Sample records for upland cotton genome

  1. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.)

    PubMed Central

    2013-01-01

    Background Cotton, one of the world’s leading crops, is important to the world’s textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. Results We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G. raimondii contains a D genome (D5). Conclusions The library represents the first BIBAC library in cotton and related species, thus providing tools useful for integrative physical mapping, large-scale genome sequencing and large-scale functional analysis of the Upland cotton genome. Comparative sequence analysis provides insights into the Upland cotton genome, and a possible mechanism underlying the divergence and evolution of polyploid Upland cotton from its diploid putative progenitor species, G. raimondii. PMID:23537070

  2. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution

    USDA-ARS?s Scientific Manuscript database

    Genetic and genomic analyses of Upland cotton (Gossypium hirsutum) are difficult because it has a complex allotetraploid (AADD; 2n = 4x = 52) genome. Here we sequenced, assembled and analyzed the world's most important cultivated cotton genome with 246.2 gigabase (Gb) clean data obtained using whol...

  3. Genomic analyses in cotton identify signatures of selection and loci associated with fiber quality and yield traits.

    PubMed

    Fang, Lei; Wang, Qiong; Hu, Yan; Jia, Yinhua; Chen, Jiedan; Liu, Bingliang; Zhang, Zhiyuan; Guan, Xueying; Chen, Shuqi; Zhou, Baoliang; Mei, Gaofu; Sun, Junling; Pan, Zhaoe; He, Shoupu; Xiao, Songhua; Shi, Weijun; Gong, Wenfang; Liu, Jianguang; Ma, Jun; Cai, Caiping; Zhu, Xiefei; Guo, Wangzhen; Du, Xiongming; Zhang, Tianzhen

    2017-07-01

    Upland cotton (Gossypium hirsutum) is the most important natural fiber crop in the world. The overall genetic diversity among cultivated species of cotton and the genetic changes that occurred during their improvement are poorly understood. Here we report a comprehensive genomic assessment of modern improved upland cotton based on the genome-wide resequencing of 318 landraces and modern improved cultivars or lines. We detected more associated loci for lint yield than for fiber quality, which suggests that lint yield has stronger selection signatures than other traits. We found that two ethylene-pathway-related genes were associated with increased lint yield in improved cultivars. We evaluated the population frequency of each elite allele in historically released cultivar groups and found that 54.8% of the elite genome-wide association study (GWAS) alleles detected were transferred from three founder landraces: Deltapine 15, Stoneville 2B and Uganda Mian. Our results provide a genomic basis for improving cotton cultivars and for further evolutionary analysis of polyploid crops.

  4. Comparative phenotypic analysis of Gossypium raimondii with Upland cotton

    USDA-ARS?s Scientific Manuscript database

    Gossypium raimondii Ulbr., a wild species with a diploid genome, has been sequenced due to its small genome size and sequence similarity with the polyploidy cultivated Gossypium species. Accessibility of the G. raimondii genome has made the species a reference used extensively in cotton genomic and...

  5. Efect of tri-species chromosome shuffling on agronomic and fiber traits in Upland cotton

    USDA-ARS?s Scientific Manuscript database

    Gossypium barbadense (L.), G. tomentosum (Seem.), G. mustelinum (Watt.) and G. darwinii (Watt.) are in the primary gene pool of Upland cotton (G. hirsutum). They share a common chromosome number (2n=52), similar AD-genome architecture, and form reasonably fertile F1 hybrids. However, reduced transm...

  6. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization

    PubMed Central

    Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua

    2015-01-01

    Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus. PMID:25992947

  7. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    PubMed

    Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua

    2015-01-01

    Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

  8. Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

    PubMed

    Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

    2014-11-06

    Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved understanding of the roles of the Hsf gene family during stress responses and fiber development.

  9. Subgenome-anchored physical frameworks of the allotetraploid Upland cotton (Gossypium hirsutum L.) genome, and an approach toward reference-grade assemblies of polyploids

    USDA-ARS?s Scientific Manuscript database

    Like many agricultural crops, the cultivated cotton genome is large and polyploid (~2.5Gb), consisting of two very similar repeat-rich subgenomes, whose size and complexity pose significant challenges for accurate genome reconstruction using whole-genome shotgun approaches. A strategy for accurately...

  10. RNA-Seq Transcriptome Profiling of Upland Cotton (Gossypium hirsutum L.) Root Tissue under Water-Deficit Stress

    PubMed Central

    Bowman, Megan J.; Park, Wonkeun; Bauer, Philip J.; Udall, Joshua A.; Page, Justin T.; Raney, Joshua; Scheffler, Brian E.; Jones, Don. C.; Campbell, B. Todd

    2013-01-01

    An RNA-Seq experiment was performed using field grown well-watered and naturally rain fed cotton plants to identify differentially expressed transcripts under water-deficit stress. Our work constitutes the first application of the newly published diploid D5 Gossypium raimondii sequence in the study of tetraploid AD1 upland cotton RNA-seq transcriptome analysis. A total of 1,530 transcripts were differentially expressed between well-watered and water-deficit stressed root tissues, in patterns that confirm the accuracy of this technique for future studies in cotton genomics. Additionally, putative sequence based genome localization of differentially expressed transcripts detected A2 genome specific gene expression under water-deficit stress. These data will facilitate efforts to understand the complex responses governing transcriptomic regulatory mechanisms and to identify candidate genes that may benefit applied plant breeding programs. PMID:24324815

  11. Genome-wide identification and characterization of TCP transcription factor genes in upland cotton (Gossypium hirsutum).

    PubMed

    Li, Wen; Li, Deng-Di; Han, Li-Hong; Tao, Miao; Hu, Qian-Qian; Wu, Wen-Ying; Zhang, Jing-Bo; Li, Xue-Bao; Huang, Geng-Qing

    2017-08-31

    TCP proteins are plant-specific transcription factors (TFs), and perform a variety of physiological functions in plant growth and development. In this study, 74 non-redundant TCP genes were identified in upland cotton (Gossypium hirsutum L.) genome. Cotton TCP family can be classified into two classes (class I and class II) that can be further divided into 11 types (groups) based on their motif composition. Quantitative RT-PCR analysis indicated that GhTCPs display different expression patterns in cotton tissues. The majority of these genes are preferentially or specifically expressed in cotton leaves, while some GhTCP genes are highly expressed in initiating fibers and/or elongating fibers of cotton. Yeast two-hybrid results indicated that GhTCPs can interact with each other to form homodimers or heterodimers. In addition, GhTCP14a and GhTCP22 can interact with some transcription factors which are involved in fiber development. These results lay solid foundation for further study on the functions of TCP genes during cotton fiber development.

  12. Next Generation Genetic Mapping of the Ligon-lintless-2 (Li2) Locus in Upland Cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing offers new ways to identify the genetic mechanisms that underlie mutant phenotypes. The release of a reference diploid Gossypium raimondii (D5) genome and bioinformatics tools to sort tetraploid reads into subgenomes has brought cotton genetic mapping into the genomics er...

  13. Resequencing a core collection of upland cotton identifies genomic variation and loci influencing fiber quality and yield.

    PubMed

    Ma, Zhiying; He, Shoupu; Wang, Xingfen; Sun, Junling; Zhang, Yan; Zhang, Guiyin; Wu, Liqiang; Li, Zhikun; Liu, Zhihao; Sun, Gaofei; Yan, Yuanyuan; Jia, Yinhua; Yang, Jun; Pan, Zhaoe; Gu, Qishen; Li, Xueyuan; Sun, Zhengwen; Dai, Panhong; Liu, Zhengwen; Gong, Wenfang; Wu, Jinhua; Wang, Mi; Liu, Hengwei; Feng, Keyun; Ke, Huifeng; Wang, Junduo; Lan, Hongyu; Wang, Guoning; Peng, Jun; Wang, Nan; Wang, Liru; Pang, Baoyin; Peng, Zhen; Li, Ruiqiang; Tian, Shilin; Du, Xiongming

    2018-05-07

    Upland cotton is the most important natural-fiber crop. The genomic variation of diverse germplasms and alleles underpinning fiber quality and yield should be extensively explored. Here, we resequenced a core collection comprising 419 accessions with 6.55-fold coverage depth and identified approximately 3.66 million SNPs for evaluating the genomic variation. We performed phenotyping across 12 environments and conducted genome-wide association study of 13 fiber-related traits. 7,383 unique SNPs were significantly associated with these traits and were located within or near 4,820 genes; more associated loci were detected for fiber quality than fiber yield, and more fiber genes were detected in the D than the A subgenome. Several previously undescribed causal genes for days to flowering, fiber length, and fiber strength were identified. Phenotypic selection for these traits increased the frequency of elite alleles during domestication and breeding. These results provide targets for molecular selection and genetic manipulation in cotton improvement.

  14. Genome-wide identification and characterization of SnRK2 gene family in cotton (Gossypium hirsutum L.).

    PubMed

    Liu, Zhao; Ge, Xiaoyang; Yang, Zuoren; Zhang, Chaojun; Zhao, Ge; Chen, Eryong; Liu, Ji; Zhang, Xueyan; Li, Fuguang

    2017-06-12

    Sucrose non-fermenting-1-related protein kinase 2 (SnRK2) is a plant-specific serine/threonine kinase family involved in the abscisic acid (ABA) signaling pathway and responds to osmotic stress. A genome-wide analysis of this protein family has been conducted previously in some plant species, but little is known about SnRK2 genes in upland cotton (Gossypium hirsutum L.). The recent release of the G. hirsutum genome sequence provides an opportunity to identify and characterize the SnRK2 kinase family in upland cotton. We identified 20 putative SnRK2 sequences in the G. hirsutum genome, designated as GhSnRK2.1 to GhSnRK2.20. All of the sequences encoded hydrophilic proteins. Phylogenetic analysis showed that the GhSnRK2 genes were classifiable into three groups. The chromosomal location and phylogenetic analysis of the cotton SnRK2 genes indicated that segmental duplication likely contributed to the diversification and evolution of the genes. The gene structure and motif composition of the cotton SnRK2 genes were analyzed. Nine exons were conserved in length among all members of the GhSnRK2 family. Although the C-terminus was divergent, seven conserved motifs were present. All GhSnRK2s genes showed expression patterns under abiotic stress based on transcriptome data. The expression profiles of five selected genes were verified in various tissues by quantitative real-time RT-PCR (qRT-PCR). Transcript levels of some family members were up-regulated in response to drought, salinity or ABA treatments, consistent with potential roles in response to abiotic stress. This study is the first comprehensive analysis of SnRK2 genes in upland cotton. Our results provide the fundamental information for the functional dissection of GhSnRK2s and vital availability for the improvement of plant stress tolerance using GhSnRK2s.

  15. Identification of exotic genetic components and DNA methylation pattern analysis of three cotton introgression lines from Gossypium bickii.

    PubMed

    He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming

    2011-01-01

    The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.

  16. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  17. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  18. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  19. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  20. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  1. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...

  2. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...

  3. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...

  4. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...

  5. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...

  6. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...

  7. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...

  8. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...

  9. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...

  10. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...

  11. Linkage Map Construction and QTL Analysis of Agronomic and Fiber Quality Traits in Cotton.

    USDA-ARS?s Scientific Manuscript database

    The superior fiber properties of Gossypium barbadense L. serve as a source of novel variation for improving fiber quality in Upland cotton (G. hirsutum L.), but introgression from G. barbadense has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an e...

  12. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...

  13. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...

  14. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...

  15. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...

  16. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...

  17. Identification of the group IIa WRKY subfamily and the functional analysis of GhWRKY17 in upland cotton (Gossypium hirsutum L.).

    PubMed

    Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning; Yu, Shuxun

    2018-01-01

    WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant's susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton.

  18. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Cotton is a world’s leading crop important to the world’s textile and energy industries, and a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction and extensive analysis of a binary bacterial artificial chromosome (BI...

  19. Genome-wide identification and characterization of microRNAs differenytially expressed in fibers in a cotton phytochrome A1 RNAi line

    USDA-ARS?s Scientific Manuscript database

    Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...

  20. Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

    PubMed

    Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

    2017-08-01

    Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Genome-wide comparative transcriptome analysis of CMS-D2 and its maintainer and restorer lines in upland cotton.

    PubMed

    Wu, Jianyong; Zhang, Meng; Zhang, Bingbing; Zhang, Xuexian; Guo, Liping; Qi, Tingxiang; Wang, Hailin; Zhang, Jinfa; Xing, Chaozhu

    2017-06-08

    Cytoplasmic male sterility (CMS) conferred by the cytoplasm from Gossypium harknessii (D2) is an important system for hybrid seed production in Upland cotton (G. hirsutum). The male sterility of CMS-D2 (i.e., A line) can be restored to fertility by a restorer (i.e., R line) carrying the restorer gene Rf1 transferred from the D2 nuclear genome. However, the molecular mechanisms of CMS-D2 and its restoration are poorly understood. In this study, a genome-wide comparative transcriptome analysis was performed to identify differentially expressed genes (DEGs) in flower buds among the isogenic fertile R line and sterile A line derived from a backcross population (BC 8 F 1 ) and the recurrent parent, i.e., the maintainer (B line). A total of 1464 DEGs were identified among the three isogenic lines, and the Rf1-carrying Chr_D05 and its homeologous Chr_A05 had more DEGs than other chromosomes. The results of GO and KEGG enrichment analysis showed differences in circadian rhythm between the fertile and sterile lines. Eleven DEGs were selected for validation using qRT-PCR, confirming the accuracy of the RNA-seq results. Through genome-wide comparative transcriptome analysis, the differential expression profiles of CMS-D2 and its maintainer and restorer lines in Upland cotton were identified. Our results provide an important foundation for further studies into the molecular mechanisms of the interactions between the restorer gene Rf1 and the CMS-D2 cytoplasm.

  2. Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

    PubMed

    Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

    2016-04-11

    Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

  3. A MAGIC population-based genome-wide association study reveals functional association of GhRBB1_A07 gene with superior fiber quality in cotton

    USDA-ARS?s Scientific Manuscript database

    An Upland cotton multi-parent advanced generation inter-cross (MAGIC) population was developed through random-mating of 11 diverse cultivars for five generations. In this study, fiber quality data obtained from four environments and 6,071 SNP markers generated via GBS and 223 microsatellite markers...

  4. Molecular Mapping of Restriction-Site Associated DNA Markers In Allotetraploid Upland Cotton.

    PubMed

    Wang, Yangkun; Ning, Zhiyuan; Hu, Yan; Chen, Jiedan; Zhao, Rui; Chen, Hong; Ai, Nijiang; Guo, Wangzhen; Zhang, Tianzhen

    2015-01-01

    Upland cotton (Gossypium hirsutum L., 2n = 52, AADD) is an allotetraploid, therefore the discovery of single nucleotide polymorphism (SNP) markers is difficult. The recent emergence of genome complexity reduction technologies based on the next-generation sequencing (NGS) platform has greatly expedited SNP discovery in crops with highly repetitive and complex genomes. Here we applied restriction-site associated DNA (RAD) sequencing technology for de novo SNP discovery in allotetraploid cotton. We identified 21,109 SNPs between the two parents and used these for genotyping of 161 recombinant inbred lines (RILs). Finally, a high dense linkage map comprising 4,153 loci over 3500-cM was developed based on the previous result. Using this map quantitative trait locus (QTLs) conferring fiber strength and Verticillium Wilt (VW) resistance were mapped to a more accurate region in comparison to the 1576-cM interval determined using the simple sequence repeat (SSR) genetic map. This suggests that the newly constructed map has more power and resolution than the previous SSR map. It will pave the way for the rapid identification of the marker-assisted selection in cotton breeding and cloning of QTL of interest traits.

  5. Identification of the group IIa WRKY subfamily and the functional analysis of GhWRKY17 in upland cotton (Gossypium hirsutum L.)

    PubMed Central

    Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning

    2018-01-01

    WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant’s susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton. PMID:29370286

  6. Population structure and genetic basis of the agronomic traits of upland cotton in China revealed by a genome-wide association study using high-density SNPs.

    PubMed

    Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu

    2017-11-01

    Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton-producing and cotton-consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nationwide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into three subpopulations based on 11 975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among three genetic subpopulations, seven geographic distributions and four breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the three subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multieffects in QTLs and interassociations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents.

    PubMed

    Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J

    2017-01-01

    High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional unconfirmed possible duplications, inversions and translocations, and unbalance SNP sequence homology or SNP sequence/loci genomic dominance, or homeolog loci bias of the upland tetraploid A t and D t subgenomes. The alignments indicated that 364 SNP-associated previously unintegrated scaffolds can be placed in pseudochromosomes of the NBI G hirsutum assembly. This is the first intraspecific SNP genetic linkage consensus map assembled in G hirsutum with a core of reproducible mendelian SNP markers assayed on different populations and it provides further knowledge of chromosome arrangement of genic and nongenic SNPs. Together, the consensus map and RIL populations provide a synergistically useful platform for localizing and identifying agronomically important loci for improvement of the cotton crop.

  8. Introgression of resistance to reniform nematode (Rotylenchulus reniformis) into upland cotton (Gossypium hirsutum) from Gossypium arboreum and a Gossypium hirsutum/Gossypium aridum bridging line

    USDA-ARS?s Scientific Manuscript database

    Gossypium hirsutum is the predominant cotton of commerce and all cultivars of this species are susceptible to the reniform nematode, Rotylenchulus reniformis. To introgress resistance to R. reniformis into the tetraploid 2(AD1) G. hirsutum, a resistant diploid A2-genome G. arboreum accession (A2-19...

  9. 7 CFR 1427.25 - Determination of the prevailing world market price and the adjusted world price for upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... and the adjusted world price for upland cotton. 1427.25 Section 1427.25 Agriculture Regulations of the..., PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.25 Determination of the prevailing world market price and the adjusted world price for upland cotton. (a) CCC will...

  10. 7 CFR 1427.25 - Determination of the prevailing world market price and the adjusted world price for upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... and the adjusted world price for upland cotton. 1427.25 Section 1427.25 Agriculture Regulations of the..., PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.25 Determination of the prevailing world market price and the adjusted world price for upland cotton. (a) CCC will...

  11. 7 CFR 1427.25 - Determination of the prevailing world market price and the adjusted world price for upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... and the adjusted world price for upland cotton. 1427.25 Section 1427.25 Agriculture Regulations of the..., PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.25 Determination of the prevailing world market price and the adjusted world price for upland cotton. (a) CCC will...

  12. 7 CFR 1427.25 - Determination of the prevailing world market price and the adjusted world price for upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... and the adjusted world price for upland cotton. 1427.25 Section 1427.25 Agriculture Regulations of the..., PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.25 Determination of the prevailing world market price and the adjusted world price for upland cotton. (a) CCC will...

  13. 7 CFR 1427.25 - Determination of the prevailing world market price and the adjusted world price for upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... and the adjusted world price for upland cotton. 1427.25 Section 1427.25 Agriculture Regulations of the..., PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.25 Determination of the prevailing world market price and the adjusted world price for upland cotton. (a) CCC will...

  14. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    PubMed

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation for cultivating moderately short and compact varieties in future Chinese cotton-breeding programs.

  15. Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system

    PubMed Central

    Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei

    2017-01-01

    The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154

  16. Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.

    PubMed

    Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei

    2017-03-13

    The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H + -pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6-81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome.

  17. BAC-pool sequencing and analysis of large segments of A12 and D12 homoeologous chromosomes in Upland cotton

    USDA-ARS?s Scientific Manuscript database

    New and emerging next generation sequencing technologies have reduced sequencing costs, but there is room for additional approaches that can be applied to complex polyploid plant genomes. Large (about 2.5GB) and highly repetitive tetraploid genome of G. hirsutum is still cost-intensive with traditi...

  18. The cotton centromere contains a Ty3-gypsy-like LTR retroelement.

    PubMed

    Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto

    2012-01-01

    The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species.

  19. The Cotton Centromere Contains a Ty3-gypsy-like LTR Retroelement

    PubMed Central

    Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto

    2012-01-01

    The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species. PMID:22536361

  20. Genetic diversity and structure of elite cotton germplasm (Gossypium hirsutum L.) using genome-wide SNP data.

    PubMed

    Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing

    2017-10-01

    Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.

  1. Extra long staple upland cotton for the production of superior yarn

    USDA-ARS?s Scientific Manuscript database

    Cotton, Gossypium spp., fibers are produced primarily by two species, G. hirsutum L., upland, and G. barbadense L., pima, which also is referred to as Extra Long Staple (ELS). The Cotton Improvement Laboratory, Texas AgriLife Research, has developed ELS upland lines through intraspecific crosses and...

  2. Identification of associated SSR markers for yield component and fiber quality traits based on frame map and Upland cotton collections.

    PubMed

    Qin, Hongde; Chen, Min; Yi, Xianda; Bie, Shu; Zhang, Cheng; Zhang, Youchang; Lan, Jiayang; Meng, Yanyan; Yuan, Youlu; Jiao, Chunhai

    2015-01-01

    Detecting QTLs (quantitative trait loci) that enhance cotton yield and fiber quality traits and accelerate breeding has been the focus of many cotton breeders. In the present study, 359 SSR (simple sequence repeat) markers were used for the association mapping of 241 Upland cotton collections. A total of 333 markers, representing 733 polymorphic loci, were detected. The average linkage disequilibrium (LD) decay distances were 8.58 cM (r2 > 0.1) and 5.76 cM (r2 > 0.2). 241 collections were arranged into two subgroups using STRUCTURE software. Mixed linear modeling (MLM) methods (with population structure (Q) and relative kinship matrix (K)) were applied to analyze four phenotypic datasets obtained from four environments (two different locations and two years). Forty-six markers associated with the number of bolls per plant (NB), boll weight (BW), lint percentage (LP), fiber length (FL), fiber strength (FS) and fiber micornaire value (FM) were repeatedly detected in at least two environments. Of 46 associated markers, 32 were identified as new association markers, and 14 had been previously reported in the literature. Nine association markers were near QTLs (at a distance of less than 1-2 LD decay on the reference map) that had been previously described. These results provide new useful markers for marker-assisted selection in breeding programs and new insights for understanding the genetic basis of Upland cotton yields and fiber quality traits at the whole-genome level.

  3. 75 FR 50847 - Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-18

    ... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... previous final rule that implemented the 2008 Farm Bill provisions for the cotton program. The correction removes definitions that are no longer used concerning Northern Europe prices for cotton. CCC is also...

  4. Seed Size, Ginning Rate, and Net Ginning Energy Requirement in Upland Cotton

    USDA-ARS?s Scientific Manuscript database

    Not much information is available in the literature on the effect of seed size on ginning efficiency in upland cotton. In 2015, nine diverse upland cotton cultivars and germplasm were planted at two locations in Stoneville, MS to test the above relationship. Two of the cultivars (Ark 9317-26 and DP ...

  5. Comparative hi-density intraspecific linkage mapping using three elite populations from common parents

    USDA-ARS?s Scientific Manuscript database

    High-density linkage maps are fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, e.g., Upland cotton (Gossypium hirsutum L., 2n=52). Using 3 full-sib intra-specific mapping populations fr...

  6. CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

    PubMed

    Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

    2017-07-01

    The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

  7. Effect of seed size on ginning Efficiency in Upland Cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Not much information is available in the literature on the effect of seed size on ginning efficiency in upland cotton. In 2015 and 2016 nine diverse upland cotton cultivars and germplasm lines were planted at two locations in Stoneville, MS to test the above relationship. Two of the cultivars (Ark 9...

  8. Association mapping analysis of fiber yield and quality traits in Upland cotton (Gossypium hirsutum L.).

    PubMed

    Ademe, Mulugeta Seyoum; He, Shoupu; Pan, Zhaoe; Sun, Junling; Wang, Qinglian; Qin, Hongde; Liu, Jinhai; Liu, Hui; Yang, Jun; Xu, Dongyong; Yang, Jinlong; Ma, Zhiying; Zhang, Jinbiao; Li, Zhikun; Cai, Zhongmin; Zhang, Xuelin; Zhang, Xin; Huang, Aifen; Yi, Xianda; Zhou, Guanyin; Li, Lin; Zhu, Haiyong; Pang, Baoyin; Wang, Liru; Jia, Yinhua; Du, Xiongming

    2017-12-01

    Fiber yield and quality are the most important traits for Upland cotton (Gossypium hirsutum L.). Identifying high yield and good fiber quality genes are the prime concern of researchers in cotton breeding. Association mapping offers an alternative and powerful method for detecting those complex agronomic traits. In this study, 198 simple sequence repeats (SSRs) were used to screen markers associated with fiber yield and quality traits with 302 elite Upland cotton accessions that were evaluated in 12 locations representing the Yellow River and Yangtze River cotton growing regions of China. Three subpopulations were found after the estimation of population structure. The pair-wise kinship values varied from 0 to 0.867. Only 1.59% of the total marker locus pairs showed significant linkage disequilibrium (LD, p < 0.001). The genome-wide LD decayed within the genetic distance of ~30 to 32 cM at r 2  = 0.1, and decreased to ~1 to 2 cM at r 2  = 0.2, indicating the potential for association mapping. Analysis based on a mixed linear model detected 57 significant (p < 0.01) marker-trait associations, including seven associations for fiber length, ten for fiber micronaire, nine for fiber strength, eight for fiber elongation, five for fiber uniformity index, five for fiber uniformity ratio, six for boll weight and seven for lint percent, for a total of 35 SSR markers, of which 11 markers were associated with more than one trait. Among marker-trait associations, 24 associations coincided with the previously reported quantitative trait loci (QTLs), the remainder were newly identified QTLs/genes. The QTLs identified in this study will potentially facilitate improvement of fiber yield and quality in the future cotton molecular breeding programs.

  9. Mapping and genomic targeting of the major leaf shape gene (L) in Upland cotton (Gossypium hirsutum L.).

    PubMed

    Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu

    2014-01-01

    A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.

  10. Changes in cotton quality during ginning

    USDA-ARS?s Scientific Manuscript database

    Upland cotton gins across the cotton belt were sampled during the 2005-06 and 2006-07 ginning seasons to assess the changes in upland cotton quality during the ginning process and throughout the ginning season. Samples were taken at the module, feeder apron, and before and after lint cleaning at re...

  11. Ginning efficiency in upland cotton - a value-added trait in cotton improvement

    USDA-ARS?s Scientific Manuscript database

    In the past few years, there has been some consorted effort between cotton geneticists and ginning engineers to understand "ginning efficiency" in upland cotton. Ginning efficiency includes ginning rate (measured in gm lint sec -1) and net gin stand energy (measured in Wh kg -1 lint). Improved ginn...

  12. 75 FR 65423 - Crop Assistance Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-25

    ... provide emergency assistance to reestablish the purchasing power of eligible producers of rice, cotton... related conditions in 2009, the Secretary of Agriculture determined that producers of rice, upland cotton... of rice, upland cotton, soybeans, and sweet potatoes. CAP is a limited one-time program to...

  13. Segregation distortion and genome-wide digenic interactions affect transmission of introgressed chromatin from wild cotton species.

    PubMed

    Chandnani, Rahul; Wang, Baohua; Draye, Xavier; Rainville, Lisa K; Auckland, Susan; Zhuang, Zhimin; Lubbers, Edward L; May, O Lloyd; Chee, Peng W; Paterson, Andrew H

    2017-10-01

    This study reports transmission genetics of chromosomal segments into Gossypium hirsutum from its most distant euploid relative, Gossypium mustelinum . Mutilocus interactions and structural rearrangements affect introgression and segregation of donor chromatin. Wild allotetraploid relatives of cotton are a rich source of genetic diversity that can be used in genetic improvement, but linkage drag and non-Mendelian transmission genetics are prevalent in interspecific crosses. These problems necessitate knowledge of transmission patterns of chromatin from wild donor species in cultivated recipient species. From an interspecific cross, Gossypium hirsutum × Gossypium mustelinum, we studied G. mustelinum (the most distant tetraploid relative of Upland cotton) allele retention in 35 BC 3 F 1 plants and segregation patterns in BC 3 F 2 populations totaling 3202 individuals, using 216 DNA marker loci. The average retention of donor alleles across BC 3 F 1 plants was higher than expected and the average frequency of G. mustelinum alleles in BC 3 F 2 segregating families was less than expected. Despite surprisingly high retention of G. mustelinum alleles in BC 3 F 1 , 46 genomic regions showed no introgression. Regions on chromosomes 3 and 15 lacking introgression were closely associated with possible small inversions previously reported. Nonlinear two-locus interactions are abundant among loci with single-locus segregation distortion, and among loci originating from one of the two subgenomes. Comparison of the present results with those of prior studies indicates different permeability of Upland cotton for donor chromatin from different allotetraploid relatives. Different contributions of subgenomes to two-locus interactions suggest different fates of subgenomes in the evolution of allotetraploid cottons. Transmission genetics of G. hirsutum × G. mustelinum crosses reveals allelic interactions, constraints on fixation and selection of donor alleles, and challenges with retention of introgressed chromatin for crop improvement.

  14. Initial experiences utilizing exotic landrace germplasm in an upland cotton breeding program

    USDA-ARS?s Scientific Manuscript database

    A critical objective of plant breeding programs is accessing new sources of genetic variation. In upland cotton, one of the relatively untapped sources of genetic variation is maintained in the USDA-ARS cotton germplasm collection and is the exotic landrace collection. Photoperiod sensitivity is a m...

  15. Assessing the breeding potential of extra-long staple germplasm in an upland cotton breeding program

    USDA-ARS?s Scientific Manuscript database

    Fiber quality improvement of upland cotton (Gossypium hirsutum L.) is essential to increase the value and competitiveness of cotton fiber. The closely related allotetraploid species G. barbadense has long been targeted as a source of beneficial fiber quality alleles. Although interspecific hybridiza...

  16. 7 CFR 1427.160 - Applicability.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... (a) This subpart is applicable to the 2008 through 2012 crops of upland and extra long staple seed... for upland cotton and the national average loan rate for extra long staple cotton. (c) A producer must...) Loans shall not be available for seed cotton produced on land owned or otherwise in the possession of...

  17. Test cross evaluation of upland cotton accessions for selected fiber properties

    USDA-ARS?s Scientific Manuscript database

    Texas A&M AgriLife Research released several upland cotton (Gossypium hirsutum L.) germplasm lines that exhibit near extra-long and extra-long staple (ELS) upper half mean length (UHML) fibers, similar to those produced by pima cotton (Gossypium barbadense L.) and significantly longer than those of ...

  18. Genetic variation in salt tolerance during seed germination in a backcross inbred line population and advanced breeding lines derived from upland cotton x pima cotton

    USDA-ARS?s Scientific Manuscript database

    Seed germination is a crucial phase of the plant life cycle that affects its establishment and productivity. However, information on salt tolerance at this phase is limited. Pima cotton (Gossypium barbadense L.) may be more salt tolerant during germination than Upland cotton (G. hirsutum L.) based o...

  19. Registration of RMBUP-C4, a random mated population with Gossypium hirsutum L. alleles, introgresssed into Upland cotton germplasm

    USDA-ARS?s Scientific Manuscript database

    RMBUP-C4 (Random Mated Barbadense Upland Population Cycle 4) (Reg. No. GP_____: PI______) is a unique random mated germplasm population of Upland cotton (Gossypium hirsutum L.) which has introgression of G. barbadense L. alleles. This population involved five cycles of random mating beginning ...

  20. Comparative genomic analysis of the PKS genes in five species and expression analysis in upland cotton

    PubMed Central

    Cheng, Xi; Wang, Yanan; Abdullah, Muhammad; Li, Manli; Li, Dahui; Gao, Junshan

    2017-01-01

    Plant type III polyketide synthase (PKS) can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum) and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV). The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C) of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs) in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber. PMID:29104824

  1. Quantitative trait loci analysis for net ginning energy requirements in upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Cotton cultivars with reduced fiber-seed attachment force have the potential to be ginned faster with less energy. The objective of this study was to identify quantitative trait loci (QTL) for net ginning energy (NGE) requirement, and its relationship with other fiber quality traits in upland cotton...

  2. Genetic effects of nine Gossypium barbadense L. chromosome substitution lines in topcrosses with five elite Upland cotton G. hirsutum L. cultivars

    USDA-ARS?s Scientific Manuscript database

    Crosses between Gossypium barbadense L. and Upland (G. hirsutum L.) have produced limited success in introgressing fiber quality genes into Upland cotton. Chrosome substitution lines (CSL) have chromosomes or arms from G. barbadense, line 3-79, substituted for the corresponding chromosome or arm in ...

  3. Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents. Genomics Insights

    USDA-ARS?s Scientific Manuscript database

    High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement; high-density linkage maps are especially important in paleopolyploids with exce...

  4. [The inheritance of an ultra-dwarf plant mutant from upland cotton].

    PubMed

    Chen, Xu-Sheng; DI, Jia-Chun; Xu, Nai-Yin; Xiao, Song-Hua; Liu, Jian-Guang

    2007-04-01

    The inheritance of an ultra-dwarf plant mutant from upland cotton (Gossypium hirsutum L.) was studied, which showed that the mutant was controlled by single recessive quality gene. This gene was denominated as du tentatively. No similar mutant has been found in upland cotton. The mutation could not normally flower and produce bolls under natural conditions, and its mature height was only 10.5 cm. When treated with exogenous GA3, it could normally flower and boll, and plant height could reach 57.8 cm finally.

  5. Comparative Chloroplast Genomics of Gossypium Species: Insights Into Repeat Sequence Variations and Phylogeny

    PubMed Central

    Wu, Ying; Liu, Fang; Yang, Dai-Gang; Li, Wei; Zhou, Xiao-Jian; Pei, Xiao-Yu; Liu, Yan-Gai; He, Kun-Lun; Zhang, Wen-Sheng; Ren, Zhong-Ying; Zhou, Ke-Hai; Ma, Xiong-Feng; Li, Zhong-Hu

    2018-01-01

    Cotton is one of the most economically important fiber crop plants worldwide. The genus Gossypium contains a single allotetraploid group (AD) and eight diploid genome groups (A–G and K). However, the evolution of repeat sequences in the chloroplast genomes and the phylogenetic relationships of Gossypium species are unclear. Thus, we determined the variations in the repeat sequences and the evolutionary relationships of 40 cotton chloroplast genomes, which represented the most diverse in the genus, including five newly sequenced diploid species, i.e., G. nandewarense (C1-n), G. armourianum (D2-1), G. lobatum (D7), G. trilobum (D8), and G. schwendimanii (D11), and an important semi-wild race of upland cotton, G. hirsutum race latifolium (AD1). The genome structure, gene order, and GC content of cotton species were similar to those of other higher plant plastid genomes. In total, 2860 long sequence repeats (>10 bp in length) were identified, where the F-genome species had the largest number of repeats (G. longicalyx F1: 108) and E-genome species had the lowest (G. stocksii E1: 53). Large-scale repeat sequences possibly enrich the genetic information and maintain genome stability in cotton species. We also identified 10 divergence hotspot regions, i.e., rpl33-rps18, psbZ-trnG (GCC), rps4-trnT (UGU), trnL (UAG)-rpl32, trnE (UUC)-trnT (GGU), atpE, ndhI, rps2, ycf1, and ndhF, which could be useful molecular genetic markers for future population genetics and phylogenetic studies. Site-specific selection analysis showed that some of the coding sites of 10 chloroplast genes (atpB, atpE, rps2, rps3, petB, petD, ccsA, cemA, ycf1, and rbcL) were under protein sequence evolution. Phylogenetic analysis based on the whole plastomes suggested that the Gossypium species grouped into six previously identified genetic clades. Interestingly, all 13 D-genome species clustered into a strong monophyletic clade. Unexpectedly, the cotton species with C, G, and K-genomes were admixed and nested in a large clade, which could have been due to their recent radiation, incomplete lineage sorting, and introgression hybridization among different cotton lineages. In conclusion, the results of this study provide new insights into the evolution of repeat sequences in chloroplast genomes and interspecific relationships in the genus Gossypium. PMID:29619041

  6. Quantitative trait locus mapping of drought and salt tolerance in as introgressed recombinant inbred line population of upland cotton under the greenhouse and feild conditions

    USDA-ARS?s Scientific Manuscript database

    Drought and salt tolerances are complex traits and controlled by multiple genes, environmental factors and their interactions. Drought and salt stresses can result in more than 50% yield loss in Upland cotton (Gossypium hirsutum L.). G. barbadense L. (the source of Pima cotton) carries desirable tra...

  7. Construction of a high-density genetic map and lint percentage and cottonseed nutrient trait QTL identification in upland cotton (Gossypium hirsutum L.).

    PubMed

    Liu, Dexin; Liu, Fang; Shan, Xiaoru; Zhang, Jian; Tang, Shiyi; Fang, Xiaomei; Liu, Xueying; Wang, Wenwen; Tan, Zhaoyun; Teng, Zhonghua; Zhang, Zhengsheng; Liu, Dajun

    2015-10-01

    Upland cotton plays a critical role not only in the textile industry, but also in the production of important secondary metabolites, such as oil and proteins. Construction of a high-density linkage map and identifying yield and seed trait quantitative trail loci (QTL) are prerequisites for molecular marker-assisted selective breeding projects. Here, we update a high-density upland cotton genetic map from recombinant inbred lines. A total of 25,313 SSR primer pairs were screened for polymorphism between Yumian 1 and T586, and 1712 SSR primer pairs were used to genotype the mapping population and construct a map. An additional 1166 loci have been added to our previously published map with 509 SSR markers. The updated genetic map spans a total recombinant length of 3338.2 cM and contains 1675 SSR loci and nine morphological markers, with an average interval of 1.98 cM between adjacent markers. Green lint (Lg) mapped on chromosome 15 in a previous report is mapped in an interval of 2.6 cM on chromosome 21. Based on the map and phenotypic data from multiple environments, 79 lint percentage and seed nutrient trait QTL are detected. These include 8 lint percentage, 13 crude protein, 15 crude oil, 8 linoleic, 10 oleic, 13 palmitic, and 12 stearic acid content QTL. They explain 3.5-62.7 % of the phenotypic variation observed. Four morphological markers identified have a major impact on lint percentage and cottonseed nutrients traits. In this study, our genetic map provides new sights into the tetraploid cotton genome. Furthermore, the stable QTL and morphological markers could be used for fine-mapping and map-based cloning.

  8. High-Density Linkage Map Construction and Mapping of Salt-Tolerant QTLs at Seedling Stage in Upland Cotton Using Genotyping by Sequencing (GBS).

    PubMed

    Diouf, Latyr; Pan, Zhaoe; He, Shou-Pu; Gong, Wen-Fang; Jia, Yin Hua; Magwanga, Richard Odongo; Romy, Kimbembe Romesh Eric; Or Rashid, Harun; Kirungu, Joy Nyangasi; Du, Xiongming

    2017-12-05

    Over 6% of agricultural land is affected by salinity. It is becoming obligatory to use saline soils, so growing salt-tolerant plants is a priority. To gain an understanding of the genetic basis of upland cotton tolerance to salinity at seedling stage, an intra-specific cross was developed from CCRI35, tolerant to salinity, as female with Nan Dan (NH), sensitive to salinity, as the male. A genetic map of 5178 SNP markers was developed from 277 F 2:3 populations. The map spanned 4768.098 cM, with an average distance of 0.92 cM. A total of 66 QTLs for 10 traits related to salinity were detected in three environments (0, 110, and 150 mM salt treatment). Only 14 QTLs were consistent, accounting for 2.72% to 9.87% of phenotypic variation. Parental contributions were found to be in the ratio of 3:1, 10 QTLs from the sensitive and four QTLs from the resistant parent. Five QTLs were located in A t and nine QTLs in the D t sub-genome. Moreover, eight clusters were identified, in which 12 putative key genes were found to be related to salinity. The GBS-SNPs-based genetic map developed is the first high-density genetic map that has the potential to provide deeper insights into upland cotton salinity tolerance. The 12 key genes found in this study could be used for QTL fine mapping and cloning for further studies.

  9. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.).

    PubMed

    Zhang, Xiaohong; Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton.

  10. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  11. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...

  12. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...

  13. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...

  14. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...

  15. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...

  16. COTIP: Cotton TILLING Platform, a Resource for Plant Improvement and Reverse Genetic Studies

    PubMed Central

    Aslam, Usman; Cheema, Hafiza M. N.; Ahmad, Sheraz; Khan, Iqrar A.; Malik, Waqas; Khan, Asif A.

    2016-01-01

    Cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (Gossypium hirsutum L.) carrying both A and D genome. Since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. Mutation based improvement strategies provide an effective way of creating new allelic variations. Targeting Induced Local Lesions IN Genomes (TILLING) provides a mutation based reverse genetic strategy to create and evaluate induced genetic variability at DNA level. Here, we report development and testing of TILLING populations of allotetraploid cotton (G. hirsutum) for functional genomic studies and mutation based enrichment of cotton genetic resources. Seed of two cotton cultivars “PB-899 and PB-900” were mutagenized with 0.3 and 0.2% (v/v) ethyl methanesulfonate, respectively. The phenotyping of M1 and M2 populations presented numerous mutants regarding the branching pattern, leaf morphology, disease resistance, photosynthetic lesions and flower sterility. Molecular screening for point mutations was performed by TILLING PCR aided CEL1 mismatch cleavage. To estimate the mutation frequency in the mutant genomes, five gene classes were TILLed in 8000 M2 plants of each var. “PB-899” and “PB-900.” These include actin (GhACT), Pectin Methyl Esterase (GhPME), sucrose synthase (GhSUS), resistance gene analog, and defense response gene (DRGs). The var. PB-899 was harboring 47% higher mutation induction rate than PB-900. The highest rate of mutation frequency was identified for NAC-TF5 (EU706348) of DRGs class, ranging from 1/58 kb in PB-899 to 1/105 kb in PB-900. The mutation screening assay revealed the presence of significant proportion of induced mutations in cotton TILLING populations such as 1/153 kb and 1/326 kb in var. “PB-899” and “PB-900,” respectively. The establishment of a cotton TILLING platform (COTIP) and data obtained from the resource TILLING population suggest its effectiveness in widening the genetic bases of cotton for improvement and utilizing it for subsequent reverse genetic studies of various genes. PMID:28082993

  17. Characterization of the late embryogenesis abundant (LEA) proteins family and their role in drought stress tolerance in upland cotton.

    PubMed

    Magwanga, Richard Odongo; Lu, Pu; Kirungu, Joy Nyangasi; Lu, Hejun; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Zhang, Zhenmei; Salih, Haron; Wang, Kunbo; Liu, Fang

    2018-01-15

    Late embryogenesis abundant (LEA) proteins are large groups of hydrophilic proteins with major role in drought and other abiotic stresses tolerance in plants. In-depth study and characterization of LEA protein families have been carried out in other plants, but not in upland cotton. The main aim of this research work was to characterize the late embryogenesis abundant (LEA) protein families and to carry out gene expression analysis to determine their potential role in drought stress tolerance in upland cotton. Increased cotton production in the face of declining precipitation and availability of fresh water for agriculture use is the focus for breeders, cotton being the backbone of textile industries and a cash crop for many countries globally. In this work, a total of 242, 136 and 142 LEA genes were identified in G. hirsutum, G. arboreum and G. raimondii respectively. The identified genes were classified into eight groups based on their conserved domain and phylogenetic tree analysis. LEA 2 were the most abundant, this could be attributed to their hydrophobic character. Upland cotton LEA genes have fewer introns and are distributed in all chromosomes. Majority of the duplicated LEA genes were segmental. Syntenic analysis showed that greater percentages of LEA genes are conserved. Segmental gene duplication played a key role in the expansion of LEA genes. Sixty three miRNAs were found to target 89 genes, such as miR164, ghr-miR394 among others. Gene ontology analysis revealed that LEA genes are involved in desiccation and defense responses. Almost all the LEA genes in their promoters contained ABRE, MBS, W-Box and TAC-elements, functionally known to be involved in drought stress and other stress responses. Majority of the LEA genes were involved in secretory pathways. Expression profile analysis indicated that most of the LEA genes were highly expressed in drought tolerant cultivars Gossypium tomentosum as opposed to drought susceptible, G. hirsutum. The tolerant genotypes have a greater ability to modulate genes under drought stress than the more susceptible upland cotton cultivars. The finding provides comprehensive information on LEA genes in upland cotton, G. hirsutum and possible function in plants under drought stress.

  18. Interspecific chromosome substitution lines from Gossypium barbadense and G. tomentosum in Upland cotton improvement

    USDA-ARS?s Scientific Manuscript database

    The merit of interspecific germplasm introgression has been well appreciated in many crop species, but it has not been exploited well in Upland cotton improvement. Wide-cross introgression typically requires considerable time and effort to circumvent and overcome biological, genetic, and cytogenetic...

  19. Breeding Potential of Introgression Lines Developed from Interspecific Crossing between Upland Cotton (Gossypium hirsutum) and Gossypium barbadense: Heterosis, Combining Ability and Genetic Effects

    PubMed Central

    Li, Xingli; Pei, Wenfeng

    2016-01-01

    Upland cotton (Gossypium hirstum L.), which produces more than 95% of the world natural cotton fibers, has a narrow genetic base which hinders progress in cotton breeding. Introducing germplasm from exotic sources especially from another cultivated tetraploid G. barbadense L. can broaden the genetic base of Upland cotton. However, the breeding potential of introgression lines (ILs) in Upland cotton with G. barbadense germplasm integration has not been well addressed. This study involved six ILs developed from an interspecific crossing and backcrossing between Upland cotton and G. barbadense and represented one of the first studies to investigate breeding potentials of a set of ILs using a full diallel analysis. High mid-parent heterosis was detected in several hybrids between ILs and a commercial cultivar, which also out-yielded the high-yielding cultivar parent in F1, F2 and F3 generations. A further analysis indicated that general ability (GCA) variance was predominant for all the traits, while specific combining ability (SCA) variance was either non-existent or much lower than GCA. The estimated GCA effects and predicted additive effects for parents in each trait were positively correlated (at P<0.01). Furthermore, GCA and additive effects for each trait were also positively correlated among generations (at P<0.05), suggesting that F2 and F3 generations can be used as a proxy to F1 in analyzing combining abilities and estimating genetic parameters. In addition, differences between reciprocal crosses in F1 and F2 were not significant for yield, yield components and fiber quality traits. But maternal effects appeared to be present for seed oil and protein contents in F3. This study identified introgression lines as good general combiners for yield and fiber quality improvement and hybrids with high heterotic vigor in yield, and therefore provided useful information for further utilization of introgression lines in cotton breeding. PMID:26730964

  20. Breeding Potential of Introgression Lines Developed from Interspecific Crossing between Upland Cotton (Gossypium hirsutum) and Gossypium barbadense: Heterosis, Combining Ability and Genetic Effects.

    PubMed

    Zhang, Jinfa; Wu, Man; Yu, Jiwen; Li, Xingli; Pei, Wenfeng

    2016-01-01

    Upland cotton (Gossypium hirstum L.), which produces more than 95% of the world natural cotton fibers, has a narrow genetic base which hinders progress in cotton breeding. Introducing germplasm from exotic sources especially from another cultivated tetraploid G. barbadense L. can broaden the genetic base of Upland cotton. However, the breeding potential of introgression lines (ILs) in Upland cotton with G. barbadense germplasm integration has not been well addressed. This study involved six ILs developed from an interspecific crossing and backcrossing between Upland cotton and G. barbadense and represented one of the first studies to investigate breeding potentials of a set of ILs using a full diallel analysis. High mid-parent heterosis was detected in several hybrids between ILs and a commercial cultivar, which also out-yielded the high-yielding cultivar parent in F1, F2 and F3 generations. A further analysis indicated that general ability (GCA) variance was predominant for all the traits, while specific combining ability (SCA) variance was either non-existent or much lower than GCA. The estimated GCA effects and predicted additive effects for parents in each trait were positively correlated (at P<0.01). Furthermore, GCA and additive effects for each trait were also positively correlated among generations (at P<0.05), suggesting that F2 and F3 generations can be used as a proxy to F1 in analyzing combining abilities and estimating genetic parameters. In addition, differences between reciprocal crosses in F1 and F2 were not significant for yield, yield components and fiber quality traits. But maternal effects appeared to be present for seed oil and protein contents in F3. This study identified introgression lines as good general combiners for yield and fiber quality improvement and hybrids with high heterotic vigor in yield, and therefore provided useful information for further utilization of introgression lines in cotton breeding.

  1. 77 FR 20503 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ...-AD19 Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade AGENCY... amending the procedures for determining the official leaf grade for Upland and Pima cotton. The leaf grade is a part of the official classification which denotes cotton fiber quality used in cotton marketing...

  2. 75 FR 24373 - Cotton Research and Promotion Program: Designation of Cotton-Producing States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... 0581-AC84 Cotton Research and Promotion Program: Designation of Cotton- Producing States AGENCY... amending the Cotton Research and Promotion Order (Cotton Order) following a referendum held October 13 through November 10, 2009, in which Upland cotton producers and importers favored the adoption of two...

  3. Correlated selection response of fiber properties measured by high volume instrument and advanced fiber information system in Upland cotton

    USDA-ARS?s Scientific Manuscript database

    Fiber properties measured by high volume instrument (HVI) and advanced fiber information system (AFIS) are currently being used in Upland cotton (Gossypium hirsutum L.) breeding. It would be interesting to know if selections for parameters measured by the two instrumental systems are equally effici...

  4. Breeding implications of boll distribution responses to water stress deficits in Upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    To identify the impact of different water stress deficits on the boll distribution of elite Upland cotton (Gossypium hirsutum L.) cultivars in the Texas High Plains, cultivars which represent the diverse gene-pools of the private sector were subjected to three different water deficit regimes. This s...

  5. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...

  6. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...

  7. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...

  8. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...

  9. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...

  10. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...

  11. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...

  12. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...

  13. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...

  14. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...

  15. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...

  16. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...

  17. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...

  18. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...

  19. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...

  20. 7 CFR 1488.2 - Definition of terms.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    .... Cotton Standards Act (7 CFR 28.40), by-products of cotton such as cotton mill waste, motes, and linters..., including eligible cotton, produced in the United States and designated as eligible for export under CCC's... cotton means Upland and Extra Long staple cotton grown in the United States: Provided, however, That...

  1. 7 CFR 1488.2 - Definition of terms.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    .... Cotton Standards Act (7 CFR 28.40), by-products of cotton such as cotton mill waste, motes, and linters..., including eligible cotton, produced in the United States and designated as eligible for export under CCC's... cotton means Upland and Extra Long staple cotton grown in the United States: Provided, however, That...

  2. 7 CFR 1488.2 - Definition of terms.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    .... Cotton Standards Act (7 CFR 28.40), by-products of cotton such as cotton mill waste, motes, and linters..., including eligible cotton, produced in the United States and designated as eligible for export under CCC's... cotton means Upland and Extra Long staple cotton grown in the United States: Provided, however, That...

  3. 7 CFR 1488.2 - Definition of terms.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    .... Cotton Standards Act (7 CFR 28.40), by-products of cotton such as cotton mill waste, motes, and linters..., including eligible cotton, produced in the United States and designated as eligible for export under CCC's... cotton means Upland and Extra Long staple cotton grown in the United States: Provided, however, That...

  4. 7 CFR 1488.2 - Definition of terms.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Cotton Standards Act (7 CFR 28.40), by-products of cotton such as cotton mill waste, motes, and linters..., including eligible cotton, produced in the United States and designated as eligible for export under CCC's... cotton means Upland and Extra Long staple cotton grown in the United States: Provided, however, That...

  5. Fine mapping and identification of candidate genes for a QTL affecting Meloidogyne incognita reproduction in Upland cotton

    USDA-ARS?s Scientific Manuscript database

    The resistant line Auburn 623RNR and a number of elite breeding lines derived from it remain the most important source of root-knot nematode (RKN) resistance because they exhibit the highest level of resistance to RKN known to date in Upland cotton (Gossypium hirsutum L). Prior genetic mapping analy...

  6. Overexpression of MIC-3 indicates a direct role for the MIC gene family in mediating Upland cotton (Gossypium hirsutum) resistance to root-knot nematode (Meloidogyne incognita).

    PubMed

    Wubben, Martin J; Callahan, Franklin E; Velten, Jeff; Burke, John J; Jenkins, Johnie N

    2015-02-01

    Transgene-based analysis of the MIC-3 gene provides the first report of a cotton gene having a direct role in mediating cotton resistance to root-knot nematode. Major quantitative trait loci have been mapped to Upland cotton (Gossypium hirsutum L.) chromosomes 11 and 14 that govern the highly resistant phenotype in response to infection by root-knot nematode (RKN; Meloidogyne incognita); however, nearly nothing is known regarding the underlying molecular determinants of this RKN-resistant phenotype. Multiple lines of circumstantial evidence have strongly suggested that the MIC (Meloidogyne Induced Cotton) gene family plays an integral role in mediating cotton resistance to RKN. In this report, we demonstrate that overexpression of MIC-3 in the RKN-susceptible genetic background Coker 312 reduces RKN egg production by ca. 60-75 % compared to non-transgenic controls and transgene-null sibling lines. MIC-3 transcript and protein overexpression were confirmed in root tissues of multiple independent transgenic lines with each line showing a similar level of increased resistance to RKN. In contrast to RKN fecundity, transgenic lines showed RKN-induced root galling similar to the susceptible controls. In addition, we determined that this effect of MIC-3 overexpression was specific to RKN as no effect was observed on reniform nematode (Rotylenchulus reniformis) reproduction. Transgenic lines did not show obvious alterations in growth, morphology, flowering, or fiber quality traits. Gene expression analyses showed that MIC-3 transcript levels in uninfected transgenic roots exceeded levels observed in RKN-infected roots of naturally resistant plants and that overexpression did not alter the regulation of native MIC genes in the genome. These results are the first report describing a direct role for a specific gene family in mediating cotton resistance to a plant-parasitic nematode.

  7. High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.).

    PubMed

    Li, Libei; Zhao, Shuqi; Su, Junji; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Gu, Lijiao; Zhang, Chi; Liu, Guoyuan; Yu, Dingwei; Liu, Qibao; Zhang, Xianlong; Yu, Shuxun

    2017-01-01

    Due to China's rapidly increasing population, the total arable land area has dramatically decreased; as a consequence, the competition for farming land allocated for grain and cotton production has become fierce. Therefore, to overcome the existing contradiction between cotton grain and fiber production and the limited farming land, development of early-maturing cultivars is necessary. In this research, a high-density linkage map of upland cotton was constructed using genotyping by sequencing (GBS) to discover single nucleotide polymorphism (SNP) markers associated with early maturity in 170 F2 individuals derived from a cross between LU28 and ZHONG213. The high-density genetic map, which was composed of 3978 SNP markers across the 26 cotton chromosomes, spanned 2480 cM with an average genetic distance of 0.62 cM. Collinearity analysis showed that the genetic map was of high quality and accurate and agreed well with the Gossypium hirsutum reference genome. Based on this high-density linkage map, QTL analysis was performed on cotton early-maturity traits, including FT, FBP, WGP, NFFB, HNFFB and PH. A total 47 QTLs for the six traits were detected; each of these QTLs explained between 2.61% and 32.57% of the observed phenotypic variation. A major region controlling early-maturity traits in Gossypium hirsutum was identified for FT, FBP, WGP, NFFB and HNFFB on chromosome D03. QTL analyses revealed that phenotypic variation explained (PVE) ranged from 10.42% to 32.57%. Two potential candidate genes, Gh_D03G0885 and Gh_D03G0922, were predicted in a stable QTL region and had higher expression levels in the early-maturity variety ZHONG213 than in the late-maturity variety LU28. However, further evidence is required for functional validation. This study could provide useful information for the dissection of early-maturity traits and guide valuable genetic loci for molecular-assisted selection (MAS) in cotton breeding.

  8. High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.)

    PubMed Central

    Li, Libei; Zhao, Shuqi; Su, Junji; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Gu, Lijiao; Zhang, Chi; Liu, Guoyuan; Yu, Dingwei; Liu, Qibao; Zhang, Xianlong

    2017-01-01

    Due to China’s rapidly increasing population, the total arable land area has dramatically decreased; as a consequence, the competition for farming land allocated for grain and cotton production has become fierce. Therefore, to overcome the existing contradiction between cotton grain and fiber production and the limited farming land, development of early-maturing cultivars is necessary. In this research, a high-density linkage map of upland cotton was constructed using genotyping by sequencing (GBS) to discover single nucleotide polymorphism (SNP) markers associated with early maturity in 170 F2 individuals derived from a cross between LU28 and ZHONG213. The high-density genetic map, which was composed of 3978 SNP markers across the 26 cotton chromosomes, spanned 2480 cM with an average genetic distance of 0.62 cM. Collinearity analysis showed that the genetic map was of high quality and accurate and agreed well with the Gossypium hirsutum reference genome. Based on this high-density linkage map, QTL analysis was performed on cotton early-maturity traits, including FT, FBP, WGP, NFFB, HNFFB and PH. A total 47 QTLs for the six traits were detected; each of these QTLs explained between 2.61% and 32.57% of the observed phenotypic variation. A major region controlling early-maturity traits in Gossypium hirsutum was identified for FT, FBP, WGP, NFFB and HNFFB on chromosome D03. QTL analyses revealed that phenotypic variation explained (PVE) ranged from 10.42% to 32.57%. Two potential candidate genes, Gh_D03G0885 and Gh_D03G0922, were predicted in a stable QTL region and had higher expression levels in the early-maturity variety ZHONG213 than in the late-maturity variety LU28. However, further evidence is required for functional validation. This study could provide useful information for the dissection of early-maturity traits and guide valuable genetic loci for molecular-assisted selection (MAS) in cotton breeding. PMID:28809947

  9. Pollen genotyping in cotton for genetic linkage analysis

    USDA-ARS?s Scientific Manuscript database

    Cotton is an important fiber and oil crop and thus makes very important contributions to US agricultural security and sustainable agriculture. Two species are vital for American cotton industry, i.e., Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) that are prized for high yields...

  10. Comparative transcriptome analysis of cotton fiber development of Upland cotton (Gossypium hirsutum) and Chromosome Segment Substitution Lines from G. hirsutum × G. barbadense.

    PubMed

    Li, Peng-Tao; Wang, Mi; Lu, Quan-Wei; Ge, Qun; Rashid, Md Harun Or; Liu, Ai-Ying; Gong, Ju-Wu; Shang, Hai-Hong; Gong, Wan-Kui; Li, Jun-Wen; Song, Wei-Wu; Guo, Li-Xue; Su, Wei; Li, Shao-Qi; Guo, Xiao-Ping; Shi, Yu-Zhen; Yuan, You-Lu

    2017-09-08

    How to develop new cotton varieties possessing high yield traits of Upland cotton and superior fiber quality traits of Sea Island cotton remains a key task for cotton breeders and researchers. While multiple attempts bring in little significant progresses, the development of Chromosome Segment Substitution Lines (CSSLs) from Gossypium barbadense in G. hirsutum background provided ideal materials for aforementioned breeding purposes in upland cotton improvement. Based on the excellent fiber performance and relatively clear chromosome substitution segments information identified by Simple Sequence Repeat (SSR) markers, two CSSLs, MBI9915 and MBI9749, together with the recurrent parent CCRI36 were chosen to conduct transcriptome sequencing during the development stages of fiber elongation and Secondary Cell Wall (SCW) synthesis (from 10DPA and 28DPA), aiming at revealing the mechanism of fiber development and the potential contribution of chromosome substitution segments from Sea Island cotton to fiber development of Upland cotton. In total, 15 RNA-seq libraries were constructed and sequenced separately, generating 705.433 million clean reads with mean GC content of 45.13% and average Q30 of 90.26%. Through multiple comparisons between libraries, 1801 differentially expressed genes (DEGs) were identified, of which the 902 up-regulated DEGs were mainly involved in cell wall organization and response to oxidative stress and auxin, while the 898 down-regulated ones participated in translation, regulation of transcription, DNA-templated and cytoplasmic translation based on GO annotation and KEGG enrichment analysis. Subsequently, STEM software was performed to explicate the temporal expression pattern of DEGs. Two peroxidases and four flavonoid pathway-related genes were identified in the "oxidation-reduction process", which could play a role in fiber development and quality formation. Finally, the reliability of RNA-seq data was validated by quantitative real-time PCR of randomly selected 20 genes. The present report focuses on the similarities and differences of transcriptome profiles between the two CSSLs and the recurrent parent CCRI36 and provides novel insights into the molecular mechanism of fiber development, and into further exploration of the feasible contribution of G. barbadense substitution segments to fiber quality formation, which will lay solid foundation for simultaneously improving fiber yield and quality of upland cotton through CSSLs.

  11. The Elusive Search for Reniform Nematode Resistance in Cotton.

    PubMed

    Khanal, Churamani; McGawley, Edward C; Overstreet, Charles; Stetina, Salliana R

    2018-05-01

    The reniform nematode (Rotylenchulus reniformis Linford and Oliveira) has emerged as the most important plant-parasitic nematode of cotton in the United States cotton belt. Success in the development of reniform nematode-resistant upland cotton cultivars (Gossypium hirsutum L.) has not been realized despite over three decades of breeding efforts. Research approaches ranging from conventional breeding to triple species hybrids to marker-assisted selection have been employed to introgress reniform nematode resistance from other species of cotton into upland cultivars. Reniform nematode-resistant breeding lines derived from G. longicalyx were developed in 2007. However, these breeding lines displayed stunting symptoms and a hypersensitive response to reniform nematode infection. Subsequent breeding efforts focused on G. barbadense, G. aridum, G. armoreanum, and other species that have a high level of resistance to reniform nematode. Marker-assisted selection has greatly improved screening of reniform nematode-resistant lines. The use of advanced molecular techniques such as CRISPER-Cas9 systems and alternative ways such as delivery of suitable "cry" proteins and specific double-stranded RNA to nematodes will assist in developing resistant cultivars of cotton. In spite of the efforts of cotton breeders and nematologists, successes are limited only to the development of reniform nematode-resistant breeding lines. In this article, we provide an overview of the approaches employed to develop reniform nematode-resistant upland cotton cultivars in the past, progress to date, major obstacles, and some promising future research activity.

  12. 78 FR 47214 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-05

    ... Long Staple Cotton Crop Provisions AGENCY: Federal Crop Insurance Corporation, USDA. ACTION: Proposed... Insurance Regulations, Extra Long Staple (ELS) Cotton Crop Insurance Provisions to make the ELS Cotton Crop Insurance Provisions consistent with the Upland Cotton Crop Insurance Provisions and to allow a late...

  13. Individual and combined contributions of the Renbarb1, Renbarb2, and Renbarb3 quantitative trait loci to reniform nematode (Rotylenchulus reniformis Linford & Oliveira) resistance in Upland Cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    The infection of Upland cotton (Gossypium hirsutum L.) by the root parasite Rotylenchulus reniformis (Linford & Oliveira), the reniform nematode, results in massive annual yield losses throughout the southeastern United States and portions of Texas. Resistance to reniform nematode was identified in...

  14. Functional characterization of GhSOC1 and GhMADS42 homologs from upland cotton (Gossypium hirsutum L.).

    PubMed

    Zhang, Xiaohong; Wei, Jianghui; Fan, Shuli; Song, Meizhen; Pang, Chaoyou; Wei, Hengling; Wang, Chengshe; Yu, Shuxun

    2016-01-01

    In Arabidopsis flowering pathway, MADS-box genes encode transcription factors, with their structures and functions highly conserved in many species. In our study, two MADS-box genes GhSOC1 and GhMADS42 (Gossypium hirsutum L.) were cloned from upland cotton CCRI36 and transformed into Arabidopsis. GhSOC1 was additionally transformed into upland cotton. Comparative analysis demonstrated sequence conservation between GhSOC1 and GhMADS42 and genes of other plant species. Tissue-specific expression analysis of GhSOC1 and GhMADS42 revealed spatiotemporal expression patterns involving high transcript levels in leaves, shoot apical buds, and flowers. In addition, overexpression of both GhSOC1 and GhMADS42 in Arabidopsis accelerated flowering, with GhMADS42 transgenic plants showing abnormal floral organ phenotypes. Overexpression of GhSOC1 in upland cotton also produced variations in floral organs. Furthermore, chromatin immunoprecipitation assay demonstrated that GhSOC1 could regulate GhMADS41 and GhMADS42, but not FLOWERING LOCUS T, by directly binding to the genes promoter. Finally, yeast two-hybrid and bimolecular fluorescence complementation approaches were undertaken to better understand the interaction of GhSOC1 and other MADS-box factors. These experiments showed that GhSOC1 can interact with APETALA1/FRUITFULL-like proteins in cotton. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Transcriptome Analysis Suggests That Chromosome Introgression Fragments from Sea Island Cotton (Gossypium barbadense) Increase Fiber Strength in Upland Cotton (Gossypium hirsutum).

    PubMed

    Lu, Quanwei; Shi, Yuzhen; Xiao, Xianghui; Li, Pengtao; Gong, Juwu; Gong, Wankui; Liu, Aiying; Shang, Haihong; Li, Junwen; Ge, Qun; Song, Weiwu; Li, Shaoqi; Zhang, Zhen; Rashid, Md Harun Or; Peng, Renhai; Yuan, Youlu; Huang, Jinling

    2017-10-05

    As high-strength cotton fibers are critical components of high quality cotton, developing cotton cultivars with high-strength fibers as well as high yield is a top priority for cotton development. Recently, chromosome segment substitution lines (CSSLs) have been developed from high-yield Upland cotton ( Gossypium hirsutum ) crossed with high-quality Sea Island cotton ( G. barbadense ). Here, we constructed a CSSL population by crossing CCRI45, a high-yield Upland cotton cultivar, with Hai1, a Sea Island cotton cultivar with superior fiber quality. We then selected two CSSLs with significantly higher fiber strength than CCRI45 (MBI7747 and MBI7561), and one CSSL with lower fiber strength than CCRI45 (MBI7285), for further analysis. We sequenced all four transcriptomes at four different time points postanthesis, and clustered the 44,678 identified genes by function. We identified 2200 common differentially-expressed genes (DEGs): those that were found in both high quality CSSLs (MBI7747 and MBI7561), but not in the low quality CSSL (MBI7285). Many of these genes were associated with various metabolic pathways that affect fiber strength. Upregulated DEGs were associated with polysaccharide metabolic regulation, single-organism localization, cell wall organization, and biogenesis, while the downregulated DEGs were associated with microtubule regulation, the cellular response to stress, and the cell cycle. Further analyses indicated that three genes, XLOC_036333 [mannosyl-oligosaccharide-α-mannosidase ( MNS1 )], XLOC_029945 ( FLA8 ), and XLOC_075372 ( snakin-1 ), were potentially important for the regulation of cotton fiber strength. Our results suggest that these genes may be good candidates for future investigation of the molecular mechanisms of fiber strength formation and for the improvement of cotton fiber quality through molecular breeding. Copyright © 2017 Lu et al.

  16. The elusive search for reniform nematode resistance in cotton

    USDA-ARS?s Scientific Manuscript database

    The reniform nematode (Rotylenchulus reniformis Linford and Oliveira) has emerged as the most important plant parasitic nematode of cotton in the US cotton belt. Success in the development of reniform nematode resistant upland cotton cultivars (Gossypium hirsutum L.) has not been realized despite ov...

  17. 78 FR 70485 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-26

    ...-0002] RIN 0563-AC41 Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions AGENCY... Cotton Crop Insurance Provisions to make the Extra Long Staple (ELS) Cotton Crop Insurance Provisions consistent with the Upland Cotton Crop Insurance Provisions and to allow a late planting period. The intended...

  18. CMD: a Cotton Microsatellite Database resource for Gossypium genomics

    PubMed Central

    Blenda, Anna; Scheffler, Jodi; Scheffler, Brian; Palmer, Michael; Lacape, Jean-Marc; Yu, John Z; Jesudurai, Christopher; Jung, Sook; Muthukumar, Sriram; Yellambalase, Preetham; Ficklin, Stephen; Staton, Margaret; Eshelman, Robert; Ulloa, Mauricio; Saha, Sukumar; Burr, Ben; Liu, Shaolin; Zhang, Tianzhen; Fang, Deqiu; Pepper, Alan; Kumpatla, Siva; Jacobs, John; Tomkins, Jeff; Cantrell, Roy; Main, Dorrie

    2006-01-01

    Background The Cotton Microsatellite Database (CMD) is a curated and integrated web-based relational database providing centralized access to publicly available cotton microsatellites, an invaluable resource for basic and applied research in cotton breeding. Description At present CMD contains publication, sequence, primer, mapping and homology data for nine major cotton microsatellite projects, collectively representing 5,484 microsatellites. In addition, CMD displays data for three of the microsatellite projects that have been screened against a panel of core germplasm. The standardized panel consists of 12 diverse genotypes including genetic standards, mapping parents, BAC donors, subgenome representatives, unique breeding lines, exotic introgression sources, and contemporary Upland cottons with significant acreage. A suite of online microsatellite data mining tools are accessible at CMD. These include an SSR server which identifies microsatellites, primers, open reading frames, and GC-content of uploaded sequences; BLAST and FASTA servers providing sequence similarity searches against the existing cotton SSR sequences and primers, a CAP3 server to assemble EST sequences into longer transcripts prior to mining for SSRs, and CMap, a viewer for comparing cotton SSR maps. Conclusion The collection of publicly available cotton SSR markers in a centralized, readily accessible and curated web-enabled database provides a more efficient utilization of microsatellite resources and will help accelerate basic and applied research in molecular breeding and genetic mapping in Gossypium spp. PMID:16737546

  19. Trash particle distribution measurements in ginned cotton

    USDA-ARS?s Scientific Manuscript database

    A beltwide commercial cotton gin sampling project was initiated for the 2005-06 and 2006-07 ginning seasons to assess the changes in upland cotton quality during the ginning process and throughout the ginning season. The Cotton Trash Identification System (CTIS) developed at the USDA-ARS Southwester...

  20. 7 CFR 28.303 - Standards for length of staple for American upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... cotton. 28.303 Section 28.303 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... STANDARDS AND STANDARD CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for Length of Staple § 28.303 Standards for length of staple for...

  1. 7 CFR 28.303 - Standards for length of staple for American upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... cotton. 28.303 Section 28.303 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... STANDARDS AND STANDARD CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for Length of Staple § 28.303 Standards for length of staple for...

  2. 7 CFR 28.303 - Standards for length of staple for American upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... cotton. 28.303 Section 28.303 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... STANDARDS AND STANDARD CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for Length of Staple § 28.303 Standards for length of staple for...

  3. 7 CFR 28.303 - Standards for length of staple for American upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... cotton. 28.303 Section 28.303 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... STANDARDS AND STANDARD CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for Length of Staple § 28.303 Standards for length of staple for...

  4. 7 CFR 28.303 - Standards for length of staple for American upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... cotton. 28.303 Section 28.303 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... STANDARDS AND STANDARD CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for Length of Staple § 28.303 Standards for length of staple for...

  5. Registration of five upland cotton mutant germplasm lines with superior fiber length, strength, and uniformity

    USDA-ARS?s Scientific Manuscript database

    Mutant germplasm lines MD 15-Mut 13 (Reg. No. GP-1025, PI 681706), MD 15-Mut 31 (Reg. No. GP-1026, PI 681707), MD 15-Mut 61 (Reg. No. GP-1027, PI 681708), MD 15-Mut 89 (Reg. No. GP-1028, PI 681709), and MD 15-Mut 138 (Reg. No. GP-1029, PI 681710) are unique genotypes of upland cotton (Gossypium hirs...

  6. Evaluations of Fusarium wilt resistance in Upland cotton from Uzbek cotton germplasm resources.

    USDA-ARS?s Scientific Manuscript database

    Fusarium oxysporum f. sp. vasinfectum Atk. Sny & Hans (FOV), in combination with Verticillium dahliae Kleb, causes a wilt disease complex in cotton that significantly reduces yield. A highly virulent strain of FOV, No. 316, was isolated that caused up to 80% plant death in commercial cotton in Uzbe...

  7. Genetic diversity analysis of Gossypium arboreum germplasm accessions using genotyping-by-sequencing.

    PubMed

    Li, Ruijuan; Erpelding, John E

    2016-10-01

    The diploid cotton species Gossypium arboreum possesses many favorable agronomic traits such as drought tolerance and disease resistance, which can be utilized in the development of improved upland cotton cultivars. The USDA National Plant Germplasm System maintains more than 1600 G. arboreum accessions. Little information is available on the genetic diversity of the collection thereby limiting the utilization of this cotton species. The genetic diversity and population structure of the G. arboreum germplasm collection were assessed by genotyping-by-sequencing of 375 accessions. Using genome-wide single nucleotide polymorphism sequence data, two major clusters were inferred with 302 accessions in Cluster 1, 64 accessions in Cluster 2, and nine accessions unassigned due to their nearly equal membership to each cluster. These two clusters were further evaluated independently resulting in the identification of two sub-clusters for the 302 Cluster 1 accessions and three sub-clusters for the 64 Cluster 2 accessions. Low to moderate genetic diversity between clusters and sub-clusters were observed indicating a narrow genetic base. Cluster 2 accessions were more genetically diverse and the majority of the accessions in this cluster were landraces. In contrast, Cluster 1 is composed of varieties or breeding lines more recently added to the collection. The majority of the accessions had kinship values ranging from 0.6 to 0.8. Eight pairs of accessions were identified as potential redundancies due to their high kinship relatedness. The genetic diversity and genotype data from this study are essential to enhance germplasm utilization to identify genetically diverse accessions for the detection of quantitative trait loci associated with important traits that would benefit upland cotton improvement.

  8. Phosphorus forms in Alabama decatur silt loam with upland cotton production

    USDA-ARS?s Scientific Manuscript database

    Alabama was historically known as "The Cotton State." It ranks 4th with 10.1% of U.S. cotton production. We assessed the forms and labile P in the Alabama Decatur silt loam cotton soils, and evaluated the impact of management practices on the soil P forms. We observed that manure and inorganic ferti...

  9. Correlations and path analysis among agronomic and technological traits of upland cotton.

    PubMed

    Farias, F J C; Carvalho, L P; Silva Filho, J L; Teodoro, P E

    2016-08-12

    To date, path analysis has been used with the aim of breeding different cultures. However, for cotton, there have been few studies using this analysis, and all of these have used fiber productivity as the primary dependent variable. Therefore, the aim of the present study was to identify agronomic and technological properties that can be used as criteria for direct and indirect phenotypes in selecting cotton genotypes with better fibers. We evaluated 16 upland cotton genotypes in eight trials conducted during the harvest 2008/2009 in the State of Mato Grosso, using a randomized block design with four replicates. The evaluated traits were: plant height, average boll weight, percentage of fiber, cotton seed yield, fiber length, uniformity of fiber, short fiber index, fiber strength, elongation, maturity of the fibers, micronaire, reflectance, and the degree of yellowing. Phenotypic correlations between the traits and cotton fiber yield (main dependent variable) were unfolded in direct and indirect effects through path analysis. Fiber strength, uniformity of fiber, and reflectance were found to influence fiber length, and therefore, these traits are recommended for both direct and indirect selection of cotton genotypes.

  10. 7 CFR 1427.105 - Payment.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... samples or reginned motes, but not semi-processed motes, the net weight of the cotton used (gross weight... AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.105 Payment. (a) Payments specified in this subpart will be determined by multiplying the...

  11. 7 CFR 1427.105 - Payment.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... samples or reginned motes, but not semi-processed motes, the net weight of the cotton used (gross weight... AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.105 Payment. (a) Payments specified in this subpart will be determined by multiplying the...

  12. 7 CFR 1427.105 - Payment.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... samples or reginned motes, but not semi-processed motes, the net weight of the cotton used (gross weight... AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.105 Payment. (a) Payments specified in this subpart will be determined by multiplying the...

  13. 7 CFR 1427.105 - Payment.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... samples or reginned motes, but not semi-processed motes, the net weight of the cotton used (gross weight... AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.105 Payment. (a) Payments specified in this subpart will be determined by multiplying the...

  14. New DNA Markers for the Use in Cotton (Gossypium spp.) Improvement

    USDA-ARS?s Scientific Manuscript database

    SSR markers, also known as DNA microsatellite markers, are proving to be very useful for saturation of the large and complex upland cotton (Gossypium hirsutum genetic linkage map. Monsanto Company has invested heavily in development of cotton SSRs and has implemented molecular breeding technologies ...

  15. Survey of thrips species infesting cotton across the southern U.S. cotton belt

    USDA-ARS?s Scientific Manuscript database

    A survey investigating the composition of adult thrips species and the effect of preventive, at-plant insecticides on this composition was conducted at multiple locations across the upland U.S. Cotton Belt in 2009 and 2010. Small-plot experiments included insecticide seed treatments containing imid...

  16. 7 CFR 28.2 - Terms defined.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... convenience the word “cotton” is used to signify vegetable hair removed from cottonseed in the usual process... including the growths sometimes referred to as Upland, Gulf, and Texas cotton, but excluding American Pima growths. (p) Official Cotton Standards. Official Cotton Standards of the United States for the color grade...

  17. 7 CFR 28.2 - Terms defined.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... convenience the word “cotton” is used to signify vegetable hair removed from cottonseed in the usual process... including the growths sometimes referred to as Upland, Gulf, and Texas cotton, but excluding American Pima growths. (p) Official Cotton Standards. Official Cotton Standards of the United States for the color grade...

  18. 7 CFR 28.2 - Terms defined.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... convenience the word “cotton” is used to signify vegetable hair removed from cottonseed in the usual process... including the growths sometimes referred to as Upland, Gulf, and Texas cotton, but excluding American Pima growths. (p) Official Cotton Standards. Official Cotton Standards of the United States for the color grade...

  19. 7 CFR 28.2 - Terms defined.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... convenience the word “cotton” is used to signify vegetable hair removed from cottonseed in the usual process... including the growths sometimes referred to as Upland, Gulf, and Texas cotton, but excluding American Pima growths. (p) Official Cotton Standards. Official Cotton Standards of the United States for the color grade...

  20. 7 CFR 28.2 - Terms defined.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... convenience the word “cotton” is used to signify vegetable hair removed from cottonseed in the usual process... including the growths sometimes referred to as Upland, Gulf, and Texas cotton, but excluding American Pima growths. (p) Official Cotton Standards. Official Cotton Standards of the United States for the color grade...

  1. Meloidogyne incognita emigration from cotton roots may be induced by the resistance QTL qMi-C11

    USDA-ARS?s Scientific Manuscript database

    Upland cotton (Gossypium hirsutum) is one of the most widely grown crops in the southern US, and Meloidogyne incognita is the most significant pathogen of cotton in the US. Two QTLs, qMi-C11 and qMi-C14, conferring resistance to M. incognita have been identified in cotton. Previous research docume...

  2. The Complete Mitochondrial Genome of Gossypium hirsutum and Evolutionary Analysis of Higher Plant Mitochondrial Genomes

    PubMed Central

    Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping

    2013-01-01

    Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520

  3. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    PubMed

    Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

    2013-01-01

    Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  4. 7 CFR 1427.1 - Applicability.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... of upland cotton and extra long staple cotton. Rules codified in this part which are issued after... land owned or otherwise in the possession of the United States if such land is occupied without the...

  5. Enrichment of chromosome 17 specific molecular markers of Pima cotton substituted in Upland cotton lines

    USDA-ARS?s Scientific Manuscript database

    Cotton is the primary source of non-synthetic textile fiber, as well as an important source of food, feed, fuel and other products. In the USA cotton is a major crop in 13 states and grown in 17 states on about 5 million hectares, more than all crops except maize, wheat or soybean, with a return of...

  6. Functional Characterization of a Dihydroflavanol 4-Reductase from the Fiber of Upland Cotton (Gossypium hirsutum).

    PubMed

    Wang, Le; Zhu, Yue; Wang, Peng; Fan, Qiang; Wu, Yao; Peng, Qing-Zhong; Xia, Gui-Xian; Wu, Jia-He

    2016-01-26

    Dihydroflavanol 4-reductase (DFR) is a key later enzyme involved in two polyphenols' (anthocyanins and proanthocyanidins (PAs)) biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1) was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (-)-epicatachin and (-)-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (-)-catachin and (-)-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.

  7. Registration of BARBREN-713 Germplasm line of Upland cotton resistant to reniform and root-knot nematodes

    USDA-ARS?s Scientific Manuscript database

    Cotton (Gossypium hirsutum L.) germplasm line BARBREN-713 (Reg. No. ___, PI _____) was developed and released by the USDA-ARS, Mississippi Agricultural and Forest Experiment Station, Texas A&M AgriLife Research, and Cotton Incorporated in 2012. The objective of the release was to provide public and...

  8. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    PubMed

    Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang

    2012-01-01

    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  9. Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton

    PubMed Central

    Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang

    2012-01-01

    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops. PMID:22768325

  10. Registration of LONREN-1 and LONREN-2 germplasm lines of Upland Cotton resistant to reniform nematode

    USDA-ARS?s Scientific Manuscript database

    Cotton (Gossypium hirsutum L.) germplasm lines LONREN-1 (Reg. No. GP-977, PI 669509) and LONREN-2 (Reg. No. GP978, PI 669510) were developed and released by the USDA-ARS, Texas Agricultural Experiment Station and Cotton Incorporated in 2007 to provide breeders with desirable germplasm resistant to t...

  11. Comparative physical and chemical analyses of cotton fibers from two near isogenic upland lines differing in fiber wall thickness

    USDA-ARS?s Scientific Manuscript database

    The thickness of cotton fiber cell walls is an important property that partially determines the economic value of cotton. To better understand the physical and chemical manifestations of the genetic variations that regulate the degree of fiber wall thickness, we used a comprehensive set of methods t...

  12. Reproduction and pathogenicity of endemic populations of Rotylenchulus reniformis on cotton

    USDA-ARS?s Scientific Manuscript database

    The reniform nematode (Rotylenchulus reniformis) is the predominant parasitic nematode of upland cotton (Gossypium hirsutum) in the southern United States. Little is known about variability in geographic isolates of reniform nematode. In order to evaluate the comparative reproduction and pathogenici...

  13. Ginning efficiency - research progress

    USDA-ARS?s Scientific Manuscript database

    In the past few years, there has been a consorted effort between cotton geneticists/breeders, ginning engineers and molecular scientists to understand ‘ginning efficiency’ in upland cotton. Ginning efficiency includes ginning rate (measured in g lint sec-1) and net gin stand energy (measured in Wh k...

  14. Breeding potential of elite Pee Dee germplasm in Upland cotton breeding programs

    USDA-ARS?s Scientific Manuscript database

    Successful plant breeding programs begin with parental line selection. Effective parental line selection is facilitated when the breeding potential of candidate parental lines is known. Using topcross families involving germplasm representing eight US public cotton breeding programs, we evaluated th...

  15. GhNAC12, a neutral candidate gene, leads to early aging in cotton (Gossypium hirsutum L).

    PubMed

    Zhao, Fengli; Ma, Jianhui; Li, Libei; Fan, Shuli; Guo, Yaning; Song, Meizhen; Wei, Hengling; Pang, Chaoyou; Yu, Shuxun

    2016-01-15

    NAC (NAM, ATAF, and CUC) is one of the largest transcription factor families in plants, and its members play various roles in plant growth, development, and the response to biotic and abiotic stresses. Currently, 77 NAC genes have been reported in cotton (Gossypium hirsutum L.). And GhNAC12 showed up-regulation during leaf senescence, but its role in this process is poorly understood. In the present study, a preliminary function analysis of GhNAC12 was performed during leaf senescence. qRT-PCR analysis indicated that GhNAC12 expression increased during the early-aging process and the aging of cotyledons. Additionally, we observed that overexpression of GhNAC12 in Arabidopsis led to early senescence (early aging). Our findings suggest that GhNAC12 is a candidate gene for early aging in upland cotton cultivars. Neutrality tests suggested that there was no selection pressure imposed on GhNAC12 during the domestication of upland cotton. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. The Mating System of the Wild-to-Domesticated Complex of Gossypium hirsutum L. Is Mixed

    PubMed Central

    Velázquez-López, Rebeca; Wegier, Ana; Alavez, Valeria; Pérez-López, Javier; Vázquez-Barrios, Valeria; Arroyo-Lambaer, Denise; Ponce-Mendoza, Alejandro; Kunin, William E.

    2018-01-01

    The domestication syndrome of many plants includes changes in their mating systems. The evolution of the latter is shaped by ecological and genetic factors that are particular to an area. Thus, the reproductive biology of wild relatives must be studied in their natural distribution to understand the mating system of a crop species as a whole. Gossypium hirsutum (upland cotton) includes both domesticated varieties and wild populations of the same species. Most studies on mating systems describe cultivated cotton as self-pollinated, while studies on pollen dispersal report outcrossing; however, the mating system of upland cotton has not been described as mixed and little is known about its wild relatives. In this study we selected two wild metapopulations for comparison with domesticated plants and one metapopulation with evidence of recent gene flow between wild relatives and the crop to evaluate the mating system of cotton’s wild-to-domesticated complex. Using classic reproductive biology methods, our data demonstrate that upland cotton presents a mixed mating system throughout the complex. Given cotton’s capacity for outcrossing, differences caused by the domestication process in cultivated individuals can have consequences for its wild relatives. This characterization of the diversity of the wild relatives in their natural distribution, as well as their interactions with the crop, will be useful to design and implement adequate strategies for conservation and biosecurity. PMID:29868048

  17. Mapping by sequencing in cotton (Gossypium hirsutum) line MD52ne identified candidate genes for fiber strength and its related quality attributes.

    PubMed

    Islam, Md S; Zeng, Linghe; Thyssen, Gregory N; Delhom, Christopher D; Kim, Hee Jin; Li, Ping; Fang, David D

    2016-06-01

    Three QTL regions controlling three fiber quality traits were validated and further fine-mapped with 27 new single nucleotide polymorphism (SNP) markers. Transcriptome analysis suggests that receptor-like kinases found within the validated QTLs are potential candidate genes responsible for superior fiber strength in cotton line MD52ne. Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candidate gene prediction can uncover the genetic and molecular basis of fiber quality traits. Four previously-identified QTLs (qFBS-c3, qSFI-c14, qUHML-c14 and qUHML-c24) related to fiber bundle strength, short fiber index and fiber length, respectively, were validated using an F3 population that originated from a cross of MD90ne × MD52ne. A group of 27 new SNP markers generated from mapping-by-sequencing (MBS) were placed in QTL regions to improve and validate earlier maps. Our refined QTL regions spanned 4.4, 1.8 and 3.7 Mb of physical distance in the Gossypium raimondii reference genome. We performed RNA sequencing (RNA-seq) of 15 and 20 days post-anthesis fiber cells from MD52ne and MD90ne and aligned reads to the G. raimondii genome. The QTL regions contained 21 significantly differentially expressed genes (DEGs) between the two near-isogenic parental lines. SNPs that result in non-synonymous substitutions to amino acid sequences of annotated genes were identified within these DEGs, and mapped. Taken together, transcriptome and amino acid mutation analysis indicate that receptor-like kinase pathway genes are likely candidates for superior fiber strength and length in MD52ne. MBS along with RNA-seq demonstrated a powerful strategy to elucidate candidate genes for the QTLs that control complex traits in a complex genome like tetraploid upland cotton.

  18. 7 CFR 28.403 - Middling Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the range...

  19. 7 CFR 28.442 - Middling Yellow Stained Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  20. 7 CFR 28.403 - Middling Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the range...

  1. 7 CFR 28.442 - Middling Yellow Stained Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  2. 7 CFR 28.442 - Middling Yellow Stained Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  3. 7 CFR 28.442 - Middling Yellow Stained Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  4. 7 CFR 28.403 - Middling Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the range...

  5. 7 CFR 28.403 - Middling Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the range...

  6. 7 CFR 1962.6 - Liens and assignments on chattel property.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... and Water (SW) loans. When a new security agreement or chattel mortgage is taken, all existing security items will be described on it. (b) [Reserved] (c) Assignments of upland cotton, rice, wheat and... cotton, rice, wheat and feed grain programs. (1) Obtaining assignments. Assignments will be obtained as...

  7. 7 CFR 1962.6 - Liens and assignments on chattel property.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... and Water (SW) loans. When a new security agreement or chattel mortgage is taken, all existing security items will be described on it. (b) [Reserved] (c) Assignments of upland cotton, rice, wheat and... cotton, rice, wheat and feed grain programs. (1) Obtaining assignments. Assignments will be obtained as...

  8. 7 CFR 1962.6 - Liens and assignments on chattel property.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... and Water (SW) loans. When a new security agreement or chattel mortgage is taken, all existing security items will be described on it. (b) [Reserved] (c) Assignments of upland cotton, rice, wheat and... cotton, rice, wheat and feed grain programs. (1) Obtaining assignments. Assignments will be obtained as...

  9. Genetic characterization of reniform nematode resistance for Gossypium arboreum accession PI 417895

    USDA-ARS?s Scientific Manuscript database

    Reniform nematode (Rotylenchulus reniformis) is an important root pathogen of cotton in the southeastern United States and management is hindered by the lack of host-plant resistance in upland cotton (Gossypium hirsutum). The G. arboreum germplasm collection is an important source of resistance. Tra...

  10. Chromosomal assignment of ALFP markers in upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    In this research, we used two sets of cotton aneuploid (G. hirsutum × G. tomentosum and G. hirsutum × G. barbadense) plants to locate AFLP markers to chromosome using deletion analysis method. Thirty-eight primer combinations were used to generate 608 polymorphic AFLP markers. Ninety-eight AFLP mark...

  11. 7 CFR 28.442 - Middling Yellow Stained Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  12. 7 CFR 28.403 - Middling Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the range...

  13. Genome-wide Identification and analysis of the stress-resistance function of the TPS (Trehalose-6-Phosphate Synthase) gene family in cotton.

    PubMed

    Mu, Min; Lu, Xu-Ke; Wang, Jun-Juan; Wang, De-Long; Yin, Zu-Jun; Wang, Shuai; Fan, Wei-Li; Ye, Wu-Wei

    2016-03-18

    Trehalose (a-D-glucopyranosyl a-D-glucopyranoside) is a nonreducing disaccharide and is widely distributed in bacteria, fungi, algae, plants and invertebrates. In the study, the identification of trehalose-6-phosphate synthase (TPS) genes stress-related in cotton, and the genetic structure analysis and molecular evolution analysis of TPSs were conducted with bioinformatics methods, which could lay a foundation for further research of TPS functions in cotton. The genome information of Gossypium raimondii (group D), G. arboreum L. (group A), and G. hirsutum L. (group AD) was used in the study. Fifty-three TPSs were identified comprising 15 genes in group D, 14 in group A, and 24 in group AD. Bioinformatics methods were used to analyze the genetic structure and molecular evolution of TPSs. Real-time PCR analysis was performed to investigate the expression patterns of gene family members. All TPS family members in cotton can be divided into two subfamilies: Class I and Class II. The similarity of the TPS sequence is high within the same species and close within their family relatives. The genetic structures of two TPS subfamily members are different, with more introns and a more complicated gene structure in Class I. There is a TPS domain(Glyco transf_20) at the N-terminal in all TPS family members and a TPP domain(Trehalose_PPase) at the C-terminal in all except GrTPS6, GhTPS4, and GhTPS9. All Class II members contain a UDP-forming domain. The responses to environmental stresses showed that stresses could induce the expression of TPSs but the expression patterns vary with different stresses. The distribution of TPSs varies with different species but is relatively uniform on chromosomes. Genetic structure varies with different gene members, and expression levels vary with different stresses and exhibit tissue specificity. The upregulated genes in upland cotton TM-1 is significantly more than that in G. raimondii and G. arboreum L. Shixiya 1.

  14. Genome-wide association study discovered candidate genes of Verticillium wilt resistance in upland cotton (Gossypium hirsutum L.).

    PubMed

    Li, Tinggang; Ma, Xuefeng; Li, Nanyang; Zhou, Lei; Liu, Zheng; Han, Huanyong; Gui, Yuejing; Bao, Yuming; Chen, Jieyin; Dai, Xiaofeng

    2017-12-01

    Verticillium wilt (VW), caused by infection by Verticillium dahliae, is considered one of the most yield-limiting diseases in cotton. To examine the genetic architecture of cotton VW resistance, we performed a genome-wide association study (GWAS) using a panel of 299 accessions and 85 630 single nucleotide polymorphisms (SNPs) detected using the specific-locus amplified fragment sequencing (SLAF-seq) approach. Trait-SNP association analysis detected a total of 17 significant SNPs at P < 1.17 × 10 -5 (P = 1/85 630, -log 10 P = 4.93); the peaks of SNPs associated with VW resistance on A10 were continuous and common in three environments (RDIG2015, RDIF2015 and RDIF2016). Haplotype block structure analysis predicted 22 candidate genes for VW resistance based on A10_99672586 with a minimum P-value (-log 10 P = 6.21). One of these genes (CG02) was near the significant SNP A10_99672586 (0.26 Mb), located in a 372-kb haplotype block, and its Arabidopsis AT3G25510 homologues contain TIR-NBS-LRR domains that may be involved in disease resistance response. Real-time quantitative PCR and virus-induced gene silencing (VIGS) analysis showed that CG02 was specific to up-regulation in the resistant (R) genotype Zhongzhimian2 (ZZM2) and that silenced plants were more susceptible to V. dahliae. These results indicate that CG02 is likely the candidate gene for resistance against V. dahliae in cotton. The identified locus or gene may serve as a promising target for genetic engineering and selection for improving resistance to VW in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Water use, canopy temperature, lint yield, and fiber quality response of six upland cotton cultivars to water stress

    USDA-ARS?s Scientific Manuscript database

    The declining saturated thickness of the Ogallala Aquifer combined with the unpredictability of precipitation during the growing season in the Southern High Plains has resulted in elevated production risks associated with short-term crop water deficits. Cotton (Gossypium spp.) cultivars that can use...

  16. 7 CFR 28.407 - Good Ordinary Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Good Ordinary Color. 28.407 Section 28.407 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.407 Good Ordinary Color. Good Ordinary Color is color which is within the range...

  17. 7 CFR 28.407 - Good Ordinary Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Good Ordinary Color. 28.407 Section 28.407 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.407 Good Ordinary Color. Good Ordinary Color is color which is within the range...

  18. 7 CFR 28.407 - Good Ordinary Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Good Ordinary Color. 28.407 Section 28.407 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.407 Good Ordinary Color. Good Ordinary Color is color which is within the range...

  19. 7 CFR 28.407 - Good Ordinary Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Good Ordinary Color. 28.407 Section 28.407 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.407 Good Ordinary Color. Good Ordinary Color is color which is within the range...

  20. 7 CFR 28.401 - Good Middling Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Good Middling Color. 28.401 Section 28.401 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.401 Good Middling Color. Good Middling Color is color which is within the range...

  1. 7 CFR 28.401 - Good Middling Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Good Middling Color. 28.401 Section 28.401 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.401 Good Middling Color. Good Middling Color is color which is within the range...

  2. 7 CFR 28.401 - Good Middling Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Good Middling Color. 28.401 Section 28.401 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.401 Good Middling Color. Good Middling Color is color which is within the range...

  3. 7 CFR 28.405 - Low Middling Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...

  4. 7 CFR 28.401 - Good Middling Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Good Middling Color. 28.401 Section 28.401 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.401 Good Middling Color. Good Middling Color is color which is within the range...

  5. 7 CFR 28.405 - Low Middling Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...

  6. 7 CFR 28.405 - Low Middling Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...

  7. 7 CFR 28.405 - Low Middling Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...

  8. Dissecting genotype × environment interactions and trait correlations present in the Pee Dee cotton germplasm collection following seventy years of plant breeding

    USDA-ARS?s Scientific Manuscript database

    Genotype × environment interactions and trait correlations significantly impact efforts to develop high yield, high quality, and environmentally stable Upland cotton (Gossypium hirsutum L.) cultivars. Knowledge of both can and should be used to design optimal breeding programs and effective selectio...

  9. Multivariate analysis of the cotton seed ionome reveals integrated genetic signatures of abiotic stress-response

    USDA-ARS?s Scientific Manuscript database

    To mitigate the effects of heat and drought stress, an understanding of the genetic control of physiological responses to these environmental conditions is needed. To this end, we evaluated an upland cotton (Gossypium hirsutum L.) mapping population under water-limited and well-watered conditions in...

  10. Registration of a tufted-naked seed upland cotton germplasm

    USDA-ARS?s Scientific Manuscript database

    A tufted-naked cotton (Gossypium hirsutum L.) mutant, 9023n4t (Reg. No. GP-971, PI 667553) was developed from the cultivar SC 9023 (9023) (PI 590933) through chemical mutagenesis. Germplasm line 9023n4t was developed by the Department of Plant and Soil Science, Texas Tech University, and released in...

  11. 7 CFR 28.401 - Good Middling Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Good Middling Color. 28.401 Section 28.401 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.401 Good Middling Color. Good Middling Color is color which is within the range...

  12. 7 CFR 28.405 - Low Middling Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...

  13. 7 CFR 28.407 - Good Ordinary Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Good Ordinary Color. 28.407 Section 28.407 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.407 Good Ordinary Color. Good Ordinary Color is color which is within the range...

  14. Recurrent selection performance for FOV race 4 resistance in selected cotton germplasm and progeny

    USDA-ARS?s Scientific Manuscript database

    Recurrent selection is being used to improve Fusarium oxysporum f. sp. vasinfectum race 4 (FOV4) resistance in Upland (Gossypium hirsutum L.) and Pima (G. barbadense L.) cotton using naturally infested fields and artificially inoculum-greenhouse sites. One of our target objectives is to introduce a ...

  15. 7 CFR 28.464 - Leaf Grade 4.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 4. 28.464 Section 28.464 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.464 Leaf Grade 4. Leaf Grade 4 is leaf which is within the range represented by...

  16. 7 CFR 28.465 - Leaf Grade 5.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 5. 28.465 Section 28.465 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.465 Leaf Grade 5. Leaf Grade 5 is leaf which is within the range represented by...

  17. 7 CFR 28.467 - Leaf Grade 7.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 7. 28.467 Section 28.467 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.467 Leaf Grade 7. Leaf Grade 7 is leaf which is within the range represented by...

  18. 7 CFR 28.463 - Leaf Grade 3.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 3. 28.463 Section 28.463 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.463 Leaf Grade 3. Leaf Grade 3 is leaf which is within the range represented by...

  19. 7 CFR 28.462 - Leaf Grade 2.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 2. 28.462 Section 28.462 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.462 Leaf Grade 2. Leaf Grade 2 is leaf which is within the range represented by...

  20. 7 CFR 28.462 - Leaf Grade 2.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 2. 28.462 Section 28.462 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.462 Leaf Grade 2. Leaf Grade 2 is leaf which is within the range represented by...

  1. 7 CFR 28.465 - Leaf Grade 5.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 5. 28.465 Section 28.465 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.465 Leaf Grade 5. Leaf Grade 5 is leaf which is within the range represented by...

  2. 7 CFR 28.464 - Leaf Grade 4.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 4. 28.464 Section 28.464 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.464 Leaf Grade 4. Leaf Grade 4 is leaf which is within the range represented by...

  3. 7 CFR 28.462 - Leaf Grade 2.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 2. 28.462 Section 28.462 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.462 Leaf Grade 2. Leaf Grade 2 is leaf which is within the range represented by...

  4. 7 CFR 28.465 - Leaf Grade 5.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 5. 28.465 Section 28.465 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.465 Leaf Grade 5. Leaf Grade 5 is leaf which is within the range represented by...

  5. 7 CFR 28.463 - Leaf Grade 3.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 3. 28.463 Section 28.463 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.463 Leaf Grade 3. Leaf Grade 3 is leaf which is within the range represented by...

  6. 7 CFR 28.462 - Leaf Grade 2.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 2. 28.462 Section 28.462 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.462 Leaf Grade 2. Leaf Grade 2 is leaf which is within the range represented by...

  7. 7 CFR 28.464 - Leaf Grade 4.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 4. 28.464 Section 28.464 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.464 Leaf Grade 4. Leaf Grade 4 is leaf which is within the range represented by...

  8. 7 CFR 28.463 - Leaf Grade 3.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 3. 28.463 Section 28.463 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.463 Leaf Grade 3. Leaf Grade 3 is leaf which is within the range represented by...

  9. 7 CFR 28.466 - Leaf Grade 6.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 6. 28.466 Section 28.466 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.466 Leaf Grade 6. Leaf Grade 6 is leaf which is within the range represented by...

  10. 7 CFR 28.461 - Leaf Grade 1.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 1. 28.461 Section 28.461 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.461 Leaf Grade 1. Leaf Grade 1 is leaf which is within the range represented by...

  11. 7 CFR 28.461 - Leaf Grade 1.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 1. 28.461 Section 28.461 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.461 Leaf Grade 1. Leaf Grade 1 is leaf which is within the range represented by...

  12. 7 CFR 28.461 - Leaf Grade 1.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 1. 28.461 Section 28.461 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.461 Leaf Grade 1. Leaf Grade 1 is leaf which is within the range represented by...

  13. 7 CFR 28.465 - Leaf Grade 5.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 5. 28.465 Section 28.465 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.465 Leaf Grade 5. Leaf Grade 5 is leaf which is within the range represented by...

  14. 7 CFR 28.463 - Leaf Grade 3.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 3. 28.463 Section 28.463 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.463 Leaf Grade 3. Leaf Grade 3 is leaf which is within the range represented by...

  15. 7 CFR 28.467 - Leaf Grade 7.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 7. 28.467 Section 28.467 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.467 Leaf Grade 7. Leaf Grade 7 is leaf which is within the range represented by...

  16. 7 CFR 28.467 - Leaf Grade 7.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 7. 28.467 Section 28.467 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.467 Leaf Grade 7. Leaf Grade 7 is leaf which is within the range represented by...

  17. 7 CFR 28.466 - Leaf Grade 6.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 6. 28.466 Section 28.466 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.466 Leaf Grade 6. Leaf Grade 6 is leaf which is within the range represented by...

  18. 7 CFR 28.465 - Leaf Grade 5.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 5. 28.465 Section 28.465 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.465 Leaf Grade 5. Leaf Grade 5 is leaf which is within the range represented by...

  19. 7 CFR 28.462 - Leaf Grade 2.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 2. 28.462 Section 28.462 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.462 Leaf Grade 2. Leaf Grade 2 is leaf which is within the range represented by...

  20. 7 CFR 28.463 - Leaf Grade 3.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 3. 28.463 Section 28.463 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.463 Leaf Grade 3. Leaf Grade 3 is leaf which is within the range represented by...

  1. 7 CFR 28.464 - Leaf Grade 4.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 4. 28.464 Section 28.464 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.464 Leaf Grade 4. Leaf Grade 4 is leaf which is within the range represented by...

  2. 7 CFR 28.461 - Leaf Grade 1.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 1. 28.461 Section 28.461 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.461 Leaf Grade 1. Leaf Grade 1 is leaf which is within the range represented by...

  3. 7 CFR 28.466 - Leaf Grade 6.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 6. 28.466 Section 28.466 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.466 Leaf Grade 6. Leaf Grade 6 is leaf which is within the range represented by...

  4. 7 CFR 28.464 - Leaf Grade 4.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 4. 28.464 Section 28.464 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.464 Leaf Grade 4. Leaf Grade 4 is leaf which is within the range represented by...

  5. 7 CFR 28.466 - Leaf Grade 6.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Leaf Grade 6. 28.466 Section 28.466 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.466 Leaf Grade 6. Leaf Grade 6 is leaf which is within the range represented by...

  6. 7 CFR 28.466 - Leaf Grade 6.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Leaf Grade 6. 28.466 Section 28.466 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.466 Leaf Grade 6. Leaf Grade 6 is leaf which is within the range represented by...

  7. 7 CFR 28.467 - Leaf Grade 7.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Leaf Grade 7. 28.467 Section 28.467 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.467 Leaf Grade 7. Leaf Grade 7 is leaf which is within the range represented by...

  8. 7 CFR 28.461 - Leaf Grade 1.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Leaf Grade 1. 28.461 Section 28.461 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.461 Leaf Grade 1. Leaf Grade 1 is leaf which is within the range represented by...

  9. 7 CFR 28.467 - Leaf Grade 7.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf Grade 7. 28.467 Section 28.467 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Leaf Grade of American Upland Cotton § 28.467 Leaf Grade 7. Leaf Grade 7 is leaf which is within the range represented by...

  10. Effects of certain key metrics of hydroentanglement system on properties of nonwoven fabrics made with commercially cleaned greige cotton

    USDA-ARS?s Scientific Manuscript database

    Research was conducted to determine the effects of certain key process metrics of a commercial-grade hydroentanglement system on properties of the nonwoven fabrics made with cleaned Upland greige cotton lint. The metrics studied, among others, were the hydroentangling water pressure, the strip orif...

  11. Replacing soybean meal with Upland cottonseed, Pima cottonseed, or extruded Pima cottonseed cake on production of lactating dairy cows

    USDA-ARS?s Scientific Manuscript database

    Cottonseed is an important dietary ingredient for dairy cows and is fed principally as upland cottonseed. However, Pima cotton production is growing in the U.S. Pima cottonseed contains greater levels of protein, oil and gossypol, a potentially toxic compound. Heating cottonseed promotes the gossypo...

  12. Effect of replacing soybean meal protein with protein from upland cottonseed, Pima cottonseed, or extruded Pima cottonseed on production of lactating dairy cows

    USDA-ARS?s Scientific Manuscript database

    Pima cotton production is increasing in the U.S., but Pima cottonseed contains higher concentrations of the toxic pigment gossypol than conventional upland cottonseed. Heating promotes gossypol reaction with protein, reducing gossypol absorption and toxicity. The objective of this study was to asses...

  13. Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

  14. Molecular analysis of late-stage fiber development in upland cotton

    USDA-ARS?s Scientific Manuscript database

    Cotton is the world's most important textile and the number one value-added crop. It plays a crucial role in the economy of Texas – supporting close to 50,000 jobs and supplying $2 billion to the state economy. Its role is even more evident in the South Plains of Texas, which supplies approximately...

  15. Modifications to a LATE MERISTEM IDENTITY-1 gene are responsible for the major leaf shapes of Upland cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Leaf shape varies spectacularly among plants. Leaves are the primary source of photo-assimilate in crop plants and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. Leaf shape played a unique role in cotton improvement, as breeders ha...

  16. Do genotypic differences in thermotolerance plasticity correspond with water-induced differences in yield and photosynthetic stability for field-grown upland cotton?

    USDA-ARS?s Scientific Manuscript database

    To determine if cultivar differences in thermotolerance plasticity of photosystem II promote yield or photosynthetic stability when variability in both parameters is water-induced, the temperature response of maximum quantum yield of photosystem II (Fv/Fm) was evaluated for two cotton cultivars (FM ...

  17. Comparative genetic analysis of lint yield and fiber quality among single, three-way, and double crosses in upland cotton

    USDA-ARS?s Scientific Manuscript database

    Decisions on the appropriate crossing systems to employ for genetic improvement of quantitative traits are critical in cotton breeding. Determination of genetic variance for lint yield and fiber quality in three different crossing schemes, i.e., single cross (SC), three-way cross (TWC), and double ...

  18. Independent replication of mitochondrial genes supports the transcriptional program in developing fiber cells of cotton (Gossypium hirsutum L.).

    PubMed

    Thyssen, Gregory N; Song, Xianliang; Naoumkina, Marina; Kim, Hee-Jin; Fang, David D

    2014-07-01

    The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary independently between different cell types and developmental stages. Our objective was to determine the relationship between mitochondrial gene copy number and transcript abundance in the elongating fiber cells of Upland cotton (Gossypium hirsutum L.). We compared RNA and DNA from cotton fiber cells at five developmental time points from early elongation through secondary cell wall thickening from the Ligon-lintless 2 (Li2) short fiber mutant and its wild type near isogenic line (NIL) DP5690. Mitochondrial gene copy number decreased from 3 to 8-DPA in the developing cotton fiber cells while transcript levels remained low. As secondary cell wall biosynthesis began in developing fibers, the expression levels and copy numbers of mitochondrial genes involved in energy production and respiration were up-regulated in wild type cotton DP5690. However, the short fiber mutant Li2, failed to increase expression of these genes, which include three subunits of ATP synthase, atp1, atp8 and atp9 and two cytochrome genes cox1 and cob. At the same time, Li2 failed to increase the copy numbers of these highly expressed genes. Surprisingly, we found that when mitochondrial genes were highly transcribed, they also had very high copy numbers. This observation suggests that in developing cotton fibers, increased mitochondrial sublimon replication may support increases in gene transcription. Published by Elsevier B.V.

  19. Exploring pima and upland cross-combinations to identify fusarium oxysporum f. sp. vasinfectum race 4 resistant cottons by combining ability of superior cultivars

    USDA-ARS?s Scientific Manuscript database

    A cotton breeding program strives to identify the best performance cultivars or breeding lines which can be used as parents in crosses. Multi-cross combinations provide the means of performance of each parent and assess the combining ability or productivity of parents through the hybridization proce...

  20. A new fuzzless seed locus in an upland cotton (Gossypium hirsutum L.) mutant

    USDA-ARS?s Scientific Manuscript database

    Various fiber mutants of cotton have been reported since 1920. Two of the best characterized mutants are the naked seed loci, N1N1 and n2n2. Recently, a naked-tufted mutant called 9023n4t was developed from the cultivar SC 9023 through chemical mutagenesis. The objective of this research was to dete...

  1. Construction of a high-density linkage map and mapping quantitative trait loci for somatic embryogenesis using leaf petioles as explants in upland cotton (Gossypium hirsutum L.).

    PubMed

    Xu, Zhenzhen; Zhang, Chaojun; Ge, Xiaoyang; Wang, Ni; Zhou, Kehai; Yang, Xiaojie; Wu, Zhixia; Zhang, Xueyan; Liu, Chuanliang; Yang, Zuoren; Li, Changfeng; Liu, Kun; Yang, Zhaoen; Qian, Yuyuan; Li, Fuguang

    2015-07-01

    The first high-density linkage map was constructed to identify quantitative trait loci (QTLs) for somatic embryogenesis (SE) in cotton ( Gossypium hirsutum L.) using leaf petioles as explants. Cotton transformation is highly limited by only a few regenerable genotypes and the lack of understanding of the genetic and molecular basis of somatic embryogenesis (SE) in cotton (Gossypium hirsutum L.). To construct a more saturated linkage map and further identify quantitative trait loci (QTLs) for SE using leaf petioles as explants, a high embryogenesis frequency line (W10) from the commercial Chinese cotton cultivar CRI24 was crossed with TM-1, a genetic standard upland cotton with no embryogenesis frequency. The genetic map spanned 2300.41 cM in genetic distance and contained 411 polymorphic simple sequence repeat (SSR) loci. Of the 411 mapped loci, 25 were developed from unigenes identified for SE in our previous study. Six QTLs for SE were detected by composite interval mapping method, each explaining 6.88-37.07% of the phenotypic variance. Single marker analysis was also performed to verify the reliability of QTLs detection, and the SSR markers NAU3325 and DPL0209 were detected by the two methods. Further studies on the relatively stable and anchoring QTLs/markers for SE in an advanced population of W10 × TM-1 and other cross combinations with different SE abilities may shed light on the genetic and molecular mechanism of SE in cotton.

  2. CottonDB: A resource for cotton genome research

    USDA-ARS?s Scientific Manuscript database

    CottonDB (http://cottondb.org/) is a database and web resource for cotton genomic and genetic research. Created in 1995, CottonDB was among the first plant genome databases established by the USDA-ARS. Accessed through a website interface, the database aims to be a convenient, inclusive medium of ...

  3. Registration of cotton germplasm USDA MD 16-1 and USDA MD 16-2 with enhanced lint yield and fiber quality.

    USDA-ARS?s Scientific Manuscript database

    Upland cotton germplasm USDA MD 16-1 (Reg. No. __ and PI ___ ), and USDA MD 16-2 (Reg. No. ___ and PI___) (Gossypium hirsutum L.), have enhanced yield and good fiber quality. These germplasm lines were developed by the USDA-ARS, Stoneville, MS and released in 2017. Two crosses, MD 25-51 X MD 10-9-1 ...

  4. Genotypic comparisons of chromosomes 01, 04 and 18 from three tetraploid species of gossypium in topcrosses with five elite cultivars of G. hirsutum L

    USDA-ARS?s Scientific Manuscript database

    Upland cotton, Gossypium hirsutum L. is planted on most of the hectareage of cultivated cotton in the United States and the world. The cultivated tetraploid species G. barbadense L. produces extra long, strong, and fine fibers. Breeders would like to move fiber quality alleles from this species in...

  5. Registration of six germplasm lines of cotton, Gosspyium hirsutum L. with resistance to root-knot and reniform nematodes

    USDA-ARS?s Scientific Manuscript database

    Six Upland cotton, Gossypium hirsutum L., germplasm lines, M Rk-Rn 1, M Rk-Rn 2, M Rk-Rn 3, M Rk-Rn 4, M Rk-Rn 5, and M Rk-Rn 6, with resistance to root-knot nematode, Meloidogyne incognita (Kofoid and White) Chitwood, and reniform nematode, Rotylenchulus reniformis Linford and Oliveria, were jointl...

  6. Advanced Backcross QTL Analysis of Fiber Strength and Fineness in a Cross between Gossypium hirsutum and G. mustelinum.

    PubMed

    Wang, Baohua; Zhuang, Zhimin; Zhang, Zhengsheng; Draye, Xavier; Shuang, Lan-Shuan; Shehzad, Tariq; Lubbers, Edward L; Jones, Don; May, O Lloyd; Paterson, Andrew H; Chee, Peng W

    2017-01-01

    The molecular genetic basis of cotton fiber strength and fineness in crosses between Gossypium mustelinum and Gossypium hirsutum (Upland cotton) was dissected using 21 BC 3 F 2 and 12 corresponding BC 3 F 2:3 and BC 3 F 2:4 families. The BC 3 F 2 families were genotyped with simple sequence repeat markers from a G. hirsutum by G. mustelinum linkage map, and the three generations of BC 3 -derived families were phenotyped for fiber strength (STR) and fineness (Micronaire, MIC). A total of 42 quantitative trait loci (QTLs) were identified through one-way analysis of variance, including 15 QTLs for STR and 27 for MIC, with the percentage of variance explained by individual loci averaging 13.86 and 14.06%, respectively. Eighteen of the 42 QTLs were detected at least twice near the same markers in different generations/families or near linked markers in the same family, and 28 of the 42 QTLs were identified in both mixed model-based composite interval mapping and one-way variance analyses. Alleles from G. mustelinum increased STR for eight of 15 and reduced MIC for 15 of 27 QTLs. Significant among-family genotypic effects ( P < 0.001) were detected in 13 and 10 loci for STR and MIC respectively, and five loci showed significant ( P < 0.001) genotype × family interaction for MIC. These results support the hypothesis that fiber quality improvement for Upland cotton could be realized by introgressing G. mustelinum alleles although complexities due to the different effects of genetic background on introgressed chromatin might be faced. Building on prior work with G. barbadense, G. tomentosum , and G. darwinii , QTL mapping involving introgression of G. mustelinum alleles offers new allelic variation to Upland cotton germplasm.

  7. Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

    PubMed

    Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

    2014-02-10

    Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. 7 CFR 1205.201 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... than the de minimis value established by the Secretary or industrial products as that term is defined by regulation. (e) Upland Cotton means all cultivated varieties of the species Gossypium hirsutum L...

  9. 7 CFR 1205.201 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... than the de minimis value established by the Secretary or industrial products as that term is defined by regulation. (e) Upland Cotton means all cultivated varieties of the species Gossypium hirsutum L...

  10. 7 CFR 1205.201 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... than the de minimis value established by the Secretary or industrial products as that term is defined by regulation. (e) Upland Cotton means all cultivated varieties of the species Gossypium hirsutum L...

  11. 7 CFR 1205.201 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... than the de minimis value established by the Secretary or industrial products as that term is defined by regulation. (e) Upland Cotton means all cultivated varieties of the species Gossypium hirsutum L...

  12. 7 CFR 1205.201 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... than the de minimis value established by the Secretary or industrial products as that term is defined by regulation. (e) Upland Cotton means all cultivated varieties of the species Gossypium hirsutum L...

  13. CottonGen: a genomics, genetics and breeding database for cotton research

    USDA-ARS?s Scientific Manuscript database

    CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, vis...

  14. 7 CFR 1412.1 - Applicability, statutory changes, interest, and contract provisions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ..., oats, upland cotton, rice, peanuts, soybeans, sunflower seed, rapeseed, canola, safflower, flaxseed, mustard seed, crambe, sesame seed, pulse crops, and other designated oilseeds as determined and announced...

  15. 7 CFR 1412.1 - Applicability, statutory changes, interest, and contract provisions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ..., oats, upland cotton, rice, peanuts, soybeans, sunflower seed, rapeseed, canola, safflower, flaxseed, mustard seed, crambe, sesame seed, pulse crops, and other designated oilseeds as determined and announced...

  16. Transcriptome analysis of nitric oxide-responsive genes in upland cotton (Gossypium hirsutum).

    PubMed

    Huang, Juan; Wei, Hengling; Li, Libei; Yu, Shuxun

    2018-01-01

    Nitric oxide (NO) is an important signaling molecule with diverse physiological functions in plants. It is therefore important to characterize the downstream genes and signal transduction networks modulated by NO. Here, we identified 1,932 differentially expressed genes (DEGs) responding to NO in upland cotton using high throughput tag sequencing. The results of quantitative real-time polymerase chain reaction (qRT-PCR) analysis of 25 DEGs showed good consistency. Gene Ontology (GO) and KEGG pathway were analyzed to gain a better understanding of these DEGs. We identified 157 DEGs belonging to 36 transcription factor (TF) families and 72 DEGs related to eight plant hormones, among which several TF families and hormones were involved in stress responses. Hydrogen peroxide and malondialdehyde (MDA) contents were increased, as well related genes after treatment with sodium nitroprusside (SNP) (an NO donor), suggesting a role for NO in the plant stress response. Finally, we compared of the current and previous data indicating a massive number of NO-responsive genes at the large-scale transcriptome level. This study evaluated the landscape of NO-responsive genes in cotton and identified the involvement of NO in the stress response. Some of the identified DEGs represent good candidates for further functional analysis in cotton.

  17. Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

    USDA-ARS?s Scientific Manuscript database

    Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

  18. Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

    PubMed Central

    Malik, Waqas; Iqbal, Muhammad Zaffar; Ali Khan, Asif; Qayyum, Abdul; Ali Abid, Muhammad; Noor, Etrat; Qadir Ahmad, Muhammad; Hasan Abbasi, Ghulam

    2014-01-01

    Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L.) is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS) technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS) are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i) comparative analysis of low- and high-throughput marker technologies available in cotton, (ii) genetic diversity in the available wild and improved gene pools of cotton, (iii) identification of the genomic regions within cotton genome underlying economic traits, and (iv) marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands. PMID:25401149

  19. A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

    PubMed Central

    Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  20. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome.

    PubMed

    Xu, Zhanyou; Yu, Jing; Kohel, Russell J; Percy, Richard G; Beavis, William D; Main, Dorrie; Yu, John Z

    2015-07-01

    Cotton fiber represents the largest single cell in plants and they serve as models to study cell development. This study investigated the distribution and evolution of fiber Unigenes anchored to recombination hotspots between tetraploid cotton (Gossypium hirsutum) At and Dt subgenomes, and within a parental diploid cotton (Gossypium raimondii) D genome. Comparative analysis of At vs D and Dt vs D showed that 1) the D genome provides many fiber genes after its merger with another parental diploid cotton (Gossypium arboreum) A genome although the D genome itself does not produce any spinnable fiber; 2) similarity of fiber genes is higher between At vs D than between Dt vs D genomic hotspots. This is the first report that fiber genes have higher similarity between At and D than between Dt and D. The finding provides new insights into cotton genomic regions that would facilitate genetic improvement of natural fiber properties. Published by Elsevier Inc.

  1. United States Department of Agriculture-Agricultural Research Service studies on polyketide toxins of Fusarium oxysporum f sp vasinfectum: potential targets for disease control.

    PubMed

    Bell, Alois A; Wheeler, Michael H; Liu, Jinggao; Stipanovic, Robert D; Puckhaber, Lorraine S; Orta, Heather

    2003-01-01

    A group of 133 isolates of the cotton wilt pathogen Fusarium oxysporum Schlecht f sp vasinfectum (Atk) Sny & Hans, representing five races and 20 vegetative compatibility groups within race 1 were used to determine the identity, biosynthetic regulation and taxonomic distribution of polyketide toxins produced by this pathogen. All isolates of F oxysporum f sp vasinfectum produced and secreted the nonaketide naphthazarin quinones, bikaverin and norbikaverin. Most isolates of race 1 (previously denoted as races 1, 2 and 6; and also called race A) also synthesized the heptaketide naphthoquinones, nectriafurone, anhydrofusarubin lactol and 5-O-methyljavanicin. Nine avirulent isolates of F oxysporum from Upland cotton roots, three isolates of race 3 of F oxysporum f sp vasinfectum, and four isolates of F oxysporum f sp vasinfectum from Australia, all of which previously failed to cause disease of Upland cotton (Gossypium hirsutum L) in stem-puncture assays, also failed to synthesize or secrete more than trace amounts of the heptaketide compounds. These results indicate that the heptaketides may have a unique role in the virulence of race 1 to Upland cotton. The synthesis of all polyketide toxins by ATCC isolate 24908 of F oxysporum f sp vasinfectum was regulated by pH, carbon/nitrogen ratios, and availability of calcium in media. Synthesis was greatest below pH 7.0 and increased progressively as carbon/nitrogen ratios were increased by decreasing the amounts of nitrogen added to media. The nonaketides were the major polyketides accumulated in synthetic media at pH 4.5 and below, whereas the heptaketides were predominant at pH 5.0 and above. The heptaketides were the major polyketides formed when 10 F oxysporum f sp vasinfectum race 1 isolates were grown on sterilized stems of Fusarium wilt-susceptible cotton cultivars, but these compounds were not produced on sorghum grain cultures. Both groups of polyketide toxins were apparently secreted by F oxysporum f sp vasinfectum, since half of the toxin in 2-day-old shake culture was present in the supernatant. Secretion was enhanced by calcium. Glutamine and glutamic acid inhibited both nonaketide and heptaketide syntheses, even at low nitrogen

  2. QTLs Analysis and Validation for Fiber Quality Traits Using Maternal Backcross Population in Upland Cotton.

    PubMed

    Ma, Lingling; Zhao, Yanpeng; Wang, Yumei; Shang, Lianguang; Hua, Jinping

    2017-01-01

    Cotton fiber is renewable natural fiber source for textile. Improving fiber quality is an essential goal for cotton breeding project. In present study, F 14 recombinant inbred line (RIL) population was backcrossed by the maternal parent to obtain a backcross (BC) population, derived from one Upland cotton hybrid. Three repetitive field trials were performed by randomized complete block design with two replicates in three locations in 2015, together with the BC population, common male parent and the RIL population. Totally, 26 QTLs in BC population explained 5.00-14.17% of phenotype variation (PV) and 37 quantitative trait loci (QTL) were detected in RIL population explaining 5.13-34.00% of PV. Seven common QTLs detected simultaneously in two populations explained PV from 7.69 to 23.05%. A total of 20 QTLs in present study verified the previous results across three environments in 2012. Particularly, qFL-Chr5-2 controlling fiber length on chromosome 5 explained 34.00% of PV, while qFL-Chr5-3 only within a 0.8 cM interval explained 13.93% of PV on average in multiple environments. These stable QTLs explaining great variation offered essential information for marker-assisted selection (MAS) to improve fiber quality traits. Lots of epistasis being detected in both populations acted as one of important genetic compositions of fiber quality traits.

  3. Effects of GhWUS from upland cotton (Gossypium hirsutum L.) on somatic embryogenesis and shoot regeneration.

    PubMed

    Xiao, Yanqing; Chen, Yanli; Ding, Yanpeng; Wu, Jie; Wang, Peng; Yu, Ya; Wei, Xi; Wang, Ye; Zhang, Chaojun; Li, Fuguang; Ge, Xiaoyang

    2018-05-01

    The WUSCHEL (WUS) gene encodes a plant-specific homeodomain-containing transcriptional regulator, which plays important roles during embryogenesis, as well as in the formation of shoot and flower meristems. Here, we isolated two homologues of Arabidopsis thaliana WUS (AtWUS), GhWUS1a_At and GhWUS1b_At, from upland cotton (Gossypium hirsutum). Domain analysis suggested that the two putative GhWUS proteins contained a highly conserved DNA-binding HOX domain and a WUS-box. Expression profile analysis showed that GhWUSs were predominantly expressed during the embryoid stage. Ectopic expression of GhWUSs in Arabidopsis could induce somatic embryo and shoot formation from seedling root tips. Furthermore, in the absence of exogenous hormone, overexpression of GhWUSs in Arabidopsis could promote shoot regeneration from excised roots, and in the presence of exogenous auxin, excised roots expressing GhWUS could be induced to produce somatic embryo. In addition, expression of the chimeric GhWUS repressor in cotton callus inhibited embryogenic callus formation. Our results show that GhWUS is an important regulator of somatic embryogenesis and shoot regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).

    PubMed

    Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y

    2015-06-01

    Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.

  5. A draft physical map of a D-genome cotton species (Gossypium raimondii)

    PubMed Central

    2010-01-01

    Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427

  6. Mapping quantitative trait loci for lint yield and fiber quality across environments in a Gossypium hirsutum × Gossypium barbadense backcross inbred line population.

    PubMed

    Yu, Jiwen; Zhang, Ke; Li, Shuaiyang; Yu, Shuxun; Zhai, Honghong; Wu, Man; Li, Xingli; Fan, Shuli; Song, Meizhen; Yang, Daigang; Li, Yunhai; Zhang, Jinfa

    2013-01-01

    Identification of stable quantitative trait loci (QTLs) across different environments and mapping populations is a prerequisite for marker-assisted selection (MAS) for cotton yield and fiber quality. To construct a genetic linkage map and to identify QTLs for fiber quality and yield traits, a backcross inbred line (BIL) population of 146 lines was developed from a cross between Upland cotton (Gossypium hirsutum) and Egyptian cotton (Gossypium barbadense) through two generations of backcrossing using Upland cotton as the recurrent parent followed by four generations of self pollination. The BIL population together with its two parents was tested in five environments representing three major cotton production regions in China. The genetic map spanned a total genetic distance of 2,895 cM and contained 392 polymorphic SSR loci with an average genetic distance of 7.4 cM per marker. A total of 67 QTLs including 28 for fiber quality and 39 for yield and its components were detected on 23 chromosomes, each of which explained 6.65-25.27% of the phenotypic variation. Twenty-nine QTLs were located on the At subgenome originated from a cultivated diploid cotton, while 38 were on the Dt subgenome from an ancestor that does not produce spinnable fibers. Of the eight common QTLs (12%) detected in more than two environments, two were for fiber quality traits including one for fiber strength and one for uniformity, and six for yield and its components including three for lint yield, one for seedcotton yield, one for lint percentage and one for boll weight. QTL clusters for the same traits or different traits were also identified. This research represents one of the first reports using a permanent advanced backcross inbred population of an interspecific hybrid population to identify QTLs for fiber quality and yield traits in cotton across diverse environments. It provides useful information for transferring desirable genes from G. barbadense to G. hirsutum using MAS.

  7. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    PubMed

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  8. Evaluating Pilose, a Cultigen of Gossypium hirsutum, as a Source of Resistance to Cotton Fleahopper (Hemiptera: Miridae).

    PubMed

    McLoud, Laura Ann; Knutson, Allen; Campos-Figueroa, Manuel; Smith, C Wayne; Hague, Steven

    2015-08-01

    Cotton fleahopper (Pseudatomoscelis seriatus Reuter) (Hemiptera: Miridae) is a piercing-sucking insect that has emerged as a major pest of cotton (Gossypium hirsutum L.) in Texas. Cotton fleahoppers feed on floral buds, commonly referred to as squares, causing damage and abscission, and subsequent yield loss. Previous studies indicate that plant resistance to cotton fleahopper is present in upland cotton, but the mechanism of resistance remains undetermined. In this study, Pilose, a cultigen of G. hirsutum, was examined as a source of resistance to cotton fleahopper, focusing on mechanism of resistance and heritability of the resistance trait. Results indicated that the resistance trait in Pilose is heritable and that pubescence is causative of resistance or that the resistance trait may be tightly linked to genes controlling pubescence. Behavioral assays indicated nonpreference as a mode of resistance in plants with dense pubescence. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Diallel analysis for technological traits in upland cotton.

    PubMed

    Queiroz, D R; Farias, F J C; Cavalcanti, J J V; Carvalho, L P; Neder, D G; Souza, L S S; Farias, F C; Teodoro, P E

    2017-09-21

    Final cotton quality is of great importance, and it depends on intrinsic and extrinsic fiber characteristics. The objective of this study was to estimate general (GCA) and specific (SCA) combining abilities for technological fiber traits among six upland cotton genotypes and their fifteen hybrid combinations, as well as to determine the effective genetic effects in controlling the traits evaluated. In 2015, six cotton genotypes: FM 993, CNPA 04-2080, PSC 355, TAM B 139-17, IAC 26, and TAMCOT-CAMD-E and fifteen hybrid combinations were evaluated at the Experimental Station of Embrapa Algodão, located in Patos, PB, Brazil. The experimental design was a randomized block with three replications. Technological fiber traits evaluated were: length (mm); strength (gf/tex); fineness (Micronaire index); uniformity (%); short fiber index (%), and spinning index. The diallel analysis was carried out according to the methodology proposed by Griffing, using method II and model I. Significant differences were detected between the treatments and combining abilities (GCA and SCA), indicating the variability of the study material. There was a predominance of additive effects for the genetic control of all traits. TAM B 139-17 presented the best GCA estimates for all traits. The best combinations were: FM 993 x TAM B 139-17, CNPA 04-2080 x PSC 355, FM 993 x TAMCOT-CAMD-E, PSC 355 x TAM B 139-17, and TAM B 139-17 x TAMCOT-CAMD-E, by obtaining the best estimates of SCA, with one of the parents having favorable estimates for GCA.

  10. Gossypium accessions resistant to Rotylenchulus reniformis vary in sensitivity to the herbicide fluometuron

    USDA-ARS?s Scientific Manuscript database

    Reniform nematode (Rotylenchulus reniformis) resistance is being transferred to Upland cotton (Gossypium hirsutum) from its distant relatives. Anecdotal observations of fluometuron damage to LONREN lines with resistance from G. longicalyx raised concerns about introducing herbicide sensitivity from ...

  11. Identification and characterization of CONSTANS-like (COL) gene family in upland cotton (Gossypium hirsutum L.).

    PubMed

    Cai, Darun; Liu, Hui; Sang, Na; Huang, Xianzhong

    2017-01-01

    The CONSTANS/FLOWERING LOCUS T (CO/FT) regulon plays a central role in the control of flowering time in photoperiod-sensitive plants. Flowering time in wild cotton (Gossypium spp.) has strict photoperiod sensitivity, but domesticated cotton is day-neutral. Information on the molecular characterization of the CO and CO-like (COL) genes in cotton is very limited. In this study, we identified 42 COL homologs (GhCOLs) in the G. hirsutum genome, and many of them were previously unreported. We studied their chromosome distribution, phylogenetic relationships, and structures of genes and proteins. Our results showed that GhCOLs were classified into three groups, and 14 COLs in group I showed conserved structure when compared with other plants. Two homoeologous pairs, GhCOL1-A and GhCOL1-D in Group I, showed the highest sequence similarity to Arabidopsis thaliana CO and rice CO homologous gene Heading date1 (Hd1). Tissue-specific expression showed that 42 GhCOL genes may function as tissue-specific regulators in different cells or organs. We cloned and sequenced the 14 GhCOL genes in Group I related to flowering induction to study their diurnal expression pattern, and found that their expression showed distinct circadian regulation. Most of them peaked at dawn and decreased rapidly to their minima at dusk, then started to accumulate until following dawn under long- or short-day conditions. Transgenic study in the Arabidopsis co-2 mutant demonstrated that GhCOL1-A and GhCOL1-D fully rescued the late-flowering phenotype, whereas GhCOL3-A, GhCOL3-D, GhCOL7-A, and GhCOL7-D partially rescued the late-flowering phenotype, and the other five homoeologous pairs in Group I did not promote flowering. These results indicate that GhCOL1-A and GhCOL1-D were potential flowering inducers, and are candidate genes for research in flowering regulation in cotton.

  12. Structure, evolution, and comparative genomics of tetraploid cotton based on a high-density genetic linkage map

    PubMed Central

    Li, Ximei; Jin, Xin; Wang, Hantao; Zhang, Xianlong; Lin, Zhongxu

    2016-01-01

    A high-density linkage map was constructed using 1,885 newly obtained loci and 3,747 previously published loci, which included 5,152 loci with 4696.03 cM in total length and 0.91 cM in mean distance. Homology analysis in the cotton genome further confirmed the 13 expected homologous chromosome pairs and revealed an obvious inversion on Chr10 or Chr20 and repeated inversions on Chr07 or Chr16. In addition, two reciprocal translocations between Chr02 and Chr03 and between Chr04 and Chr05 were confirmed. Comparative genomics between the tetraploid cotton and the diploid cottons showed that no major structural changes exist between DT and D chromosomes but rather between AT and A chromosomes. Blast analysis between the tetraploid cotton genome and the mixed genome of two diploid cottons showed that most AD chromosomes, regardless of whether it is from the AT or DT genome, preferentially matched with the corresponding homologous chromosome in the diploid A genome, and then the corresponding homologous chromosome in the diploid D genome, indicating that the diploid D genome underwent converted evolution by the diploid A genome to form the DT genome during polyploidization. In addition, the results reflected that a series of chromosomal translocations occurred among Chr01/Chr15, Chr02/Chr14, Chr03/Chr17, Chr04/Chr22, and Chr05/Chr19. PMID:27084896

  13. 7 CFR 1427.22 - Commodity certificate exchanges.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Commodity certificate exchanges. 1427.22 Section 1427... Deficiency Payments § 1427.22 Commodity certificate exchanges. (a) For any outstanding marketing assistance loan provided for upland cotton, a producer may purchase a commodity certificate and exchange that...

  14. Anther response to high-temperature stress during development and pollen thermotolerance heterosis as revealed by pollen tube growth and in vitro pollen vigor analysis in upland cotton.

    PubMed

    Song, Guicheng; Wang, Miaomiao; Zeng, Bin; Zhang, Jing; Jiang, Chenliang; Hu, Qirui; Geng, Guangtao; Tang, Canming

    2015-05-01

    Pollen tube growth in styles was strongly inhibited by temperature above 35 °C, and the yield of cotton decreased because of the adverse effect of high temperatures during square development. High-temperature stress during flowering influences the square development of upland cotton (Gossypium hirsutum L.) and cotton yield. Although it is well known that square development is sensitive to high temperature, high-temperature sensitive stages of square development and the effects of high temperature on pollen tube growth in the styles are unknown. The effect of high temperature on anther development corresponding to pollen vigor is unknown during anther development. The objectives of this study were to identify the stages of square development that are sensitive to high temperatures (37/30 and 40/34 °C), to determine whether the abnormal development of squares influenced by high temperature is responsible for the variation in the in vitro germination percent of pollen grains at anthesis, to identify the effect of high temperature on pollen germination in the styles, and to determine pollen thermotolerance heterosis. Our results show that the stages from the sporogenous cell to tetrad stage (square length <6.0 mm) were the most sensitive to high temperature, and the corresponding pollen viability at anthesis was consistent with the changes in the square development stage. Pollen tube growth in the styles was strongly inhibited by temperature above 35 °C, and the yield of cotton decreased because of the effect of high temperature during square development. The thermotolerance of hybrid F1 pollen showed heterosis, and pollen viability could be used as a criterion for screening for high-temperature tolerance cultivars. These results can be used in breeding to develop new cotton cultivars that can withstand high-temperature conditions, particularly in a future warmer climate.

  15. Comparative genomic de-convolution of the cotton genome revealed a decaploid ancestor and widespread chromosomal fractionation.

    PubMed

    Wang, Xiyin; Guo, Hui; Wang, Jinpeng; Lei, Tianyu; Liu, Tao; Wang, Zhenyi; Li, Yuxian; Lee, Tae-Ho; Li, Jingping; Tang, Haibao; Jin, Dianchuan; Paterson, Andrew H

    2016-02-01

    The 'apparently' simple genomes of many angiosperms mask complex evolutionary histories. The reference genome sequence for cotton (Gossypium spp.) revealed a ploidy change of a complexity unprecedented to date, indeed that could not be distinguished as to its exact dosage. Herein, by developing several comparative, computational and statistical approaches, we revealed a 5× multiplication in the cotton lineage of an ancestral genome common to cotton and cacao, and proposed evolutionary models to show how such a decaploid ancestor formed. The c. 70% gene loss necessary to bring the ancestral decaploid to its current gene count appears to fit an approximate geometrical model; that is, although many genes may be lost by single-gene deletion events, some may be lost in groups of consecutive genes. Gene loss following cotton decaploidy has largely just reduced gene copy numbers of some homologous groups. We designed a novel approach to deconvolute layers of chromosome homology, providing definitive information on gene orthology and paralogy across broad evolutionary distances, both of fundamental value and serving as an important platform to support further studies in and beyond cotton and genomics communities. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.

  16. Structure, evolution, and comparative genomics of tetraploid cotton based on a high-density genetic linkage map.

    PubMed

    Li, Ximei; Jin, Xin; Wang, Hantao; Zhang, Xianlong; Lin, Zhongxu

    2016-06-01

    A high-density linkage map was constructed using 1,885 newly obtained loci and 3,747 previously published loci, which included 5,152 loci with 4696.03 cM in total length and 0.91 cM in mean distance. Homology analysis in the cotton genome further confirmed the 13 expected homologous chromosome pairs and revealed an obvious inversion on Chr10 or Chr20 and repeated inversions on Chr07 or Chr16. In addition, two reciprocal translocations between Chr02 and Chr03 and between Chr04 and Chr05 were confirmed. Comparative genomics between the tetraploid cotton and the diploid cottons showed that no major structural changes exist between DT and D chromosomes but rather between AT and A chromosomes. Blast analysis between the tetraploid cotton genome and the mixed genome of two diploid cottons showed that most AD chromosomes, regardless of whether it is from the AT or DT genome, preferentially matched with the corresponding homologous chromosome in the diploid A genome, and then the corresponding homologous chromosome in the diploid D genome, indicating that the diploid D genome underwent converted evolution by the diploid A genome to form the DT genome during polyploidization. In addition, the results reflected that a series of chromosomal translocations occurred among Chr01/Chr15, Chr02/Chr14, Chr03/Chr17, Chr04/Chr22, and Chr05/Chr19. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Progress in Development of Reniform Resistant Germplasm Developed from BARBREN-713

    USDA-ARS?s Scientific Manuscript database

    Following the release of new reniform nematode (Rotylenchulus reniformis Linford and Oliveira) resistant upland cotton (Gossypium hirusutm L.) germplasm lines, such as BARBREN-713, breeding efforts were initiated in 2011 with the goal of improving both yield and fiber quality performance in reniform...

  18. Successful boll development after ovary damage during emasculation of upland cotton flowers

    USDA-ARS?s Scientific Manuscript database

    Gossypium hirsutum flowers are easily emasculated by splitting the staminal column with the fingernail and removing the corolla and androecium. However, any damage to the ovary is considered detrimental to successful boll formation and damaged flowers are typically discarded. This study evaluated ...

  19. Exotic germplasm introgression effect on agronomic and fiber properties of upland cotton

    USDA-ARS?s Scientific Manuscript database

    Genetic diversity is an important breeder’s tool for selection and improvement in crop cultivar development. Any successful breeding program depends on selecting superior quality parents. Lack of genetic diversity limits the potential of the breeder in selecting elite parents. Genetic uniformity pre...

  20. 7 CFR 2.65 - Administrator, Agricultural Research Service.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... States population and special high-risk groups; and (iii) Design and carry out methodological research... designed to reduce the cost of producing upland cotton in the United States (7 U.S.C. 1441 note). (16...: (i) Design and carry out periodic nationwide food consumption surveys to measure household food...

  1. 7 CFR 2.65 - Administrator, Agricultural Research Service.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... groups; and (iii) Design and carry out methodological research studies to develop improved procedures for... designed to reduce the cost of producing upland cotton in the United States (7 U.S.C. 1441 note). (16... Research Program. Included in this delegation is the authority to: (i) Design and carry out periodic...

  2. 7 CFR 2.65 - Administrator, Agricultural Research Service.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... groups; and (iii) Design and carry out methodological research studies to develop improved procedures for... designed to reduce the cost of producing upland cotton in the United States (7 U.S.C. 1441 note). (16... Research Program. Included in this delegation is the authority to: (i) Design and carry out periodic...

  3. 7 CFR 2.65 - Administrator, Agricultural Research Service.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... groups; and (iii) Design and carry out methodological research studies to develop improved procedures for... designed to reduce the cost of producing upland cotton in the United States (7 U.S.C. 1441 note). (16... Research Program. Included in this delegation is the authority to: (i) Design and carry out periodic...

  4. 7 CFR 2.65 - Administrator, Agricultural Research Service.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... designed to reduce the cost of producing upland cotton in the United States (7 U.S.C. 1441 note). (16... this delegation is the authority to: (i) Design and carry out periodic nationwide food consumption surveys to measure household food consumption; (ii) Design and carry out a continuous, longitudinal...

  5. Identifying drought adaptive traits in upland cotton using a proximal sensing cart for high-throughput phenotyping

    USDA-ARS?s Scientific Manuscript database

    Field-based high-throughput phenotyping is an emerging approach to characterize difficult, time-sensitive plant traits in relevant growing conditions. Proximal sensing carts have been developed as an alternative platform to more costly high-clearance tractors for phenotyping dynamic traits in the fi...

  6. 7 CFR 1412.1 - Applicability, statutory changes, interest, and contract provisions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ..., oats, upland cotton, rice, peanuts, soybeans, sunflower seed, rapeseed, canola, safflower, flaxseed, mustard seed, crambe, sesame seed, pulse crops, and other designated oilseeds as determined and announced... contract. Also, if any refund comes due to CCC under this part, interest will be due from the date of the...

  7. 7 CFR 1412.1 - Applicability, statutory changes, interest, and contract provisions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ..., oats, upland cotton, rice, peanuts, soybeans, sunflower seed, rapeseed, canola, safflower, flaxseed, mustard seed, crambe, sesame seed, pulse crops, and other designated oilseeds as determined and announced... contract. Also, if any refund comes due to CCC under this part, interest will be due from the date of the...

  8. 7 CFR 1412.1 - Applicability, statutory changes, interest, and contract provisions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ..., oats, upland cotton, rice, peanuts, soybeans, sunflower seed, rapeseed, canola, safflower, flaxseed, mustard seed, crambe, sesame seed, pulse crops, and other designated oilseeds as determined and announced... contract. Also, if any refund comes due to CCC under this part, interest will be due from the date of the...

  9. Molecular confirmation of Gossypium hirsutum chromosome substitution lines and interspecific F1 hypoaneuploids

    USDA-ARS?s Scientific Manuscript database

    The tetraploid Gossypium species G. barbadense, G. tomentosum, and G. mustelinum (2n=52) are useful sources of important genes for pest and disease resistance, and for improved agronomic and fiber traits in Upland cotton (G. hirsutum). Cytological analyses of hybrids and comparative linkage mapping...

  10. 7 CFR 1427.19 - Repayment of loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... loan level and charges, plus interest determined for such bales; or (ii) The adjusted world price, as... announce the adjusted world price for each crop of upland cotton on a weekly basis. (e) The difference.... Eastern Standard time the next workday until an announcement of the adjusted world price for the...

  11. 7 CFR 1427.19 - Repayment of loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... loan level and charges, plus interest determined for such bales; or (ii) The adjusted world price, as... announce the adjusted world price for each crop of upland cotton on a weekly basis. (e) The difference.... Eastern Standard time the next workday until an announcement of the adjusted world price for the...

  12. Genomic heterozygosity and hybrid breakdown in cotton (Gossypium): different traits, different effects.

    PubMed

    Dai, Baosheng; Guo, Huanle; Huang, Cong; Zhang, Xianlong; Lin, Zhongxu

    2016-04-12

    Hybrid breakdown has been well documented in various species. Relationships between genomic heterozygosity and traits-fitness have been extensively explored especially in the natural populations. But correlations between genomic heterozygosity and vegetative and reproductive traits in cotton interspecific populations have not been studied. In the current study, two reciprocal F2 populations were developed using Gossypium hirsutum cv. Emian 22 and G. barbadense acc. 3-79 as parents to study hybrid breakdown in cotton. A total of 125 simple sequence repeat (SSR) markers were used to genotype the two F2 interspecific populations. To guarantee mutual independence among the genotyped markers, the 125 SSR markers were checked by the linkage disequilibrium analysis. To our knowledge, this is a novel approach to evaluate the individual genomic heterozygosity. After marker checking, 83 common loci were used to assess the extent of genomic heterozygosity. Hybrid breakdown was found extensively in the two interspecific F2 populations particularly on the reproductive traits because of the infertility and the bare seeds. And then, the relationships between the genomic heterozygosity and the vegetative reproductive traits were investigated. The only relationships between hybrid breakdown and heterozygosity were observed in the (Emian22 × 3-79) F2 population for seed index (SI) and boll number per plant (BN). The maternal cytoplasmic environment may have a significant effect on genomic heterozygosity and on correlations between heterozygosity and reproductive traits. A novel approach was used to evaluate genomic heterozygosity in cotton; and hybrid breakdown was observed in reproductive traits in cotton. These findings may offer new insight into hybrid breakdown in allotetraploid cotton interspecific hybrids, and may be useful for the development of interspecific hybrids for cotton genetic improvement.

  13. Silencing GhNDR1 and GhMKK2 compromised cotton resistance to Verticillium wilt

    PubMed Central

    Gao, Xiquan; Wheeler, Terry; Li, Zhaohu; Kenerley, Charles M.; He, Ping; Shan, Libo

    2011-01-01

    SUMMARY Cotton is an important cash crop worldwide and serves as a significant source of fiber, feed, foodstuff, oil and biofuel products. Considerable effort in genetics and genomics has been expended to increase sustainable yield and quality through molecular breeding and genetic engineering of new cotton cultivars. With the effort of whole genome sequencing of cotton, it is essential to develop molecular tools and resources for large-scale analysis of gene functions at the genome-wide level. We have successfully established an Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in several cotton cultivars with different genetic backgrounds. The genes of interest were potently and readily silenced within 2 weeks after inoculation at the seedling stage. Importantly, we showed that silencing GhNDR1 and GhMKK2 compromised cotton resistance to the infection by Verticillium dahliae, a fungal pathogen causing Verticillium wilt. Furthermore, we established a cotton protoplast system for transient gene expression to study gene functions by a gain-of-function approach. The viable protoplasts were isolated from green cotyledons, etiolated cotyledons, and true leaves, and responded to a wide range of pathogen elicitors and phytohormones. Remarkably, cotton plants possess conserved, but also distinct MAP kinase activation with Arabidopsis upon bacterial elicitor flagellin perception. Thus, we demonstrated that GhNDR1 and GhMKK2 are required for Verticillium resistance in cotton using gene silencing assays, and established the high throughput loss-of-function and gain-of-function assays for functional genomic studies in cotton. PMID:21219508

  14. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    USDA-ARS?s Scientific Manuscript database

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  15. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome

    USDA-ARS?s Scientific Manuscript database

    Cotton fibers represent the largest single cell in the plant kingdom, and they have been used as a model to study cell function, differentiation, maturation, and cell death. The cotton fiber transcriptome can be clustered into two genomic regions: conserved and recombination hotspots. Genetic link...

  16. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    PubMed Central

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource for tetraploid cotton genome assembly, for cloning genes related to superior agronomic traits, and for further comparative genomic analyses in Gossypium. PMID:23046547

  17. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

    PubMed Central

    Paterson, Andrew H.; Wang, Xuelin; Xu, Yiqing; Wu, Dongyang; Qu, Yanshu; Jiang, Anna; Ye, Qiaolin

    2016-01-01

    Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp) genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt) DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb) in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense) than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants. PMID:27847816

  18. Cocoa/Cotton Comparative Genomics

    USDA-ARS?s Scientific Manuscript database

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  19. Biological fabrication of cellulose fibers with tailored properties

    NASA Astrophysics Data System (ADS)

    Natalio, Filipe; Fuchs, Regina; Cohen, Sidney R.; Leitus, Gregory; Fritz-Popovski, Gerhard; Paris, Oskar; Kappl, Michael; Butt, Hans-Jürgen

    2017-09-01

    Cotton is a promising basis for wearable smart textiles. Current approaches that rely on fiber coatings suffer from function loss during wear. We present an approach that allows biological incorporation of exogenous molecules into cotton fibers to tailor the material’s functionality. In vitro model cultures of upland cotton (Gossypium hirsutum) are incubated with 6-carboxyfluorescein-glucose and dysprosium-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-glucose, where the glucose moiety acts as a carrier capable of traveling from the vascular connection to the outermost cell layer of the ovule epidermis, becoming incorporated into the cellulose fibers. This yields fibers with unnatural properties such as fluorescence or magnetism. Combining biological systems with the appropriate molecular design offers numerous possibilities to grow functional composite materials and implements a material-farming concept.

  20. A global assembly of cotton ESTs

    PubMed Central

    Udall, Joshua A.; Swanson, Jordan M.; Haller, Karl; Rapp, Ryan A.; Sparks, Michael E.; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B.; Sickler, Brad A.; Wilkins, Thea A.; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R.; Pierce, Margaret L.; Essenberg, Margaret; Kim, HyeRan; Llewellyn, Danny J.; Dennis, Elizabeth S.; Kudrna, David; Wing, Rod; Paterson, Andrew H.; Soderlund, Cari; Wendel, Jonathan F.

    2006-01-01

    Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; AT and DT genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941

  1. Genotypic and environmental effects on cottonseed oil, nitrogen, and gossypol contents in eighteen years Regional High Quality tests

    USDA-ARS?s Scientific Manuscript database

    Determination of environmental influence on seed traits is critical for genetic improvement of seed quality in Upland cotton (Gossypium hirsutum L.). The objective of this study was to analyze the relative contribution of environment and genotype (G) for seed oil, nitrogen (N), and gossypol content...

  2. Chemical variation for fiber cuticular wax levels in upland cotton (Gossypium hirsutum) evaluated under contrasting irrigation regimes

    USDA-ARS?s Scientific Manuscript database

    Fiber quality is important for the sale of bulk fiber to textile mills for processing but is affected by many environmental factors, including water deficit. These environmental factors have made it difficult to identify the primary determinants of fiber quality which has spurred renewed research ef...

  3. 7 CFR 28.402 - Strict Middling Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Strict Middling Color. 28.402 Section 28.402... for the Color Grade of American Upland Cotton § 28.402 Strict Middling Color. Strict Middling Color is color which is within the range represented by a set of samples in the custody of the United States...

  4. 7 CFR 28.402 - Strict Middling Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Strict Middling Color. 28.402 Section 28.402... for the Color Grade of American Upland Cotton § 28.402 Strict Middling Color. Strict Middling Color is color which is within the range represented by a set of samples in the custody of the United States...

  5. 7 CFR 28.402 - Strict Middling Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Strict Middling Color. 28.402 Section 28.402... for the Color Grade of American Upland Cotton § 28.402 Strict Middling Color. Strict Middling Color is color which is within the range represented by a set of samples in the custody of the United States...

  6. 7 CFR 28.402 - Strict Middling Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Strict Middling Color. 28.402 Section 28.402... for the Color Grade of American Upland Cotton § 28.402 Strict Middling Color. Strict Middling Color is color which is within the range represented by a set of samples in the custody of the United States...

  7. Using experimental design and spatial analyses to improve the precision of NDVI estimates in upland cotton field trials

    USDA-ARS?s Scientific Manuscript database

    Controlling for spatial variability is important in high-throughput phenotyping studies that enable large numbers of genotypes to be evaluated across time and space. In the current study, we compared the efficacy of different experimental designs and spatial models in the analysis of canopy spectral...

  8. Registration of tufted-naked seed in upland cotton germplasm 9023n4t

    USDA-ARS?s Scientific Manuscript database

    A naked-tufted mutant called 9023n4t (PI 667553) was developed from the cultivar SC 9023 (Gossypium hirsutum L.) through chemical mutagenesis. This germplasm was developed by the Department of Plant and Soil Science, Texas Tech University and released in April, 2013. This mutant is quite unique sinc...

  9. 7 CFR 28.402 - Strict Middling Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Middling Color. 28.402 Section 28.402... for the Color Grade of American Upland Cotton § 28.402 Strict Middling Color. Strict Middling Color is color which is within the range represented by a set of samples in the custody of the United States...

  10. Genetic effects of chromosomes 01, 04, and 18 from three tetraploid gossypium species in topcrosses with five elite cultivars

    USDA-ARS?s Scientific Manuscript database

    Chromosome substitution lines (CSL) have been developed for selected chromosomes from two tetraploid species of Gossypium and have been shown to be effective ways to target introgression of useful alleles from exotic tetraploid species into Upland cotton, G. hirsutum L. Genetic effects of chromosome...

  11. Genome Sequence of Pantoea annatis strain CFH 7-1, which is associated with a vector-borne cotton fruit disease

    USDA-ARS?s Scientific Manuscript database

    Pantoea ananatis is a bacterium with versatile niches that vary from pathogenic to beneficial. We present the genome of strain CFH 7-1, which was recovered from a diseased greenhouse cotton boll previously caged with a field-collected cotton fleahopper (Pseudatomoscelis seriatus). These data will ...

  12. Mapping-by-sequencing of Ligon-lintless-1 (Li 1 ) reveals a cluster of neighboring genes with correlated expression in developing fibers of Upland cotton (Gossypium hirsutum L.).

    PubMed

    Thyssen, Gregory N; Fang, David D; Turley, Rickie B; Florane, Christopher; Li, Ping; Naoumkina, Marina

    2015-09-01

    Mapping-by-sequencing and SNP marker analysis were used to fine map the Ligon-lintless-1 ( Li 1 ) short fiber mutation in tetraploid cotton to a 255-kb region that contains 16 annotated proteins. The Ligon-lintless-1 (Li 1 ) mutant of cotton (Gossypium hirsutum L.) has been studied as a model for cotton fiber development since its identification in 1929; however, the causative mutation has not been identified yet. Here we report the fine genetic mapping of the mutation to a 255-kb region that contains only 16 annotated genes in the reference Gossypium raimondii genome. We took advantage of the incompletely dominant dwarf vegetative phenotype to identify 100 mutants (Li 1 /Li 1 ) and 100 wild-type (li 1 /li 1 ) homozygotes from a mapping population of 2567 F2 plants, which we bulked and deep sequenced. Since only homozygotes were sequenced, we were able to use a high stringency in SNP calling to rapidly narrow down the region harboring the Li 1 locus, and designed subgenome-specific SNP markers to test the population. We characterized the expression of all sixteen genes in the region by RNA sequencing of elongating fibers and by RT-qPCR at seven time points spanning fiber development. One of the most highly expressed genes found in this interval in wild-type fiber cells is 40-fold under-expressed at the day of anthesis (DOA) in the mutant fiber cells.  This gene is a major facilitator superfamily protein, part of the large family of proteins that includes auxin and sugar transporters. Interestingly, nearly all genes in this region were most highly expressed at DOA and showed a high degree of co-expression. Further characterization is required to determine if transport of hormones or carbohydrates is involved in both the dwarf and lintless phenotypes of Li 1 plants.

  13. Cotton transformation via pollen tube pathway.

    PubMed

    Wang, Min; Zhang, Baohong; Wang, Qinglian

    2013-01-01

    Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

  14. Alleviation of lead-induced physiological, metabolic, and ultramorphological changes in leaves of upland cotton through glutathione.

    PubMed

    Khan, Mumtaz; Daud, M K; Basharat, Ali; Khan, Muhammad Jamil; Azizullah, Azizullah; Muhammad, Niaz; Muhammad, Noor; Ur Rehman, Zia; Zhu, Shui Jin

    2016-05-01

    Plants face changes in leaves under lead (Pb) toxicity. Reduced glutathione (GSH) has several functions in plant metabolism, but its role in alleviating Pb toxicity in cotton leaves is still unknown. In the present study, cotton seedlings (28 days old) were exposed to 500 μM Pb and 50 μM GSH, both alone and in combination, for a period of 10 days, in the Hoagland solution under controlled growth conditions. Results revealed Pb-induced changes in cotton's leaf morphology, photosynthesis, and oxidative metabolism. However, exogenous application of GSH restored leaf growth. GSH triggered build up of chlorophyll a, chlorophyll b, and carotenoid contents and boosted fluorescence ratios (F v/F m and F v/F 0). Moreover, GSH reduced the malondialdehyde (MDA), hydrogen peroxide (H2O2), and Pb contents in cotton leaves. Results further revealed that total soluble protein contents were decreased under Pb toxicity; however, exogenously applied GSH improved these contents in cotton leaves. Activities of antioxidant enzymes (catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), glutathione reductase (GR), and ascorbate peroxidase (APX)) were also increased by GSH application under Pb toxicity. Microscopic analysis showed that excess Pb shattered thylakoid membranes in chloroplasts. However, GSH stabilized ultrastructure of Pb-stressed cotton leaves. These findings suggested that exogenously applied GSH lessened the adverse effects of Pb and improved cotton's tolerance to oxidative stress.

  15. Genomics-enabled analysis of the emergent disease cotton bacterial blight

    PubMed Central

    Phillips, Anne Z.; Burke, Jillian; Bunn, J. Imani; Allen, Tom W.; Wheeler, Terry

    2017-01-01

    Cotton bacterial blight (CBB), an important disease of (Gossypium hirsutum) in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm) strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars. PMID:28910288

  16. Multivariate Analysis of the Cotton Seed Ionome Reveals a Shared Genetic Architecture

    PubMed Central

    Pauli, Duke; Ziegler, Greg; Ren, Min; Jenks, Matthew A.; Hunsaker, Douglas J.; Zhang, Min; Baxter, Ivan; Gore, Michael A.

    2018-01-01

    To mitigate the effects of heat and drought stress, a better understanding of the genetic control of physiological responses to these environmental conditions is needed. To this end, we evaluated an upland cotton (Gossypium hirsutum L.) mapping population under water-limited and well-watered conditions in a hot, arid environment. The elemental concentrations (ionome) of seed samples from the population were profiled in addition to those of soil samples taken from throughout the field site to better model environmental variation. The elements profiled in seeds exhibited moderate to high heritabilities, as well as strong phenotypic and genotypic correlations between elements that were not altered by the imposed irrigation regimes. Quantitative trait loci (QTL) mapping results from a Bayesian classification method identified multiple genomic regions where QTL for individual elements colocalized, suggesting that genetic control of the ionome is highly interrelated. To more fully explore this genetic architecture, multivariate QTL mapping was implemented among groups of biochemically related elements. This analysis revealed both additional and pleiotropic QTL responsible for coordinated control of phenotypic variation for elemental accumulation. Machine learning algorithms that utilized only ionomic data predicted the irrigation regime under which genotypes were evaluated with very high accuracy. Taken together, these results demonstrate the extent to which the seed ionome is genetically interrelated and predictive of plant physiological responses to adverse environmental conditions. PMID:29437829

  17. Gene copy number evolution during tetraploid cotton radiation.

    PubMed

    Rong, J; Feltus, F A; Liu, L; Lin, L; Paterson, A H

    2010-11-01

    After polyploid formation, retention or loss of duplicated genes is not random. Genes with some functional domains are convergently restored to 'singleton' state after many independent genome duplications, and have been referred to as 'duplication-resistant' (DR) genes. To further explore the timeframe for their restoration to the singleton state, 27 cotton homologs of genes found to be 'DR' in Arabidopsis were selected based on diagnostic Pfam domains. Their copy numbers were studied using southern hybridization and sequence analysis in five tetraploid species and their ancestral A and D genome diploids. DR genes had significantly lower copy number than gene families hybridizing to randomly selected cotton ESTs. Three DR genes showed complete loss of D genome-derived homoeologs in some or all tetraploid species. Prior analysis has shown gene loss in polyploid cotton to be rare, and herein only one randomly selected gene showed loss of a homoeolog in only one of the five tetraploid species (Gossypium mustelinum). BAC sequencing confirmed two cases of gene loss in tetraploid cotton. Divergence among 5' sequences of DR genes amplified from G. arboreum, G. raimondii, and Gossypioides kirkii was correlated with gene copy number. These results show that genes containing Pfam domains associated with duplication resistance in Arabidopsis have also been preferentially restored to low copy number after a more recent polyploidization event in cotton. In tetraploid cotton, genes from the progenitor D genome seem to experience more gene copy number divergence than genes from the A genome. Together with D subgenome-biased alterations in gene expression, perhaps gene loss may contribute to the relatively larger portion of quantitative trait variation attributable to D than A subgenome chromosomes of tetraploid cotton.

  18. 7 CFR 28.525 - Symbols and code numbers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... designations in inches. (a) Symbols and Code numbers used for Color Grades of American Upland Cotton. Color... 41 Low Middling LM 51 Strict Good Ordinary SGO 61 Good Ordinary GO 71 Good Middling Light Spotted GM Lt SP 12 Strict Middling Light Spotted SM Lt Sp 22 Middling Light Spotted Mid Lt Sp 32 Strict Low...

  19. 7 CFR 28.525 - Symbols and code numbers.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... designations in inches. (a) Symbols and Code numbers used for Color Grades of American Upland Cotton. Color... 41 Low Middling LM 51 Strict Good Ordinary SGO 61 Good Ordinary GO 71 Good Middling Light Spotted GM Lt SP 12 Strict Middling Light Spotted SM Lt Sp 22 Middling Light Spotted Mid Lt Sp 32 Strict Low...

  20. 7 CFR 28.525 - Symbols and code numbers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... designations in inches. (a) Symbols and Code numbers used for Color Grades of American Upland Cotton. Color... 41 Low Middling LM 51 Strict Good Ordinary SGO 61 Good Ordinary GO 71 Good Middling Light Spotted GM Lt SP 12 Strict Middling Light Spotted SM Lt Sp 22 Middling Light Spotted Mid Lt Sp 32 Strict Low...

  1. 7 CFR 28.525 - Symbols and code numbers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... designations in inches. (a) Symbols and Code numbers used for Color Grades of American Upland Cotton. Color... 41 Low Middling LM 51 Strict Good Ordinary SGO 61 Good Ordinary GO 71 Good Middling Light Spotted GM Lt SP 12 Strict Middling Light Spotted SM Lt Sp 22 Middling Light Spotted Mid Lt Sp 32 Strict Low...

  2. 7 CFR 28.525 - Symbols and code numbers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... designations in inches. (a) Symbols and Code numbers used for Color Grades of American Upland Cotton. Color... 41 Low Middling LM 51 Strict Good Ordinary SGO 61 Good Ordinary GO 71 Good Middling Light Spotted GM Lt SP 12 Strict Middling Light Spotted SM Lt Sp 22 Middling Light Spotted Mid Lt Sp 32 Strict Low...

  3. 7 CFR 28.404 - Strict Low Middling Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Strict Low Middling Color. 28.404 Section 28.404... for the Color Grade of American Upland Cotton § 28.404 Strict Low Middling Color. Strict Low Middling Color is color which is within the range represented by a set of samples in the custody of the United...

  4. 7 CFR 28.406 - Strict Good Ordinary Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Strict Good Ordinary Color. 28.406 Section 28.406... for the Color Grade of American Upland Cotton § 28.406 Strict Good Ordinary Color. Strict Good Ordinary Color is color which is within the range represented by a set of samples in the custody of the...

  5. 7 CFR 28.404 - Strict Low Middling Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Strict Low Middling Color. 28.404 Section 28.404... for the Color Grade of American Upland Cotton § 28.404 Strict Low Middling Color. Strict Low Middling Color is color which is within the range represented by a set of samples in the custody of the United...

  6. 7 CFR 28.404 - Strict Low Middling Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Strict Low Middling Color. 28.404 Section 28.404... for the Color Grade of American Upland Cotton § 28.404 Strict Low Middling Color. Strict Low Middling Color is color which is within the range represented by a set of samples in the custody of the United...

  7. 7 CFR 28.406 - Strict Good Ordinary Color.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Strict Good Ordinary Color. 28.406 Section 28.406... for the Color Grade of American Upland Cotton § 28.406 Strict Good Ordinary Color. Strict Good Ordinary Color is color which is within the range represented by a set of samples in the custody of the...

  8. 7 CFR 28.406 - Strict Good Ordinary Color.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Strict Good Ordinary Color. 28.406 Section 28.406... for the Color Grade of American Upland Cotton § 28.406 Strict Good Ordinary Color. Strict Good Ordinary Color is color which is within the range represented by a set of samples in the custody of the...

  9. 7 CFR 28.406 - Strict Good Ordinary Color.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Strict Good Ordinary Color. 28.406 Section 28.406... for the Color Grade of American Upland Cotton § 28.406 Strict Good Ordinary Color. Strict Good Ordinary Color is color which is within the range represented by a set of samples in the custody of the...

  10. 7 CFR 28.404 - Strict Low Middling Color.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Strict Low Middling Color. 28.404 Section 28.404... for the Color Grade of American Upland Cotton § 28.404 Strict Low Middling Color. Strict Low Middling Color is color which is within the range represented by a set of samples in the custody of the United...

  11. Field experimental design comparisons to detect field effects associated with agronomic traits in Upland cotton

    USDA-ARS?s Scientific Manuscript database

    Field variation is one of the important factors that can have a significant impact on genetic data analysis. Ineffective control of field variation may result in an inflated residual variance and/or biased estimation of genetic variations and/or effects. In this study, we addressed this problem by m...

  12. Four chromosome-specific (Gossypium barbadense chromosome 5sh) Upland cotton RILs with improved elongation

    USDA-ARS?s Scientific Manuscript database

    A chromosome specific recombinant inbred line (CS-B05shRIL) population was created from a cross of TM-1, the genetic standard line of Gossypium hirsutum L. and CS-B05sh, a previously released interspecific chromosome substitution line in which all of the chromosome pairs are genetically similar to T...

  13. Investigation of the influence of leaf thickness on canopy reflectance and physiological traits in upland and Pima cotton populations

    USDA-ARS?s Scientific Manuscript database

    Field-based, high-throughput phenotyping (FB-HTP) methods are becoming more prevalent in plant genetics and breeding because they enable the evaluation of large numbers of genotypes under actual field conditions. Many systems for FB-HTP quantify and characterize the reflected radiation from the crop...

  14. 7 CFR 28.406 - Strict Good Ordinary Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Good Ordinary Color. 28.406 Section 28.406... for the Color Grade of American Upland Cotton § 28.406 Strict Good Ordinary Color. Strict Good Ordinary Color is color which is within the range represented by a set of samples in the custody of the...

  15. 7 CFR 28.404 - Strict Low Middling Color.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Low Middling Color. 28.404 Section 28.404... for the Color Grade of American Upland Cotton § 28.404 Strict Low Middling Color. Strict Low Middling Color is color which is within the range represented by a set of samples in the custody of the United...

  16. The use of disease severity variables in predicting efficacy of FOV4 resistance selection

    USDA-ARS?s Scientific Manuscript database

    In 2015, 85 Upland (Gossypium hirsutum L.) accessions from the USDA-ARS Cotton Collection and 126 F6 Pima-S6 x Pima-S7 (G. barbadense L.) recombinant inbred lines were evaluated for disease performance under pressure of Fusarium oxysporum f. sp. vasinfectum race 4 (FOV4) in a replicated field trial ...

  17. Transcript profiling by microarray and marker analysis of the short cotton (Gossypium hirsutum L.) fiber mutant Ligon lintless-1 (Li1).

    PubMed

    Gilbert, Matthew K; Turley, Rickie B; Kim, Hee Jin; Li, Ping; Thyssen, Gregory; Tang, Yuhong; Delhom, Christopher D; Naoumkina, Marina; Fang, David D

    2013-06-17

    Cotton fiber length is very important to the quality of textiles. Understanding the genetics and physiology of cotton fiber elongation can provide valuable tools to the cotton industry by targeting genes or other molecules responsible for fiber elongation. Ligon Lintless-1 (Li1) is a monogenic mutant in Upland cotton (Gossypium hirsutum) which exhibits an early cessation of fiber elongation resulting in very short fibers (< 6 mm) at maturity. This presents an excellent model system for studying the underlying molecular and cellular processes involved with cotton fiber elongation. Previous reports have characterized Li1 at early cell wall elongation and during later secondary cell wall synthesis, however there has been very limited analysis of the transition period between these developmental time points. Physical and morphological measurements of the Li1 mutant fibers were conducted, including measurement of the cellulose content during development. Affymetrix microarrays were used to analyze transcript profiles at the critical developmental time points of 3 days post anthesis (DPA), the late elongation stage of 12 DPA and the early secondary cell wall synthesis stage of 16 DPA. The results indicated severe disruption to key hormonal and other pathways related to fiber development, especially pertaining to the transition stage from elongation to secondary cell wall synthesis. Gene Ontology enrichment analysis identified several key pathways at the transition stage that exhibited altered regulation. Genes involved in ethylene biosynthesis and primary cell wall rearrangement were affected, and a primary cell wall-related cellulose synthase was transcriptionally repressed. Linkage mapping using a population of 2,553 F2 individuals identified SSR markers associated with the Li1 genetic locus on chromosome 22. Linkage mapping in combination with utilizing the diploid G. raimondii genome sequences permitted additional analysis of the region containing the Li1 gene. The early termination of fiber elongation in the Li1 mutant is likely controlled by an early upstream regulatory factor resulting in the altered regulation of hundreds of downstream genes. Several elongation-related genes that exhibited altered expression profiles in the Li1 mutant were identified. Molecular markers closely associated with the Li1 locus were developed. Results presented here will lay the foundation for further investigation of the genetic and molecular mechanisms of fiber elongation.

  18. BAC-pool 454-sequencing: A rapid and efficient approach to sequence complex tetraploid cotton genomes

    USDA-ARS?s Scientific Manuscript database

    New and emerging next generation sequencing technologies have been promising in reducing sequencing costs, but not significantly for complex polyploid plant genomes such as cotton. Large and highly repetitive genome of G. hirsutum (~2.5GB) is less amenable and cost-intensive with traditional BAC-by...

  19. Genome sequence of the cultivated cotton Gossypium arboreum

    USDA-ARS?s Scientific Manuscript database

    Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...

  20. The complete chloroplast genome sequence of Gossypium hirsutum: organization and phylogenetic relationships to other angiosperms

    PubMed Central

    Lee, Seung-Bum; Kaittanis, Charalambos; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry

    2006-01-01

    Background Cotton (Gossypium hirsutum) is the most important fiber crop grown in 90 countries. In 2004–2005, US farmers planted 79% of the 5.7-million hectares of nuclear transgenic cotton. Unfortunately, genetically modified cotton has the potential to hybridize with other cultivated and wild relatives, resulting in geographical restrictions to cultivation. However, chloroplast genetic engineering offers the possibility of containment because of maternal inheritance of transgenes. The complete chloroplast genome of cotton provides essential information required for genetic engineering. In addition, the sequence data were used to assess phylogenetic relationships among the major clades of rosids using cotton and 25 other completely sequenced angiosperm chloroplast genomes. Results The complete cotton chloroplast genome is 160,301 bp in length, with 112 unique genes and 19 duplicated genes within the IR, containing a total of 131 genes. There are four ribosomal RNAs, 30 distinct tRNA genes and 17 intron-containing genes. The gene order in cotton is identical to that of tobacco but lacks rpl22 and infA. There are 30 direct and 24 inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Most of the direct repeats are within intergenic spacer regions, introns and a 72 bp-long direct repeat is within the psaA and psaB genes. Comparison of protein coding sequences with expressed sequence tags (ESTs) revealed nucleotide substitutions resulting in amino acid changes in ndhC, rpl23, rpl20, rps3 and clpP. Phylogenetic analysis of a data set including 61 protein-coding genes using both maximum likelihood and maximum parsimony were performed for 28 taxa, including cotton and five other angiosperm chloroplast genomes that were not included in any previous phylogenies. Conclusion Cotton chloroplast genome lacks rpl22 and infA and contains a number of dispersed direct and inverted repeats. RNA editing resulted in amino acid changes with significant impact on their hydropathy. Phylogenetic analysis provides strong support for the position of cotton in the Malvales in the eurosids II clade sister to Arabidopsis in the Brassicales. Furthermore, there is strong support for the placement of the Myrtales sister to the eurosid I clade, although expanded taxon sampling is needed to further test this relationship. PMID:16553962

  1. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

    PubMed

    Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

    2010-02-01

    To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

  2. A polyketide synthase gene and an aspartate kinase like gene are required for the biosynthesis of fusaric acid in Fusarium Oxysporum f. sp. Vasinfectum

    USDA-ARS?s Scientific Manuscript database

    A genetically unique strain of the Fusarium wilt pathogen was first recognized in wilted and dead Upland cotton seedlings in Australia in 1993. Since that time the disease spread rapidly despite stringent containment practices. The Australian biotype isolates of Fusarium oxysporum f. sp. vasinfec...

  3. Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of horizontal gene transfer from Fusarium.

    PubMed

    Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng

    2018-01-01

    Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  4. Biological fabrication of cellulose fibers with tailored properties.

    PubMed

    Natalio, Filipe; Fuchs, Regina; Cohen, Sidney R; Leitus, Gregory; Fritz-Popovski, Gerhard; Paris, Oskar; Kappl, Michael; Butt, Hans-Jürgen

    2017-09-15

    Cotton is a promising basis for wearable smart textiles. Current approaches that rely on fiber coatings suffer from function loss during wear. We present an approach that allows biological incorporation of exogenous molecules into cotton fibers to tailor the material's functionality. In vitro model cultures of upland cotton ( Gossypium hirsutum ) are incubated with 6-carboxyfluorescein-glucose and dysprosium-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-glucose, where the glucose moiety acts as a carrier capable of traveling from the vascular connection to the outermost cell layer of the ovule epidermis, becoming incorporated into the cellulose fibers. This yields fibers with unnatural properties such as fluorescence or magnetism. Combining biological systems with the appropriate molecular design offers numerous possibilities to grow functional composite materials and implements a material-farming concept. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  5. Structural analysis of Gossypium hirsutum fibers grown under greenhouse and hydroponic conditions.

    PubMed

    Natalio, Filipe; Tahir, Muhammad Nawaz; Friedrich, Norman; Köck, Margret; Fritz-Popovski, Gerhard; Paris, Oskar; Paschke, Reinhard

    2016-06-01

    Cotton is the one of the world's most important crops. Like any other crop, cotton growth/development and fiber quality is highly dependent on environmental factors. Increasing global weather instability has been negatively impacting its economy. Cotton is a crop that exerts an intensive pressure over natural resources (land and water) and demands an overuse of pesticides. Thus, the search for alternative cotton culture methods that are pesticide-free (biocotton) and enable customized standard fiber quality should be encouraged. Here we describe a culture of Gossypium hirsutum ("Upland" Cotton) utilizing a greenhouse and hydroponics in which the fibers are morphological similar to conventional cultures and structurally fit into the classical two-phase cellulose I model with 4.19nm crystalline domains surrounded by amorphous regions. These fibers exhibit a single crystalline form of cellulose I-Iß, monoclinic unit cell. Fiber quality bulk analysis shows an improved length, strength, whiteness when compared with soil-based cultures. Finally, we show that our fibers can be spun, used for production of non-woven fabrics and indigo-vat stained demonstrating its potential in industrial and commercial applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Evaluation of genotype x environment interactions in cotton using the method proposed by Eberhart and Russell and reaction norm models.

    PubMed

    Alves, R S; Teodoro, P E; Farias, F C; Farias, F J C; Carvalho, L P; Rodrigues, J I S; Bhering, L L; Resende, M D V

    2017-08-17

    Cotton produces one of the most important textile fibers of the world and has great relevance in the world economy. It is an economically important crop in Brazil, which is the world's fifth largest producer. However, studies evaluating the genotype x environment (G x E) interactions in cotton are scarce in this country. Therefore, the goal of this study was to evaluate the G x E interactions in two important traits in cotton (fiber yield and fiber length) using the method proposed by Eberhart and Russell (simple linear regression) and reaction norm models (random regression). Eight trials with sixteen upland cotton genotypes, conducted in a randomized block design, were used. It was possible to identify a genotype with wide adaptability and stability for both traits. Reaction norm models have excellent theoretical and practical properties and led to more informative and accurate results than the method proposed by Eberhart and Russell and should, therefore, be preferred. Curves of genotypic values as a function of the environmental gradient, which predict the behavior of the genotypes along the environmental gradient, were generated. These curves make possible the recommendation to untested environmental levels.

  7. Molecular cloning and localization of a novel cotton annexin gene expressed preferentially during fiber development.

    PubMed

    Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen

    2010-10-01

    Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.

  8. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres

    USDA-ARS?s Scientific Manuscript database

    Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...

  9. Genome-wide classification, evolutionary analysis and gene expression patterns of the kinome in Gossypium

    PubMed Central

    Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng

    2018-01-01

    The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506

  10. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    USDA-ARS?s Scientific Manuscript database

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  11. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres.

    PubMed

    Paterson, Andrew H; Wendel, Jonathan F; Gundlach, Heidrun; Guo, Hui; Jenkins, Jerry; Jin, Dianchuan; Llewellyn, Danny; Showmaker, Kurtis C; Shu, Shengqiang; Udall, Joshua; Yoo, Mi-jeong; Byers, Robert; Chen, Wei; Doron-Faigenboim, Adi; Duke, Mary V; Gong, Lei; Grimwood, Jane; Grover, Corrinne; Grupp, Kara; Hu, Guanjing; Lee, Tae-ho; Li, Jingping; Lin, Lifeng; Liu, Tao; Marler, Barry S; Page, Justin T; Roberts, Alison W; Romanel, Elisson; Sanders, William S; Szadkowski, Emmanuel; Tan, Xu; Tang, Haibao; Xu, Chunming; Wang, Jinpeng; Wang, Zining; Zhang, Dong; Zhang, Lan; Ashrafi, Hamid; Bedon, Frank; Bowers, John E; Brubaker, Curt L; Chee, Peng W; Das, Sayan; Gingle, Alan R; Haigler, Candace H; Harker, David; Hoffmann, Lucia V; Hovav, Ran; Jones, Donald C; Lemke, Cornelia; Mansoor, Shahid; ur Rahman, Mehboob; Rainville, Lisa N; Rambani, Aditi; Reddy, Umesh K; Rong, Jun-kang; Saranga, Yehoshua; Scheffler, Brian E; Scheffler, Jodi A; Stelly, David M; Triplett, Barbara A; Van Deynze, Allen; Vaslin, Maite F S; Waghmare, Vijay N; Walford, Sally A; Wright, Robert J; Zaki, Essam A; Zhang, Tianzhen; Dennis, Elizabeth S; Mayer, Klaus F X; Peterson, Daniel G; Rokhsar, Daniel S; Wang, Xiyin; Schmutz, Jeremy

    2012-12-20

    Polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. Here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (Myr) ago, and allopolyploidy reuniting divergent Gossypium genomes approximately 1-2 Myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (Gossypium hirsutum and Gossypium barbadense), genetic complexity equalled only by Brassica among sequenced angiosperms. Nascent fibre evolution, before allopolyploidy, is elucidated by comparison of spinnable-fibred Gossypium herbaceum A and non-spinnable Gossypium longicalyx F genomes to one another and the outgroup D genome of non-spinnable Gossypium raimondii. The sequence of a G. hirsutum A(t)D(t) (in which 't' indicates tetraploid) cultivar reveals many non-reciprocal DNA exchanges between subgenomes that may have contributed to phenotypic innovation and/or other emergent properties such as ecological adaptation by polyploids. Most DNA-level novelty in G. hirsutum recombines alleles from the D-genome progenitor native to its New World habitat and the Old World A-genome progenitor in which spinnable fibre evolved. Coordinated expression changes in proximal groups of functionally distinct genes, including a nuclear mitochondrial DNA block, may account for clusters of cotton-fibre quantitative trait loci affecting diverse traits. Opportunities abound for dissecting emergent properties of other polyploids, particularly angiosperms, by comparison to diploid progenitors and outgroups.

  12. Pest resistance and agronomic performance of Upland cotton lines following eight generations of introgression of the BNL3279_105 DNA marker from Gossypium barbadense GB713

    USDA-ARS?s Scientific Manuscript database

    The BNL3279 primers give unique DNA markers that are closely linked with resistance to reniform nematodes in Gossypium longicalx, Gossypium barbadense GB713, and Gossypium aridum. Plants that had been selected and advanced based on reniform nematode bioassays for each of five or six generations of ...

  13. Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

    PubMed

    Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

    2017-03-01

    An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

  14. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

    PubMed Central

    Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  15. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

    PubMed

    Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

  16. RNA interference for functional genomics and improvement of cotton (Gossypium species)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  17. Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species

    USDA-ARS?s Scientific Manuscript database

    Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium ...

  18. Monopodial and sympodial branching architecture in cotton is differentially regulated by the Gossypium hirsutum SINGLE FLOWER TRUSS and SELF-PRUNING orthologs.

    PubMed

    McGarry, Roisin C; Prewitt, Sarah F; Culpepper, Samantha; Eshed, Yuval; Lifschitz, Eliezer; Ayre, Brian G

    2016-10-01

    Domestication of upland cotton (Gossypium hirsutum) converted it from a lanky photoperiodic perennial to a day-neutral annual row-crop. Residual perennial traits, however, complicate irrigation and crop management, and more determinate architectures are desired. Cotton simultaneously maintains robust monopodial indeterminate shoots and sympodial determinate shoots. We questioned if and how the FLOWERING LOCUS T/SINGLE FLOWER TRUSS (SFT)-like and TERMINAL FLOWER1/SELF-PRUNING (SP)-like genes control the balance of monopodial and sympodial growth in a woody perennial with complex growth habit. Virus-based manipulation of GhSP and GhSFT expression enabled unprecedented functional analysis of cotton development. GhSP maintains growth in all apices; in its absence, both monopodial and sympodial branch systems terminate precociously. GhSFT encodes a florigenic signal stimulating rapid onset of sympodial branching and flowering in side shoots of wild photoperiodic and modern day-neutral accessions. High florigen concentrations did not alter monopodial apices, implying that once a cotton apex is SP-determined, it cannot be reset by florigen. GhSP is also essential to establish and maintain cambial activity. Dynamic changes in GhSFT and GhSP levels navigate meristems between monopodial and sympodial programs in a single plant. SFT and SP influenced cotton domestication and are ideal targets for further agricultural optimization. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  19. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.

    PubMed

    Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.

  20. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

    PubMed Central

    Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

  1. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    PubMed

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

  2. Molecular diversity and association mapping of fiber quality traits in exotic G. hirsutum L. germplasm.

    PubMed

    Abdurakhmonov, I Y; Kohel, R J; Yu, J Z; Pepper, A E; Abdullaev, A A; Kushanov, F N; Salakhutdinov, I B; Buriev, Z T; Saha, S; Scheffler, B E; Jenkins, J N; Abdukarimov, A

    2008-12-01

    The narrow genetic base of cultivated cotton germplasm is hindering the cotton productivity worldwide. Although potential genetic diversity exists in Gossypium genus, it is largely 'underutilized' due to photoperiodism and the lack of innovative tools to overcome such challenges. The application of linkage disequilibrium (LD)-based association mapping is an alternative powerful molecular tool to dissect and exploit the natural genetic diversity conserved within cotton germplasm collections, greatly accelerating still 'lagging' cotton marker-assisted selection (MAS) programs. However, the extent of genome-wide linkage disequilibrium (LD) has not been determined in cotton. We report the extent of genome-wide LD and association mapping of fiber quality traits by using a 95 core set of microsatellite markers in a total of 285 exotic Gossypium hirsutum accessions, comprising of 208 landrace stocks and 77 photoperiodic variety accessions. We demonstrated the existence of useful genetic diversity within exotic cotton germplasm. In this germplasm set, 11-12% of SSR loci pairs revealed a significant LD. At the significance threshold (r(2)>/=0.1), a genome-wide average of LD declines within the genetic distance at <10 cM in the landrace stocks germplasm and >30 cM in variety germplasm. Genome wide LD at r(2)>/=0.2 was reduced on average to approximately 1-2 cM in the landrace stock germplasm and 6-8 cM in variety germplasm, providing evidence of the potential for association mapping of agronomically important traits in cotton. We observed significant population structure and relatedness in assayed germplasm. Consequently, the application of the mixed liner model (MLM), considering both kinship (K) and population structure (Q) detected between 6% and 13% of SSR markers associated with the main fiber quality traits in cotton. Our results highlight for the first time the feasibility and potential of association mapping, with consideration of the population structure and stratification existing in cotton germplasm resources. The number of SSR markers associated with fiber quality traits in diverse cotton germplasm, which broadly covered many historical meiotic events, should be useful to effectively exploit potentially new genetic variation by using MAS programs.

  3. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  4. Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.

    PubMed

    Feng, Hongjie; Tian, Xinhui; Liu, Yongchang; Li, Yanjun; Zhang, Xinyu; Jones, Brian Joseph; Sun, Yuqiang; Sun, Jie

    2013-01-01

    As a result of changing consumer preferences, cotton (Gossypium Hirsutum L.) from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H) were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL). The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin) were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.

  5. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior to the split of A and D diploid progenitor species. The FAD genes are differentially expressed in various organs and cell types, including fiber, and expression of the FAD7/8-1 gene was induced by cold temperature. These data define the genetic and functional genomic properties of this important gene family in cotton and provide a foundation for future efforts to improve cotton abiotic stress tolerance through molecular breeding approaches.« less

  6. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior to the split of A and D diploid progenitor species. The FAD genes are differentially expressed in various organs and cell types, including fiber, and expression of the FAD7/8-1 gene was induced by cold temperature. These data define the genetic and functional genomic properties of this important gene family in cotton and provide a foundation for future efforts to improve cotton abiotic stress tolerance through molecular breeding approaches.« less

  7. 77 FR 19925 - Upland Cotton Base Quality

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-03

    ...\\-inch, leaf 3, (micronaire 3.5 through 3.6 and 4.3 through 4.9, strength 25.5 through 29.4 grams per tex..., (micronaire 3.5 through 3.6 and 4.3 through 4.9, strength 25.5 through 29.4 grams per tex, length uniformity... 4, (micronaire 3.5 through 3.6 and 4.3 through 4.9, strength 25.5 through 29.4 grams per tex, length...

  8. Evolutionary Conservation and Divergence of Gene Coexpression Networks in Gossypium (Cotton) Seeds.

    PubMed

    Hu, Guanjing; Hovav, Ran; Grover, Corrinne E; Faigenboim-Doron, Adi; Kadmon, Noa; Page, Justin T; Udall, Joshua A; Wendel, Jonathan F

    2016-12-01

    The cotton genus (Gossypium) provides a superior system for the study of diversification, genome evolution, polyploidization, and human-mediated selection. To gain insight into phenotypic diversification in cotton seeds, we conducted coexpression network analysis of developing seeds from diploid and allopolyploid cotton species and explored network properties. Key network modules and functional associations were identified related to seed oil content and seed weight. We compared species-specific networks to reveal topological changes, including rewired edges and differentially coexpressed genes, associated with speciation, polyploidy, and cotton domestication. Network comparisons among species indicate that topologies are altered in addition to gene expression profiles, indicating that changes in transcriptomic coexpression relationships play a role in the developmental architecture of cotton seed development. The global network topology of allopolyploids, especially for domesticated G. hirsutum, resembles the network of the A-genome diploid more than that of the D-genome parent, despite its D-like phenotype in oil content. Expression modifications associated with allopolyploidy include coexpression level dominance and transgressive expression, suggesting that the transcriptomic architecture in polyploids is to some extent a modular combination of that of its progenitor genomes. Among allopolyploids, intermodular relationships are more preserved between two different wild allopolyploid species than they are between wild and domesticated forms of a cultivated cotton, and regulatory connections of oil synthesis-related pathways are denser and more closely clustered in domesticated vs. wild G. hirsutum. These results demonstrate substantial modification of genic coexpression under domestication. Our work demonstrates how network inference informs our understanding of the transcriptomic architecture of phenotypic variation associated with temporal scales ranging from thousands (domestication) to millions (speciation) of years, and by polyploidy. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intraspecific and Interspecific Populations of Gossypium spp.

    PubMed Central

    Hulse-Kemp, Amanda M.; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D.; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L.; Kochan, Kelli J.; Riggs, Penny K.; Scheffler, Jodi A.; Udall, Joshua A.; Ulloa, Mauricio; Wang, Shirley S.; Zhu, Qian-Hao; Bag, Sumit K.; Bhardwaj, Archana; Burke, John J.; Byers, Robert L.; Claverie, Michel; Gore, Michael A.; Harker, David B.; Islam, Md S.; Jenkins, Johnie N.; Jones, Don C.; Lacape, Jean-Marc; Llewellyn, Danny J.; Percy, Richard G.; Pepper, Alan E.; Poland, Jesse A.; Mohan Rai, Krishan; Sawant, Samir V.; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M.; Wang, Fei; Yourstone, Scott M.; Zheng, Xiuting; Lawley, Cindy T.; Ganal, Martin W.; Van Deynze, Allen; Wilson, Iain W.; Stelly, David M.

    2015-01-01

    High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community. PMID:25908569

  10. Agrobacterium-mediated virus-induced gene silencing assay in cotton.

    PubMed

    Gao, Xiquan; Britt, Robert C; Shan, Libo; He, Ping

    2011-08-20

    Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation(1). To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation(2,3). Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies(3,4). As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development(6), and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves(7), providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino phenotype started to appear on the true leaves, with 100% silencing efficiency in all replicated experiments. The silencing of endogenous gene expression was also confirmed by RT-PCR analysis. Significantly, silencing could potently occur in all the cultivars we tested, including various commercially grown varieties in Texas. This rapid and efficient Agrobacterium-mediated VIGS assay provides a very powerful tool for rapid large-scale analysis of gene functions at genome-wide level in cotton.

  11. Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

    PubMed Central

    Gao, Xiquan; Britt Jr., Robert C.; Shan, Libo; He, Ping

    2011-01-01

    Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino phenotype started to appear on the true leaves, with 100% silencing efficiency in all replicated experiments. The silencing of endogenous gene expression was also confirmed by RT-PCR analysis. Significantly, silencing could potently occur in all the cultivars we tested, including various commercially grown varieties in Texas. This rapid and efficient Agrobacterium-mediated VIGS assay provides a very powerful tool for rapid large-scale analysis of gene functions at genome-wide level in cotton. PMID:21876527

  12. Development of chromosome-specific markers with high polymorphism for allotetraploid cotton based on genome-wide characterization of simple sequence repeats in diploid cottons (Gossypium arboreum L. and Gossypium raimondii Ulbrich).

    PubMed

    Lu, Cairui; Zou, Changsong; Zhang, Youping; Yu, Daoqian; Cheng, Hailiang; Jiang, Pengfei; Yang, Wencui; Wang, Qiaolian; Feng, Xiaoxu; Prosper, Mtawa Andrew; Guo, Xiaoping; Song, Guoli

    2015-02-06

    Tetraploid cotton contains two sets of homologous chromosomes, the At- and Dt-subgenomes. Consequently, many markers in cotton were mapped to multiple positions during linkage genetic map construction, posing a challenge to anchoring linkage groups and mapping economically-important genes to particular chromosomes. Chromosome-specific markers could solve this problem. Recently, the genomes of two diploid species were sequenced whose progenitors were putative contributors of the At- and Dt-subgenomes to tetraploid cotton. These sequences provide a powerful tool for developing chromosome-specific markers given the high level of synteny among tetraploid and diploid cotton genomes. In this study, simple sequence repeats (SSRs) on each chromosome in the two diploid genomes were characterized. Chromosome-specific SSRs were developed by comparative analysis and proved to distinguish chromosomes. A total of 200,744 and 142,409 SSRs were detected on the 13 chromosomes of Gossypium arboreum L. and Gossypium raimondii Ulbrich, respectively. Chromosome-specific SSRs were obtained by comparing SSR flanking sequences from each chromosome with those from the other 25 chromosomes. The average was 7,996 per chromosome. To confirm their chromosome specificity, these SSRs were used to distinguish two homologous chromosomes in tetraploid cotton through linkage group construction. The chromosome-specific SSRs and previously-reported chromosome markers were grouped together, and no marker mapped to another homologous chromosome, proving that the chromosome-specific SSRs were unique and could distinguish homologous chromosomes in tetraploid cotton. Because longer dinucleotide AT-rich repeats were the most polymorphic in previous reports, the SSRs on each chromosome were sorted by motif type and repeat length for convenient selection. The primer sequences of all chromosome-specific SSRs were also made publicly available. Chromosome-specific SSRs are efficient tools for chromosome identification by anchoring linkage groups to particular chromosomes during genetic mapping and are especially useful in mapping of qualitative-trait genes or quantitative trait loci with just a few markers. The SSRs reported here will facilitate a number of genetic and genomic studies in cotton, including construction of high-density genetic maps, positional gene cloning, fingerprinting, and genetic diversity and comparative evolutionary analyses among Gossypium species.

  13. Genomic prediction for winter survival in lowland switchgrass

    USDA-ARS?s Scientific Manuscript database

    Switchgrass (Panicum virgatum L.) is a North American native perennial warm season grass and a promising cellulosic bioenergy feedstock. It has two ecotypes – lowland and upland. The lowland ecotype has generated considerable interest because of its higher biomass compared to the upland ecotype. How...

  14. Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development

    PubMed Central

    Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal

    2016-01-01

    The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939

  15. Spatial Mapping of Lipids at Cellular Resolution in Embryos of Cotton[W][OA

    PubMed Central

    Horn, Patrick J.; Korte, Andrew R.; Neogi, Purnima B.; Love, Ebony; Fuchs, Johannes; Strupat, Kerstin; Borisjuk, Ljudmilla; Shulaev, Vladimir; Lee, Young-Jin; Chapman, Kent D.

    2012-01-01

    Advances in mass spectrometry (MS) have made comprehensive lipidomics analysis of complex tissues relatively commonplace. These compositional analyses, although able to resolve hundreds of molecular species of lipids in single extracts, lose the original cellular context from which these lipids are derived. Recently, high-resolution MS of individual lipid droplets from seed tissues indicated organelle-to-organelle variation in lipid composition, suggesting that heterogeneity of lipid distributions at the cellular level may be prevalent. Here, we employed matrix-assisted laser desorption/ionization–MS imaging (MALDI-MSI) approaches to visualize lipid species directly in seed tissues of upland cotton (Gossypium hirsutum). MS imaging of cryosections of mature cotton embryos revealed a distinct, heterogeneous distribution of molecular species of triacylglycerols and phosphatidylcholines, the major storage and membrane lipid classes in cotton embryos. Other lipids were imaged, including phosphatidylethanolamines, phosphatidic acids, sterols, and gossypol, indicating the broad range of metabolites and applications for this chemical visualization approach. We conclude that comprehensive lipidomics images generated by MALDI-MSI report accurate, relative amounts of lipid species in plant tissues and reveal previously unseen differences in spatial distributions providing for a new level of understanding in cellular biochemistry. PMID:22337917

  16. Usefulness of the HMRPGV method for simultaneous selection of upland cotton genotypes with greater fiber length and high yield stability.

    PubMed

    Farias, F J C; Carvalho, L P; Silva Filho, J L; Teodoro, P E

    2016-08-19

    The harmonic mean of the relative performance of genotypic predicted value (HMRPGV) method has been used to measure the genotypic stability and adaptability of various crops. However, its use in cotton is still restricted. This study aimed to use mixed models to select cotton genotypes that simultaneously result in longer fiber length, higher fiber yield, and phenotypic stability in both of these traits. Eight trials with 16 cotton genotypes were conducted in the 2008/2009 harvest in Mato Grosso State. The experimental design was randomized complete blocks with four replicates of each of the 16 genotypes. In each trial, we evaluated fiber yield and fiber length. The genetic parameters were estimated using the restricted maximum likelihood/best linear unbiased predictor method. Joint selection considering, simultaneously, fiber length, fiber yield, stability, and adaptability is possible with the HMRPGV method. Our results suggested that genotypes CNPA MT 04 2080 and BRS CEDRO may be grown in environments similar to those tested here and may be predicted to result in greater fiber length, fiber yield, adaptability, and phenotypic stability. These genotypes may constitute a promising population base in breeding programs aimed at increasing these trait values.

  17. Contemporary evolution of a Lepidopteran species, Heliothis virescens, in response to modern agricultural practices.

    PubMed

    Fritz, Megan L; DeYonke, Alexandra M; Papanicolaou, Alexie; Micinski, Stephen; Westbrook, John; Gould, Fred

    2018-01-01

    Adaptation to human-induced environmental change has the potential to profoundly influence the genomic architecture of affected species. This is particularly true in agricultural ecosystems, where anthropogenic selection pressure is strong. Heliothis virescens primarily feeds on cotton in its larval stages, and US populations have been declining since the widespread planting of transgenic cotton, which endogenously expresses proteins derived from Bacillus thuringiensis (Bt). No physiological adaptation to Bt toxin has been found in the field, so adaptation in this altered environment could involve (i) shifts in host plant selection mechanisms to avoid cotton, (ii) changes in detoxification mechanisms required for cotton-feeding vs. feeding on other hosts or (iii) loss of resistance to previously used management practices including insecticides. Here, we begin to address whether such changes occurred in H. virescens populations between 1997 and 2012, as Bt-cotton cultivation spread through the agricultural landscape. For our study, we produced an H. virescens genome assembly and used this in concert with a ddRAD-seq-enabled genome scan to identify loci with significant allele frequency changes over the 15-year period. Genetic changes at a previously described H. virescens insecticide target of selection were detectable in our genome scan and increased our confidence in this methodology. Additional loci were also detected as being under selection, and we quantified the selection strength required to elicit observed allele frequency changes at each locus. Potential contributions of genes near loci under selection to adaptive phenotypes in the H. virescens cotton system are discussed. © 2017 John Wiley & Sons Ltd.

  18. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    PubMed

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  19. Introgression of genes for cotton leaf curl virus resistance and increased fiber strength from Gossypium stocksii into upland cotton (G. hirsutum).

    PubMed

    Nazeer, W; Ahmad, S; Mahmood, K; Tipu, A L; Mahmood, A; Zhou, B

    2014-02-21

    Cotton leaf curl virus disease is a major hurdle for successful cotton production in Pakistan. There has been considerable economic loss due to this disease during the last decade. It would be desirable to have cotton varieties resistant to this disease. We explored the possibility of transferring virus resistant genes from the wild species Gossypium stocksii into MNH-786, a cultivar of G. hirsutum. Hybridization was done under field condition at the Cotton Research Station, Multan, during 2010-11. Boll shedding was controlled by application of exogenous hormones. F1 seeds were treated with 0.03% colchicine solution for 6 h and germinated. Cytological observations at peak squaring/flowering stage showed that these plants were hexaploid, having 2n = 6x = 78 chromosomes. The F1 plants showed intermediate expression for leaf size, leaf area, petiole length, bracteole number and size, bracteole area, bracteole dentation, flower size, pedicel size, and petal number and size. Moreover it possessed high fiber strength of 54.4 g/tex, which is 54% greater than that of the check variety, i.e. MNH-786 (G. hirsutum). The F1 population did not show any symptom of CLCuVD in the field, tested by grafting with CLCuVD susceptible rootstock (var. S12). We conclude that it is possible to transfer CLCuVD resistance and high fiber strength from G. stocksii to G. hirsutum.

  20. The Dual Functions of WLIM1a in Cell Elongation and Secondary Wall Formation in Developing Cotton Fibers[C][W

    PubMed Central

    Han, Li-Bo; Li, Yuan-Bao; Wang, Hai-Yun; Wu, Xiao-Min; Li, Chun-Li; Luo, Ming; Wu, Shen-Jie; Kong, Zhao-Sheng; Pei, Yan; Jiao, Gai-Li; Xia, Gui-Xian

    2013-01-01

    LIN-11, Isl1 and MEC-3 (LIM)-domain proteins play pivotal roles in a variety of cellular processes in animals, but plant LIM functions remain largely unexplored. Here, we demonstrate dual roles of the WLIM1a gene in fiber development in upland cotton (Gossypium hirsutum). WLIM1a is preferentially expressed during the elongation and secondary wall synthesis stages in developing fibers. Overexpression of WLIM1a in cotton led to significant changes in fiber length and secondary wall structure. Compared with the wild type, fibers of WLIM1a-overexpressing plants grew longer and formed a thinner and more compact secondary cell wall, which contributed to improved fiber strength and fineness. Functional studies demonstrated that (1) WLIM1a acts as an actin bundler to facilitate elongation of fiber cells and (2) WLIM1a also functions as a transcription factor to activate expression of Phe ammonia lyase–box genes involved in phenylpropanoid biosynthesis to build up the secondary cell wall. WLIM1a localizes in the cytosol and nucleus and moves into the nucleus in response to hydrogen peroxide. Taken together, these results demonstrate that WLIM1a has dual roles in cotton fiber development, elongation, and secondary wall formation. Moreover, our study shows that lignin/lignin-like phenolics may substantially affect cotton fiber quality; this finding may guide cotton breeding for improved fiber traits. PMID:24220634

  1. A Genetic Map Between Gossypium hirsutum and the Brazilian Endemic G. mustelinum and Its Application to QTL Mapping

    PubMed Central

    Wang, Baohua; Liu, Limei; Zhang, Dong; Zhuang, Zhimin; Guo, Hui; Qiao, Xin; Wei, Lijuan; Rong, Junkang; May, O. Lloyd; Paterson, Andrew H.; Chee, Peng W.

    2016-01-01

    Among the seven tetraploid cotton species, little is known about transmission genetics and genome organization in Gossypium mustelinum, the species most distant from the source of most cultivated cotton, G. hirsutum. In this research, an F2 population was developed from an interspecific cross between G. hirsutum and G. mustelinum (HM). A genetic linkage map was constructed mainly using simple sequence repeat (SSRs) and restriction fragment length polymorphism (RFLP) DNA markers. The arrangements of most genetic loci along the HM chromosomes were identical to those of other tetraploid cotton species. However, both major and minor structural rearrangements were also observed, for which we propose a parsimony-based model for structural divergence of tetraploid cottons from common ancestors. Sequences of mapped markers were used for alignment with the 26 scaffolds of the G. hirsutum draft genome, and showed high consistency. Quantitative trait locus (QTL) mapping of fiber elongation in advanced backcross populations derived from the same parents demonstrated the value of the HM map. The HM map will serve as a valuable resource for QTL mapping and introgression of G. mustelinum alleles into G. hirsutum, and help clarify evolutionary relationships between the tetraploid cotton genomes. PMID:27172208

  2. Genomic landscape of fiber genes in fibered and non-fibered cottons

    USDA-ARS?s Scientific Manuscript database

    Cotton fiber is the largest single cell in the plant kingdom. It is the best model to study cell function, differentiation, maturation, and cell death. Cotton fiber transcriptome can be clustered into two types of regions: conservative areas and recombination hotspots. This study was to investig...

  3. TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton

    USDA-ARS?s Scientific Manuscript database

    Bacterial blight of cotton (BBC), caused by Xanthomonas citri subsp. malvacearum (Xcm), is among the most destructive diseases in cotton (Gossypium spp.). Transcription activator-like (TAL) effectors from Xcm are essential for BBC disease progression. Here, we carried out whole-genome PacBio-seque...

  4. Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus.

    PubMed

    Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S

    2011-08-24

    In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

  5. Analysis of Flavonoids and the Flavonoid Structural Genes in Brown Fiber of Upland Cotton

    PubMed Central

    Liu, Yongchang; Li, Yanjun; Zhang, Xinyu; Jones, Brian Joseph; Sun, Yuqiang; Sun, Jie

    2013-01-01

    Backgroud As a result of changing consumer preferences, cotton (Gossypium Hirsutum L.) from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. Experimental Design Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3′H, and GhF3′5′H) were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. Result The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL). The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin) were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. Conclusions Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers. PMID:23527031

  6. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    USDA-ARS?s Scientific Manuscript database

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  7. ABP9, a maize bZIP transcription factor, enhances tolerance to salt and drought in transgenic cotton.

    PubMed

    Wang, Chunling; Lu, Guoqing; Hao, Yuqiong; Guo, Huiming; Guo, Yan; Zhao, Jun; Cheng, Hongmei

    2017-09-01

    ABP9 , encoding a bZIP transcription factor from maize, enhances tolerance to multiple stresses and may participate in the ABA signaling pathway in transgenic cotton by altering physiological and biochemical processes and stress-related gene expression. Abiotic stresses, such as soil salinity and drought, negatively affect growth, development, and yield in cotton. Gene ABP9, which encodes a bZIP transcription factor, binds to the abscisic acid (ABA)-responsive-element (ABRE2) motif of the maize catalase1 gene. Its expression significantly improves tolerance in Arabidopsis to multiple abiotic stresses, but little is known about its role in cotton. In the present study, the ABP9 gene was introduced into upland cotton (Gossypium hirsutum L.) cultivar R15 by Agrobacterium tumefaciens-mediated transformation, and 12 independent transgenic cotton lines were obtained. Cotton plants over-expressing ABP9 have enhanced tolerance to salt and osmotic stress. Under stress, they developed better root systems in a greenhouse and higher germination, reduced stomatal aperture, and stomatal density in a growth chamber. Under drought conditions, survival rate and relative water content (RWC) of transgenic cotton were higher than those of R15 plants. Under salt and osmotic stresses, chlorophyll, proline, and soluble sugar contents significantly increased in transgenic cotton leaves and the malondialdehyde (MDA) content was lower than in R15. Overexpression of ABP9 also enhanced oxidative stress tolerance, reduced cellular levels of reactive oxygen species (ROS) through increased activities of antioxidative enzymes, and alleviated oxidative damage to cell. Interestingly, ABP9 over-expressing cotton was more sensitive to exogenous ABA than R15 at seed germination, root growth, stomatal aperture, and stomatal density. Moreover, ABP9 overexpression upregulated significantly the transcription levels of stress-related genes such as GhDBP2, GhNCED2, GhZFP1, GhERF1, GhHB1, and GhSAP1 under salt treatment. Conjointly, these results showed that overexpression of ABP9 conferred enhanced tolerance to multiple abiotic stresses in cotton. The stress-tolerant transgenic lines provide valuable resources for cotton breeding.

  8. Molecular characterization of the Gossypium Diversity Reference Set of the US National Cotton Germplasm Collection.

    PubMed

    Hinze, Lori L; Fang, David D; Gore, Michael A; Scheffler, Brian E; Yu, John Z; Frelichowski, James; Percy, Richard G

    2015-02-01

    A core marker set containing markers developed to be informative within a single commercial cotton species can elucidate diversity structure within a multi-species subset of the Gossypium germplasm collection. An understanding of the genetic diversity of cotton (Gossypium spp.) as represented in the US National Cotton Germplasm Collection is essential to develop strategies for collecting, conserving, and utilizing these germplasm resources. The US collection is one of the largest world collections and includes not only accessions with improved yield and fiber quality within cultivated species, but also accessions possessing sources of abiotic and biotic stress resistance often found in wild species. We evaluated the genetic diversity of a subset of 272 diploid and 1,984 tetraploid accessions in the collection (designated the Gossypium Diversity Reference Set) using a core set of 105 microsatellite markers. Utility of the core set of markers in differentiating intra-genome variation was much greater in commercial tetraploid genomes (99.7 % polymorphic bands) than in wild diploid genomes (72.7 % polymorphic bands), and may have been influenced by pre-selection of markers for effectiveness in the commercial species. Principal coordinate analyses revealed that the marker set differentiated interspecific variation among tetraploid species, but was only capable of partially differentiating among species and genomes of the wild diploids. Putative species-specific marker bands in G. hirsutum (73) and G. barbadense (81) were identified that could be used for qualitative identification of misclassifications, redundancies, and introgression within commercial tetraploid species. The results of this broad-scale molecular characterization are essential to the management and conservation of the collection and provide insight and guidance in the use of the collection by the cotton research community in their cotton improvement efforts.

  9. Using Population Genomics to Reveal Temporal Patterns of Host Use in the Cotton Fleahopper (Pseudatomoscelis seriatus)

    USDA-ARS?s Scientific Manuscript database

    The cotton fleahopper (CFH), Pseudatomoscelis seriatus (Reuter, 1876) (Hemiptera: Miridae), is a pest of commercial cotton (Gossypium hirsutum L.) with over 100 known host plants across its range. Both adults and nymphs attack small, developing squares, leading to abscission of the square. A new t...

  10. A High Density Consensus Genetic Map of Tetraploid Cotton That Integrates Multiple Component Maps through Molecular Marker Redundancy Check

    PubMed Central

    Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc

    2012-01-01

    A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214

  11. Divergence and evolution of cotton bHLH proteins from diploid to allotetraploid.

    PubMed

    Liu, Bingliang; Guan, Xueying; Liang, Wenhua; Chen, Jiedan; Fang, Lei; Hu, Yan; Guo, Wangzhen; Rong, Junkang; Xu, Guohua; Zhang, Tianzhen

    2018-02-23

    Polyploidy is considered a major driving force in genome expansion, yielding duplicated genes whose expression may be conserved or divergence as a consequence of polyploidization. We compared the genome sequences of tetraploid cotton (Gossypium hirsutum) and its two diploid progenitors, G. arboreum and G. raimondii, and found that the bHLH genes were conserved over the polyploidization. Oppositely, the expression of the homeolgous gene pairs was diversified. The biased homeologous proportion for bHLH family is significantly higher (64.6%) than the genome wide homeologous expression bias (40%). Compared with cacao (T. cacao), orthologous genes only accounted for a small proportion (41.7%) of whole cotton bHLHs family. The further Ks analysis indicated that bHLH genes underwent at least two distinct episodes of whole genome duplication: a recent duplication (1.0-60.0 million years ago, MYA, 0.005 < Ks < 0.312) and an old duplication (> 60.0 MYA, 0.312 < Ks < 3.0). The old duplication event might have played a key role in the expansion of the bHLH family. Both recent and old duplicated pairs (68.8%) showed a divergent expression profile, indicating specialized functions. The expression diversification of the duplicated genes suggested it might be a universal feature of the long-term evolution of cotton. Overview of cotton bHLH proteins indicated a conserved and divergent evolution from diploids to allotetraploid. Our results provided an excellent example for studying the long-term evolution of polyploidy.

  12. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    PubMed

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Modifications to a LATE MERISTEM IDENTITY1 gene are responsible for the major leaf shapes of Upland cotton (Gossypium hirsutum L.).

    PubMed

    Andres, Ryan J; Coneva, Viktoriya; Frank, Margaret H; Tuttle, John R; Samayoa, Luis Fernando; Han, Sang-Won; Kaur, Baljinder; Zhu, Linglong; Fang, Hui; Bowman, Daryl T; Rojas-Pierce, Marcela; Haigler, Candace H; Jones, Don C; Holland, James B; Chitwood, Daniel H; Kuraparthy, Vasu

    2017-01-03

    Leaf shape varies spectacularly among plants. Leaves are the primary source of photoassimilate in crop plants, and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. Leaf shape played a unique role in cotton improvement, as breeders have selected for entire and lobed leaf morphs resulting from a single locus, okra (l-D 1 ), which is responsible for the major leaf shapes in cotton. The l-D 1 locus is not only of agricultural importance in cotton, but through pioneering chimeric and morphometric studies, it has contributed to fundamental knowledge about leaf development. Here we show that an HD-Zip transcription factor homologous to the LATE MERISTEM IDENTITY1 (LMI1) gene of Arabidopsis is the causal gene underlying the l-D 1 locus. The classical okra leaf shape allele has a 133-bp tandem duplication in the promoter, correlated with elevated expression, whereas an 8-bp deletion in the third exon of the presumed wild-type normal allele causes a frame-shifted and truncated coding sequence. Our results indicate that subokra is the ancestral leaf shape of tetraploid cotton that gave rise to the okra allele and that normal is a derived mutant allele that came to predominate and define the leaf shape of cultivated cotton. Virus-induced gene silencing (VIGS) of the LMI1-like gene in an okra variety was sufficient to induce normal leaf formation. The developmental changes in leaves conferred by this gene are associated with a photosynthetic transcriptomic signature, substantiating its use by breeders to produce a superior cotton ideotype.

  14. Modifications to a LATE MERISTEM IDENTITY1 gene are responsible for the major leaf shapes of Upland cotton (Gossypium hirsutum L.)

    PubMed Central

    Andres, Ryan J.; Coneva, Viktoriya; Frank, Margaret H.; Tuttle, John R.; Samayoa, Luis Fernando; Han, Sang-Won; Kaur, Baljinder; Zhu, Linglong; Fang, Hui; Bowman, Daryl T.; Rojas-Pierce, Marcela; Haigler, Candace H.; Jones, Don C.; Holland, James B.; Chitwood, Daniel H.; Kuraparthy, Vasu

    2017-01-01

    Leaf shape varies spectacularly among plants. Leaves are the primary source of photoassimilate in crop plants, and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. Leaf shape played a unique role in cotton improvement, as breeders have selected for entire and lobed leaf morphs resulting from a single locus, okra (l-D1), which is responsible for the major leaf shapes in cotton. The l-D1 locus is not only of agricultural importance in cotton, but through pioneering chimeric and morphometric studies, it has contributed to fundamental knowledge about leaf development. Here we show that an HD-Zip transcription factor homologous to the LATE MERISTEM IDENTITY1 (LMI1) gene of Arabidopsis is the causal gene underlying the l-D1 locus. The classical okra leaf shape allele has a 133-bp tandem duplication in the promoter, correlated with elevated expression, whereas an 8-bp deletion in the third exon of the presumed wild-type normal allele causes a frame-shifted and truncated coding sequence. Our results indicate that subokra is the ancestral leaf shape of tetraploid cotton that gave rise to the okra allele and that normal is a derived mutant allele that came to predominate and define the leaf shape of cultivated cotton. Virus-induced gene silencing (VIGS) of the LMI1-like gene in an okra variety was sufficient to induce normal leaf formation. The developmental changes in leaves conferred by this gene are associated with a photosynthetic transcriptomic signature, substantiating its use by breeders to produce a superior cotton ideotype. PMID:27999177

  15. Boll weevil (Anthonomus grandis) population genomics as a tool for monitoring and management

    USDA-ARS?s Scientific Manuscript database

    Despite the success of eradication efforts across most of the cotton-producing regions of the U.S., the cotton boll weevil (Anthonomus grandis grandis Boheman) remains a major pest of cotton in much of the New World. The area along the Texas border with northern Mexico has been a particularly troub...

  16. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    PubMed

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

    PubMed

    Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

    2018-06-01

    Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres

    PubMed Central

    Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

    2015-01-01

    Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818

  19. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms

    PubMed Central

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control. PMID:26435695

  20. Functional Genomic Analysis of Cotton Genes with Agrobacterium-Mediated Virus-Induced Gene Silencing

    PubMed Central

    Gao, Xiquan; Shan, Libo

    2015-01-01

    Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses. PMID:23386302

  1. Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing.

    PubMed

    Gao, Xiquan; Shan, Libo

    2013-01-01

    Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses.

  2. Genome-wide analysis of gene expression of EMS-induced short fiber mutant Ligon lintless-y (liy) in cotton (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    The length of cotton fiber is an important agronomic trait characteristic that directly affects the quality of yarn and fabric. Cotton fiber mutants have been useful tools to study the molecular processes of fiber development. In this work we describe a chemically-induced short fiber mutant Ligon-li...

  3. Rapid diversification of the cotton genus (Gossypium: Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes.

    Treesearch

    Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel

    2002-01-01

    Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...

  4. Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus

    PubMed Central

    2011-01-01

    Background In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases. PMID:21864377

  5. Gossypium barbadense genome sequence provides insight into the evolution of extra-long staple fiber and specialized metabolites.

    PubMed

    Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya

    2015-09-30

    Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.

  6. Salt stress responsiveness of a wild cotton species (Gossypium klotzschianum) based on transcriptomic analysis.

    PubMed

    Wei, Yangyang; Xu, Yanchao; Lu, Pu; Wang, Xingxing; Li, Zhenqing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Yuhong; Zhang, Zhenmei; Lin, Zhongxu; Liu, Fang; Wang, Kunbo

    2017-01-01

    Cotton is a pioneer of saline land crop, while salt stress still causes its growth inhibition and fiber production decrease. Phenotype identification showed better salt tolerance of a wild diploid cotton species Gossypium klotzschianum. To elucidate the salt-tolerant mechanisms in G. klotzschianum, we firstly detected the changes in hormones, H2O2 and glutathione (GSSH and GSH), then investigated the gene expression pattern of roots and leaves treated with 300 mM NaCl for 0, 3, 12, 48 h, and each time control by RNA-seq on the Illumina-Solexa platform. Physiological determination proved that the significant increase in hormone ABA at 48 h, while that in H2O2 was at 12 h, likewise, the GSH content decrease at 48 h and the GSSH content increase at 48 h, under salt stress. In total, 37,278 unigenes were identified from the transcriptome data, 8,312 and 6,732 differentially expressed genes (DEGs) were discovered to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation and expression analysis elucidated hormone biosynthesis and signal transduction, reactive oxygen species (ROS), and salt overly sensitive (SOS) signal transduction related genes revealed the important roles of them in signal transmission, oxidation balance and ion homeostasis in response to salinity stress. This is a report which focuses on primary response to highly salty stress (upto 300 mM NaCl) in cotton using a wild diploid Gossypium species, broadening our understanding of the salt tolerance mechanism in cotton and laying a solid foundation of salt resistant for the genetic improvement of upland cotton with the resistance to salt stress.

  7. Gbvdr6, a Gene Encoding a Receptor-Like Protein of Cotton (Gossypium barbadense), Confers Resistance to Verticillium Wilt in Arabidopsis and Upland Cotton

    PubMed Central

    Yang, Yuwen; Chen, Tianzi; Ling, Xitie; Ma, Zhengqiang

    2018-01-01

    Verticillium wilt is a soil-borne disease that can cause devastating losses in cotton production. Because there is no effective chemical means to combat the disease, the only effective way to control Verticillium wilt is through genetic improvement. Therefore, the identification of additional disease-resistance genes will benefit efforts toward the genetic improvement of cotton resistance to Verticillium wilt. Based on screening of a BAC library with a partial Ve homologous fragment and expression analysis, a V. dahliae-induced gene, Gbvdr6, was isolated and cloned from the Verticillium wilt-resistant cotton G. barbadense cultivar Hai7124. The gene was located in the gene cluster containing Gbve1 and Gbvdr5 and adjacent to the Verticillium wilt-resistance QTL hotspot. Gbvdr6 was induced by Verticillium dahliae Kleb and by the plant hormones salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH) but not by abscisic acid (ABA). Gbvdr6 was localized to the plasma membrane. Overexpression of Gbvdr6 in Arabidopsis and cotton enhanced resistance to V. dahliae. Moreover, the JA/ET signaling pathway-related genes PR3, PDF 1.2, ERF1 and the SA-related genes PR1 and PR2 were constitutively expressed in transgenic plants. Gbvdr6-overexpressing Arabidopsis was less sensitive than the wild-type plant to MeJA. Furthermore, the accumulation of reactive oxygen species and callose was triggered at early time points after V. dahliae infection. These results suggest that Gbvdr6 confers resistance to V. dahliae through regulation of the JA/ET and SA signaling pathways. PMID:29387078

  8. Salt stress responsiveness of a wild cotton species (Gossypium klotzschianum) based on transcriptomic analysis

    PubMed Central

    Wang, Xingxing; Li, Zhenqing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Yuhong; Zhang, Zhenmei; Liu, Fang

    2017-01-01

    Cotton is a pioneer of saline land crop, while salt stress still causes its growth inhibition and fiber production decrease. Phenotype identification showed better salt tolerance of a wild diploid cotton species Gossypium klotzschianum. To elucidate the salt-tolerant mechanisms in G. klotzschianum, we firstly detected the changes in hormones, H2O2 and glutathione (GSSH and GSH), then investigated the gene expression pattern of roots and leaves treated with 300 mM NaCl for 0, 3, 12, 48 h, and each time control by RNA-seq on the Illumina-Solexa platform. Physiological determination proved that the significant increase in hormone ABA at 48 h, while that in H2O2 was at 12 h, likewise, the GSH content decrease at 48 h and the GSSH content increase at 48 h, under salt stress. In total, 37,278 unigenes were identified from the transcriptome data, 8,312 and 6,732 differentially expressed genes (DEGs) were discovered to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation and expression analysis elucidated hormone biosynthesis and signal transduction, reactive oxygen species (ROS), and salt overly sensitive (SOS) signal transduction related genes revealed the important roles of them in signal transmission, oxidation balance and ion homeostasis in response to salinity stress. This is a report which focuses on primary response to highly salty stress (upto 300 mM NaCl) in cotton using a wild diploid Gossypium species, broadening our understanding of the salt tolerance mechanism in cotton and laying a solid foundation of salt resistant for the genetic improvement of upland cotton with the resistance to salt stress. PMID:28552980

  9. Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

    PubMed

    Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

    2017-06-29

    Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

  10. De novo genome assembly of the red silk cotton tree (Bombax ceiba).

    PubMed

    Gao, Yong; Wang, Haibo; Liu, Chao; Chu, Honglong; Dai, Dongqin; Song, Shengnan; Yu, Long; Han, Lihong; Fu, Yi; Tian, Bin; Tang, Lizhou

    2018-05-01

    Bombax ceiba L. (the red silk cotton tree) is a large deciduous tree that is distributed in tropical and sub-tropical Asia as well as northern Australia. It has great economic and ecological importance, with several applications in industry and traditional medicine in many Asian countries. To facilitate further utilization of this plant resource, we present here the draft genome sequence for B. ceiba. We assembled a relatively intact genome of B. ceiba by using PacBio single-molecule sequencing and BioNano optical mapping technologies. The final draft genome is approximately 895 Mb long, with contig and scaffold N50 sizes of 1.0 Mb and 2.06 Mb, respectively. The high-quality draft genome assembly of B. ceiba will be a valuable resource enabling further genetic improvement and more effective use of this tree species.

  11. Genome-Wide Comparative Analysis of the Phospholipase D Gene Families among Allotetraploid Cotton and Its Diploid Progenitors

    PubMed Central

    Tang, Kai; Dong, Chun-Juan; Liu, Jin-Yuan

    2016-01-01

    In this study, 40 phospholipase D (PLD) genes were identified from allotetraploid cotton Gossypium hirsutum, and 20 PLD genes were examined in diploid cotton Gossypium raimondii. Combining with 19 previously identified Gossypium arboreum PLD genes, a comparative analysis was performed among the PLD gene families among allotetraploid and two diploid cottons. Based on the orthologous relationships, we found that almost each G. hirsutum PLD had a corresponding homolog in the G. arboreum and G. raimondii genomes, except for GhPLDβ3A, whose homolog GaPLDβ3 may have been lost during the evolution of G. arboreum after the interspecific hybridization. Phylogenetic analysis showed that all of the cotton PLDs were unevenly classified into six numbered subgroups: α, β/γ, δ, ε, ζ and φ. An N-terminal C2 domain was found in the α, β/γ, δ and ε subgroups, while phox homology (PX) and pleckstrin homology (PH) domains were identified in the ζ subgroup. The subgroup φ possessed a single peptide instead of a functional domain. In each phylogenetic subgroup, the PLDs showed high conservation in gene structure and amino acid sequences in functional domains. The expansion of GhPLD and GrPLD gene families were mainly attributed to segmental duplication and partly attributed to tandem duplication. Furthermore, purifying selection played a critical role in the evolution of PLD genes in cotton. Quantitative RT-PCR documented that allotetraploid cotton PLD genes were broadly expressed and each had a unique spatial and developmental expression pattern, indicating their functional diversification in cotton growth and development. Further analysis of cis-regulatory elements elucidated transcriptional regulations and potential functions. Our comparative analysis provided valuable information for understanding the putative functions of the PLD genes in cotton fiber. PMID:27213891

  12. Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

    PubMed

    Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

    2018-02-01

    The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the associations of CHLI protein function and the chlorophyll biosynthesis pathway but also has implications for cotton breeding.

  13. Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

    PubMed

    Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

    2018-01-05

    Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

    PubMed

    Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

    2017-12-10

    Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected in any of the healthy looking transgenic lines. In this study for the first time, efficacy of the host (G. arboreum)-encoded miRNAs against CLCuD symptoms was experimentally demonstrated through overexpression of miR398 and miR2950 in G. hirsutum var. HS6 plants. Computational prediction of miRNAs targeting virus genome and their subsequent implication in translational inhibition or cleavage based suppression of viral mRNA via overexpression could help in generating virus resistant plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Molecular characterization of a virus from the family Luteoviridae associated with cotton blue disease.

    PubMed

    Corrêa, R L; Silva, T F; Simões-Araújo, J L; Barroso, P A V; Vidal, M S; Vaslin, M F S

    2005-07-01

    Cotton blue disease is an aphid-transmitted cotton disease described in Brazil in 1962 as Vein Mosaic "var. Ribeirão Bonito". At present it causes economically important losses in cotton crops if control measures are not implemented. The observed symptoms and mode of transmission have prompted researchers to speculate that cotton blue disease could be attributed to a member of the family Luteoviridae, but there was no molecular evidence supporting this hypothesis. We have amplified part of the genome of a virus associated with this disease using degenerate primers for members of the family Luteoviridae. Sequence analysis of the entire capsid and a partial RdRp revealed a virus probably belonging to the genus Polerovirus. Based on our results we propose that cotton blue disease is associated with a virus with the putative name Cotton leafroll dwarf virus (CLRDV).

  16. Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array.

    PubMed

    Hinze, Lori L; Hulse-Kemp, Amanda M; Wilson, Iain W; Zhu, Qian-Hao; Llewellyn, Danny J; Taylor, Jen M; Spriggs, Andrew; Fang, David D; Ulloa, Mauricio; Burke, John J; Giband, Marc; Lacape, Jean-Marc; Van Deynze, Allen; Udall, Joshua A; Scheffler, Jodi A; Hague, Steve; Wendel, Jonathan F; Pepper, Alan E; Frelichowski, James; Lawley, Cindy T; Jones, Don C; Percy, Richard G; Stelly, David M

    2017-02-03

    Cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapted to emerging environmental and climate conditions. Accessions and lines have traditionally been characterized based on phenotypes, but phenotypic profiles are limited by the cost, time, and space required to make visual observations and measurements. With advances in molecular genetic methods, genotypic profiles are increasingly able to identify differences among accessions due to the larger number of genetic markers that can be measured. A combination of both methods would greatly enhance our ability to characterize germplasm resources. Recent efforts have culminated in the identification of sufficient SNP markers to establish high-throughput genotyping systems, such as the CottonSNP63K array, which enables a researcher to efficiently analyze large numbers of SNP markers and obtain highly repeatable results. In the current investigation, we have utilized the SNP array for analyzing genetic diversity primarily among cotton cultivars, making comparisons to SSR-based phylogenetic analyses, and identifying loci associated with seed nutritional traits. The SNP markers distinctly separated G. hirsutum from other Gossypium species and distinguished the wild from cultivated types of G. hirsutum. The markers also efficiently discerned differences among cultivars, which was the primary goal when designing the CottonSNP63K array. Population structure within the genus compared favorably with previous results obtained using SSR markers, and an association study identified loci linked to factors that affect cottonseed protein content. Our results provide a large genome-wide variation data set for primarily cultivated cotton. Thousands of SNPs in representative cotton genotypes provide an opportunity to finely discriminate among cultivated cotton from around the world. The SNPs will be relevant as dense markers of genome variation for association mapping approaches aimed at correlating molecular polymorphisms with variation in phenotypic traits, as well as for molecular breeding approaches in cotton.

  17. Unique synteny and alternate splicing of the chitin synthases in closely related heliothine moths

    USDA-ARS?s Scientific Manuscript database

    Two chitin synthase genes were characterized in the genomes of two heliothine moths: the corn earworm/cotton bollworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae) and the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In both moths, the coding sequences for the two ge...

  18. Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism

    PubMed Central

    2010-01-01

    Background The soil-borne fungal pathogen Verticillium dahliae Kleb causes Verticillium wilt in a wide range of crops including cotton (Gossypium hirsutum). To date, most upland cotton varieties are susceptible to V. dahliae and the breeding for cotton varieties with the resistance to Verticillium wilt has not been successful. Results Hpa1Xoo is a harpin protein from Xanthomonas oryzae pv. oryzae which induces the hypersensitive cell death in plants. When hpa1Xoo was transformed into the susceptible cotton line Z35 through Agrobacterium-mediated transformation, the transgenic cotton line (T-34) with an improved resistance to Verticillium dahliae was obtained. Cells of the transgenic T-34, when mixed with the conidia suspension of V. dahliae, had a higher tolerance to V. dahliae compared to cells of untransformed Z35. Cells of T-34 were more viable 12 h after mixing with V. dahliae conidia suspension. Immunocytological analysis showed that Hpa1Xoo, expressed in T-34, accumulated as clustered particles along the cell walls of T-34. In response to the infection caused by V. dahliae, the microscopic cell death and the generation of reactive oxygen intermediates were observed in leaves of T-34 and these responses were absent in leaves of Z35 inoculated with V. dahliae. Quantitative RT-PCR analysis indicated that five defense-related genes, ghAOX1, hin1, npr1, ghdhg-OMT, and hsr203J, were up-regulated in T-34 inoculated with V. dahliae. The up-regulations of these defense-relate genes were not observed or in a less extent in leaves of Z-35 after the inoculation. Conclusions Hpa1Xoo accumulates along the cell walls of the transgenic T-34, where it triggers the generation of H2O2 as an endogenous elicitor. T-34 is thus in a primed state, ready to protect the host from the pathogen. The results of this study suggest that the transformation of cotton with hpa1Xoo could be an effective approach for the development of cotton varieties with the improved resistance against soil-borne pathogens. PMID:20398293

  19. Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton.

    PubMed

    Suzuki, Hideaki; Rodriguez-Uribe, Laura; Xu, Jiannong; Zhang, Jinfa

    2013-10-01

    A global view of differential expression of genes in CMS-D8 of cotton was presented in this study which will facilitate the understanding of cytoplasmic male sterility in cotton. Cytoplasmic male sterility (CMS) is a maternally inherited trait in higher plants which is incapable of producing functional pollen. However, the male fertility can be restored by one or more nuclear-encoded restorer genes. A genome-wide transcriptome analysis of CMS and restoration in cotton is currently lacking. In this study, Affymetrix GeneChips© Cotton Genome Array containing 24,132 transcripts was used to compare differentially expressed (DE) genes of flower buds at the meiosis stage between CMS and its restorer cotton plants conditioned by the D8 cytoplasm. A total of 458 (1.9 %) of DE genes including 127 up-regulated and 331 down-regulated ones were identified in the CMS-D8 line. Quantitative RT-PCR was used to validate 10 DE genes selected from seven functional categories. The most frequent DE gene group was found to encode putative proteins involved in cell wall expansion, such as pectinesterase, pectate lyase, pectin methylesterase, glyoxal oxidase, polygalacturonase, indole-3-acetic acid-amino synthetase, and xyloglucan endo-transglycosylase. Genes in cytoskeleton category including actin, which plays a key role in cell wall expansion, cell elongation and cell division, were also highly differentially expressed between the fertile and CMS plants. This work represents the first study in utilizing microarray to identify CMS-related genes by comparing overall DE genes between fertile and CMS plants in cotton. The results provide evidence that many CMS-associated genes are mainly involved in cell wall expansion. Further analysis will be required to elucidate the molecular mechanisms of male sterility which will facilitate the development of new hybrid cultivars in cotton.

  20. Genome-wide analysis of the WRKY gene family in cotton.

    PubMed

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  1. Complete genome of the cotton bacteria blight pathogen Xanthomonas citri pv. malvacearum strain MSCT

    USDA-ARS?s Scientific Manuscript database

    Xanthomonas citri pv. malvacearum (Xcm) is a major pathogen of Gossypium hirsutum. In this study we report the complete genome of the Xcm strain MSCT assembled from long read DNA sequencing technology. The MSCT genome is the first Xcm genome that has complete coding regions for Xcm transcriptional a...

  2. Genomic diversity in switchgrass (Panicum virgatum): from the continental scale to a dune landscape

    PubMed Central

    Morris, Geoffrey P.; Grabowski, Paul; Borevitz, Justin O.

    2011-01-01

    Connecting broad-scale patterns of genetic variation and population structure to genetic diversity on a landscape is a key step towards understanding historical processes of migration and adaptation. New genomic approaches can be used to increase the resolution of phylogeographic studies while reducing locus sampling effects and circumventing ascertainment bias. Here, we use a novel approach based on high-throughput sequencing to characterize genetic diversity in complete chloroplast genomes and >10,000 nuclear loci in switchgrass, across a continental and landscape scale. Switchgrass is a North American tallgrass species, which is widely used in conservation and perennial biomass production, and shows strong ecotypic adaptation and population structure across the continental range. We sequenced 40.9 billion base pairs from 24 individuals from across the species’ range and 20 individuals from the Indiana Dunes. Analysis of plastome sequence revealed 203 variable SNP sites that define eight haplogroups, which are differentiated by 4 to 127 SNPs and confirmed by patterns of indel variation. These include three deeply divergent haplogroups, which correspond to the previously described lowland-upland ecotypic split and a novel upland haplogroup split that dates to the mid-Pleistoscene. Most of the plastome haplogroup diversity present in the northern switchgrass range, including in the Indiana Dunes, originated in the mid- or upper-Pleistocene prior to the most recent postglacial recolonization. Furthermore, a recently colonized landscape feature (~150 ya) in the Indiana Dunes contains several deeply divergent upland haplogroups. Nuclear markers also support a deep lowland-upland split, followed by limited gene flow, and show extensive gene flow in the local population of the Indiana Dunes. PMID:22060816

  3. Functional characterization of a novel jasmonate ZIM-domain interactor (NINJA) from upland cotton (Gossypium hirsutum).

    PubMed

    Wang, Le; Wu, Shu-Ming; Zhu, Yue; Fan, Qiang; Zhang, Zhen-Nan; Hu, Guang; Peng, Qing-Zhong; Wu, Jia-He

    2017-03-01

    The jasmonic acid (JA) signalling pathway plays roles in plant development and defence against biotic and abiotic stresses. We isolated a cotton NINJA (novel interactor of JA ZIM-domain) gene, designated GhNINJA, which contains a 1305 bp open read frame. The GhNINJA gene encodes a 434 amino acid peptide. According to quantitative real-time PCR analysis, GhNINJA is preferentially expressed in roots, and its expression level is greatly induced by Verticillium dahliae infection. Through a virus-induced gene silencing technique, we developed GhNINJA-silenced cotton plants, which had significantly decreased expression of the target gene with an average expression of 6% of the control. The regenerating lateral root growth of silenced plants was largely inhibited compared to the control. Analysis by microscopy demonstrated that the cell length of the root differentiation zone in GhNINJA-silenced plants is significantly shorter than those of the control. Moreover, the silenced plants exhibited higher tolerance to V. dahliae infection compared to the control, which was linked to the increased expression of the defence marker genes PDF1.2 and PR4. Together, these data indicated that knockdown of GhNINJA represses the root growth and enhances the tolerance to V. dahliae. Therefore, GhNINJA gene can be used as a candidate gene to breed the new cultivars for improving cotton yield and disease resistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    PubMed Central

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  5. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

  6. Determination and analysis of the genome sequence of Spodoptera littoralis multiple nucleopolyhedrovirus

    USDA-ARS?s Scientific Manuscript database

    The Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV), a pathogen of the Egyptian cotton leaf worm Spodoptera littoralis, was subjected to sequencing of its entire DNA genome and bioassay analysis comparing its virulence to that of other baculoviruses. The annotated SpliMNPV genome of...

  7. Genome regions' putative association with Fusarium wilt or root-knot nematode resistance in cotton.

    USDA-ARS?s Scientific Manuscript database

    Around 1,300 microsatellite or SSR markers [named MUSB001 – MUSB1316 (600 informative)] were developed at the USDA-ARS, WICSRU Shafter, CA with the support of cooperators and Cotton Incorporated. These MUSB markers were developed from BAC-end DNA sequence information from a previously developed BAC ...

  8. Interspecific chromosomal effects on agronomic traits in Gossypium hirsutum by AD analysis using intermated G. barbadense chromosome substitution lines.

    PubMed

    Saha, S; Wu, J; Jenkins, J N; McCarty, J C; Stelly, D M

    2013-01-01

    The untapped potential of the beneficial alleles from Gossypium barbadense L. has not been well utilized in G. hirsutum L. (often referred to as Upland cotton) breeding programs. This is primarily due to genomic incompatibility and technical challenges associated with conventional methods of interspecific introgression. In this study, we used a hypoaneuploid-based chromosome substitution line as a means for systematically introgressing G. barbadense doubled-haploid line '3-79' germplasm into a common Upland genetic background, inbred 'Texas marker-1' ('TM-1'). We reported on the chromosomal effects, lint percentage, boll weight, seedcotton yield and lint yield in chromosome substitution CS-B (G. barbadense L.) lines. Using an additive-dominance genetic model, we studied the interaction of alleles located on two alien substituted chromosomes versus one alien substituted chromosome using a partial diallel mating design of selected CS-B lines (CS-B05sh, CS-B06, CS-B09, CS-B10, CS-B12, CS-B17 and CS-B18). Among these parents, CS-B09 and CS-B10 were reported for the first time. The donor parent 3-79, had the lowest additive effect for all of the agronomic traits. All of the CS-B lines had significant additive effects with boll weight and lint percentage. CS-B10 had the highest additive effects for lint percentage, and seedcotton and lint yield among all of the lines showing a transgressive genetic mode of inheritance for these traits. CS-B09 had greater additive genetic effects on lint yield, while CS-B06, CS-B10 and CS-B17 had superior additive genetic effects on both lint and seedcotton yield compared to TM-1 parent. The 3-79 line had the highest dominance effects for boll weight (0.513 g) and CS-B10 had the lowest dominance effect for boll weight (-0.702). Some major antagonistic genetic effects for the agronomic traits were present with most of the substituted chromosomes and chromosome arms, a finding suggested their recalcitrance to conventional breeding efforts. The results revealed that the substituted chromosomes and arms of 3-79 carried some cryptic beneficial alleles with potential to improve agronomic traits including yield, whose effects were masked at the whole genome level in 3-79.

  9. Molecular characterization of GhPLDα1 and its relationship with secondary cell wall thickening in cotton fibers.

    PubMed

    Tang, Kai; Liu, Jin-Yuan

    2017-01-01

    Phospholipase D (PLD) hydrolyzes phospholipids to generate a free polar head group (e.g., choline) and a second messenger phosphatidic acid and plays diverse roles in plant growth and development, including seed germination, leaf senescence, root hair growth, and hypocotyl elongation. However, the function of PLD in cotton remains largely unexplored. Here, the comprehensive molecular characterization of GhPLDα1 was explored with its role in upland cotton (Gossypium hirsutum) fiber development. The GhPLDα1 gene was cloned successfully, and a sequence alignment showed that GhPLDα1 contains one C2 domain and two HKD (HxKxxxxD) domains. Quantitative reverse transcriptase-polymerase chain reaction measured the expression of GhPLDα1 in various cotton tissues with the highest level in fibers at 20 days post anthesis (d.p.a.). Fluorescent microscopy and immunoblotting in tobacco epidermis showed the GhPLDα1 distribution in both cell membranes and the cytoplasm. An activity assay indicated changes in PLDα enzyme activity in developing fiber cells with a peak level at 20 d.p.a., coinciding with the onset of cellulose accumulation and the increased H 2 O 2 content during fiber development. Furthermore, the inhibition of PLDα activity obviously decreased the cellulose and H 2 O 2 contents of in vitro-cultured cotton fibers. These results provide important evidence explaining the relationship of GhPLDα1 with secondary cell wall thickening in cotton fibers in that GhPLDα1 may correlate with the increased H 2 O 2 content at the onset of secondary cell wall thickening, ultimately promoting cellulose biosynthesis. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Reproductive ecology of tundra swans on the Arctic National Wildlife Refuge, Alaska

    USGS Publications Warehouse

    Monda, Matthew J.; Ratti, John T.; McCabe, Thomas R.

    1994-01-01

    Management of tundra swans (Cygnus columbianus) is hampered by a lack of information on their nesting and brood-rearing ecology. We studied tundra swan nesting and brood-rearing ecology on the Arctic National Wildlife Refuge (ANWR), Alaska, 1988-90. Nest success was 58% (n = 31) in 1988, 83% (n = 36) in 1989, 84% (n = 43) in 1990, and 76% (n = 110) for the 3 years. Nests were located predominately in marshes dominated by sheathed pondweed (Potamogeton vaginatus), mare's tail (Hippuris vulgaris), and Hoppner sedge (Carex subspathacea), or by pendent grass (Arctophila fulva), water sedge (C. aquatilis), and tall cotton grass (Eriophorum angustifolium). Nests were seldom located in upland or partially vegetated habitats and were near coastal lagoons or large coastal lakes. Incubating swans were easily disturbed by ground observers and left their nests when we were 500-2,000 m from the nest. Swans did not cover eggs with nest material prior to departure; thus, eggs were vulnerable to avain predation and thermal stress. Brood-foraging sites on the Kongakut Delta (n = 41) were frequently in aquatic-marsh (59%) and saline graminoid-shrub (29%) habitats, occasionally in graminoid-marsh (7%) and partially vegetated (5%) habitats, and absent from upland, graminoid-shrub-water sedge, and graminoid-shrub-cotton grass habitats. Brood-foraging sites on the Canning Delta (n = 35) were frequently in graminoid-marsh (46%), graminoid-shrub-water sedge (26%), and aquatic-marsh (23%) habitats, occasionally in graminoid-shrub-cotton grass (3%) and upland habitats (3%), and absent from saline graminoid-shrub and partially vegetated habitats. Young cygnets grazed in terrestrial habitats more frequently than older broods on the Kongakut (P = 0.003) and Canning (P = 0.053) deltas. Wetlands with sheathed pondweed were uncommon but preferred by broods (P = 0.001). Using field experiments, we evaluated effects of swan grazing and fertilization from feces on aboveground biomass production and plant-species composition. Fertilization from swan feces did not have an overall effect (P = 0.991) or interact with clipping (simulated grazing with hand shears) (P = 0.881) for any response variable investigated. Clipping increased total vegetational biomass the year of clipping (P = 0.001), decreased biomass the year after clipping (P = 0.001), and increased total shoot densities (P = 0.017). Shoot densities after clipping increased for Hoppner sedge (P = 0.010), did not change for tundra grass (Dupontia fischeri) (P = 0.296), and decreased for chickweed (Dupontia fischeri) (P = 0.006). Traditional use of foraging sites may enhance grazing areas by increasing plant production the year of grazing and densities of plant species that tolerate grazing. Protection of aquatic-marsh, graminoid-marsh, and saline graminoid-shrub habitats, particularly those supporting sheathed pondweed and traditionally used nesting areas, is important for maintaining current swan populations on ANWR.

  11. Comparative transcriptome profiling of upland (VS16) and lowland (AP13) ecotypes of switchgrass.

    PubMed

    Ayyappan, Vasudevan; Saha, Malay C; Thimmapuram, Jyothi; Sripathi, Venkateswara R; Bhide, Ketaki P; Fiedler, Elizabeth; Hayford, Rita K; Kalavacharla, Venu Kal

    2017-01-01

    Transcriptomes of two switchgrass genotypes representing the upland and lowland ecotypes will be key tools in switchgrass genome annotation and biotic and abiotic stress functional genomics. Switchgrass (Panicum virgatum L.) is an important bioenergy feedstock for cellulosic ethanol production. We report genome-wide transcriptome profiling of two contrasting tetraploid switchgrass genotypes, VS16 and AP13, representing the upland and lowland ecotypes, respectively. A total of 268 million Illumina short reads (50 nt) were generated, of which, 133 million were obtained in AP13 and the rest 135 million in VS16. More than 90% of these reads were mapped to the switchgrass reference genome (V1.1). We identified 6619 and 5369 differentially expressed genes in VS16 and AP13, respectively. Gene ontology and KEGG pathway analysis identified key genes that regulate important pathways including C4 photosynthesis, photorespiration and phenylpropanoid metabolism. A series of genes (33) involved in photosynthetic pathway were up-regulated in AP13 but only two genes showed higher expression in VS16. We identified three dicarboxylate transporter homologs that were highly expressed in AP13. Additionally, genes that mediate drought, heat, and salinity tolerance were also identified. Vesicular transport proteins, syntaxin and signal recognition particles were seen to be up-regulated in VS16. Analyses of selected genes involved in biosynthesis of secondary metabolites, plant-pathogen interaction, membrane transporters, heat, drought and salinity stress responses confirmed significant variation in the relative expression reflected in RNA-Seq data between VS16 and AP13 genotypes. The phenylpropanoid pathway genes identified here are potential targets for biofuel conversion.

  12. Confamiliar transferability of simple sequence repeat (SSR) markers from cotton (Gossypium hirsutum L.) and jute (Corchorus olitorius L.) to twenty two Malvaceous species.

    PubMed

    Satya, Pratik; Paswan, Pramod Kumar; Ghosh, Swagata; Majumdar, Snehalata; Ali, Nasim

    2016-06-01

    Cross-species transferability is a quick and economic method to enrich SSR database, particularly for minor crops where little genomic information is available. However, transferability of SSR markers varies greatly between species, genera and families of plant species. We assessed confamiliar transferability of SSR markers from cotton (Gossypium hirsutum) and jute (Corchorus olitorius) to 22 species distributed in different taxonomic groups of Malvaceae. All the species selected were potential industrial crop species having little or no genomic resources or SSR database. Of the 14 cotton SSR loci tested, 13 (92.86 %) amplified in G. arboreum and 71.43 % exhibited cross-genera transferability. Nine out of 11 jute SSRs (81.81 %) showed cross-transferability across genera. SSRs from both the species exhibited high polymorphism and resolving power in other species. The correlation between transferability of cotton and jute SSRs were highly significant (r = 0.813). The difference in transferability among species was also significant for both the marker groups. High transferability was observed at genus, tribe and subfamily level. At tribe level, transferability of jute SSRs (41.04 %) was higher than that of cotton SSRs (33.74 %). The tribe Byttnerieae exhibited highest SSR transferability (48.7 %). The high level of cross-genera transferability (>50 %) in ten species of Malvaceae, where no SSR resource is available, calls for large scale transferability testing from the enriched SSR databases of cotton and jute.

  13. Evolutionary dynamics of 3D genome architecture following polyploidization in cotton.

    PubMed

    Wang, Maojun; Wang, Pengcheng; Lin, Min; Ye, Zhengxiu; Li, Guoliang; Tu, Lili; Shen, Chao; Li, Jianying; Yang, Qingyong; Zhang, Xianlong

    2018-02-01

    The formation of polyploids significantly increases the complexity of transcriptional regulation, which is expected to be reflected in sophisticated higher-order chromatin structures. However, knowledge of three-dimensional (3D) genome structure and its dynamics during polyploidization remains poor. Here, we characterize 3D genome architectures for diploid and tetraploid cotton, and find the existence of A/B compartments and topologically associated domains (TADs). By comparing each subgenome in tetraploids with its extant diploid progenitor, we find that genome allopolyploidization has contributed to the switching of A/B compartments and the reorganization of TADs in both subgenomes. We also show that the formation of TAD boundaries during polyploidization preferentially occurs in open chromatin, coinciding with the deposition of active chromatin modification. Furthermore, analysis of inter-subgenomic chromatin interactions has revealed the spatial proximity of homoeologous genes, possibly associated with their coordinated expression. This study advances our understanding of chromatin organization in plants and sheds new light on the relationship between 3D genome evolution and transcriptional regulation.

  14. Unravel the key genes potentially related to high strength of cotton fiber by comparative phenotypic and genomic analyses

    USDA-ARS?s Scientific Manuscript database

    The demand of high strength of cotton fibers has been increased dramatically with the advent of modern high speed spinning technology for producing yarn. Bundle fiber strength is affected by fiber-to-fiber interactions in addition to the individual fiber strength. The bundle fiber strength is not al...

  15. A MAGIC population-based genome-wide association study reveals functional association of GhRBB1_A07 gene with superior fiber quality in cotton

    USDA-ARS?s Scientific Manuscript database

    Background: Cotton supplies a great majority of natural fiber for the global textile industry. The negative correlation between yield and fiber quality has hindered breeders’ ability to improve these traits simultaneously. A multi-parent advanced generation inter-cross (MAGIC) population developed t...

  16. Identification of candidate genes from the SAD gene family in cotton for determination of cottonseed oil composition.

    PubMed

    Shang, Xiaoguang; Cheng, Chaoze; Ding, Jian; Guo, Wangzhen

    2017-02-01

    Cotton is an economically important crop grown for natural fiber and seed oil production. Cottonseed oil ranks third after soybean oil and colza oil in terms of edible oilseed tonnage worldwide. The fatty acid composition of cottonseed oil determines its industrial application and nutritional values. However, little progress has been made in understanding cottonseed oil biogenesis. Stearoyl-acyl carrier protein desaturase (SAD), the only known enzyme to convert saturated fatty acids into unsaturated fatty acids in plants, plays key roles in determining the fatty acid composition of cottonseed oil. In this study, we identified 9, 9, 18 and 19 SAD genes in the genomes of four sequenced cotton species: diploid Gossypium raimondii (D 5 ), G. arboreum (A 2 ), tetraploid G. hirsutum acc. TM-1 (AD 1 ) and G. barbadense cv. Xinhai21 (AD 2 ), respectively. Bioinformatic and phylogenetic analyses revealed that cotton SADs can be classified into two classes. Expression patterns showed developmental and spatial regulation of SADs in cotton. GhSAD2 and GhSAD4 were preferentially expressed in developing ovules 20-35 days post-anthesis, and significantly different expression patterns were found between high-oil and low-oil cotton cultivars, implying these two genes could be involved in cottonseed oil biogenesis. Association analysis further confirmed that GhSAD4-At expression was closely related to the oleic acid (O) content, linoleic acid (L) content and O/L value in cottonseed, implying GhSAD4 plays an important role in cottonseed oil composition. This study brings new perspectives for integrated genome-wide identification of SADs in cotton and provides references for the genetic improvement of cottonseed oil.

  17. The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

    PubMed

    He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

    2017-07-03

    Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

  18. Quantitative trait loci analysis of Verticillium wilt resistance in interspecific backcross populations of Gossypium hirsutum × Gossypium barbadense.

    PubMed

    Shi, Yuzhen; Zhang, Baocai; Liu, Aiying; Li, Wentan; Li, Junwen; Lu, Quanwei; Zhang, Zhen; Li, Shaoqi; Gong, Wankui; Shang, Haihong; Gong, Juwu; Chen, Tingting; Ge, Qun; Wang, Tao; Zhu, Heqin; Liu, Zhi; Yuan, Youlu

    2016-11-05

    Verticillium wilt (VW) caused by Verticillium dahliae (Kleb) is one of the most destructive diseases of cotton. The identification of highly resistant QTLs or genes in the whole cotton genome is quite important for developing a VW-resistant variety and for further molecular design breeding. In the present study, BC 1 F 1 , BC 1 S 1 , and BC 2 F 1 populations derived from an interspecific backcross between the highly resistant line Hai1 (Gossypium barbadense L.) and the susceptible variety CCRI36 (G. hirsutum L.) as the recurrent parent were constructed. Quantitative trait loci (QTL) related to VW resistance were detected in the whole cotton genome using a high-density simple sequence repeat (SSR) genetic linkage map from the BC 1 F 1 population, with 2292 loci covering 5115.16 centiMorgan (cM) of the cotton (AD) genome, and the data concerning VW resistance that were obtained from four dates of BC 2 F 1 in the artificial disease nursery and one date of BC 1 S 1 and BC 2 F 1 in the field. A total of 48 QTLs for VW resistance were identified, and 37 of these QTLs had positive additive effects, which indicated that the G. barbadense alleles increased resistance to VW and decreased the disease index (DI) by about 2.2-10.7. These QTLs were located on 19 chromosomes, in which 33 in the A subgenome and 15 QTLs in the D subgenome. The 6 QTLs were found to be stable. The 6 QTLs were consistent with those identified previously, and another 42 were new, unreported QTLs, of which 31 QTLs were from G. barbadense. By meta-analysis, 17 QTL hotspot regions were identified and 10 of them were new, unreported hotspot regions. 29 QTLs in this paper were in 12 hotspot regions and were all from G. barbadense. These stable or consensus QTL regions warrant further investigation to better understand the genetics and molecular mechanisms underlying VW resistance. This study provides useful information for further comparative analysis and marker-assisted selection in the breeding of disease-resistant cotton. It may also lay an important foundation for gene cloning and further molecular design breeding for the entire cotton genome.

  19. Feast and famine in plant genomes.

    Treesearch

    Jonathan F. Wendel; Richard C. Cronn; J. Spencer Jonhston; H. James Price

    2002-01-01

    Plant genomes vary over several orders of magnitude in size, even among closely related species, yet the origin, genesis and significance of this variation are not clear. Because DNA content varies over a sevenfold range among diploid species in the cotton genus (Gossypium) and its allies, this group offers opportunities for exploring patterns and mechanisms of genome...

  20. Deploying a Proximal Sensing Cart to Identify Drought-Adaptive Traits in Upland Cotton for High-Throughput Phenotyping

    PubMed Central

    Thompson, Alison L.; Thorp, Kelly R.; Conley, Matthew; Andrade-Sanchez, Pedro; Heun, John T.; Dyer, John M.; White, Jeffery W.

    2018-01-01

    Field-based high-throughput phenotyping is an emerging approach to quantify difficult, time-sensitive plant traits in relevant growing conditions. Proximal sensing carts represent an alternative platform to more costly high-clearance tractors for phenotyping dynamic traits in the field. A proximal sensing cart and specifically a deployment protocol, were developed to phenotype traits related to drought tolerance in the field. The cart-sensor package included an infrared thermometer, ultrasonic transducer, multi-spectral reflectance sensor, weather station, and RGB cameras. The cart deployment protocol was evaluated on 35 upland cotton (Gossypium hirsutum L.) entries grown in 2017 at Maricopa, AZ, United States. Experimental plots were grown under well-watered and water-limited conditions using a (0,1) alpha lattice design and evaluated in June and July. Total collection time of the 0.87 hectare field averaged 2 h and 27 min and produced 50.7 MB and 45.7 GB of data from the sensors and RGB cameras, respectively. Canopy temperature, crop water stress index (CWSI), canopy height, normalized difference vegetative index (NDVI), and leaf area index (LAI) differed among entries and showed an interaction with the water regime (p < 0.05). Broad-sense heritability (H2) estimates ranged from 0.097 to 0.574 across all phenotypes and collections. Canopy cover estimated from RGB images increased with counts of established plants (r = 0.747, p = 0.033). Based on the cart-derived phenotypes, three entries were found to have improved drought-adaptive traits compared to a local adapted cultivar. These results indicate that the deployment protocol developed for the cart and sensor package can measure multiple traits rapidly and accurately to characterize complex plant traits under drought conditions. PMID:29868041

  1. A Detailed RFLP Map of Cotton, Gossypium Hirsutum X Gossypium Barbadense: Chromosome Organization and Evolution in a Disomic Polyploid Genome

    PubMed Central

    Reinisch, A. J.; Dong, J. M.; Brubaker, C. L.; Stelly, D. M.; Wendel, J. F.; Paterson, A. H.

    1994-01-01

    We employ a detailed restriction fragment length polymorphism (RFLP) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. About 46.2% of nuclear DNA probes detect RFLPs distinguishing Gossypium hirsutum and Gossypium barbadense; and 705 RFLP loci are assembled into 41 linkage groups and 4675 cM. The subgenomic origin (A vs. D) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. The A and D subgenomes show similar recombinational length, suggesting that repetitive DNA in the physically larger A subgenome is recombinationally inert. RFLPs are somewhat more abundant in the D subgenome. Linkage among duplicated RFLPs reveals 11 pairs of homoeologous chromosomal regions-two appear homosequential, most differ by inversions, and at least one differs by a translocation. Most homoeologies involve chromosomes from different subgenomes, putatively reflecting the n = 13 to n = 26 polyploidization event of 1.1-1.9 million years ago. Several observations suggest that another, earlier, polyploidization event spawned n = 13 cottons, at least 25 million years ago. The cotton genome contains about 400-kb DNA per cM, hence map-based gene cloning is feasible. The cotton map affords new opportunities to study chromosome evolution, and to exploit Gossypium genetic resources for improvement of the world's leading natural fiber. PMID:7851778

  2. Long noncoding RNAs and their proposed functions in fibre development of cotton (Gossypium spp.).

    PubMed

    Wang, Maojun; Yuan, Daojun; Tu, Lili; Gao, Wenhui; He, Yonghui; Hu, Haiyan; Wang, Pengcheng; Liu, Nian; Lindsey, Keith; Zhang, Xianlong

    2015-09-01

    Long noncoding RNAs (lncRNAs) are transcripts of at least 200 bp in length, possess no apparent coding capacity and are involved in various biological regulatory processes. Until now, no systematic identification of lncRNAs has been reported in cotton (Gossypium spp.). Here, we describe the identification of 30 550 long intergenic noncoding RNA (lincRNA) loci (50 566 transcripts) and 4718 long noncoding natural antisense transcript (lncNAT) loci (5826 transcripts). LncRNAs are rich in repetitive sequences and preferentially expressed in a tissue-specific manner. The detection of abundant genome-specific and/or lineage-specific lncRNAs indicated their weak evolutionary conservation. Approximately 76% of homoeologous lncRNAs exhibit biased expression patterns towards the At or Dt subgenomes. Compared with protein-coding genes, lncRNAs showed overall higher methylation levels and their expression was less affected by gene body methylation. Expression validation in different cotton accessions and coexpression network construction helped to identify several functional lncRNA candidates involved in cotton fibre initiation and elongation. Analysis of integrated expression from the subgenomes of lncRNAs generating miR397 and its targets as a result of genome polyploidization indicated their pivotal functions in regulating lignin metabolism in domesticated tetraploid cotton fibres. This study provides the first comprehensive identification of lncRNAs in Gossypium. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. iTRAQ-Based Quantitative Proteomic Analysis Reveals Cold Responsive Proteins Involved in Leaf Senescence in Upland Cotton (Gossypium hirsutum L.).

    PubMed

    Zheng, Xuewei; Fan, Shuli; Wei, Hengling; Tao, Chengcheng; Ma, Qiang; Ma, Qifeng; Zhang, Siping; Li, Hongbin; Pang, Chaoyou; Yu, Shuxun

    2017-09-16

    Premature leaf senescence occurs in the ultimate phase of the plant, and it occurs through a complex series of actions regulated by stress, hormones and genes. In this study, a proteomic analysis was performed to analyze the factors that could induce premature leaf senescence in two cotton cultivars. We successfully identified 443 differential abundant proteins (DAPs) from 7388 high-confidence proteins at four stages between non-premature senescence (NS) and premature senescence (PS), among which 158 proteins were over-accumulated, 238 proteins were down-accumulated at four stages, and 47 proteins displayed overlapped accumulation. All the DAPs were mapped onto 21 different categories on the basis of a Clusters of Orthologous Groups (COG) analysis, and 9 clusters were based on accumulation. Gene Ontology (GO) enrichment results show that processes related to stress responses, including responses to cold temperatures and responses to hormones, are significantly differentially accumulated. More importantly, the enriched proteins were mapped in The Arabidopsis Information Resource (TAIR), showing that 58 proteins play an active role in abiotic stress, hormone signaling and leaf senescence. Among these proteins, 26 cold-responsive proteins (CRPs) are significantly differentially accumulated. The meteorological data showed that the median temperatures declined at approximately 15 days before the onset of aging, suggesting that a decrease in temperature is tightly linked to an onset of cotton leaf senescence. Because accumulations of H₂O₂ and increased jasmonic acid (JA) were detected during PS, we speculate that two pathways associated with JA and H₂O₂ are closely related to premature leaf senescence in cotton.

  4. Use of diversity arrays technology markers for integration into a cotton reference map and anchoring to a recombinant inbred line map

    USDA-ARS?s Scientific Manuscript database

    A DArT marker platform is developed for the cotton genome to evaluate the use of DArT markers compared to AFLPs in mapping, and transferability across the mapping populations. We used a reference genetic map of tetraploid Gossypium that already contained ~5000 loci which coalesced into 26 chromosom...

  5. The draft genome of a diploid cotton Gossypium raimondii

    USDA-ARS?s Scientific Manuscript database

    We have sequenced and assembled the draft genome of Gossypium raimondii, whose progenitor is considered the contributor of the D-subgenome to the economically important natural textile fiber producer, G. hirsutum. Next-generation Illumina pair-end (PE) sequencing strategies were employed to obtain ...

  6. Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

    PubMed Central

    Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

    2012-01-01

    Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

  7. Draft Genome Sequence and Description of Janthinobacterium sp. Strain CG3, a Psychrotolerant Antarctic Supraglacial Stream Bacterium

    PubMed Central

    Smith, Heidi; Akiyama, Tatsuya; Franklin, Michael; Woyke, Tanja; Teshima, Hazuki; Davenport, Karen; Daligault, Hajnalka; Erkkila, Tracy; Goodwin, Lynne; Gu, Wei; Xu, Yan; Chain, Patrick

    2013-01-01

    Here we present the draft genome sequence of Janthinobacterium sp. strain CG3, a psychrotolerant non-violacein-producing bacterium that was isolated from the Cotton Glacier supraglacial stream. The genome sequence of this organism will provide insight as to the mechanisms necessary for bacteria to survive in UV-stressed icy environments. PMID:24265494

  8. Molecular evolution of the plastid genome during diversification of the cotton genus.

    PubMed

    Chen, Zhiwen; Grover, Corrinne E; Li, Pengbo; Wang, Yumei; Nie, Hushuai; Zhao, Yanpeng; Wang, Meiyan; Liu, Fang; Zhou, Zhongli; Wang, Xingxing; Cai, Xiaoyan; Wang, Kunbo; Wendel, Jonathan F; Hua, Jinping

    2017-07-01

    Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and one tetraploid genomic group, namely AD. To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome duringdiversification, chloroplast genomes (cpDNA) from 6 D-genome and 2 G-genome species of Gossypium (G. armourianum D 2-1 , G. harknessii D 2-2 , G. davidsonii D 3-d , G. klotzschianum D 3-k , G. aridum D 4 , G. trilobum D 8 , and G. australe G 2 , G. nelsonii G 3 ) were newly reported here. In combination with the 26 previously released cpDNA sequences, we performed comparative phylogenetic analyses of 34 Gossypium chloroplast genomes that collectively represent most of the diversity in the genus. Gossypium chloroplasts span a small range in size that is mostly attributable to indels that occur in the large single copy (LSC) region of the genome. Phylogenetic analysis using a concatenation of all genes provides robust support for six major Gossypium clades, largely supporting earlier inferences but also revealing new information on intrageneric relationships. Using Theobroma cacao as an outgroup, diversification of the genus was dated, yielding results that are in accord with previous estimates of divergence times, but also offering new perspectives on the basal, early radiation of all major clades within the genus as well as gaps in the record indicative of extinctions. Like most higher-plant chloroplast genomes, all cotton species exhibit a conserved quadripartite structure, i.e., two large inverted repeats (IR) containing most of the ribosomal RNA genes, and two unique regions, LSC (large single sequence) and SSC (small single sequence). Within Gossypium, the IR-single copy region junctions are both variable and homoplasious among species. Two genes, accD and psaJ, exhibited greater rates of synonymous and non-synonymous substitutions than did other genes. Most genes exhibited Ka/Ks ratios suggestive of neutral evolution, with 8 exceptions distributed among one to several species. This research provides an overview of the molecular evolution of a single, large non-recombining molecular during the diversification of this important genus. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Genome-wide analysis of the MADS-box gene family in polyploid cotton (Gossypium hirsutum) and in its diploid parental species (Gossypium arboreum and Gossypium raimondii).

    PubMed

    Nardeli, Sarah Muniz; Artico, Sinara; Aoyagi, Gustavo Mitsunori; de Moura, Stéfanie Menezes; da Franca Silva, Tatiane; Grossi-de-Sa, Maria Fatima; Romanel, Elisson; Alves-Ferreira, Marcio

    2018-06-01

    The MADS-box gene family encodes transcription factors that share a highly conserved domain known to bind to DNA. Members of this family control various processes of development in plants, from root formation to fruit ripening. In this work, a survey of diploid (Gossypium raimondii and Gossypium arboreum) and tetraploid (Gossypium hirsutum) cotton genomes found a total of 147, 133 and 207 MADS-box genes, respectively, distributed in the MIKC, Mα, Mβ, Mγ, and Mδ subclades. A comparative phylogenetic analysis among cotton species, Arabidopsis, poplar and grapevine MADS-box homologous genes allowed us to evaluate the evolution of each MADS-box lineage in cotton plants and identify sequences within well-established subfamilies. Chromosomal localization and phylogenetic analysis revealed that G. raimondii and G. arboreum showed a conserved evolution of the MIKC subclade and a distinct pattern of duplication events in the Mα, Mγ and Mδ subclades. Additionally, G. hirsutum showed a combination of its parental subgenomes followed by a distinct evolutionary history including gene gain and loss in each subclade. qPCR analysis revealed the expression patterns of putative homologs in the AP1, AP3, AGL6, SEP4, AGL15, AG, AGL17, TM8, SVP, SOC and TT16 subfamilies of G. hirsutum. The identification of putative cotton orthologs is discussed in the light of evolution and gene expression data from other plants. This analysis of the MADS-box genes in Gossypium species opens an avenue to understanding the origin and evolution of each gene subfamily within diploid and polyploid species and paves the way for functional studies in cotton species. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  10. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    PubMed

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  11. Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

    PubMed

    Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

    2017-09-15

    At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Genome-wide investigation and expression profiling of APX gene family in Gossypium hirsutum provide new insights in redox homeostasis maintenance during different fiber development stages.

    PubMed

    Tao, Chengcheng; Jin, Xiang; Zhu, Liping; Xie, Quanliang; Wang, Xuchu; Li, Hongbin

    2018-06-01

    Ascorbate peroxidase (APX) is a member of heme-containing peroxidases which catalyze the H 2 O 2 -dependent oxidation of a wide range of substrates in plants and animals. As is known, H 2 O 2 acts as a signaling molecule in the regulation of fiber development. Our previous work reported that ascorbate peroxidase 1 (GhAPX1) was important for cotton fiber elongation. However, knowledge about APX gene family members and their evolutionary and functional characteristics in cotton is limited. Here, we report 26 GhAPX genes by genome-wide investigation of tetraploid cotton Gossypium hirsutum. Phylogenetic and gene structure analyses classified these APX members into five clades and syntenic analysis suggested two duplication events. Expression profiling of the 26 APXs revealed that ten members are expressed in cotton fibers. Notably, GhAPX10A, GhAPX10D, GhAPX12A, and GhAPX12D showed high expression levels in 30-day fiber, while GhAPX1A/D, GhAPX3A/D, and GhAPX6A/D showed very low expression levels. The enzyme activity and H 2 O 2 content assays revealed that cotton fiber kept high enzyme activity and the lowest H 2 O 2 level in 30-day fibers, indicating that other than GhAPX1, the newly reported APX members are responsible for the reactive oxygen species homeostasis in the cotton fiber maturation stages. Expression profiling of ten fiber-expressed APXs after phytohormone treatments revealed their regulation patterns by different stimuli, suggesting that GhAPX1, GhAPX12A, and GhAPX12D are responsible to most phytohormone treatments. Our data provided evolutionary and functional information of GhAPX gene family members and revealed that different members are responsible to redox homeostasis during different cotton fiber development stages.

  13. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

    PubMed Central

    Silva, TF; Corrêa, RL; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, MFS

    2008-01-01

    Background Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus. PMID:18937850

  14. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease.

    PubMed

    Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S

    2008-10-20

    Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway. PMID:27597995

  16. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway.

  17. A New Synthetic Amphiploid (AADDAA) between Gossypium hirsutum and G. arboreum Lays the Foundation for Transferring Resistances to Verticillium and Drought

    PubMed Central

    Chen, Yu; Wang, Yingying; Zhao, Ting; Yang, Jianwei; Feng, Shouli; Nazeer, Wajad; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium arboreum, a cultivated cotton species (2n = 26, AA) native to Asia, possesses invaluable characteristics unavailable in the tetraploid cultivated cotton gene pool, such as resistance to pests and diseases and tolerance to abiotic stresses. However, it is quite difficult to transfer favorable traits into Upland cotton through conventional methods due to the cross-incompatibility of G. hirsutum (2n = 52, AADD) and G. arboreum. Here, we improved an embryo rescue technique to overcome the cross-incompatibility between these two parents for transferring favorable genes from G. arboreum into G. hirsutum. Our results indicate that MSB2K supplemented with 0.5 mgl-1 kinetin and 250 mg-1 casein hydrolysate is an efficient initial medium for rescuing early (3 d after pollination) hybrid embryos. Eight putative hybrids were successfully obtained, which were further verified and characterized by cytology, molecular markers and morphological analysis. The putative hybrids were subsequently treated with different concentrations of colchicine solution to double their chromosomes. The results demonstrate that four putative hybrid plants were successfully chromosome-doubled by treatment with 0.1% colchicine for 24 h and become amphiploid, which were confirmed by cytological observation, self-fertilization and backcrossing. Preliminary assessments of resistance at seedling stage indicate that the synthetic amphiploid showed highly resistant to Verticillium and drought. The synthetic amphiploid between G. hirsutum × G. arboreum would lay the foundation for developing G. arboreum-introgressed lines with the uniform genetic background of G. hirsutum acc TM-1, which would greatly enhance and simplify the mining, isolation, characterization, cloning and use of G. arboreum-specific desirable genes in future cotton breeding programs. PMID:26061996

  18. Generation and Analysis of a Large-Scale Expressed Sequence Tag Database from a Full-Length Enriched cDNA Library of Developing Leaves of Gossypium hirsutum L

    PubMed Central

    Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Yu, Shuxun

    2013-01-01

    Background Cotton (Gossypium hirsutum L.) is one of the world’s most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. Methodology/Principal Findings In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR), which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. Conclusions/Significance These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence assembly and annotation in G. hirsutum and comparative genomics among Gossypium species. PMID:24146870

  19. Characterization of reniform nematode genome through shotgun sequencing

    USDA-ARS?s Scientific Manuscript database

    The reniform nematode (RN), a major agricultural pest particularly on cotton in the United States(U.S.), is among the major plant parasitic nematodes for which limited genomic information exists. In this study, over 380 Mb of sequence data were generated from four pooled adult female RN and assembl...

  20. Genomic Comparison of the P-ATPase Gene Family in Four Cotton Species and Their Expression Patterns in Gossypium hirsutum.

    PubMed

    Chen, Wen; Si, Guo-Yang; Zhao, Gang; Abdullah, Muhammad; Guo, Ning; Li, Da-Hui; Sun, Xu; Cai, Yong-Ping; Lin, Yi; Gao, Jun-Shan

    2018-05-05

    Plant P-type H⁺-ATPase (P-ATPase) is a membrane protein existing in the plasma membrane that plays an important role in the transmembrane transport of plant cells. To understand the variety and quantity of P-ATPase proteins in different cotton species, we combined four databases from two diploid cotton species ( Gossypium raimondii and G. arboreum ) and two tetraploid cotton species ( G. hirsutum and G. barbadense ) to screen the P-ATPase gene family and resolved the evolutionary relationships between the former cotton species. We identified 53, 51, 99 and 98 P-ATPase genes from G. arboretum, G. raimondii , G. barbadense and G. hirsutum , respectively. The structural and phylogenetic analyses revealed that the gene structure was consistent between P-ATPase genes, with a close evolutionary relationship. The expression analysis of P-ATPase genes showed that many P-ATPase genes were highly expressed in various tissues and at different fiber developmental stages in G. hirsutum , suggesting that they have potential functions during growth and fiber development in cotton.

  1. Development and GBS-genotyping of introgression lines (ILs) using two wild species of rice, O. meridionalis and O. rufipogon, in a common recurrent parent, O. sativa cv. Curinga.

    PubMed

    Arbelaez, Juan D; Moreno, Laura T; Singh, Namrata; Tung, Chih-Wei; Maron, Lyza G; Ospina, Yolima; Martinez, César P; Grenier, Cécile; Lorieux, Mathias; McCouch, Susan

    Two populations of interspecific introgression lines (ILs) in a common recurrent parent were developed for use in pre-breeding and QTL mapping. The ILs were derived from crosses between cv Curinga, a tropical japonica upland cultivar, and two different wild donors, Oryza meridionalis Ng. accession (W2112) and Oryza rufipogon Griff. accession (IRGC 105491). The lines were genotyped using genotyping-by-sequencing (GBS) and SSRs. The 32 Curinga/ O. meridionalis ILs contain 76.73 % of the donor genome in individual introgressed segments, and each line has an average of 94.9 % recurrent parent genome. The 48 Curinga/ O. rufipogon ILs collectively contain 97.6 % of the donor genome with an average of 89.9 % recurrent parent genome per line. To confirm that these populations were segregating for traits of interest, they were phenotyped for pericarp color in the greenhouse and for four agronomic traits-days to flowering, plant height, number of tillers, and number of panicles-in an upland field environment. Seeds from these IL libraries and the accompanying GBS datasets are publicly available and represent valuable genetic resources for exploring the genetics and breeding potential of rice wild relatives.

  2. Genome-wide analysis of codon usage bias in four sequenced cotton species.

    PubMed

    Wang, Liyuan; Xing, Huixian; Yuan, Yanchao; Wang, Xianlin; Saeed, Muhammad; Tao, Jincai; Feng, Wei; Zhang, Guihua; Song, Xianliang; Sun, Xuezhen

    2018-01-01

    Codon usage bias (CUB) is an important evolutionary feature in a genome which provides important information for studying organism evolution, gene function and exogenous gene expression. The CUB and its shaping factors in the nuclear genomes of four sequenced cotton species, G. arboreum (A2), G. raimondii (D5), G. hirsutum (AD1) and G. barbadense (AD2) were analyzed in the present study. The effective number of codons (ENC) analysis showed the CUB was weak in these four species and the four subgenomes of the two tetraploids. Codon composition analysis revealed these four species preferred to use pyrimidine-rich codons more frequently than purine-rich codons. Correlation analysis indicated that the base content at the third position of codons affect the degree of codon preference. PR2-bias plot and ENC-plot analyses revealed that the CUB patterns in these genomes and subgenomes were influenced by combined effects of translational selection, directional mutation and other factors. The translational selection (P2) analysis results, together with the non-significant correlation between GC12 and GC3, further revealed that translational selection played the dominant role over mutation pressure in the codon usage bias. Through relative synonymous codon usage (RSCU) analysis, we detected 25 high frequency codons preferred to end with T or A, and 31 low frequency codons inclined to end with C or G in these four species and four subgenomes. Finally, 19 to 26 optimal codons with 19 common ones were determined for each species and subgenomes, which preferred to end with A or T. We concluded that the codon usage bias was weak and the translation selection was the main shaping factor in nuclear genes of these four cotton genomes and four subgenomes.

  3. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

    PubMed Central

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

    2016-01-01

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

  4. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

    PubMed

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

    2016-02-09

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

  5. Expansion and stress responses of the AP2/EREBP superfamily in cotton.

    PubMed

    Liu, Chunxiao; Zhang, Tianzhen

    2017-01-31

    The allotetraploid cotton originated from one hybridization event between an extant progenitor of Gosssypium herbaceum (A 1 ) or G. arboreum (A 2 ) and another progenitor, G. raimondii Ulbrich (D 5 ) 1-1.5 million years ago (Mya). The APETALA2/ethylene-responsive element binding protein (AP2/EREBP) transcription factors constitute one of the largest and most conserved gene families in plants. They are characterized by their AP2 domain, which comprises 60-70 amino acids, and are classified into four main subfamilies: the APETALA2 (AP2), Related to ABI3/VP1 (RAV), Dehydration-Responsive Element Binding protein (DREB) and Ethylene-Responsive Factor (ERF) subfamilies. The AP2/EREBP genes play crucial roles in plant growth, development and biotic and abiotic stress responses. Hence, understanding the molecular characteristics of cotton stress tolerance and gene family expansion would undoubtedly facilitate cotton resistance breeding and evolution research. A total of 269 AP2/EREBP genes were identified in the G. raimondii (D5) cotton genome. The protein domain architecture and intron/exon structure are simple and relatively conserved within each subfamily. They are distributed throughout all chromosomes but are clustered on various chromosomes due to genomic tandem duplication. We identified 73 tandem duplicated genes and 221 segmental duplicated gene pairs which contributed to the expansion of AP2/EREBP superfamily. Of them, tandem duplication was the most important force of the expansion of the B3 group. Transcriptome analysis showed that 504 AP2/EREBP genes were expressed in at least one tested G. hirsutum TM-1 tissues. In G. hirsutum, 151 non-repeated genes of the DREB and ERF subfamily genes were responsive to different stresses: 132 genes were induced by cold, 63 genes by drought and 94 genes by heat. qRT-PCR confirmed that 13 GhDREB and 15 GhERF genes were induced by cold and/or drought. No transcripts detected for 53 of the 111 tandem duplicated genes in TM-1. In addition, some homoeologous genes showed biased expression toward either A-or D-subgenome. The AP2/EREBP genes were obviously expanded in Gossypium. The GhDREB and GhERF genes play crucial roles in cotton stress responses. Our genome-wide analysis of AP2/EREBP genes in cotton provides valuable information for characterizing the molecular functions of AP2/EREBP genes and reveals insights into their evolution in polyploid plants.

  6. Genome-wide recombination rate variation in a recombination map of cotton.

    PubMed

    Shen, Chao; Li, Ximei; Zhang, Ruiting; Lin, Zhongxu

    2017-01-01

    Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species' genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton.

  7. Genome-wide recombination rate variation in a recombination map of cotton

    PubMed Central

    Shen, Chao; Li, Ximei; Zhang, Ruiting

    2017-01-01

    Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species’ genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton. PMID:29176878

  8. Duplicated genes evolve independently in allopolyploid cotton.

    Treesearch

    Richard C. Cronn; Randall L. Small; Jonathan F. Wendel

    1999-01-01

    Of the many processes that generate gene duplications, polyploidy is unique in that entire genomes are duplicated. This process has been important in the evolution of many eukaryotic groups, and it occurs with high frequency in plants. Recent evidence suggests that polyploidization may be accompanied by rapid genomic changes, but the evolutionary fate of discrete loci...

  9. Diversity and population structure of northern switchgrass as revealed through exome capture sequencing

    DOE PAGES

    Evans, Joseph; Crisovan, Emily; Barry, Kerrie; ...

    2015-10-01

    Panicum virgatum L. (switchgrass) is a polyploid, perennial grass species that is native to North America, and is being developed as a future biofuel feedstock crop. Switchgrass is present primarily in two ecotypes: a northern upland ecotype, composed of tetraploid and octoploid accessions, and a southern lowland ecotype, composed of primarily tetraploid accessions. We employed high-coverage exome capture sequencing (~2.4 Tb) to genotype 537 individuals from 45 upland and 21 lowland populations. From these data, we identified ~27 million single-nucleotide polymorphisms (SNPs), of which 1 590 653 high-confidence SNPs were used in downstream analyses of diversity within and between themore » populations. From the 66 populations, we identified five primary population groups within the upland and lowland ecotypes, a result that was further supported through genetic distance analysis. We identified conserved, ecotype-restricted, non-synonymous SNPs that are predicted to affect the protein function of CONSTANS (CO) and EARLY HEADING DATE 1 (EHD1), key genes involved in flowering, which may contribute to the phenotypic differences between the two ecotypes. We also identified, relative to the near-reference Kanlow population, 17 228 genes present in more copies than in the reference genome (up-CNVs), 112 630 genes present in fewer copies than in the reference genome (down-CNVs) and 14 430 presence/absence variants (PAVs), affecting a total of 9979 genes, including two upland-specific CNV clusters. In total, 45 719 genes were affected by an SNP, CNV, or PAV across the panel, providing a firm foundation to identify functional variation associated with phenotypic traits of interest for biofuel feedstock production.« less

  10. Diversity and population structure of northern switchgrass as revealed through exome capture sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evans, Joseph; Crisovan, Emily; Barry, Kerrie

    Panicum virgatum L. (switchgrass) is a polyploid, perennial grass species that is native to North America, and is being developed as a future biofuel feedstock crop. Switchgrass is present primarily in two ecotypes: a northern upland ecotype, composed of tetraploid and octoploid accessions, and a southern lowland ecotype, composed of primarily tetraploid accessions. We employed high-coverage exome capture sequencing (~2.4 Tb) to genotype 537 individuals from 45 upland and 21 lowland populations. From these data, we identified ~27 million single-nucleotide polymorphisms (SNPs), of which 1 590 653 high-confidence SNPs were used in downstream analyses of diversity within and between themore » populations. From the 66 populations, we identified five primary population groups within the upland and lowland ecotypes, a result that was further supported through genetic distance analysis. We identified conserved, ecotype-restricted, non-synonymous SNPs that are predicted to affect the protein function of CONSTANS (CO) and EARLY HEADING DATE 1 (EHD1), key genes involved in flowering, which may contribute to the phenotypic differences between the two ecotypes. We also identified, relative to the near-reference Kanlow population, 17 228 genes present in more copies than in the reference genome (up-CNVs), 112 630 genes present in fewer copies than in the reference genome (down-CNVs) and 14 430 presence/absence variants (PAVs), affecting a total of 9979 genes, including two upland-specific CNV clusters. In total, 45 719 genes were affected by an SNP, CNV, or PAV across the panel, providing a firm foundation to identify functional variation associated with phenotypic traits of interest for biofuel feedstock production.« less

  11. Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium).

    PubMed

    Stipanovic, Robert; Puckhaber, Lorraine; Frelichowski, James; Esquivel, Jesus; Westbrook, John; O'Neil, Mike; Bell, Alois; Dowd, Michael; Hake, Kater; Duke, Sara

    2016-02-01

    The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their leaves that contain the dimeric sesquiterpenoid gossypol as well as other biosynthetically related terpenoids. In addition to gossypol, a previously unknown dimeric sesquiterpenoid, gossypolhemiquinone (GHQ), was identified in trace amounts in G. thurberi, a member of the D genome. Other members of the D genome of Gossypium were subsequently found to contain this compound, but GHQ was not detected in commercial cotton cultivars. When fed to Helicoverpa zea in an artificial diet, GHQ delayed days-to-pupation, reduced pupal weights, and survival to adulthood to a lesser or equal extent than gossypol in comparison to the control diet. However, GHQ had a synergistic effect on survival and days-to-pupation when combined with gossypol at the highest dosage tested (0.18%; 15.5:84.5 GHQ:gossypol). Because gossypol exhibits anti-cancer activity, GHQ was also evaluated for its anti-cancer activity against the National Cancer Institute's 60-Human Tumor Cell Line Screen. Significant inhibitory activity against most of these cell lines was not observed, but the results may offer some promise against leukemia cancer cell lines. Published by Elsevier Ltd.

  12. High-Affinity Methanotrophy Informed by Genome-Wide Analysis of Upland Soil Cluster Alpha (USCα) from Axel Heiberg Island, Canadian High Arctic

    NASA Astrophysics Data System (ADS)

    Rusley, C.; Onstott, T. C.; Lau, M.

    2017-12-01

    Methane (CH4) is a potent greenhouse gas whose proper budgeting is vital to climate predictions. Recent studies have identified upland Arctic mineral cryosols as consistent CH4 sinks, drawing CH4 from both the atmosphere and underlying anaerobic soil layers. Global atmospheric CH4 uptake is proposed to be mediated by high-affinity methanotrophs based on the detection of the marker gene pmoA (particulate methane monooxygenase beta subunit). However, a lack of pure cultures and scarcity of genomic information have hindered our understanding of their metabolic capabilities and versatility. Together with the missing genetic linkage between its pmoA and 16S ribosomal RNA (rRNA) gene, the factors that control the distribution and magnitude of high-affinity methanotrophy in the Arctic permafrost-affected region have remained elusive. Using 21 metagenomic datasets of surface soils obtained from long-term core incubation experiments,1 this bioinformatics study aimed to reconstruct the draft genome of the Upland Soil Cluster α-proteobacteria (USCα), the high-affinity methanotroph previously detected in the samples,2 and to determine its phylogeny and metabolic requirements. We obtained a genome bin containing the high-affinity form of the USCα-like pmoA gene. The 3.03 Mbp assembly is 91.6% complete with a unique set of single-copy marker genes. The 16S rRNA gene fragment of USCα belongs to the α-proteobacterial family Beijerinckiaceae. Genome annotation indicates possible formaldehyde oxidation via tetrahydromethanopterin-linked C1 transfer pathways, acetate utilization, carbon fixation via the Calvin-Benson-Bassham cycle, and glycogen production. Notably, the key enzymes for formaldehyde assimilation via the serine and ribulose monophosphate pathways are missing. The presence of genes encoding nitrate reductase and hemoglobin suggests adaptation to low O2 under water-logged conditions. Since USCα has versatile carbon metabolisms, it may not be an obligate methanotroph. Stackhouse, B. T. et al. J. Geophys. Res. Biogeosciences 120, 1764-1784 (2015). Lau, M. C. Y. et al. ISME J. 9, 1880-1891 (2015).

  13. Investigation of the Influence of Leaf Thickness on Canopy Reflectance and Physiological Traits in Upland and Pima Cotton Populations

    PubMed Central

    Pauli, Duke; White, Jeffrey W.; Andrade-Sanchez, Pedro; Conley, Matthew M.; Heun, John; Thorp, Kelly R.; French, Andrew N.; Hunsaker, Douglas J.; Carmo-Silva, Elizabete; Wang, Guangyao; Gore, Michael A.

    2017-01-01

    Many systems for field-based, high-throughput phenotyping (FB-HTP) quantify and characterize the reflected radiation from the crop canopy to derive phenotypes, as well as infer plant function and health status. However, given the technology's nascent status, it remains unknown how biophysical and physiological properties of the plant canopy impact downstream interpretation and application of canopy reflectance data. In that light, we assessed relationships between leaf thickness and several canopy-associated traits, including normalized difference vegetation index (NDVI), which was collected via active reflectance sensors carried on a mobile FB-HTP system, carbon isotope discrimination (CID), and chlorophyll content. To investigate the relationships among traits, two distinct cotton populations, an upland (Gossypium hirsutum L.) recombinant inbred line (RIL) population of 95 lines and a Pima (G. barbadense L.) population composed of 25 diverse cultivars, were evaluated under contrasting irrigation regimes, water-limited (WL) and well-watered (WW) conditions, across 3 years. We detected four quantitative trait loci (QTL) and significant variation in both populations for leaf thickness among genotypes as well as high estimates of broad-sense heritability (on average, above 0.7 for both populations), indicating a strong genetic basis for leaf thickness. Strong phenotypic correlations (maximum r = −0.73) were observed between leaf thickness and NDVI in the Pima population, but not the RIL population. Additionally, estimated genotypic correlations within the RIL population for leaf thickness with CID, chlorophyll content, and nitrogen discrimination (r^gij = −0.32, 0.48, and 0.40, respectively) were all significant under WW but not WL conditions. Economically important fiber quality traits did not exhibit significant phenotypic or genotypic correlations with canopy traits. Overall, our results support considering variation in leaf thickness as a potential contributing factor to variation in NDVI or other canopy traits measured via proximal sensing, and as a trait that impacts fundamental physiological responses of plants. PMID:28868055

  14. Development of a 63K SNP array for Gossypium and high-density mapping of intra- and inter-specific populations of cotton (G. hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    High-throughput genotyping arrays provide a standardized resource for crop research communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), candidate marker and quantitative trait loci (QTL) ide...

  15. Comparative Genomics of an Unusual Biogeographic Disjunction in the Cotton Tribe (Gossypieae) Yields Insights into Genome Downsizing

    PubMed Central

    Arick, Mark A; Conover, Justin L; Thrash, Adam; Sanders, William S; Hsu, Chuan-Yu; Naqvi, Rubab Zahra; Farooq, Muhammad; Li, Xiaochong; Gong, Lei; Mudge, Joann; Ramaraj, Thiruvarangan; Udall, Joshua A; Peterson, Daniel G

    2017-01-01

    Abstract Long-distance insular dispersal is associated with divergence and speciation because of founder effects and strong genetic drift. The cotton tribe (Gossypieae) has experienced multiple transoceanic dispersals, generating an aggregate geographic range that encompasses much of the tropics and subtropics worldwide. Two genera in the Gossypieae, Kokia and Gossypioides, exhibit a remarkable geographic disjunction, being restricted to the Hawaiian Islands and Madagascar/East Africa, respectively. We assembled and use de novo genome sequences to address questions regarding the divergence of these two genera from each other and from their sister-group, Gossypium. In addition, we explore processes underlying the genome downsizing that characterizes Kokia and Gossypioides relative to other genera in the tribe. Using 13,000 gene orthologs and synonymous substitution rates, we show that the two disjuncts last shared a common ancestor ∼5 Ma, or half as long ago as their divergence from Gossypium. We report relative stasis in the transposable element fraction. In comparison to Gossypium, there is loss of ∼30% of the gene content in the two disjunct genera and a history of genome-wide accumulation of deletions. In both genera, there is a genome-wide bias toward deletions over insertions, and the number of gene losses exceeds the number of gains by ∼2- to 4-fold. The genomic analyses presented here elucidate genomic consequences of the demographic and biogeographic history of these closest relatives of Gossypium, and enhance their value as phylogenetic outgroups. PMID:29194487

  16. Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis).

    PubMed

    Li, Ruijuan; Rashotte, Aaron M; Singh, Narendra K; Lawrence, Kathy S; Weaver, David B; Locy, Robert D

    2015-01-01

    Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.). An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747), resistant (BARBREN-713), and hypersensitive (LONREN-1) genotypes of cotton (Gossypium hirsutum L.) with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

  17. Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

    PubMed

    Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

    2012-11-01

    Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

  18. Entire nucleotide sequences of Gossypium raimondii and G. arboreum mitochondrial genomes revealed A-genome species as cytoplasmic donor of the allotetraploid species.

    PubMed

    Chen, Z; Nie, H; Grover, C E; Wang, Y; Li, P; Wang, M; Pei, H; Zhao, Y; Li, S; Wendel, J F; Hua, J

    2017-05-01

    Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and an allotetraploid genomic group, AD. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) are the putative contributors to the progenitor of G. hirsutum (AD 1 ), the economically important fibre-producing cotton species. Mitochondrial DNA from week-old etiolated seedlings was extracted from isolated organelles using discontinuous sucrose density gradient method. Mitochondrial genomes were sequenced, assembled, annotated and analysed in orderly. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) mitochondrial genomes were provided in this study. The mitochondrial genomes of two diploid species harboured circular genome of 643,914 bp (D 5 ) and 687,482 bp (A 2 ), respectively. They differ in size and number of repeat sequences, both contain illuminating triplicate sequences with 7317 and 10,246 bp, respectively, demonstrating dynamic difference and rearranged genome organisations. Comparing the D 5 and A 2 mitogenomes with mitogenomes of tetraploid Gossypium species (AD 1 , G. hirsutum; AD 2 , G. barbadense), a shared 11 kbp fragment loss was detected in allotetraploid species, three regions shared by G. arboreum (A 2 ), G. hirsutum (AD 1 ) and G. barbadense (AD 2 ), while eight regions were specific to G. raimondii (D 5 ). The presence/absence variations and gene-based phylogeny supported that A-genome is a cytoplasmic donor to the progenitor of allotetraploid species G. hirsutum and G. barbadense. The results present structure variations and phylogeny of Gossypium mitochondrial genome evolution. © 2017 The Authors. Plant Biology published by John Wiley & Sons Ltd on behalf of German Botanical Society, Royal Dutch Botanical Society.

  19. GrTEdb: the first web-based database of transposable elements in cotton (Gossypium raimondii).

    PubMed

    Xu, Zhenzhen; Liu, Jing; Ni, Wanchao; Peng, Zhen; Guo, Yue; Ye, Wuwei; Huang, Fang; Zhang, Xianggui; Xu, Peng; Guo, Qi; Shen, Xinlian; Du, Jianchang

    2017-01-01

    Although several diploid and tetroploid Gossypium species genomes have been sequenced, the well annotated web-based transposable elements (TEs) database is lacking. To better understand the roles of TEs in structural, functional and evolutionary dynamics of the cotton genome, a comprehensive, specific, and user-friendly web-based database, Gossypium raimondii transposable elements database (GrTEdb), was constructed. A total of 14 332 TEs were structurally annotated and clearly categorized in G. raimondii genome, and these elements have been classified into seven distinct superfamilies based on the order of protein-coding domains, structures and/or sequence similarity, including 2929 Copia-like elements, 10 368 Gypsy-like elements, 299 L1 , 12 Mutators , 435 PIF-Harbingers , 275 CACTAs and 14 Helitrons . Meanwhile, the web-based sequence browsing, searching, downloading and blast tool were implemented to help users easily and effectively to annotate the TEs or TE fragments in genomic sequences from G. raimondii and other closely related Gossypium species. GrTEdb provides resources and information related with TEs in G. raimondii , and will facilitate gene and genome analyses within or across Gossypium species, evaluating the impact of TEs on their host genomes, and investigating the potential interaction between TEs and protein-coding genes in Gossypium species. http://www.grtedb.org/. © The Author(s) 2017. Published by Oxford University Press.

  20. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    PubMed

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton cultivars.

Top