204 turtles and tortoises revealed an overall Chlamydiaceae prevalence of 18.3% and 28.6% among free-living and captive animals respectively, with variable levels of shedding. Further testing conducted with a species-specific real-time PCR and microarray test was unsuccessful. Subsequently sequencing was applied to genotype the Chlamydiaceae-positive samples. Almost the full lengths of the 16S rRNA and ompA genes as well as the 16S-23S intergenic spacer (IGS) and 23S rRNA domain I were obtained for 14, 20 and 8 specimens respectively. Phylogenetic analysis of 16S rRNA amplicons revealed two distinct branches. Group 1 (10 specimens), specific to freshwater turtles and reported here for the first time, was most closely related to Chlamydia (C.) pneumoniae strains and the newly described Candidatus C. sanzinia. Group 2 (four specimens), detected in Testudo spp. samples, showed highest homology to C. pecorum strains but formed a separate sub-branch. Finally, molecular analysis conducted on positive samples together with their geographical distribution in places distant from each other strongly suggest that Group 1 specimens correspond to a new species in the Chlamydiaceae family. In-depth studies of Chlamydia spp. from turtles and tortoises are needed to further characterise these atypical strains and address arising questions about their pathogenicity and zoonotic potential. PMID:28950002

  19. Free-living and captive turtles and tortoises as carriers of new Chlamydia spp.

    PubMed

    Mitura, Agata; Niemczuk, Krzysztof; Zaręba, Kinga; Zając, Magdalena; Laroucau, Karine; Szymańska-Czerwińska, Monika

    2017-01-01

    A variety of Chlamydia species belonging to the Chlamydiaceae family have been reported in reptilian hosts but scarce data about their occurrence in turtles and tortoises are available. In this study, research was conducted to acquire information on invasive alien species (IAS) of turtles and indigenous turtles and tortoises, living both free and in captivity, as possible reservoirs of Chlamydiaceae. Analysis of specimens (pharyngeal and cloacal swabs and tissues) from 204 turtles and tortoises revealed an overall Chlamydiaceae prevalence of 18.3% and 28.6% among free-living and captive animals respectively, with variable levels of shedding. Further testing conducted with a species-specific real-time PCR and microarray test was unsuccessful. Subsequently sequencing was applied to genotype the Chlamydiaceae-positive samples. Almost the full lengths of the 16S rRNA and ompA genes as well as the 16S-23S intergenic spacer (IGS) and 23S rRNA domain I were obtained for 14, 20 and 8 specimens respectively. Phylogenetic analysis of 16S rRNA amplicons revealed two distinct branches. Group 1 (10 specimens), specific to freshwater turtles and reported here for the first time, was most closely related to Chlamydia (C.) pneumoniae strains and the newly described Candidatus C. sanzinia. Group 2 (four specimens), detected in Testudo spp. samples, showed highest homology to C. pecorum strains but formed a separate sub-branch. Finally, molecular analysis conducted on positive samples together with their geographical distribution in places distant from each other strongly suggest that Group 1 specimens correspond to a new species in the Chlamydiaceae family. In-depth studies of Chlamydia spp. from turtles and tortoises are needed to further characterise these atypical strains and address arising questions about their pathogenicity and zoonotic potential.

  20. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  1. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  2. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    PubMed Central

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  3. Limitations of commonly used internal controls for real-time RT-PCR analysis of renal epithelial-mesenchymal cell transition.

    PubMed

    Elberg, Gerard; Elberg, Dorit; Logan, Charlotte J; Chen, Lijuan; Turman, Martin A

    2006-01-01

    Progressive renal fibrotic disease is accompanied by the massive accumulation of myofibroblasts as defined by alpha smooth muscle actin (alphaSMA) expression. We quantitated gene expression using real-time RT-PCR analysis during conversion of primary cultured human renal tubular cells (RTC) to myofibroblasts after treatment with transforming growth factor-beta1 (TGF-beta1). We report herein the limitations of commonly used reference genes for mRNA quantitation. We determined the expression of alphaSMA and megakaryoblastic leukemia-1 (MKL1), a transcriptional regulator of alphaSMA, by quantitative real-time PCR using three common internal controls, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclophilin A and 18S rRNA. Expression of GAPDH mRNA and cyclophilin A mRNA, and to a lesser extent, 18S rRNA levels varied over time in culture and with exposure to TGF-beta1. Thus, depending on which reference gene was used, TGF-beta1 appeared to have different effects on expression of MKL1 and alphaSMA. RTC converting to myofibroblasts in primary culture is a valuable system to study renal fibrosis in humans. However, variability in expression of reference genes with TGF-beta1 treatment illustrates the need to validate mRNA quantitation with multiple reference genes to provide accurate interpretation of fibrosis studies in the absence of a universal internal standard for mRNA expression. 2006 S. Karger AG, Basel.

  4. Nucleolar evolution and coiled bodies during meiotic prophase in Olea europaea: differential localization of nucleic acids.

    PubMed

    Olmedilla, A; de Dios Alché, J; Rodríguez-García, M I

    1997-10-01

    We studied the ultrastructural evolution of the nucleolus during meiotic prophase in olive microsporocytes. During prophase, nuclear bodies morphologically similar to coiled bodies were observed. The nucleic acid composition of these bodies was examined in microsporocytes using electron microscopic techniques with EDTA preferential ribonucleoprotein staining, anti-DNA immunolabeling, the in situ terminal deoxynucleotidyl transferase-immunogold technique, and in situ hybridization with 18S rRNA and U3 snoRNA digoxigenin-labeled probes. The ultrastructural appearance of the meiocyte nucleolus indicated a low level of activity from the early prophase stage: the granular component was practically absent and nucleoli were constituted almost exclusively by dense fibrillar component containing large fibrillar centers that lacked chromatin inclusions. However, the appearance of reactivation vacuoles in the nucleolus during zygotene and high levels of rRNA in the nucleoplasm during pachytene support the presence of a peak in rRNA synthesis. Our results also show that the nuclear bodies that appear during prophase I are ribonucleoproteinaceous in nature; neither DNA nor ribosomal RNA were detected. The presence of U3 snoRNA, as shown by in situ hybridization in nuclear bodies from plant material, is also evidence that these structures are coiled bodies. We suggest that coiled bodies are involved not only in pre- and post-splicing events but also in the storage, transport or recycling of rRNA maturation elements.

  5. Phylogenetic relationships among superfamilies of Neritimorpha (Mollusca: Gastropoda).

    PubMed

    Uribe, Juan E; Colgan, Don; Castro, Lyda R; Kano, Yasunori; Zardoya, Rafael

    2016-11-01

    Despite the extraordinary morphological and ecological diversity of Neritimorpha, few studies have focused on the phylogenetic relationships of this lineage of gastropods, which includes four extant superfamilies: Neritopsoidea, Hydrocenoidea, Helicinoidea, and Neritoidea. Here, the nucleotide sequences of the complete mitochondrial genomes of Georissa bangueyensis (Hydrocenoidea), Neritina usnea (Neritoidea), and Pleuropoma jana (Helicinoidea) and the nearly complete mt genomes of Titiscania sp. (Neritopsoidea) and Theodoxus fluviatilis (Neritoidea) were determined. Phylogenetic reconstructions using probabilistic methods were based on mitochondrial (13 protein coding genes and two ribosomal rRNA genes), nuclear (partial 28S rRNA, 18S rRNA, actin, and histone H3 genes) and combined sequence data sets. All phylogenetic analyses except one converged on a single, highly supported tree in which Neritopsoidea was recovered as the sister group of a clade including Helicinoidea as the sister group of Hydrocenoidea and Neritoidea. This topology agrees with the fossil record and supports at least three independent invasions of land by neritimorph snails. The mitochondrial genomes of Titiscania sp., G. bangueyensis, N. usnea, and T. fluviatilis share the same gene organization previously described for Nerita mt genomes whereas that of P. jana has undergone major rearrangements. We sequenced about half of the mitochondrial genome of another species of Helicinoidea, Viana regina, and confirmed that this species shares the highly derived gene order of P. jana. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Sphingomonas aerophila sp. nov. and Sphingomonas naasensis sp. nov., isolated from air and soil, respectively.

    PubMed

    Kim, Soo-Jin; Moon, Ji-Young; Lim, Jun-Muk; Ahn, Jae-Hyung; Weon, Hang-Yeon; Ahn, Tae-Young; Kwon, Soon-Wo

    2014-03-01

    Two strains, designated 5413J-26(T) and KIS18-15(T), were isolated from the air and forest soil, respectively, in South Korea. Cells of the two strains were Gram-stain-negative, aerobic, polar-flagellated and rod-shaped. According to the phylogenetic tree, strains 5413J-26(T) and KIS18-15(T) fell into the cluster of Sphingomonas sensu stricto. Strain 5413J-26(T) showed the highest sequence similarities with Sphingomonas trueperi LMG 2142(T) (96.6%), Sphingomonas molluscorum KMM 3882(T) (96.5%), Sphingomonas azotifigens NBRC 15497(T) (96.3 %) and Sphingomonas pituitosa EDIV(T) (96.1 %), while strain KIS18-15(T) had the highest sequence similarity with Sphingomonas soli T5-04(T) (96.8%), Sphingomonas pituitosa EDIV(T) (96.6%), Sphingomonas leidyi ATCC 15260(T) (96.6 %), Sphingomonas asaccharolytica NBRC 15499(T) (96.6 %) and Sphingomonas koreensis JSS26(T) (96.6 %). The 16S rRNA gene sequence similarity between strains 5413J-26(T) and KIS18-15(T) was 95.4 %. Ubiquinone 10 was the predominant respiratory quinone and homospermidine was the major polyamine. The major polar lipids consisted of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, and several unidentified phospholipids and lipids. The main cellular fatty acids (>10% of the total fatty acids) of strain 5413J-26(T) were summed feature 8 (C18 : 1ω6c and/or C18 : 1ω7c), summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH) and C14 : 0 2-OH, and those of strain KIS18-15(T) were summed feature 8 and C16 : 0. Based on the results of 16S rRNA gene sequence analysis, and physiological and biochemical characterization, two novel species with the suggested names Sphingomonas aerophila sp. nov. (type strain 5413J-26(T) = KACC 16533(T) = NBRC 108942(T)) and Sphingomonas naasensis sp. nov. (type strain KIS18-15(T) = KACC 16534(T) = NBRC 108943(T)) are proposed.

  7. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    PubMed

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  8. Molecular identification of Plasmodium spp. and blood meal sources of anophelines in environmental reserves on São Luís Island, state of Maranhão, Brazil.

    PubMed

    Figueiredo, Mayra Araguaia Pereira; Di Santi, Silvia Maria; Manrique, Wilson Gómez; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

    2017-04-26

    Considering the diversity of feeding habits that females of some species of anophelines present, it is important to understand which vertebrates are part of blood food sources and how important is the role of each in the ecoepidemiology of malaria. There are many vector species for Plasmodium spp. in the State of Maranhão, Brazil. In São Luís Island, Anopheles aquasalis is the main vector for human malaria; this species is abundant in areas with primates that are positive for Plasmodium. Anopheles aquasalis has natural exophilic and zoophilic feeding behavior, but in cases of high density and absence of animals, presents quite varied behavior, and feeds on human blood. In this context, the objective of the present study was to identify Plasmodium spp. and the blood meal sources of anophelines in two environmental reserves on São Luís Island, state of Maranhão, using molecular methods. Between June and July 2013, female anophelines were collected in the Sítio Aguahy Private Reserve, in the municipality of São José de Ribamar, and in the Sítio Mangalho Reserve, located within the Maracanã Environmental Protection Area, in the municipality of São Luís. CDC-type light traps, Shannon traps and protected human bait were used during three consecutive hours in peridomestic and wooded areas. Pools of anophelines were formed using mosquitoes of the same species that had been caught at the same site on the same date. A genus-specific amplification protocol based on the 18S rRNA gene was used for qPCR and cPCR. A total of 416 anophelines were collected, of the following species: An. aquasalis (399), An. mediopunctatus (3), An. shannoni (1), An. nuneztovari (sensu lato) (1), An. goeldii (1), An. evansae (2) and An. (Nyssorhynchus) sp. (9), comprising 54 pools. Two pools were positive for Plasmodium (2/54) based on the 18S rRNA gene. In the phylogenetic analysis using the maximum likelihood method, based on a 240 bp fragment of the 18S rRNA gene, it was found that the sequences of Plasmodium sp. amplified from pools of An. aquasalis (pool 2) and An. nuneztovari (s.l.) (pool 10) were phylogenetically related to a clade of P. falciparum isolates from India, and to a clade of Plasmodium sp. isolates from psittacines in Brazil, respectively. Cat, dog and human DNA were identified in the blood meals of the anophelines sampled. The species An. aquasalis was the most abundant anopheline species in São Luís Island. Plasmodium spp. DNA was detected, thus confirming the importance of this species as the main vector on São Luís Island, Brazil. In addition, the presence of An. nuneztovari (s.l.) with DNA positive for Plasmodium spp. confirms its importance as a secondary vector.

  9. Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets

    PubMed Central

    Hofmann, Natalie; Mwingira, Felista; Shekalaghe, Seif; Robinson, Leanne J.; Mueller, Ivo; Felger, Ingrid

    2015-01-01

    Background Planning and evaluating malaria control strategies relies on accurate definition of parasite prevalence in the population. A large proportion of asymptomatic parasite infections can only be identified by surveillance with molecular methods, yet these infections also contribute to onward transmission to mosquitoes. The sensitivity of molecular detection by PCR is limited by the abundance of the target sequence in a DNA sample; thus, detection becomes imperfect at low densities. We aimed to increase PCR diagnostic sensitivity by targeting multi-copy genomic sequences for reliable detection of low-density infections, and investigated the impact of these PCR assays on community prevalence data. Methods and Findings Two quantitative PCR (qPCR) assays were developed for ultra-sensitive detection of Plasmodium falciparum, targeting the high-copy telomere-associated repetitive element 2 (TARE-2, ∼250 copies/genome) and the var gene acidic terminal sequence (varATS, 59 copies/genome). Our assays reached a limit of detection of 0.03 to 0.15 parasites/μl blood and were 10× more sensitive than standard 18S rRNA qPCR. In a population cross-sectional study in Tanzania, 295/498 samples tested positive using ultra-sensitive assays. Light microscopy missed 169 infections (57%). 18S rRNA qPCR failed to identify 48 infections (16%), of which 40% carried gametocytes detected by pfs25 quantitative reverse-transcription PCR. To judge the suitability of the TARE-2 and varATS assays for high-throughput screens, their performance was tested on sample pools. Both ultra-sensitive assays correctly detected all pools containing one low-density P. falciparum–positive sample, which went undetected by 18S rRNA qPCR, among nine negatives. TARE-2 and varATS qPCRs improve estimates of prevalence rates, yet other infections might still remain undetected when absent in the limited blood volume sampled. Conclusions Measured malaria prevalence in communities is largely determined by the sensitivity of the diagnostic tool used. Even when applying standard molecular diagnostics, prevalence in our study population was underestimated by 8% compared to the new assays. Our findings highlight the need for highly sensitive tools such as TARE-2 and varATS qPCR in community surveillance and for monitoring interventions to better describe malaria epidemiology and inform malaria elimination efforts. PMID:25734259

  10. Microbial Abundances in Salt Marsh Soils: A Molecular Approach for Small Spatial Scales

    NASA Astrophysics Data System (ADS)

    Granse, Dirk; Mueller, Peter; Weingartner, Magdalena; Hoth, Stefan; Jensen, Kai

    2016-04-01

    The rate of biological decomposition greatly determines the carbon sequestration capacity of salt marshes. Microorganisms are involved in the decomposition of biomass and the rate of decomposition is supposed to be related to microbial abundance. Recent studies quantified microbial abundance by means of quantitative polymerase chain reaction (QPCR), a method that also allows determining the microbial community structure by applying specific primers. The main microbial community structure can be determined by using primers specific for 16S rRNA (Bacteria) and 18S rRNA (Fungi) of the microbial DNA. However, the investigation of microbial abundance pattern at small spatial scales, such as locally varying abiotic conditions within a salt-marsh system, requires high accuracy in DNA extraction and QPCR methods. Furthermore, there is evidence that a single extraction may not be sufficient to reliably quantify rRNA gene copies. The aim of this study was to establish a suitable DNA extraction method and stable QPCR conditions for the measurement of microbial abundances in semi-terrestrial environments. DNA was extracted from two soil samples (top WE{5}{cm}) by using the PowerSoil DNA Extraction Kit (Mo Bio Laboratories, Inc., Carlsbad, CA) and applying a modified extraction protocol. The DNA extraction was conducted in four consecutive DNA extraction loops from three biological replicates per soil sample by reusing the PowerSoil bead tube. The number of Fungi and Bacteria rRNA gene copies of each DNA extraction loop and a pooled DNA solution (extraction loop 1 - 4) was measured by using the QPCR method with taxa specific primer pairs (Bacteria: B341F, B805R; Fungi: FR1, FF390). The DNA yield of the replicates varied at DNA extraction loop 1 between WE{25 and 85}{ng

  11. Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

    PubMed Central

    Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

    2014-01-01

    Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

  12. Wide Distribution and Genetic Diversity of Babesia microti in Small Mammals from Yunnan Province, Southwestern China.

    PubMed

    Gao, Zi-Hou; Huang, Tao-Hua; Jiang, Bao-Gui; Jia, Na; Liu, Zheng-Xiang; Shao, Zong-Ti; Jiang, Rui-Ruo; Liu, Hong-Bo; Wei, Ran; Li, Yu-Qiong; Yao, Hong-Wu; von Fricken, Michael E; Jiang, Jia-Fu; Du, Chun-Hong; Cao, Wu-Chun

    2017-10-01

    Babesia, usually found in wild and domestic mammals worldwide, have recently been responsible for emerging malaria-like zoonosis in infected patients. Human B. microti infection has been identified in China, primarily in the Southwest along the Myanmar border but little direct surveillance of B. microti infection in rodents has been carried out here (Yunnan province). In this region, a diverse topographic range combined with tropical moisture sustains a high biodiversity of small mammals, which might play important role on Babesia transmission. Small mammals were captured in 141 sample locations from 18 counties located Yunnan Province, and screened for B. microti-like parasites infection by a nested PCR to target 18S rRNA gene of Babesia, plus directly sequencing for positive samples. Univariate and multivariate forward stepwise logistic regression analysis was used to access the association between infections and some related risk factors. Infection with Babesia microti was confirmed in 2.4% (53/ 2204) of small mammals. Significant differences in prevalence rates of B. microti were observed based on variations in forest, agricultural, and residential landscapes. Furthermore, adult small mammals had higher prevalence rates than younger, pubertal mammals. The near full-length 18S rRNA gene revealed that there were two types of B. microti, Kobe and Otsu, which demonstrate the genetic diversity and regional distribution. There exists a wide distribution and genetic diversity of endemic B. microti in Southwestern China, warranting further investigations and monitoring of clinical disease in individuals presenting with Babesia like symptoms in these areas.

  13. A novel genus of the class Actinobacteria, Longivirga aurantiaca gen. nov., sp. nov., isolated from lake sediment.

    PubMed

    Qu, Jian-Hang; Zhang, Lu-Jie; Fu, Yun-Hui; Li, Xiao-Dan; Li, Hai-Feng; Tian, Hai-Long

    2018-03-01

    A novel actinobacterial strain, designated X5 T , was isolated from the sediment of Taihu Lake in China and was subjected to a polyphasic taxonomic characterization. The strain formed orange-red colonies comprising aerobic, Gram-stain-negative, rod-shaped cells on R2A agar. Phylogenetic analysis based on the 16S rRNA gene sequences revealed that the organism was closely related to the genus Sporichthya and consistently formed a distinct clade along with the members of this genus. The closest phylogenetic neighbour was Sporichthya polymorpha NBRC 12702 T with 93.7 % 16S rRNA gene sequence similarity. The major fatty acids (>10 %) were iso-C16 : 0 (18.7 %), C18 : 1ω9c (18.6 %) and C17 : 1ω8c (14.0 %). The genomic DNA G+C content was 74.4 mol%. The organism contained menaquinone MK-8(H2), MK-9(H4) and an unidentified menaquinone. Polar lipids were composed of phosphatidylglycerol, an unidentified lipid, two unidentified phospholipids and two unidentified aminolipids. The whole-cell sugars contained ribose, xylose, mannose, glucose and galactose. The cell-wall peptidoglycan contained ll-diaminopimelic acid. Based on the physiological, biochemical and chemotaxonomic data, the organism is proposed to represent a novel genus and species, for which the name Longivirga aurantiaca gen. nov., sp. nov. is proposed. The type strain is X5 T (=CGMCC 4.7317 T =NBRC 112237 T ).

  14. Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers

    PubMed Central

    Steenkeste, Nicolas; Incardona, Sandra; Chy, Sophy; Duval, Linda; Ekala, Marie-Thérèse; Lim, Pharath; Hewitt, Sean; Sochantha, Tho; Socheat, Doung; Rogier, Christophe; Mercereau-Puijalon, Odile; Fandeur, Thierry; Ariey, Frédéric

    2009-01-01

    Background Several strategies are currently deployed in many countries in the tropics to strengthen malaria control toward malaria elimination. To measure the impact of any intervention, there is a need to detect malaria properly. Mostly, decisions still rely on microscopy diagnosis. But sensitive diagnosis tools enabling to deal with a large number of samples are needed. The molecular detection approach offers a much higher sensitivity, and the flexibility to be automated and upgraded. Methods Two new molecular methods were developed: dot18S, a Plasmodium-specific nested PCR based on the 18S rRNA gene followed by dot-blot detection of species by using species-specific probes and CYTB, a Plasmodium-specific nested PCR based on cytochrome b gene followed by species detection using SNP analysis. The results were compared to those obtained with microscopic examination and the "standard" 18S rRNA gene based nested PCR using species specific primers. 337 samples were diagnosed. Results Compared to the microscopy the three molecular methods were more sensitive, greatly increasing the estimated prevalence of Plasmodium infection, including P. malariae and P. ovale. A high rate of mixed infections was uncovered with about one third of the villagers infected with more than one malaria parasite species. Dot18S and CYTB sensitivity outranged the "standard" nested PCR method, CYTB being the most sensitive. As a consequence, compared to the "standard" nested PCR method for the detection of Plasmodium spp., the sensitivity of dot18S and CYTB was respectively 95.3% and 97.3%. Consistent detection of Plasmodium spp. by the three molecular methods was obtained for 83% of tested isolates. Contradictory results were mostly related to detection of Plasmodium malariae and Plasmodium ovale in mixed infections, due to an "all-or-none" detection effect at low-level parasitaemia. Conclusion A large reservoir of asymptomatic infections was uncovered using the molecular methods. Dot18S and CYTB, the new methods reported herein are highly sensitive, allow parasite DNA extraction as well as genus- and species-specific diagnosis of several hundreds of samples, and are amenable to high-throughput scaling up for larger sample sizes. Such methods provide novel information on malaria prevalence and epidemiology and are suited for active malaria detection. The usefulness of such sensitive malaria diagnosis tools, especially in low endemic areas where eradication plans are now on-going, is discussed in this paper. PMID:19402894

  15. Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

    PubMed Central

    Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

    2000-01-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

  16. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  17. National Educators' Workshop: Update 2003. Standard Experiments in Engineering, Materials Science, and Technology. Part 2

    NASA Technical Reports Server (NTRS)

    Prior, Edwin J. (Compiler); Jacobs, James A. (Compiler); Edmonson, William (Compiler); Wilkerson, Amy (Compiler)

    2004-01-01

    The 18th Annual National Educators Workshop [NEW:Update 2003] was a part of NASA Langley s celebration of the Centennial of Controlled, Powered Flight by Orville and Wilbur Wright on December 17, 1903. The conference proceedings from NEW:Update 2003 reflect the Flight 100 theme by first providing a historic perspective on the remarkable accomplishments of the Wright Brothers. The historical perspective set the stag for insights into aeronautics and aerospace structures and materials now and into the future. The NEW:Update 2003 proceedings provide valuable resources to educators and students in the form of visuals, experiments and demonstrations for classes/labs at levels ranging from precollege through college education.

  18. National Educators' Workshop: Update 2003. Standard Experiments in Engineering, Materials Science, and Technology. Part 1

    NASA Technical Reports Server (NTRS)

    Prior, Edwin J. (Compiler); Jacobs, James A. (Compiler); Edmonson, William (Compiler); Wilkerson, Amy (Compiler)

    2004-01-01

    The 18th Annual National Educators Workshop [NEW:Update 2003] was a part of NASA Langley s celebration of the Centennial of Controlled, Powered Flight by Orville and Wilbur Wright on December 17, 1903. The conference proceedings from NEW:Update 2003 reflect the Flight 100 theme by first providing a historic perspective on the remarkable accomplishments of the Wright Brothers. The historical perspective set the stag for insights into aeronautics and aerospace structures and materials now and into the future. The NEW:Update 2003 proceedings provide valuable resources to educators and students in the form of visuals, experiments and demonstrations for classes/labs at levels ranging from precollege through college education.

  19. Chromobacterium haemolyticum sp. nov., a strongly haemolytic species.

    PubMed

    Han, Xiang Y; Han, Faye S; Segal, Jonathan

    2008-06-01

    A Gram-negative bacterium, strain MDA0585(T), isolated from a sputum culture, was characterized by a polyphasic approach. The 16S rRNA gene and a conserved portion of the DNA gyrase A gene were sequenced and analysed phylogenetically. Strain MDA0585(T) showed the closest relationships with Chromobacterium violaceum ATCC 12472(T) and Chromobacterium subtsugae PRAA4-1(T) (96.1 % and 96.3 % 16S rRNA gene sequence similarity, respectively). The cellular fatty acids of strain MDA0585(T) consisted mainly of C(16 : 0), C(16 : 1)omega7c and C(16 : 1)omega6c (summed feature 3) and C(18 : 1)omega7c and C(18 : 1)omega6c (summed feature 8), a profile that was similar to, but distinguishable from, those of C. violaceum ATCC 12472(T) and C. subtsugae PRAA4-1(T). In culture, strain MDA0585(T) differed from C. violaceum and C. subtsugae in several ways: lack of violet pigmentation, the ability to haemolyse sheep blood, differences in several biochemical reactions and higher resistance to antibiotics. The culture supernatant of strain MDA0585(T) also caused remarkable haemolysis of human erythrocytes. These results suggest that strain MDA0585(T) represents a novel species within the genus Chromobacterium, for which the name Chromobacterium haemolyticum sp. nov. is proposed. The type strain is MDA0585(T) (=CCUG 53230(T)=JCM 14163(T)=DSM 19808(T)).

  20. Comparison of diagnostic techniques for the detection of Cryptosporidium oocysts in animal samples

    PubMed Central

    Mirhashemi, Marzieh Ezzaty; Zintl, Annetta; Grant, Tim; Lucy, Frances E.; Mulcahy, Grace; De Waal, Theo

    2015-01-01

    While a large number of laboratory methods for the detection of Cryptosporidium oocysts in faecal samples are now available, their efficacy for identifying asymptomatic cases of cryptosporidiosis is poorly understood. This study was carried out to determine a reliable screening test for epidemiological studies in livestock. In addition, three molecular tests were compared to identify Cryptosporidium species responsible for the infection in cattle, sheep and horses. A variety of diagnostic tests including microscopic (Kinyoun's staining), immunological (Direct Fluorescence Antibody tests or DFAT), enzyme-linked immunosorbent assay (ELISA), and molecular methods (nested PCR) were compared to assess their ability to detect Cryptosporidium in cattle, horse and sheep faecal samples. The results indicate that the sensitivity and specificity of each test is highly dependent on the input samples; while Kinyoun's and DFAT proved to be reliable screening tools for cattle samples, DFAT and PCR analysis (targeted at the 18S rRNA gene fragment) were more sensitive for screening sheep and horse samples. Finally different PCR primer sets targeted at the same region resulted in the preferential amplification of certain Cryptosporidium species when multiple species were present in the sample. Therefore, for identification of Cryptosporidium spp. in the event of asymptomatic cryptosporidiosis, the combination of different 18S rRNA nested PCR primer sets is recommended for further epidemiological applications and also tracking the sources of infection. PMID:25662435

  1. Jannaschia seohaensis sp. nov., isolated from a tidal flat sediment.

    PubMed

    Yoon, Jung-Hoon; Kang, So-Jung; Park, Sooyeon; Oh, Ki-Hoon; Oh, Tae-Kwang

    2010-01-01

    A Gram-negative, motile and pleomorphic bacterial strain, SMK-146(T), was isolated from a tidal flat sediment of the Yellow Sea, Korea, and its taxonomic position was investigated. Strain SMK-146(T) grew optimally at pH 7.0-8.0 and 30 degrees C. It contained Q-10 as the predominant ubiquinone and C(18 : 1)omega7c and 11-methyl C(18 : 1)omega7c as the major fatty acids. The major polar lipids were phosphatidylcholine, phosphatidylglycerol and phosphatidylethanolamine. The DNA G+C content was 68.4 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain SMK-146(T) belongs to the genus Jannaschia. Strain SMK-146(T) exhibited 16S rRNA gene sequence similarity values of 95.3-97.0 % to the type strains of the five recognized Jannaschia species. The mean DNA-DNA relatedness value between strain SMK-146(T) and Jannaschia seosinensis KCCM 42114(T), the closest phylogenetic neighbour, was 17 %. Differential phenotypic properties also revealed that strain SMK-146(T) differs from the recognized Jannaschia species. On the basis of phenotypic, phylogenetic and genetic data, strain SMK-146(T) represents a novel species of the genus Jannaschia, for which the name Jannaschia seohaensis sp. nov. is proposed. The type strain is SMK-146(T) (=KCTC 22172(T) =CCUG 55326(T)).

  2. Phylogenetic relationships and species circumscription in Trentepohlia and Printzina (Trentepohliales, Chlorophyta).

    PubMed

    Rindi, Fabio; Lam, Daryl W; López-Bautista, Juan M

    2009-08-01

    Subaerial green microalgae represent a polyphyletic complex of organisms, whose genetic diversity is much higher than their simple morphologies suggest. The order Trentepohliales is the only species-rich group of subaerial algae belonging to the class Ulvophyceae and represents an ideal model taxon to investigate evolutionary patterns of these organisms. We studied phylogenetic relationships in two common genera of Trentepohliales (Trentepohlia and Printzina) by separate and combined analyses of the rbcL and 18S rRNA genes. Trentepohlia and Printzina were not resolved as monophyletic groups. Three main clades were recovered in all analyses, but none corresponded to any trentepohlialean genus as defined based on morphological grounds. The rbcL and 18S rRNA datasets provided congruent phylogenetic signals and similar topologies were recovered in single-gene analyses. Analyses performed on the combined 2-gene dataset inferred generally higher nodal support. The results clarified several taxonomic problems and showed that the evolution of these algae has been characterized by considerable morphological convergence. Trentepohlia abietina and T. flava were shown to be separate species from T. aurea; Printzina lagenifera, T. arborum and T. umbrina were resolved as polyphyletic taxa, whose vegetative morphology appears to have evolved independently in separate lineages. Incongruence between phylogenetic relationships and traditional morphological classification was demonstrated, showing that the morphological characters commonly used in the taxonomy of the Trentepohliales are phylogenetically irrelevant.

  3. The Primary open-angle glaucoma gene WDR36 functions in ribosomal RNA processing and interacts with the p53 stress–response pathway

    PubMed Central

    Skarie, Jonathan M.; Link, Brian A.

    2008-01-01

    Primary open-angle glaucoma (POAG) is a genetically complex neuropathy that affects retinal ganglion cells and is a leading cause of blindness worldwide. WDR36, a gene of unknown function, was recently identified as causative for POAG at locus GLC1G. Subsequent studies found disease-associated variants in control populations, leaving the role of WDR36 in this disease unclear. To address this issue, we determined the function of WDR36. We studied Wdr36 in zebrafish and found it is the functional homolog of yeast Utp21. Utp21 is cell essential and functions in the nucleolar processing of 18S rRNA, which is required for ribosome biogenesis. Evidence for functional homology comes from sequence alignment, ubiquitous expression, sub-cellular localization to the nucleolus and loss-of-function phenotypes that include defects in 18S rRNA processing and abnormal nucleolar morphology. Additionally, we show that loss of Wdr36 function leads to an activation of the p53 stress–response pathway, suggesting that co-inheritance of defects in p53 pathway genes may influence the impact of WDR36 variants on POAG. Although these results overall do not provide evidence for or against a role of WDR36 in POAG, they do provide important baseline information for future studies. PMID:18469340

  4. Impact of Soil Texture on Soil Ciliate Communities

    NASA Astrophysics Data System (ADS)

    Chau, J. F.; Brown, S.; Habtom, E.; Brinson, F.; Epps, M.; Scott, R.

    2014-12-01

    Soil water content and connectivity strongly influence microbial activities in soil, controlling access to nutrients and electron acceptors, and mediating interactions between microbes within and between trophic levels. These interactions occur at or below the pore scale, and are influenced by soil texture and structure, which determine the microscale architecture of soil pores. Soil protozoa are relatively understudied, especially given the strong control they exert on bacterial communities through predation. Here, ciliate communities in soils of contrasting textures were investigated. Two ciliate-specific primer sets targeting the 18S rRNA gene were used to amplify DNA extracted from eight soil samples collected from Sumter National Forest in western South Carolina. Primer sets 121F-384F-1147R (semi-nested) and 315F-959R were used to amplify soil ciliate DNA via polymerase chain reaction (PCR), and the resulting PCR products were analyzed by gel electrophoresis to obtain quantity and band size. Approximately two hundred ciliate 18S rRNA sequences were obtained were obtained from each of two contrasting soils. Sequences were aligned against the NCBI GenBank database for identification, and the taxonomic classification of best-matched sequences was determined. The ultimate goal of the work is to quantify changes in the ciliate community under short-timescale changes in hydrologic conditions for varying soil textures, elucidating dynamic responses to desiccation stress in major soil ciliate taxa.

  5. Metal contaminations impact archaeal community composition, abundance and function in remote alpine lakes.

    PubMed

    Compte-Port, Sergi; Borrego, Carles M; Moussard, Hélène; Jeanbille, Mathilde; Restrepo-Ortiz, Claudia Ximena; de Diego, Alberto; Rodriguez-Iruretagoiena, Azibar; Gredilla, Ainara; Fdez-Ortiz de Vallejuelo, Silvia; Galand, Pierre E; Kalenitchenko, Dimitri; Rols, Jean-Luc; Pokrovsky, Oleg S; Gonzalez, Aridane G; Camarero, Lluis; Muñiz, Selene; Navarro-Navarro, Enrique; Auguet, Jean-Christophe

    2018-04-24

    Using the 16S rRNA and mcrA genes, we investigated the composition, abundance and activity of sediment archaeal communities within 18 high-mountain lakes under contrasted metal levels from different origins (bedrock erosion, past-mining activities and atmospheric depositions). Bathyarchaeota, Euryarchaeota and Woesearchaeota were the major phyla found at the meta-community scale, representing 48%, 18.3% and 15.2% of the archaeal community respectively. Metals were equally important as physicochemical variables in explaining the assemblage of archaeal communities and their abundance. Methanogenesis appeared as a process of central importance in the carbon cycle within sediments of alpine lakes as indicated by the absolute abundance of methanogen 16S rRNA and mcrA gene transcripts (10 5 to 10 9 copies g -1 ). We showed that methanogen abundance and activity were significantly reduced with increasing concentrations of Pb and Cd, two indicators of airborne metal contaminations. Considering the ecological importance of methanogenesis in sediment habitats, these metal contaminations may have system wide implications even in remote area such as alpine lakes. Overall, this work was pioneer in integrating the effect of long-range atmospheric depositions on archaeal communities and indicated that metal contamination might significantly compromise the contribution of Archaea to the carbon cycling of the mountain lake sediments. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. High prevalence of small Babesia species in canines of Kerala, South India.

    PubMed

    Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil

    2017-11-01

    Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni , in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni . Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni . Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni , Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

  7. High prevalence of small Babesia species in canines of Kerala, South India

    PubMed Central

    Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil

    2017-01-01

    Aim: Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni, in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. Materials and Methods:: A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni. Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. Results:: A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni, Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. Conclusion:: A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates. PMID:29263592

  8. Rhizarian 'Novel Clade 10' Revealed as Abundant and Diverse Planktonic and Terrestrial Flagellates, including Aquavolon n. gen.

    PubMed

    Bass, David; Tikhonenkov, Denis Victorovich; Foster, Rachel; Dyal, Patricia; Janouškovec, Jan; Keeling, Patrick J; Gardner, Michelle; Neuhauser, Sigrid; Hartikainen, Hanna; Mylnikov, Alexandre P; Berney, Cédric

    2018-04-15

    Rhizarian 'Novel Clade 10' (NC10) is frequently detected by 18S rRNA gene sequencing studies in freshwater planktonic samples. We describe a new genus and two species of eukaryovorous biflagellate protists, Aquavolon hoantrani n. gen. n. sp. and A. dientrani n. gen. n. sp., which represent the first morphologically characterized members of NC10, here named Aquavolonida ord. nov. The slightly metabolic cells possess naked heterodynamic flagella, whose kinetosomes lie at a right angle to each other and are connected by at least one fibril. Unlike their closest known relative Tremula longifila, they rotate around their longitudinal axis when swimming and only very rarely glide on surfaces. Screening of a wide range of environmental DNA extractions with lineage-specific PCR primers reveals that Aquavolonida consists of a large radiation of protists, which are most diversified in freshwater planktonic habitats and as yet undetected in marine environments. Earlier-branching lineages in Aquavolonida include less frequently detected organisms from soils and freshwater sediments. The 18S rRNA gene phylogeny suggests that Aquavolonida forms a common evolutionary lineage with tremulids and uncharacterized 'Novel Clade 12', which likely represents one of the deepest lineages in the Rhizaria, separate from Cercozoa (Filosa), Endomyxa, and Retaria. © 2018 The Authors Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  9. Detection and molecular characterization of Cryptosporidium spp. in captive canaries (Serinus canaria) using different diagnostic methods.

    PubMed

    Camargo, Vinícius da Silva; Santana, Bruna Nicoleti; Ferrari, Elis Domingos; Nakamura, Alex Akira; Nagata, Walter Bertequini; Nardi, Ana Rita Moraes; Meireles, Marcelo Vasconcelos

    2018-01-01

    This study used several diagnostic methods to examine the occurrence of and molecularly characterize Cryptosporidium spp. in captive canaries (Serinus canaria) in southern and southeastern Brazil. A total of 498 fecal samples were purified by centrifugal-flotation using Sheather's solution. Cryptosporidium spp. diagnosis was performed using three diagnostic methods: malachite green negative staining, nested PCR targeting the 18S rRNA gene, followed by sequencing the amplified fragments, and duplex real-time PCR targeting the 18S rRNA specific to detect Cryptosporidium galli and Cryptosporidium avian genotype III. The overall positivity for Cryptosporidium spp. (total samples positive in at least one protocol) from the microscopic analysis, nested PCR and duplex real-time PCR protocol results was 13.3% (66/498). The positivity rates were 2.0% (10/498) and 4.6% (23/498) for Cryptosporidium spp. by microscopy and nested PCR, respectively. Sequencing of 20 samples amplified by nested PCR identified C. galli (3.0%; 15/498), Cryptosporidium avian genotype I (0.8%; 4/498) and Cryptosporidium avium (0.2%; 1/498). Duplex real-time PCR revealed a positivity of 7.8% (39/498) for C. galli and 2.4% (12/498) for avian genotype III. Malachite green negative staining differed significantly from nested PCR in detecting Cryptosporidium spp. Duplex real-time PCR was more sensitive than nested PCR/sequencing for detecting gastric Cryptosporidium in canaries.

  10. Characterization of a new clinical yeast species, Candida tunisiensis sp. nov., isolated from a strain collection from Tunisian hospitals.

    PubMed

    Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed; Sanglard, Dominique

    2013-01-01

    From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches.

  11. Characterization of a New Clinical Yeast Species, Candida tunisiensis sp. nov., Isolated from a Strain Collection from Tunisian Hospitals

    PubMed Central

    Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed

    2013-01-01

    From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches. PMID:23077122

  12. Sphingobium hydrophobicum sp. nov., a hydrophobic bacterium isolated from electronic-waste-contaminated sediment.

    PubMed

    Chen, Xingjuan; Wang, Haiji; Xu, Jingjing; Song, Da; Sun, Guoping; Xu, Meiying

    2016-10-01

    Four hydrophobic bacteria were isolated from sediment at Guiyu, an electronic-waste recycling site in southeastern China. The isolates had high cell surface hydrophobicity with microbial-adhesion-to-hydrocarbon score of 71.4 %. 16S rRNA gene sequences of the strains all showed highest similarity to the hydrophilic Sphingobium xenophagum DSM 6383T (99.9 % 16S rRNA gene sequence similarity), followed by Sphingobiumczechense DSM 25410T (97.1 %). However, DNA-DNA hybridization revealed that the isolates and S. xenophagum DSM 6383T exhibited low DNA-DNA relatedness with a hybridization value of 54.5±0.5 %. The genomic DNA G+C content was 64.2 mol% and the predominant quinone was ubiquinone Q-10. Spermidine was the major polyamine component. The major fatty acids were C18 : 1ω7c, C16 : 1ω7c, C16 : 0, C14 : 0 2-OH and C14 : 0. In contrast to its closest relative S. xenophagum DSM 6383T, the isolates had a much higher proportion of C16 : 0 and C14 : 0 and a much lower proportion of C18 : 1ω9t. Sphingoglycolipid was present and diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, and phosphatidylmonomethylethanolamine were detected in the polar lipid pattern. Phosphatidyldimethylethanolamine and phosphatidylcholine, which are present in S. xenophagum DSM 6383T, were not detected in the isolates. Results of DNA-DNA relatedness, cell surface hydrophobicity, fatty acids, polar lipids, and biochemical and physiological properties reveal that the isolates represent a novel species of the genus Sphingobium, for which the name Sphingobium hydrophobicum sp. nov. is proposed. The type strain is C1T (=CCTCC AB 2015198T=KCTC 42740T).

  13. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    USDA-ARS?s Scientific Manuscript database

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  14. Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

    PubMed

    Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

    2010-06-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

  15. The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

    PubMed Central

    De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

    1992-01-01

    The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

  16. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    PubMed

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy number and chromosomal organisation may occur within relatively short evolutionary time. We hypothesize that the 5S gene integration within the 35S unit might have repeatedly occurred during plant evolution, and probably once in Asteraceae.

  17. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy number and chromosomal organisation may occur within relatively short evolutionary time. We hypothesize that the 5S gene integration within the 35S unit might have repeatedly occurred during plant evolution, and probably once in Asteraceae. PMID:20712858

  18. Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

    PubMed Central

    Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

    1982-01-01

    1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

  19. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  20. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  1. Detection and molecular identification of Cryptosporidium species in laboratory rats (Rattus norvegicus) in Ibadan, Nigeria

    PubMed

    Ayinmode, Adekunle Bamidele; Ogbonna, Nkeiruka Fortunate; Widmer, Giovanni

    To study the occurrence of Cryptosporidium infection in laboratory rats (Rattus norvegicus) raised for experimental usage, 134 faecal samples were obtained from two rearing houses in Ibadan and examined for the presence of Cryptosporidium oocyst using the modified acid fast staining technique. Cryptosporidium species in 2 samples positive for microscopy were further characterized by a nested polymerase chain reaction (PCR) amplifying the 18S rRNA gene. Two of 134 samples were positive for the Cryptosporidium oocysts. Sequencing of the small-subunit rRNA amplicons identified the species in the two PCR positive samples as Cryptosporidium andersoni and Cryptosporidium rat genotype. These findings showed that laboratory rat is a potential reservoir for diverse Cryptosporidium species and suggests that laboratory rats should be screened for Cryptosporidium infection prior to experiments, especially where pathogen free animals are not available. This the first report to identify Cryptosporidium species infecting laboratory rats in Nigeria.

  2. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  3. Lactobacillus gorillae sp. nov., isolated from the faeces of captive and wild western lowland gorillas (Gorilla gorilla gorilla).

    PubMed

    Tsuchida, Sayaka; Kitahara, Maki; Nguema, Pierre Philippe Mbehang; Norimitsu, Saeko; Fujita, Shiho; Yamagiwa, Juichi; Ngomanda, Alfred; Ohkuma, Moriya; Ushida, Kazunari

    2014-12-01

    Four strains of Gram-staining-positive, anaerobic rods were isolated from the faeces of western lowland gorillas (Gorilla gorilla gorilla). Three strains, KZ01(T), KZ02 and KZ03, were isolated at the Kyoto City Zoo, Japan, and one strain, GG02, was isolated in the Moukalaba-Doudou National Park, Gabon. These strains were investigated taxonomically. These strains belonged to the Lactobacillus reuteri phylogenetic group according to phylogenetic analysis based on 16S rRNA gene sequences and specific phenotypic characteristics. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strains KZ01(T), KZ02, KZ03 and GG02 formed a single monophyletic cluster and had a distinct line of descent. Based on sequence similarity of the 16S rRNA gene, Lactobacillus fermentum JCM 1173(T) (96.6 %) was the closest neighbour to these novel strains, although it was clear that these strains belonged to a different species. Partial pheS sequences also supported these relationships. DNA-DNA relatedness between strain KZ01(T) and L. fermentum JCM 1173(T) was less than 22 % and the DNA G+C content of strain KZ01(T) was 50.7 mol%. The cell-wall peptidoglycan type was A4β (l-Orn-d-Asp) and the major fatty acids were C16 : 0, C18 : 1ω9c and C19 : 1 cyclo 9,10. Therefore, based on phylogenetic, phenotypic and physiological evidence, these strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus gorillae sp. nov. is proposed. The type strain is KZ01(T) ( = JCM 19575(T) = DSM 28356(T)). © 2014 IUMS.

  4. Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

    PubMed

    Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

    2017-06-01

    We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues. Interestingly, many bacterial species associated with postpartum uterine disease (i.e., Trueperella spp., Acinetobacter spp., Fusobacteria spp., Proteus spp., Prevotella spp., and Peptostreptococcus spp.) were also present in the uterus of virgin heifers and of pregnant cows. The presence of 16S rRNA gene sequence reads in the samples from the current study suggests that the uterine microbiome is established by the time a female reaches reproductive maturity, and that pregnancies are established and maintained in the presence of a uterine microbiome. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  6. Methylobacterium hispanicum sp. nov. and Methylobacterium aquaticum sp. nov., isolated from drinking water.

    PubMed

    Gallego, Virginia; García, María Teresa; Ventosa, Antonio

    2005-01-01

    Members of the genus Methylobacterium are ubiquitous in nature and can be isolated from almost any freshwater environment where dissolved oxygen exists. This genus is composed of a variety of pink-pigmented, facultatively methylotrophic (PPFM) bacteria. During a screening programme to monitor the bacterial population present in the drinking water of a municipal water supply in Seville (Spain) during the year 2003, five strains of PPFM bacteria were isolated and characterized. Analysis of their complete 16S rRNA gene sequences revealed that they constituted two separate phylogenetic groups (strains GP34T and GR18, and strains GR16T, GP22 and GP32, respectively) showing highest similarity to members of the genus Methylobacterium. The highest 16S rRNA sequence similarities of strain GP34T were found with respect to the type strains of Methylobacterium radiotolerans (96.6 %) and Methylobacterium fujisawaense (96.4 %) and the highest 16S rRNA sequence similarities of strain GR16T were to the type strains of Methylobacterium extorquens (96.0 %) and Methylobacterium rhodesianum (95.8 %). The G+C content of their DNA ranged from 66.5 to 67.8 mol%. DNA-DNA hybridization studies confirmed that they constituted two separate genospecies. On the basis of this phenotypic, phylogenetic and genotypic study, two novel species of the genus Methylobacterium are proposed: Methylobacterium hispanicum sp. nov., with type strain GP34T (CECT 5997T=CCM 7219T=DSM 16372T=CIP 108332T), and Methylobacterium aquaticum sp. nov., with type strain GR16T (CECT 5998T=CCM 7218T=DSM 16371T=CIP 108333T).

  7. Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

    PubMed

    Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

    2012-06-01

    This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (<18% of sequences shared) than sites (>25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  8. Detection of rabbit and hare processed material in compound feeds by TaqMan real-time PCR.

    PubMed

    Pegels, N; López-Calleja, I; García, T; Martín, R; González, I

    2013-01-01

    Food and feed traceability has become a priority for governments due to consumer demand for comprehensive and integrated safety policies. In the present work, a TaqMan real-time PCR assay targeting the mitochondrial 12S rRNA gene was developed for specific detection of rabbit and hare material in animal feeds and pet foods. The technique is based on the use of three species-specific primer/probe detection systems targeting three 12S rRNA gene fragments: one from rabbit species, another one from hare species and a third fragment common to rabbit and hare (62, 102 and 75 bp length, respectively). A nuclear 18S rRNA PCR system, detecting a 77-bp amplicon, was used as positive amplification control. Assay performance and sensitivity were assessed through the analysis of a batch of laboratory-scale feeds treated at 133°C at 3 bar for 20 min to reproduce feed processing conditions dictated by European regulations. Successful detection of highly degraded rabbit and hare material was achieved at the lowest target concentration assayed (0.1%). Furthermore, the method was applied to 96 processed commercial pet food products to determine whether correct labelling had been used at the market level. The reported real-time PCR technique detected the presence of rabbit tissues in 80 of the 96 samples analysed (83.3%), indicating a possible labelling fraud in some pet foods. The real-time PCR method reported may be a useful tool for traceability purposes within the framework of feed control.

  9. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  10. Isolation and identification of multidrug-resistant Staphylococcus haemolyticus from a laboratory-breeding mouse.

    PubMed

    Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu

    2011-06-01

    To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  11. Morphological and molecular identification of Sarcocystis arctica sarcocysts in three red foxes (Vulpes vulpes) from the Czech Republic.

    PubMed

    Pavlásek, Ivan; Máca, Ondřej

    2017-10-01

    Muscular sarcocystosis by Sarcocystis arctica was found for the first time in the Czech Republic, in different muscles of red fox (Vulpes vulpes). Cysts were slim, elongated, thread-like, whitish, 1-7mm long, and 206-270μm wide; bradyzoites were 7.9×2.7μm in unstained wet mounts and 9.2×2.9μm in cyst Giemsa-stained smears. The cyst wall was thin, with short villi-like protrusions, and no host response was observed in the histological sections. Examination of the distribution and intensity of sarcocysts in 17 different muscle groups revealed that the highest intensity was in the cranial tibial muscle (>15 cysts in compressoria), followed by the diaphragm, forearm, and other groups (with intensities of 3-15 cysts in compressoria). Sarcocysts were detected in 3 out of 86 foxes. Genetic characterization at 18S rRNA, 28S rRNA, ITS1 and cox1, consistently showed that the species was identical with S. arctica. Interestingly, this protozoan was also detected as a co-infection in 3 foxes with the nematode Trichinella spp. for the first time. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Neisseria oralis sp. nov., isolated from healthy gingival plaque and clinical samples

    PubMed Central

    Passaretti, Teresa V.; Jose, Reashma; Cole, Jocelyn; Coorevits, An; Carpenter, Andrea N.; Jose, Sherly; Van Landschoot, Anita; Izard, Jacques; Kohlerschmidt, Donna J.; Vandamme, Peter; Dewhirst, Floyd E.; Fisher, Mark A.; Musser, Kimberlee A.

    2013-01-01

    A polyphasic analysis was undertaken of seven independent isolates of Gram-negative cocci collected from pathological clinical samples from New York, Louisiana, Florida and Illinois and healthy subgingival plaque from a patient in Virginia, USA. The 16S rRNA gene sequence similarity among these isolates was 99.7–100 %, and the closest species with a validly published name was Neisseria lactamica (96.9 % similarity to the type strain). DNA–DNA hybridization confirmed that these isolates are of the same species and are distinct from their nearest phylogenetic neighbour, N. lactamica. Phylogenetic analysis of 16S and 23S rRNA gene sequences indicated that the novel species belongs in the genus Neisseria. The predominant cellular fatty acids were C16 : 0, summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH) and C18 : 1ω7c. The cellular fatty acid profile, together with other phenotypic characters, further supports the inclusion of the novel species in the genus Neisseria. The name Neisseria oralis sp. nov. (type strain 6332T  = DSM 25276T  = LMG 26725T) is proposed. PMID:22798652

  13. Methylobacterium gossipiicola sp. nov., a pink-pigmented, facultatively methylotrophic bacterium isolated from the cotton phyllosphere.

    PubMed

    Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Senthilkumar, Murugaiyan; Lee, Jung-Sook; Lee, Keun-Chul

    2012-01-01

    A pink, aerobic, facultatively methylotrophic, motile, Gram-negative rod, designated Gh-105(T), was isolated from the phyllosphere of cotton from Coimbatore (Tamilnadu, India). 16S rRNA gene sequence analysis showed clearly that the isolate belonged to the Methylobacterium cluster. Strain Gh-105(T) was most closely related to Methylobacterium adhaesivum AR27(T) (99% 16S rRNA gene sequence similarity) and Methylobacterium iners 5317S-33(T) (97.5%). The isolate grew with C(1) compounds such as methanol and dichloromethane, but not with formaldehyde, formate, methylamine, trimethylamine or methane, as sole carbon sources and carried mxaF, which encodes methanol dehydrogenase and supports methylotrophic metabolism. The major fatty acid was C(18:1)ω7c and the G+C content of the genomic DNA was 64.2 mol%. Physiological and biochemical data and DNA-DNA relatedness with M. adhaesivum KACC 12195(T) and M. iners KACC 11765(T) revealed clear phenotypic and genotypic differences. For this reason, we propose that strain Gh-105(T) (=CCM 7572(T) =NRRL B-51692(T)) represents the type strain of a novel species, with the name Methylobacterium gossipiicola sp. nov.

  14. Singulisphaera rosea sp. nov., a planctomycete from acidic Sphagnum peat, and emended description of the genus Singulisphaera.

    PubMed

    Kulichevskaya, Irina S; Detkova, Ekaterina N; Bodelier, Paul L E; Rijpstra, W Irene C; Damsté, Jaap S Sinninghe; Dedysh, Svetlana N

    2012-01-01

    An aerobic, pink-pigmented, budding bacterium, designated strain S26(T), was isolated from an acidic Sphagnum peat bog of north-western Russia. Cells were non-motile and spherical, occurring singly, in pairs or in short chains, and were able to attach to surfaces by means of a holdfast material. Strain S26(T) was a moderately acidophilic, mesophilic organism capable of growth at pH 3.2-7.1 (optimum at pH 4.8-5.0) and at 4-33 °C (optimum at 20-26 °C). Most sugars, several organic acids and polyalcohols were the preferred growth substrates. The major fatty acids were C(16:0), C(18:1)ω9c and C(18:2)ω6c,12c. The major neutral lipids were n-C(31:9) hydrocarbon and squalene; the polar lipids were phosphatidylglycerol, phosphatidylcholine and components with an unknown structure. The DNA G+C content of strain S26(T) was 62.2 mol%. 16S rRNA gene sequence analysis showed that strain S26(T) is a member of the order Planctomycetales. Among taxonomically characterized representatives of this order, highest levels of 16S rRNA gene sequence similarity (95.1-95.2%) were observed with strains of the non-filamentous, peat-inhabiting planctomycete Singulisphaera acidiphila. Strain S26(T) could be differentiated from Singulisphaera acidiphila based on pigmentation, significant differences in substrate utilization patterns, greater tolerance of acidic conditions and the presence of C(16:1)ω9c. Based on the data presented, strain S26(T) is considered to represent a novel species of the genus Singulisphaera, for which the name Singulisphaera rosea sp. nov. is proposed; the type strain is S26(T) (=DSM 23044(T)=VKM B-2599(T)).

  15. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  16. A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

    NASA Technical Reports Server (NTRS)

    Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.

    1993-01-01

    A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

  17. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    PubMed Central

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  18. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

    PubMed

    Wickersheim, Michelle L; Blumenstiel, Justin P

    2013-11-01

    A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

  19. The Evolutionarily Conserved Protein LAS1 Is Required for Pre-rRNA Processing at Both Ends of ITS2

    PubMed Central

    Schillewaert, Stéphanie; Wacheul, Ludivine; Lhomme, Frédéric

    2012-01-01

    Ribosome synthesis entails the formation of mature rRNAs from long precursor molecules, following a complex pre-rRNA processing pathway. Why the generation of mature rRNA ends is so complicated is unclear. Nor is it understood how pre-rRNA processing is coordinated at distant sites on pre-rRNA molecules. Here we characterized, in budding yeast and human cells, the evolutionarily conserved protein Las1. We found that, in both species, Las1 is required to process ITS2, which separates the 5.8S and 25S/28S rRNAs. In yeast, Las1 is required for pre-rRNA processing at both ends of ITS2. It is required for Rrp6-dependent formation of the 5.8S rRNA 3′ end and for Rat1-dependent formation of the 25S rRNA 5′ end. We further show that the Rat1-Rai1 5′-3′ exoribonuclease (exoRNase) complex functionally connects processing at both ends of the 5.8S rRNA. We suggest that pre-rRNA processing is coordinated at both ends of 5.8S rRNA and both ends of ITS2, which are brought together by pre-rRNA folding, by an RNA processing complex. Consistently, we note the conspicuous presence of ∼7- or 8-nucleotide extensions on both ends of 5.8S rRNA precursors and at the 5′ end of pre-25S RNAs suggestive of a protected spacer fragment of similar length. PMID:22083961

  20. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    PubMed Central

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  1. A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

    PubMed

    Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

    2015-02-01

    The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

  2. Staged Reimplantation of a Total Hip Prosthesis After Co-infection with Candida tropicalis and Staphylococcus haemolyticus: A Case Report.

    PubMed

    Sebastian, Sujeesh; Malhotra, Rajesh; Pande, Ashish; Gautam, Deepak; Xess, Immaculata; Dhawan, Benu

    2018-06-01

    Fungal prosthetic joint infection is a rare complication in total joint arthroplasty. There are no established guidelines for management of these infections. We present a case of a 53-year-old male with a hip joint prosthesis co-infected with Candida tropicalis and Staphylococcus haemolyticus. A two-stage exchange arthroplasty was performed. The patient underwent implant removal, debridement, irrigation with saline solution and application of cement spacer impregnated with vancomycin followed by aggressive antimicrobial treatment in first stage. Complete eradication of infection was demonstrated by negative culture of sonicated cement spacer fluid and negative 16S rRNA and 18S rRNA gene PCR of sonicate fluid, synovial fluid and periprosthetic tissue samples. He underwent second-stage revision hip arthroplasty after 9 months of the first stage. At the latest follow-up, there was no evidence of recurrence of infection. This case illustrates the utility of sonication of biomaterials and molecular techniques for microbiological confirmation of absence of infection in staged surgeries which is required for a successful outcome.

  3. Isolation of a new heterolobosean amoeba from a rice field soil: Vrihiamoeba italica gen. nov., sp. nov.

    PubMed

    Murase, Jun; Kawasaki, Michio; De Jonckheere, Johan F

    2010-08-01

    A heterolobosean amoeba strain 6_5F was isolated from an Italian rice field soil. Although 18S rRNA gene sequence analysis demonstrated that the new isolate was closely related to Stachyamoeba sp. ATCC 50324, further molecular analysis and morphological observation showed distinct differences amongst the two. The 5.8S rRNA gene was successfully amplified and sequenced for strain 6_5F but not for strain ATCC 50324. Trophozoites of strain ATCC 50324 transform into flagellate forms in the late stage of incubation before encystment, while strain 6_5F do not show flagellate forms under different conditions of the flagellation test. Light and electron microscopic observation showed the structural difference of cysts of strain 6_5F from strain ATCC 50324 and also from the type strain Stachyamoeba lipophora. The results show that the strain 6_5F is distinct from Stachyamoeba spp. and we propose a new genus and species for this isolate, Vrihiamoeba italica gen. nov., sp. nov. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

  4. Antarctic ice core samples: culturable bacterial diversity.

    PubMed

    Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R

    2013-01-01

    Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  5. Seasonal variation of plankton communities influenced by environmental factors in an artificial lake

    NASA Astrophysics Data System (ADS)

    Li, Xuemei; Yu, Yuhe; Zhang, Tanglin; Feng, Weisong; Ao, Hongyi; Yan, Qingyun

    2012-05-01

    We evaluated the seasonal variation in plankton community composition in an artificial lake. We conducted microscopic analysis and denaturing gradient gel electrophoresis (DGGE) of PCR-amplified partial 16S rRNA and 18S rRNA genes to characterize the plankton community. The clustering of unweighted pair group method with arithmetic mean (UPGMA) was then used to investigate the similarity of these plankton communities. DGGE fingerprinting revealed that samples collected at the different sites within a season shared high similarity and were generally grouped together. In contrast, we did not observe any seasonal variation based on microscopic analysis. Redundancy analysis (RDA) of the plankton operational taxonomic units (OTUs) in relation to environmental factors revealed that transparency was negatively correlated with the first axis ( R=-0.931), and temperature and total phosphorus (TP) were positively correlated with the first axis ( R=0.736 and R=0.660, respectively). In conclusion, plankton communities in the artificial lake exhibited significant seasonal variation. Transparency, phosphorus and temperature appear to be the major factors driving the differences in plankton composition.

  6. House microbiotas as sources of lactic acid bacteria and yeasts in traditional Italian sourdoughs.

    PubMed

    Minervini, Fabio; Lattanzi, Anna; De Angelis, Maria; Celano, Giuseppe; Gobbetti, Marco

    2015-12-01

    This study aimed at understanding the extent of contamination by lactic acid bacteria (LAB) and yeasts from the house microbiotas during sourdough back-slopping. Besides sourdoughs, wall, air, storage box, dough mixer and flour of four bakeries were analyzed. Based on plate counts, LAB and yeasts dominated the house microbiota. Based on high throughput sequencing of the 16S rRNA genes, flour harbored the highest number of Firmicutes, but only few of them adapted to storage box, dough mixer and sourdough. Lactobacillus sanfranciscensis showed the highest abundance in dough mixer and sourdoughs. Lactobacillus plantarum persisted only in storage box, dough mixer and sourdough of two bakeries. Weissella cibaria also showed higher adaptability in sourdough than in bakery equipment, suggesting that flour is the main origin of this species. Based on 18S rRNA data, Saccharomyces cerevisiae was the dominant yeast in house and sourdough microbiotas, excepted one bakery dominated by Kazachstania exigua. The results of this study suggest that the dominant species of sourdough LAB and yeasts dominated also the house microbiota. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

    PubMed

    Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

    2010-10-01

    The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

  8. Diversity and potential activity patterns of planktonic eukaryotic microbes in a mesoeutrophic coastal area (eastern English Channel)

    PubMed Central

    Rachik, Sara; Christaki, Urania; Li, Luen Luen; Genitsaris, Savvas; Breton, Elsa

    2018-01-01

    The diversity of planktonic eukaryotic microbes was studied at a coastal station of the eastern English Channel (EEC) from March 2011 to July 2015 (77 samples) using high throughput sequencing (454-pyrosequencing and Illumina) of the V2-V3 hypervariable region of the 18S SSU rDNA gene. Similar estimations of OTU relative abundance and taxonomic distribution for the dominant higher taxonomic groups (contributing >1% of the total number of OTUs) were observed with the two methods (Kolmogorov-Smirnov p-value = 0.22). Eight super-groups were identified throughout all samples: Alveolata, Stramenopiles, Opisthokonta, Hacrobia, Archeaplastida, Apusozoa, Rhizaria, and Amoebozoa (ordered by decreasing OTU richness). To gain further insight into microbial activity in the EEC, ribosomal RNA was extracted for samples from 2013–2015 (30 samples). Analysis of 18S rDNA and rRNA sequences led to the detection of 696 and 700 OTUs, respectively. Cluster analysis based on OTUs’ abundance indicated three major seasonal groups that were associated to spring, winter/autumn, and summer conditions. The clusters inferred from rRNA data showed a clearer seasonal representation of the community succession than the one based on rDNA. The rRNA/rDNA ratio was used as a proxy for relative cell activity. When all OTUs were considered, the average rRNA:rDNA ratio showed a linear trend around the 1:1 line, suggesting a linear relation between OTU abundance (rDNA) and activity (rRNA). However, this ratio was highly variable over time when considering individual OTUs. Interestingly, the OTU affiliated with P. globosa displayed rRNA:rDNA ratio that allowed to delimit high vs low abundance and high vs low activity periods. It unveiled quite well the Phaeocystis bloom dynamic regarding cell proliferation and activity, and could even be used as early indicator of an upcoming bloom. PMID:29746519

  9. Diversity and potential activity patterns of planktonic eukaryotic microbes in a mesoeutrophic coastal area (eastern English Channel).

    PubMed

    Rachik, Sara; Christaki, Urania; Li, Luen Luen; Genitsaris, Savvas; Breton, Elsa; Monchy, Sébastien

    2018-01-01

    The diversity of planktonic eukaryotic microbes was studied at a coastal station of the eastern English Channel (EEC) from March 2011 to July 2015 (77 samples) using high throughput sequencing (454-pyrosequencing and Illumina) of the V2-V3 hypervariable region of the 18S SSU rDNA gene. Similar estimations of OTU relative abundance and taxonomic distribution for the dominant higher taxonomic groups (contributing >1% of the total number of OTUs) were observed with the two methods (Kolmogorov-Smirnov p-value = 0.22). Eight super-groups were identified throughout all samples: Alveolata, Stramenopiles, Opisthokonta, Hacrobia, Archeaplastida, Apusozoa, Rhizaria, and Amoebozoa (ordered by decreasing OTU richness). To gain further insight into microbial activity in the EEC, ribosomal RNA was extracted for samples from 2013-2015 (30 samples). Analysis of 18S rDNA and rRNA sequences led to the detection of 696 and 700 OTUs, respectively. Cluster analysis based on OTUs' abundance indicated three major seasonal groups that were associated to spring, winter/autumn, and summer conditions. The clusters inferred from rRNA data showed a clearer seasonal representation of the community succession than the one based on rDNA. The rRNA/rDNA ratio was used as a proxy for relative cell activity. When all OTUs were considered, the average rRNA:rDNA ratio showed a linear trend around the 1:1 line, suggesting a linear relation between OTU abundance (rDNA) and activity (rRNA). However, this ratio was highly variable over time when considering individual OTUs. Interestingly, the OTU affiliated with P. globosa displayed rRNA:rDNA ratio that allowed to delimit high vs low abundance and high vs low activity periods. It unveiled quite well the Phaeocystis bloom dynamic regarding cell proliferation and activity, and could even be used as early indicator of an upcoming bloom.

  10. Integrated Nuclear Communications Assessment (INCA). Circuit Restoral Assessment Module

    DTIC Science & Technology

    1979-09-07

    from Report) t 18 . SUPPLEMENTARY NOTES This work sponsored by the Defense Nuclear Agency under RDT&E RMSS Code B363078464 O909QAXCAlO6O6 H2590D. 79. KEY...Connectivity ... 16 AS oun1. .i S - Update Theater Connectivity Matrix ...................................... 18 2.5 Subroutine 1.2 - Set CCSD Status...71 2- 18 Subroutine 5.1.3 - Compute Effectiveness ........ 77 2-19 Subroutine 5.2 - Assign Restoral Times ........ 80 2-20

  11. [Design of primers to DNA of lactic acid bacteria].

    PubMed

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  12. Screening for Hepatozoon parasites in gerbils and potential predators in South Africa.

    PubMed

    Harris, D James; Pereira, Ana; Halajian, Ali; Luus-Powell, Wilmien J; Kunutu, Katlego D

    2017-02-08

    Samples of gerbils and their potential predators were screened for the presence of Hepatozoon parasites (Apicomplexa: Adeleorina) using both microscopic examination and sequencing of partial 18S rRNA sequences. Positive samples were compared to published sequences in a phylogenetic framework. The results indicate that genets can be infected with Hepatozoon felis. A Cape fox was infected with Hepatozoon canis, whereas the sequence from an infected rodent fell within a group of parasites primarily recovered from other rodents and snakes.

  13. First report of Hepatozoon (Apicomplexa: Adeleorina) in caecilians, with description of a new species.

    PubMed

    Harris, D James; Damas-Moreira, Isabel; Maia, João P M C; Perera, Ana

    2014-02-01

    Hepatozoon spp. are identified for the first time in the amphibian order Gymnophiona, or caecilians, from the Seychelles island of Silhouette. Estimate of relationships derived from partial 18S rRNA gene sequences indicate these are not related to Hepatozoon spp. from frogs or to other Hepatozoon spp. from reptiles in the Seychelles. Assessment of mature gamonts from blood smears indicate that these can be recognized as a new species, Hepatozoon seychellensis n. sp.

  14. Molecular characterization of Hepatozoon species in reptiles from the Seychelles.

    PubMed

    Harris, D James; Maia, João P M C; Perera, Ana

    2011-02-01

    Hepatozoon parasites were examined for the first time in reptiles from the Seychelles Islands. Although both prevalence and intensity were low, Hepatozoon species were detected in individuals from 2 endemic species, the lizard Mabuya wrightii and the snake Lycognathophis seychellensis. This was confirmed using visual identification and through sequencing part of the 18s rRNA gene. Phylogenetic analysis indicates that the Hepatozoon on the Seychelles form a monophyletic lineage, although more data are clearly needed to stabilize estimates of relationships based on this marker.

  15. Development and application of two independent real-time PCR assays to detect clinically relevant Mucorales species.

    PubMed

    Springer, Jan; Goldenberger, Daniel; Schmidt, Friderike; Weisser, Maja; Wehrle-Wieland, Elisabeth; Einsele, Hermann; Frei, Reno; Löffler, Jürgen

    2016-03-01

    PCR-based detection of Mucorales species could improve diagnosis of suspected invasive fungal infection, leading to a better patient outcome. This study describes two independent probe-based real-time PCR tests for detection of clinically relevant Mucorales, targeting specific fragments of the 18S and the 28S rRNA genes. Both assays have a short turnaround time, allow fast, specific and very sensitive detection of clinically relevant Mucorales and have the potential to be used as quantitative tests. They were validated on various clinical samples (fresh and formalin-fixed paraffin-embedded specimens, mainly biopsies, n = 17). The assays should be used as add-on tools to complement standard techniques; a combined approach of both real-time PCR assays has 100 % sensitivity. Genus identification by subsequent sequencing is possible for amplicons of the 18S PCR assay. In conclusion, combination of the two independent Mucorales assays described in this study, 18S and 28S, detected all clinical samples associated with proven Mucorales infection (n = 10). Reliable and specific identification of Mucorales is a prerequisite for successful antifungal therapy as these fungi show intrinsic resistance to voriconazole and caspofungin.

  16. Sphingomonas japonica sp. nov., isolated from the marine crustacean Paralithodes camtschatica.

    PubMed

    Romanenko, Lyudmila A; Tanaka, Naoto; Frolova, Galina M; Mikhailov, Valery V

    2009-05-01

    A Sphingomonas-like bacterium, strain KC7(T), was isolated from a marine crustacean specimen obtained from the Sea of Japan and subjected to a polyphasic study. Comparative 16S rRNA gene sequence analysis positioned the novel strain in the genus Sphingomonas as an independent lineage adjacent to a subclade containing Sphingomonas trueperi LMG 2142(T), Sphingomonas pituitosa EDIV(T) and Sphingomonas azotifigens NBRC 15497(T). Strain KC7(T) shared highest 16S rRNA gene sequence similarity (96.1 %) with S. trueperi LMG 2142(T), Sphingomonas dokdonensis DS-4(T) and S. azotifigens NBRC 15497(T); similarities to strains of other recognized Sphingomonas species were lower (96.0-93.9 %). The strain contained sphingoglycolipid and the predominant fatty acids were C(16 : 1), C(16 : 0) and C(18 : 1); 2-OH C(14 : 0) was the major 2-hydroxy fatty acid. Previously, these lipids have been found to be characteristic of members of the genus Sphingomonas sensu stricto. On the basis of phylogenetic analysis and physiological and biochemical characterization, strain KC7(T) represents a novel species of the genus Sphingomonas, for which the name Sphingomonas japonica sp. nov. is proposed. The type strain is KC7(T) (=KMM 3038(T) =NRIC 0738(T) =JCM 15438(T)).

  17. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    PubMed

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    PubMed Central

    Dinoop, K.P.; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R.P.; Narayanan, P.

    2016-01-01

    Background & objectives: Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Methods: Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. Results: In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated (P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods. PMID:26997014

  19. Lactobacillus silagincola sp. nov. and Lactobacillus pentosiphilus sp. nov., isolated from silage.

    PubMed

    Tohno, Masanori; Tanizawa, Yasuhiro; Irisawa, Tomohiro; Masuda, Takaharu; Sakamoto, Mitsuo; Arita, Masanori; Ohkuma, Moriya; Kobayashi, Hisami

    2017-09-01

    Three Gram-stain positive, non-motile, non-spore-forming, catalase-negative and rod-shaped bacterial strains (IWT5T, IWT25T and IWT140), isolated from silage, were investigated by using a polyphasic taxonomic approach. Strains IWT5T and IWT25T grew at 10-37 °C and 30-37 °C, and at pH 4.0-7.5 and 4.0-7.0, respectively. The G+C contents of genomic DNA of strains IWT5T and IWT25T were 43.2 and 44.4 mol%, respectively. Strains IWT5T and IWT25T contained C16 : 0, C18 : 1 ω9c and summed feature 7 (unknown 18.846/C19 : 1 ω6c/C19 : 0cyclo ω10c) as the major fatty acids. Strain IWT5T was most closely related to the type strains of Lactobacillus mixtipabuli (99.9 % 16S rRNA gene sequence similarity) and Lactobacillus silagei (99.5 %). For IWT25T, the 16S rRNA gene sequence similarities with the closely related neighbour type strains L. mixtipabuli and L. silagei were 99.5 and 99.5 %, respectively. The 16S rRNA gene sequence similarities among the three novel isolates were 99.5-99.9 %. The average nucleotide identities of strains IWT5T and IWT25T to other neighbours of the genus Lactobacillus were less than 82 % and the genomes of IWT25T and IWT140 shared 97.3 % average nucleotide identity, demonstrating that the three strains were allocated to two different novel species of the genus Lactobacillus. Together with multilocus sequence analysis, phenotypic and chemotaxonomic characteristics, strains IWT5T (=JCM 31144T=DSM 102973T) and IWT25T (=JCM 31145T=DSM 102974T) are proposed as the type strains of novel species of the genus Lactobacillus, with the names Lactobacillus silagincola sp. nov. and Lactobacillus pentosiphilus sp. nov., respectively.

  20. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  1. Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

    PubMed

    Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

    2012-12-01

    Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

  2. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  3. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    NASA Technical Reports Server (NTRS)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  4. Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

    PubMed

    Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

    2018-06-27

    All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

  5. Dimorphic cycle in Candida citri sp. nov., a novel yeast species isolated from rotting fruit in Borneo.

    PubMed

    Sipiczki, Matthias

    2011-03-01

    Five dimorphic yeast strains were isolated from rotting lime fruits in Borneo. The sequences of the D1/D2 domains of the 26S rRNA genes, the internal transcribed spacer (ITS) chromosomal regions and the 18S rRNA genes were identical in the isolates and differed from the corresponding sequences of all known yeast species. Based on the sequence differences (12-15% in the D1/D2 domain) from the closest relatives and the different pattern of taxonomic traits, the new isolates are assigned the status of a new species, for which the name Candida citri sp. nov. is proposed. Its type strain is 11-469(T) , which has been deposited in Centralbureau voor Schimmelcultures (Utrecht, the Netherlands) as CBS 11858(T) , Culture Collection of Yeasts (Bratislava, Slovakia) as CCY 29-181-1(T) and the National Collection of Agricultural and Industrial Microorganisms (Budapest, Hungary) as NCAIM Y.01978(T) . MycoBank number: MB 519100. The GenBank accession numbers for nucleotide sequences of its D1/D2 domain, ITS and 18S regions are HM803241, HM803242 and HM803243, respectively. Candida citri produces invasive mycelium composed of true septate hyphae that grow towards nutrient-rich parts of the medium and develop large vacuoles at the nongrowing ends of their cells. The hyphae produce blastoconidia, which can establish satellite yeast colonies in the invaded solid substrate. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Molecular detection of Theileria, Babesia, and Hepatozoon spp. in ixodid ticks from Palestine.

    PubMed

    Azmi, Kifaya; Ereqat, Suheir; Nasereddin, Abedelmajeed; Al-Jawabreh, Amer; Baneth, Gad; Abdeen, Ziad

    2016-07-01

    Ixodid ticks transmit various infectious agents that cause disease in humans and livestock worldwide. A cross-sectional survey on the presence of protozoan pathogens in ticks was carried out to assess the impact of tick-borne protozoa on domestic animals in Palestine. Ticks were collected from herds with sheep, goats and dogs in different geographic districts and their species were determined using morphological keys. The presence of piroplasms and Hepatozoon spp. was determined by PCR amplification of a 460-540bp fragment of the 18S rRNA gene followed by RFLP or DNA sequencing. A PCR-RFLP method based on the 18S rRNA was used in order to detect and to identify Hepatozoon, Babesia and Theileria spp. A total of 516 ticks were collected from animals in six Palestinian localities. Five tick species were found: Rhipicephalus sanguineus sensu lato, Rhipicephalus turanicus, Rhipicephalus bursa, Haemaphysalis parva and Haemaphysalis adleri. PCR-based analyses of the ticks revealed Theileria ovis (5.4%), Hepatozoon canis (4.3%), Babesia ovis (0.6%), and Babesia vogeli (0.4%). Theileria ovis was significantly associated with ticks from sheep and with R. turanicus ticks (p<0.01). H. canis was detected only in R. sanguineus s.l. and was significantly associated with ticks from dogs (p<0.01). To our knowledge, this is the first report describing the presence of these pathogens in ticks collected from Palestine. Communicating these findings with health and veterinary professionals will increase their awareness, and contribute to improved diagnosis and treatment of tick-borne diseases. Copyright © 2016. Published by Elsevier GmbH.

  7. Aliisedimentitalea scapharcae gen. nov., sp. nov., isolated from ark shell Scapharca broughtonii.

    PubMed

    Kim, Young-Ok; Park, Sooyeon; Nam, Bo-Hye; Kim, Dong-Gyun; Won, Sung-Min; Park, Ji-Min; Yoon, Jung-Hoon

    2015-08-01

    A Gram-negative, aerobic, non-spore-forming, motile and ovoid or rod-shaped bacterial strain, designated MA2-16(T), was isolated from ark shell (Scapharca broughtonii) collected from the South Sea, South Korea. Strain MA2-16(T) was found to grow optimally at 30°C, at pH 7.0-8.0 and in the presence of 2.0% (w/v) NaCl. Neighbour-joining, maximum-likelihood and maximum-parsimony phylogenetic trees based on 16S rRNA gene sequences revealed that strain MA2-16(T) clustered with the type strain of Sedimentitalea nanhaiensis. The novel strain exhibited a 16S rRNA gene sequence similarity value of 97.1% to the type strain of S. nanhaiensis. In the neighbour-joining phylogenetic tree based on gyrB sequences, strain MA2-16(T) formed an evolutionary lineage independent of those of other taxa. Strain MA2-16(T) contained Q-10 as the predominant ubiquinone and C18:1 ω7c and 11-methyl C18:1 ω7c as the major fatty acids. The major polar lipids of strain MA2-16(T) were phosphatidylcholine, phosphatidylglycerol, phosphatidylethanolamine, an unidentified aminolipid and an unidentified lipid. The DNA G+C content of strain MA2-16(T) was 57.7 mol% and its DNA-DNA relatedness values with the type strains of S. nanhaiensis and some phylogenetically related species of the genera Leisingera and Phaeobacter were 13-24%. On the basis of the data presented, strain MA2-16(T) is considered to represent a novel genus and novel species within the family Rhodobacteraceae, for which the name Aliisedimentitalea scapharcae gen. nov., sp. nov. is proposed. The type strain is MA2-16(T) (=KCTC 42119(T) =CECT 8598(T)).

  8. Mucosal and salivary microbiota associated with recurrent aphthous stomatitis.

    PubMed

    Kim, Yun-Ji; Choi, Yun Sik; Baek, Keum Jin; Yoon, Seok-Hwan; Park, Hee Kyung; Choi, Youngnim

    2016-04-01

    Recurrent aphthous stomatitis (RAS) is a common oral mucosal disorder of unclear etiopathogenesis. Although recent studies of the oral microbiota by high-throughput sequencing of 16S rRNA genes have suggested that imbalances in the oral microbiota may contribute to the etiopathogenesis of RAS, no specific bacterial species associated with RAS have been identified. The present study aimed to characterize the microbiota in the oral mucosa and saliva of RAS patients in comparison with control subjects at the species level. The bacterial communities of the oral mucosa and saliva from RAS patients with active lesions (RAS, n = 18 for mucosa and n = 8 for saliva) and control subjects (n = 18 for mucosa and n = 7 for saliva) were analyzed by pyrosequencing of the 16S rRNA genes. There were no significant differences in the alpha diversity between the controls and the RAS, but the mucosal microbiota of the RAS patients showed increased inter-subject variability. A comparison of the relative abundance of each taxon revealed decreases in the members of healthy core microbiota but increases of rare species in the mucosal and salivary microbiota of RAS patients. Particularly, decreased Streptococcus salivarius and increased Acinetobacter johnsonii in the mucosa were associated with RAS risk. A dysbiosis index, which was developed using the relative abundance of A. johnsonii and S. salivarius and the regression coefficients, correctly predicted 83 % of the total cases for the absence or presence of RAS. Interestingly, A. johnsonii substantially inhibited the proliferation of gingival epithelial cells and showed greater cytotoxicity against the gingival epithelial cells than S. salivarius. RAS is associated with dysbiosis of the mucosal and salivary microbiota, and two species associated with RAS have been identified. This knowledge may provide a diagnostic tool and new targets for therapeutics for RAS.

  9. U.S. Coast Guard, Office of Boating Safety

    MedlinePlus

    ... COAST GUARD ISSUES FINALE RULE – UPDATE OF OUTBOARD ENGINE WEIGHT TEST REQUIREMENTS FY18 National Nonprofit Organization Funding ... operator, passenger, or concerned individual, can make a difference. Manufacturers Is your boat safe? You can check ...

  10. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  11. In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

    PubMed Central

    Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

    2007-01-01

    This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

  12. Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities

    PubMed Central

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A.; Clemente, Jose C.; Knight, Rob; Gordon, Jeffrey I.; Janssen, Peter H.

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats. PMID:23408926

  13. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

    PubMed

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

  14. Temporal Changes in Microbial Metagenomic Signatures and Lipid Profiles After Fracturing in the Marcellus Shale

    NASA Astrophysics Data System (ADS)

    Trexler, R.; Wrighton, K. C.; Pfiffner, S. M.; Wilkins, M.; Daly, R. A.; Mouser, P. J.

    2014-12-01

    Shale gas formations represent understudied deep biosphere ecosystems with important implications to terrestrial biogeochemical cycles and global energy resources. Recent 16S rRNA gene studies examining temporal microbial community dynamics of returned fluids from hydraulically fractured wells in the Marcellus Shale indicate ecosystem changes from aerobic, low-salt associated microbes in injected fluids to anaerobic, halophilic taxa in produced fluids several months after fracturing. To further characterize changes in the ecology, functional potential and biosignatures of observed taxa, we sequenced genomic DNA from three key time points after fracturing (T7, T82, and T328; Tn, n = days) and analyzed their lipid signatures. The metagenomic profiles verify 16S rRNA gene trends, revealing strain-type changes in dominant Bacteria of Marinobacter, Halomonas, and Halanaerobium and the Archaeal genus Methanolobus through time. Novel species within the γ-Proteobacteria were also observed. Reconstructed genomes show as bioavailable N decreases through time, genes associated with N2 fixing and obtaining N from organic pools (ncd2, nit1, and eutCB) increase in T82 and T328 samples after oxidized nitrogen species (NO3) are depleted. Further, S oxidizing genes were only detected in the T7 sample with incomplete pathways for dissimilatory sulfate reduction (DSR). Later time points showed an increase in abundance of sulfonate importer genes and the anaerobic DSR gene, asrA, suggesting the use of sulfite and sulfonates for S acquisition after sulfate is depleted. Lipid analyses confirmed distinct profiles between T82 and T328 and revealed differences in 16 and 18 C monounsaturated fatty acids, indicative of gram (-) bacteria. The lipid profile from T328 was markedly less diverse than that of T82 and indicated a very limited community, as supported by the 16S rRNA gene and metagenomic data. This research integrates metagenomic data with lipid profiles to characterize temporal changes in biosignatures and the functional potential of N and S metabolic genes of deep shale microbes.

  15. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

    PubMed

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-10-15

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

    PubMed

    Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

    2015-03-01

    Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

  17. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  18. Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

    PubMed Central

    Sato, Mitsuharu; Miyazaki, Kentaro

    2017-01-01

    Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992

  19. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

  20. How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

    PubMed

    Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

    2018-03-15

    The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

  1. Polyphasic taxonomic characterisation of a novel strain as Pararhizobium haloflavum sp. nov., isolated from soil samples near a sewage treatment tank.

    PubMed

    Shen, Xia; Li, Yu; Zhao, Zhe; Han, Yi-Fan; Zhang, Wen-Wu; Yu, Xiao-Yun; Zhang, Chong-Ya; Sun, Cong; Wu, Min

    2018-04-01

    A Gram-stain negative, aerobic, motile and ovoid- to rod-shaped bacteria strain, designated XC0140 T , was isolated from soil samples near the sewage treatment tank of a chemical factory in Zhejiang Province, China, and subjected to polyphasic taxonomic investigation. Strain XC0140 T grew at 10-37 °C and pH 6.0-9.0 (optimum, 35 °C and pH 7.5) and with 0-17% (w/v) NaCl (optimum, 1%). According to phylogenetic analysis based on 16S rRNA gene sequences, strain XC0140 T was assigned to the genus Pararhizobium with high 16S rRNA gene sequence similarity of 95.97% to "Pararhizobium helanshanense CCNWQTX14 T" , followed by Pararhizobium sphaerophysae CCNWGS0238 T (95.95%). Chemotaxonomic analysis showed that strain XC0140 T contains ubiquinone-10 as the predominant respiratory quinone and possessed summed feature 8 (comprising C 18: 1 ω7c and/or ω6c), 11-methyl C 18:1 ω7c, C 18: 0 and C 16: 0 as predominant forms of fatty acids. The polar lipids of strain XC0140 T consisted of seven phospholipids (PL), two aminolipids (AL), one glycolipid (GL) and three unidentified lipids (L1, L2 and L3). The DNA G+C content was 62.7 mol%. Based on the polyphasic taxonomic characterization, strain XC0140 T is considered to represent a novel species of the genus Pararhizobium, for which the name Pararhizobium haloflavum sp. nov. is proposed. (type strain XC0140 T  = MCCC 1K03228 T  = KCTC 52582 T ).

  2. Nocardioides endophyticus sp. nov. and Nocardioides conyzicola sp. nov., isolated from herbaceous plant roots.

    PubMed

    Han, Ji-Hye; Kim, Tae-Su; Joung, Yochan; Kim, Mi Na; Shin, Kee-Sun; Bae, Taeok; Kim, Seung Bum

    2013-12-01

    Two Gram-stain-positive, non-motile, non-spore-forming, rod-shaped actinobacterial strains were isolated from the surface-sterilized roots of mugwort (Artemisia princeps) and horse-weed (Conyza canadensis), and subjected to taxonomic characterization. 16S rRNA gene sequence analysis indicated that the isolates, designated MWE 3-5(T) and HWE 2-02(T), should be placed in the genus Nocardioides of the family Nocardioidaceae. The strains were closely related to Nocardioides hankookensis DS-30(T), which exhibited 16S rRNA gene sequence similarity values of 97.99 and 99.09 % with strains MWE 3-5(T) and HWE 2-02(T), respectively. The genome relatedness of N. hankookensis DS-30(T) with strain MWE 3-5(T) was 35.8 %, and that with strain HWE 2-02(T) was 36.4 %, whereas that between the two isolates was 43.2 %. Strains MWE 3-5(T) and HWE 2-02(T) possessed MK-8(H4) as the major isoprenoid quinone, and ll-diaminopimelic acid in the cell-wall peptidoglycan. The main fatty acids were iso-C16 : 0, iso-C17 : 0 and C18 : 1ω9c for strain MWE 3-5(T) and iso-C16 : 0, 10-methyl C18 : 0 and C18 : 1ω9c for strain HWE 2-02(T). Based on phenotypic, genotypic and phylogenetic studies, the following two novel species are proposed: Nocardioides endophyticus sp. nov. (type strain, MWE 3-5(T) = KCTC 29122(T) = JCM 18532(T)) and Nocardioides conyzicola sp. nov. (type strain, HWE 2-02(T) = KCTC 29121(T) = JCM 18531(T)).

  3. Roseomonas oryzae sp. nov., isolated from paddy rhizosphere soil.

    PubMed

    Ramaprasad, E V V; Sasikala, Ch; Ramana, Ch V

    2015-10-01

    A non-motile, coccus-shaped, pale-pink-pigmented bacterium, designated strain JC288T, was isolated from a paddy rhizosphere soil collected from Western Ghats, Kankumbi, Karnataka, India. Cells were found to be Gram-stain-negative, and catalase- and oxidase-positive; the major fatty acids were C16 : 0, C16 : 1ω7c/C16 : 1ω6c, C18 : 1ω7c/C18 : 1ω6c and C18 : 1 2-OH. The predominant respiratory quinone was Q-10 and the genomic DNA G+C content was 67.5 mol%. Strain JC288T contained diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, four unidentified aminolipids, three unidentified phospholipids, two unidentified lipids, an aminophospholipid and a glycolipid. Hydroxyspirilloxanthin was the major carotenoid of strain JC288T. 16S rRNA gene sequence comparisons indicated that strain JC288T represents a member of the genus Roseomonas within the family Acetobacteraceae of the phylum Proteobacteria. Strain JC288T shared the highest 16S rRNA gene sequence similarity with Roseomonas rhizosphaerae YW11T (97.3 %), Roseomonas aestuarii JC17T (97.1 %), Roseomonas cervicalis CIP 104027T (95.9 %) and other members of the genus Roseomonas ( < 95.5 %). The distinct genomic difference and morphological, physiological and chemotaxonomic differences from the previously described taxa support the classification of strain JC288T as a representative of a novel species of the genus Roseomonas, for which the name Roseomonas oryzae sp. nov. is proposed. The type strain is JC288T ( = KCTC 42542T = LMG 28711T).

  4. Ribosomal RNA and ribosomal proteins in corynebacteria.

    PubMed

    Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

    2003-09-04

    Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

  5. 76 FR 49391 - Approval and Promulgation of Air Quality Implementation Plans; Minnesota; Rules Update

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-10

    ... at the state and Federal levels. EPA is proposing to defer action on two sections of Minnesota's...'s request to remove the Minneapolis/ St. Paul vehicle inspection and maintenance program from the... Maintenance Section, Air Programs Branch (AR-18J), U.S. Environmental Protection Agency, Region 5, 77 West...

  6. Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.

    PubMed

    Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna

    2018-04-01

    A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.

  7. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  8. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    PubMed Central

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

    2013-01-01

    SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

  9. The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

    PubMed Central

    Petti, C. A.; Polage, C. R.; Schreckenberger, P.

    2005-01-01

    Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

  10. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    PubMed

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  11. rrndb: the Ribosomal RNA Operon Copy Number Database

    PubMed Central

    Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

    2001-01-01

    The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

  12. A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

    PubMed Central

    Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

    2009-01-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

  13. A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

    PubMed

    Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

    2009-05-01

    Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

  14. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    PubMed

    Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

    2009-10-19

    Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  15. Selection of Reference Genes for Normalization of MicroRNA Expression by RT-qPCR in Sugarcane Buds under Cold Stress

    PubMed Central

    Yang, Yuting; Zhang, Xu; Chen, Yun; Guo, Jinlong; Ling, Hui; Gao, Shiwu; Su, Yachun; Que, Youxiong; Xu, Liping

    2016-01-01

    Sugarcane, accounting for 80% of world's sugar, originates in the tropics but is cultivated mainly in the subtropics. Therefore, chilling injury frequently occurs and results in serious losses. Recent studies in various plant species have established microRNAs as key elements in the post-transcriptional regulation of response to biotic and abiotic stresses including cold stress. Though, its accuracy is largely influenced by the use of reference gene for normalization, quantitative PCR is undoubtedly a popular method used for identification of microRNAs. For identifying the most suitable reference genes for normalizing miRNAs expression in sugarcane under cold stress, 13 candidates among 17 were investigated using four algorithms: geNorm, NormFinder, deltaCt, and Bestkeeper, and four candidates were excluded because of unsatisfactory efficiency and specificity. Verification was carried out using cold-related genes miR319 and miR393 in cold-tolerant and sensitive cultivars. The results suggested that miR171/18S rRNA and miR171/miR5059 were the best reference gene sets for normalization for miRNA RT-qPCR, followed by the single miR171 and 18S rRNA. These results can aid research on miRNA responses during sugarcane stress, and the development of sugarcane tolerant to cold stress. This study is the first report concerning the reference gene selection of miRNA RT-qPCR in sugarcane. PMID:26904058

  16. Molecular detection and genetic diversity of Babesia gibsoni in dogs in Bangladesh.

    PubMed

    Terao, Masashi; Akter, Shirin; Yasin, Md Golam; Nakao, Ryo; Kato, Hirotomo; Alam, Mohammad Zahangir; Katakura, Ken

    2015-04-01

    Babesia gibsoni is a tick-borne hemoprotozoan parasite of dogs that often causes fever and hemolytic illness. Detection of B. gibsoni has been predominantly reported in Asian countries, including Japan, Korea, Taiwan, Malaysia, Bangladesh and India. The present study shows the first molecular characterization of B. gibsoni detected from dogs in Bangladesh. Blood samples were collected on FTA® Elute cards from 50 stray dogs in Mymensingh District in Bangladesh. DNA eluted from the cards was subjected to nested PCR for the 18S rRNA gene of Babesia species. Approximately 800bp PCR products were detected in 15 of 50 dogs (30%). Based on restriction fragment length polymorphism (RFLP) and direct sequencing of the PCR products, all parasite isolates were identified as B. gibsoni. Furthermore, the BgTRAP (B. gibsoni thrombospondin-related adhesive protein) gene fragments were detected in 13 of 15 18S rRNA gene PCR positive blood samples. Phylogenetic analysis of the BgTRAP gene revealed that B. gibsoni parasites in Bangladesh formed a cluster, which was genetically different from other Asian B. gibsoni isolates. In addition, tandem repeat analysis of the BgTRAP gene clearly showed considerable genetic variation among Bangladeshi isolates. These results suggested that B. gibsoni parasites in a different genetic clade are endemic in dogs in Bangladesh. Further studies are required to elucidate the origin, distribution, vector and pathogenesis of B. gibsoni parasites circulating in dogs in Bangladesh. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Morphologic and Molecular Characterization of a Demodex (Acari: Demodicidae) Species from White-Tailed Deer (Odocoileus virginianus)

    PubMed Central

    Yabsley, Michael J.; Clay, Sarah E.; Gibbs, Samantha E. J.; Cunningham, Mark W.; Austel, Michaela G.

    2013-01-01

    Demodex mites, although usually nonpathogenic, can cause a wide range of dermatological lesions ranging from mild skin irritation and alopecia to severe furunculosis. Recently, a case of demodicosis from a white-tailed deer (Odocoileus virginianus) revealed a Demodex species morphologically distinct from Demodex odocoilei. All life cycle stages were considerably larger than D. odocoilei and although similar in size to D. kutzeri and D. acutipes from European cervids, numerous morphometrics distinguished the four species. Adult males and females were 209.1 ± 13.1 and 225.5 ± 13.4 μm in length, respectively. Ova, larva, and nymphs measured 65.1 ± 4.1, 124.9 ± 11.6, and 205.1 ± 19.4 μm in length, respectively. For phylogenetic analyses, a portion of the 18S rRNA gene was amplified and sequenced from samples of the WTD Demodex sp., two Demodex samples from domestic dogs, and Demodex ursi from a black bear. Phylogenetic analyses indicated that the WTD Demodex was most similar to D. musculi from laboratory mice. A partial sequence from D. ursi was identical to the WTD Demodex sequence; however, these two species can be differentiated morphologically. This paper describes a second Demodex species from white-tailed deer and indicates that 18S rRNA is useful for phylogenetic analysis of most Demodex species, but two morphologically distinct species had identical partial sequences. Additional gene targets should be investigated for phylogenetic and parasite-host association studies. PMID:27335854

  18. Megasphaera hexanoica sp. nov., a medium-chain carboxylic acid-producing bacterium isolated from a cow rumen.

    PubMed

    Jeon, Byoung Seung; Kim, Seil; Sang, Byoung-In

    2017-07-01

    Strain MHT, a strictly anaerobic, Gram-stain-negative, non-spore-forming, spherical coccus or coccoid-shaped microorganism, was isolated from a cow rumen during a screen for hexanoic acid-producing bacteria. The microorganism grew at 30-40 °C and pH 5.5-7.5 and exhibited production of various short- and medium-chain carboxylic acids (acetic acid, butyric acid, pentanoic acid, isobutyric acid, isovaleric acid, hexanoic acid, heptanoic acid and octanoic acid), as well as H2 and CO2 as biogas. Phylogenetic analysis based on 16S rRNA gene sequencing demonstrated that MHT represents a member of the genus Megasphaera, with the closest relatives being Megapsphaera indica NMBHI-10T (94.1 % 16S rRNA sequence similarity), Megasphaera elsdenii DSM 20460T (93.8 %) and Megasphaera paucivorans DSM 16981T (93.8 %). The major cellular fatty acids produced by MHT included C12 : 0, C16 : 0, C18 : 1cis 9, and C18 : 0, and the DNA G+C content of the MHT genome is 51.8 mol%. Together, the distinctive phenotypic and phylogenetic characteristics of MHT indicate that this microorganism represents a novel species of the genus Megasphaera, for which the name Megasphaera hexanoica sp. nov. is herein proposed. The type strain of this species is MHT (=KCCM 43214T=JCM 31403T).

  19. A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigemina.

    PubMed

    Buling, A; Criado-Fornelio, A; Asenzo, G; Benitez, D; Barba-Carretero, J C; Florin-Christensen, M

    2007-06-20

    The haemoparasites Babesia bovis and Babesia bigemina affect cattle over vast areas of the tropics and temperate parts of the world. Microscopic examination of blood smears allows the detection of clinical cases of babesiosis, but this procedure lacks sensitivity when parasitaemia levels are low. In addition, differentiating between similar haemoparasites can be very difficult. Molecular diagnostic procedures can, however, overcome these problems. This paper reports a quantitative PCR (qPCR) assay involving the use of SYBR Green. Based on the amplification of a small fragment of the cytochrome b gene, this method shows both high sensitivity and specificity, and allows quantification of parasite DNA. In tests, reproducible quantitative results were obtained over the range of 0.1 ng to 0.1 fg of parasite DNA. Melting curve analysis differentiated between B. bovis and B. bigemina. To assess the performance of the new qPCR procedure it was used to screen for babesiosis in 40 cows and 80 horses. B. bigemina was detected in five cows (three of these were also found to be positive by standard PCR techniques targeting the 18S rRNA gene). In addition, B. bovis was detected in one horse and B. bigemina in two horses using the proposed method, while none was found positive by ribosomal standard PCR. The sequences of the B. bigemina cytochrome b and 18S rRNA genes were completely conserved in isolates from Spain and Argentina, while those of B. bovis showed moderate polymorphism.

  20. Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

    PubMed

    Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

    2005-12-01

    Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Top