Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells
Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy
2018-01-01
Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391
Proline oxidase promotes tumor cell survival in hypoxic tumor microenvironments
Liu, Wei; Glunde, Kristine; Bhujwalla, Zaver M.; Raman, Venu; Sharma, Anit; Phang, James M.
2012-01-01
Proline is a readily released stress substrate that can be metabolized by proline oxidase (POX) to generate either reactive oxygen species to induce apoptosis or autophagy or ATP during times of nutrient stress. However, the contribution of proline metabolism to tumorigenesis in hypoxic microenvironments has not been explored. In this study, we investigated the different functions of POX under hypoxia and glucose depletion. We found that hypoxia induced POX expression in cancer cells in vitro and that POX upregulation co-localized with hypoxic tissues in vivo. In addition, the combination of hypoxia and low-glucose showed additive effects on POX expression. Similar to conditions of low glucose, hypoxia-mediated POX induction was dependent on AMP-activated protein kinase (AMPK) activation, but was independent of HIF-1α and HIF-2α. Under low-glucose and combined low-glucose and hypoxic conditions, proline catabolized by POX was used preferentially for ATP production, whereas under hypoxia, POX mediated autophagic signaling for survival by generating ROS. Although the specific mechanism was different for hypoxia and glucose deprivation, POX consistently contributed to tumor cell survival under these conditions. Together, our findings offer new insights into the metabolic reprogramming of tumor cells present within a hostile microenvironment and suggest that proline metabolism is a potential target for cancer therapeutics. PMID:22609800
Wang, Yansheng; Luo, Zisheng; Mao, Linchun; Ying, Tiejin
2016-04-15
Effect of exogenous nitric oxide (NO) on polyamines (PAs) catabolism, γ-aminobutyric acid (GABA) shunt, proline accumulation and chilling injury of banana fruit under cold storage was investigated. Banana fruit treated with NO sustained lower chilling injury index than the control. Notably elevated nitric oxide synthetase activity and endogenous NO level were observed in NO-treated banana fruit. PAs contents in treated fruit were significantly higher than control fruit, due to the elevated activities of arginine decarboxylase and ornithine decarboxylase. NO treatment increased the activities of diamine oxidase, polyamine oxidase and glutamate decarboxylase, while reduced GABA transaminase activity to lower levels compared with control fruit, which resulted the accumulation of GABA. Besides, NO treatment upregulated proline content and significantly enhanced the ornithine aminotransferase activity. These results indicated that the chilling tolerance induced by NO treatment might be ascribed to the enhanced catabolism of PAs, GABA and proline. Copyright © 2015 Elsevier Ltd. All rights reserved.
Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech
2018-01-01
Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p -coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis.
Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech
2018-01-01
Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p-coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis. PMID:29681859
Liu, Wei; Le, Anne; Hancock, Chad; Lane, Andrew N.; Dang, Chi V.; Fan, Teresa W.-M.; Phang, James M.
2012-01-01
In addition to glycolysis, the oncogenic transcription factor c-MYC (MYC) stimulates glutamine catabolism to fuel growth and proliferation of cancer cells through up-regulating glutaminase (GLS). Glutamine is converted to glutamate by GLS, entering the tricarboxylic acid cycle as an important energy source. Less well-recognized, glutamate can also be converted to proline through Δ1-pyrroline-5-carboxylate (P5C) and vice versa. This study suggests that some MYC-induced cellular effects are due to MYC regulation of proline metabolism. Proline oxidase, also known as proline dehydrogenase (POX/PRODH), the first enzyme in proline catabolism, is a mitochondrial tumor suppressor that inhibits proliferation and induces apoptosis. MiR-23b* mediates POX/PRODH down-regulation in human kidney tumors. MiR-23b* is processed from the same transcript as miR-23b; the latter inhibits the translation of GLS. Using MYC-inducible human Burkitt lymphoma model P493 and PC3 human prostate cancer cells, we showed that MYC suppressed POX/PRODH expression primarily through up-regulating miR-23b*. The growth inhibition in the absence of MYC was partially reversed by POX/PRODH knockdown, indicating the importance of suppression of POX/PRODH in MYC-mediated cellular effects. Interestingly, MYC not only inhibited POX/PRODH, but also markedly increased the enzymes of proline biosynthesis from glutamine, including P5C synthase and P5C reductase 1. MYC-induced proline biosynthesis from glutamine was directly confirmed using 13C,15N-glutamine as a tracer. The metabolic link between glutamine and proline afforded by MYC emphasizes the complexity of tumor metabolism. Further studies of the relationship between glutamine and proline metabolism should provide a deeper understanding of tumor metabolism while enabling the development of novel therapeutic strategies. PMID:22615405
Kaur, Rimaljeet; Gupta, Anil K; Taggar, Gaurav K
2015-05-01
Oxidative responses in leaves, developing seeds and the pod wall of nine pigeonpea genotypes were investigated against Helicoverpa armigera feeding. Out of nine genotypes, four were moderately resistant, three were intermediate and two were moderately susceptible genotypes. A significant shift in the oxidative status of pigeonpea following herbivory was depicted by the upregulation of diamine oxidase (DAO), polyamine oxidase (PAO) and lipoxygenase 2 (LOX 2) activities. Polyphenol oxidase (PPO) activity was significantly higher in the infested pod wall and leaves of moderately resistant genotypes than in those of moderately susceptible genotypes. H. armigera infestation markedly enhanced phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) activities in wounded tissues. The decline in ascorbate peroxidase (APX) activity and ascorbate content was lower in moderately resistant genotypes than in moderately susceptible genotypes. A significant decrease in LOX 3 activity was also observed in the infested pod wall of moderately resistant and intermediate genotypes. A lower malondialdehyde (MDA) content and higher proline content of the infested pod wall and developing seeds was observed. Higher activities of PPO, PAL and proline content in leaves of uninfested moderately resistant genotypes could either be an unrelated observation or alternatively could help in identifying H. armigera-resistant genotypes. The increase in activities of PPO, DAO, PAO, PAL and TAL and higher proline and lower MDA content upon herbivory suggested their integrated contribution in providing resistance to pigeonpea against H. armigera. © 2014 Society of Chemical Industry.
PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA
Ling, Chung-Mei; Hedrick, L. R.
1964-01-01
Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the yeast enzymes. The presence of a dehydrogenase NAD+ enzyme for activity with P2C (α-keto-δ-amino-valeric acid) has not been previously reported. PMID:14188729
Proline Dehydrogenase Regulates Redox State and Respiratory Metabolism in Trypanosoma cruzi
Paes, Lisvane Silva; Suárez Mantilla, Brian; Zimbres, Flávia Menezes; Pral, Elisabeth Mieko Furusho; Diogo de Melo, Patrícia; Tahara, Erich B.; Kowaltowski, Alicia J.; Elias, Maria Carolina; Silber, Ariel Mariano
2013-01-01
Over the past three decades, L-proline has become recognized as an important metabolite for trypanosomatids. It is involved in a number of key processes, including energy metabolism, resistance to oxidative and nutritional stress and osmoregulation. In addition, this amino acid supports critical parasite life cycle processes by acting as an energy source, thus enabling host-cell invasion by the parasite and subsequent parasite differentiation. In this paper, we demonstrate that L-proline is oxidized to Δ1-pyrroline-5-carboxylate (P5C) by the enzyme proline dehydrogenase (TcPRODH, E.C. 1.5.99.8) localized in Trypanosoma cruzi mitochondria. When expressed in its active form in Escherichia coli, TcPRODH exhibits a Km of 16.58±1.69 µM and a Vmax of 66±2 nmol/min mg. Furthermore, we demonstrate that TcPRODH is a FAD-dependent dimeric state protein. TcPRODH mRNA and protein expression are strongly upregulated in the intracellular epimastigote, a stage which requires an external supply of proline. In addition, when Saccharomyces cerevisiae null mutants for this gene (PUT1) were complemented with the TcPRODH gene, diminished free intracellular proline levels and an enhanced sensitivity to oxidative stress in comparison to the null mutant were observed, supporting the hypothesis that free proline accumulation constitutes a defense against oxidative imbalance. Finally, we show that proline oxidation increases cytochrome c oxidase activity in mitochondrial vesicles. Overall, these results demonstrate that TcPRODH is involved in proline-dependant cytoprotection during periods of oxidative imbalance and also shed light on the participation of proline in energy metabolism, which drives critical processes of the T. cruzi life cycle. PMID:23894476
Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy
2017-01-01
The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.
Self-cloning baker's yeasts that accumulate proline enhance freeze tolerance in doughs.
Kaino, Tomohiro; Tateiwa, Tetsuya; Mizukami-Murata, Satomi; Shima, Jun; Takagi, Hiroshi
2008-09-01
We constructed self-cloning diploid baker's yeast strains by disrupting PUT1, encoding proline oxidase, and replacing the wild-type PRO1, encoding gamma-glutamyl kinase, with a pro1(D154N) or pro1(I150T) allele. The resultant strains accumulated intracellular proline and retained higher-level fermentation abilities in the frozen doughs than the wild-type strain. These results suggest that proline-accumulating baker's yeast is suitable for frozen-dough baking.
Proline Oxidase (POX) as A Target for Cancer Therapy.
Kononczuk, Joanna; Czyzewska, Urszula; Moczydlowska, Joanna; Surażyński, Arkadiusz; Palka, Jerzy; Miltyk, Wojciech
2015-01-01
Proline dehydrogenase/proline oxidase (PRODH/POX) is an enzyme catalyzing the first step of proline degradation, during which ROS and/or ATP is generated. POX is widely distributed in living organisms and is responsible for a number of regulatory processes such as redox homeostasis, osmotic adaptation, cell signaling and oxidative stress. Recent data provided evidence that POX plays an important role in carcinogenesis and tumor growth. POX may induce apoptosis in both intrinsic and extrinsic way. Due to ROS generation, POX may induce caspase-9 activity, which mediates mitochondrial apoptosis (intrinsic apoptosis pathway). POX can also stimulate TRAIL (tumor necrosis factorrelated apoptosis inducing ligand) and DR5 (death receptor 5) expression, resulting in cleavage of procaspase-8 and thus extrinsic apoptotic pathway. However, this tumor suppressor in certain environmental conditions may act as a prosurvival factor. Genotoxic, inflammatory and metabolic stress may switch POX from tumor growth inhibiting to tumor growth supporting factor. The potential mechanisms which may regulate switching of POX mode are discussed in this review.
Cappelletti, Pamela; Tallarita, Elena; Rabattoni, Valentina; Campomenosi, Paola; Sacchi, Silvia; Pollegioni, Loredano
2018-01-01
L-Proline is a multifunctional amino acid that plays an essential role in primary metabolism and physiological functions. Proline is oxidized to glutamate in the mitochondria and the FAD-containing enzyme proline oxidase (PO) catalyzes the first step in L-proline degradation pathway. Alterations in proline metabolism have been described in various human diseases, such as hyperprolinemia type I, velo-cardio-facial syndrome/Di George syndrome, schizophrenia and cancer. In particular, the mutation giving rise to the substitution Leu441Pro was identified in patients suffering of schizophrenia and hyperprolinemia type I. Here, we report on the expression of wild-type and L441P variants of human PO in a U87 glioblastoma human cell line in an attempt to assess their effect on glutamate metabolism. The subcellular localization of the flavoenzyme is not altered in the L441P variant, for which specific activity is halved compared to the wild-type PO. While this decrease in activity is significantly less than that previously proposed, an effect of the substitution on the enzyme stability is also apparent in our studies. At 24 hours of growth from transient transfection, the intracellular level of proline, glutamate, and glutamine is decreased in cells expressing the PO variants as compared to control U87 cells, reaching a similar figure at 72 h. On the other hand, the extracellular levels of the three selected amino acids show a similar time course for all clones. Furthermore, PO overexpression does not modify to a significant extent the expression of GLAST and GLT-1 glutamate transporters. Altogether, these results demonstrate that the proline pathway links cellular proline levels with those of glutamate and glutamine. On this side, PO might play a regulatory role in glutamatergic neurotransmission by affecting the cellular concentration of glutamate.
A POX on Renal Cancer Cells | Center for Cancer Research
Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis,
A POX on Renal Cancer Cells | Center for Cancer Research
Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis, suggesting a link between POX and cancer cell survival.
Ferrazzano, Lucia; Viola, Angelo; Lonati, Elena; Bulbarelli, Alessandra; Musumeci, Rosario; Cocuzza, Clementina; Lombardo, Marco; Tolomelli, Alessandra
2016-11-29
Among the different classes of antibiotics, oxazolidinone derivatives represent important drugs, since their unique mechanism of action overcomes commonly diffused multidrug-resistant bacteria. Anyway, the structural similarity of these molecules to monoamino oxidase (MAO) inhibitors, like toloxatone and blefoxatone, induces in many cases loss of selectivity as a major concern. A small library of compounds based on isoxazolidinone and dehydro-β-proline scaffold was designed with the aim to obtain antibacterial agents, evaluating at the same time the potential effects of structural features on MAO inhibitory behaviour. The structural modification introduced in the backbone, starting from Linezolid model, lead to a significant loss in antibiotic activity, while a promising inhibitory effect could be observed on monoamino oxidases. These interesting results are also in agreement with docking experiments suggesting a good binding pose of the synthesized compounds into the pocket of the oxidase enzymes, in particular of MAO-B. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Janecek, S.
1995-01-01
Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed. PMID:7549888
Janecek, S
1995-06-01
Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed.
Amooaghaie, Rayhaneh; Tabatabaie, Fatemeh
2017-07-01
The present study showed that osmopriming or pretreatment with low H 2 O 2 doses (2 mM) for 6 h alleviated salt-reduced seed germination. The NADPH oxidase activity was the main source, and superoxide dismutase (SOD) activity might be a secondary source of H 2 O 2 generation during osmopriming or H 2 O 2 pretreatment. Hematin pretreatment similar to osmopriming improved salt-reduced seed germination that was coincident with the enhancement of heme oxygenase (HO) activity. The semi-quantitative RT-PCR confirmed that osmopriming or H 2 O 2 pretreatment was able to upregulate heme oxygenase HO-1 transcription, while the application of N,N-dimethyl thiourea (DMTU as trap of endogenous H 2 O 2 ) and diphenyleneiodonium (DPI as inhibitor of NADPHox) not only blocked the upregulation of HO but also reversed the osmopriming-induced salt attenuation. The addition of CO-saturated aqueous rescued the inhibitory effect of DMTU and DPI on seed germination and α-amylase activity during osmopriming or H 2 O 2 pretreatment, but H 2 O 2 could not reverse the inhibitory effect of ZnPPIX (as HO inhibitor) or Hb (as CO scavenger) that indicates that the CO acts downstream of H 2 O 2 in priming-driven salt acclimation. The antioxidant enzymes and proline synthesis were upregulated in roots of seedlings grown from primed seeds, and these responses were reversed by adding DMTU, ZnPPIX, and Hb during osmopriming. These findings for the first time suggest that H 2 O 2 signaling and upregulation of heme oxygenase play a crucial role in priming-driven salt tolerance.
Takagi, Hiroshi; Taguchi, Junpei; Kaino, Tomohiro
2016-08-01
During fermentation processes, Saccharomyces cerevisiae cells are exposed to multiple stresses, including a high concentration of ethanol that represents toxicity through intracellular reactive oxygen species (ROS) generation. We previously reported that proline protected yeast cells from damage caused by various stresses, such as freezing and ethanol. As an anti-oxidant, proline is suggested to scavenge intracellular ROS. In this study, we examined the role of intracellular proline during ethanol treatment in S. cerevisiae strains that accumulate different concentrations of proline. When cultured in YPD medium, there was a significant accumulation of proline in the put1 mutant strain, which is deficient in proline oxidase, in the stationary phase. Expression of the mutant PRO1 gene, which encodes the γ-glutamyl kinase variant (Asp154Asn or Ile150Thr) with desensitization to feedback inhibition by proline in the put1 mutant strain, showed a prominent increase in proline content as compared with that of the wild-type strain. The oxidation level was clearly increased in wild-type cells after exposure to ethanol, indicating that the generation of ROS occurred. Interestingly, proline accumulation significantly reduces the ROS level and increases the survival rate of yeast cells in the stationary phase under ethanol stress conditions. However, there was not a clear correlation between proline content and survival rate in yeast cells. An appropriate level of intracellular proline in yeast might be important for its stress-protective effect. Hence, the engineering of proline metabolism could be promising for breeding stress-tolerant industrial yeast strains. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L
2013-02-01
The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.
NADPH oxidase mediates depressive behavior induced by chronic stress in mice.
Seo, Ji-Seon; Park, Jin-Young; Choi, Juli; Kim, Tae-Kyung; Shin, Joo-Hyun; Lee, Ja-Kyeong; Han, Pyung-Lim
2012-07-11
Stress is a potent risk factor for depression, yet the underlying mechanism is not clearly understood. In the present study, we explored the mechanism of development and maintenance of depression in a stress-induced animal model. Mice restrained for 2 h daily for 14 d showed distinct depressive behavior, and the altered behavior persisted for >3 months in the absence of intervention. Acute restraint induced a surge of oxidative stress in the brain, and stress-induced oxidative stress progressively increased with repetition of stress. In vitro, the stress hormone glucocorticoid generated superoxide via upregulation of NADPH oxidase. Consistently, repeated restraints increased the expression of the key subunits of NADPH oxidase, p47phox and p67phox, in the brain. Moreover, stressed brains markedly upregulated the expression of p47phox to weak restress evoked in the poststress period, and this molecular response was reminiscent of amplified ROS surge to restress. Pharmacological inhibition of NADPH oxidase by the NADPH oxidase inhibitor apocynin during the stress or poststress period completely blocked depressive behavior. Consistently, heterozygous p47phox knock-out mice (p47phox(+/-)) or molecular inhibition of p47phox with Lenti shRNA-p47phox in the hippocampus suppressed depressive behavior. These results suggest that repeated stress promotes depressive behavior through the upregulation of NADPH oxidase and the resultant metabolic oxidative stress, and that the inhibition of NADPH oxidase provides beneficial antidepression effects.
Cheng, Zhihui; Lin, Mingqun
2014-01-01
ABSTRACT How the obligatory intracellular bacterium Ehrlichia chaffeensis begins to replicate upon entry into human monocytes is poorly understood. Here, we examined the potential role of amino acids in initiating intracellular replication. PutA converts proline to glutamate, and GlnA converts glutamate to glutamine. E. chaffeensis PutA and GlnA complemented Escherichia coli putA and glnA mutants. Methionine sulfoximine, a glutamine synthetase inhibitor, inhibited E. chaffeensis GlnA activity and E. chaffeensis infection of human cells. Incubation of E. chaffeensis with human cells rapidly induced putA and glnA expression that peaked at 24 h postincubation. E. chaffeensis took up proline and glutamine but not glutamate. Pretreatment of E. chaffeensis with a proline transporter inhibitor (protamine), a glutamine transporter inhibitor (histidine), or proline analogs inhibited E. chaffeensis infection, whereas pretreatment with proline or glutamine enhanced infection and upregulated putA and glnA faster than no treatment or glutamate pretreatment. The temporal response of putA and glnA expression was similar to that of NtrY and NtrX, a two-component system, and electrophoretic mobility shift assays showed specific binding of recombinant E. chaffeensis NtrX (rNtrX) to the promoter regions of E. chaffeensis putA and glnA. Furthermore, rNtrX transactivated E. chaffeensis putA and glnA promoter-lacZ fusions in E. coli. Growth-promoting activities of proline and glutamine were also accompanied by rapid degradation of the DNA-binding protein CtrA. Our results suggest that proline and glutamine uptake regulates putA and glnA expression through NtrY/NtrX and facilitates degradation of CtrA to initiate a new cycle of E. chaffeensis growth. PMID:25425236
Zhou, C; Ma, Z Y; Zhu, L; Guo, J S; Zhu, J; Wang, J F
2015-12-17
The stress phytohormone abscisic acid (ABA) plays pivotal roles in plants' adaptive responses to adverse environments. Molybdenum cofactor sulfurases influence aldehyde oxidase activity and ABA biosynthesis. In this study, we isolated a novel EsMcsu1 gene encoding a molybdenum cofactor sulfurase from Eutrema salsugineum. EsMcus1 transcriptional patterns varied between organs, and its expression was significantly upregulated by abiotic stress or ABA treatment. Alfalfa plants that overexpressed EsMcsu1 had a higher ABA content than wild-type (WT) plants under drought stress conditions. Furthermore, levels of reactive oxygen species (ROS), ion leakage, and malondialdehyde were lower in the transgenic plants than in the WT plants after drought treatment, suggesting that the transgenic plants experienced less ROS-mediated damage. However, the expression of several stress-responsive genes, antioxidant enzyme activity, and osmolyte (proline and total soluble sugar) levels in the transgenic plants were higher than those in the WT plants after drought treatment. Therefore, EsMcsu1 overexpression improved drought tolerance in alfalfa plants by activating a series of ABA-mediated stress responses.
Oxidation of Proline by Mitochondria Isolated from Water-Stressed Maize Shoots 1
Sells, Gary D.; Koeppe, David E.
1981-01-01
Proline oxidation and coupled phosphorylation were measured in mitochondria after isolation from shoots of water-stressed, etiolated maize (Zea mays L.) seedlings. Both state III and state IV rates of proline oxidation decreased as a logarithmic function of increased seedling water stress between −5 and −10 bars. Proline oxidation rates decreased 62% (state III) and 58% (state IV) as seedling water potentials were decreased from −5 to −10 bars. By comparison, oxidation of succinate, exogenous NADH, or malate + pyruvate decreased only 10 to 15% in this stress range. These decreases were a linear function of increased stress and were comparable to oxidation rates of mitochondria subjected to varying in vitro osmotic potentials. Osmotically induced in vitro stress reduced proline oxidation rates linearly with more negative osmotic potentials, a decrease that was similar to the responses of the other substrates to more negative osmotic potentials. Some decrease in coupling, with all substrates as determined by ADP/O ratios, was observed under osmotic stress. Mitochondria were also isolated from shoot tissue that had been stressed and then rewatered. On a percentage basis, the recovery of proline oxidation was greater than that of the other substrates. The decreases in the proline oxidase activity of mitochondria after only slight stress indicate a mitochondrial sensitivity to water stress at significantly less negative water potentials than previously reported for measurements of maize membrane permeability and respiratory activity. PMID:16662051
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
USDA-ARS?s Scientific Manuscript database
In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...
Inhibition of the NADPH oxidase regulates HO-1 expression in chronic myeloid leukemia
Singh, Melissa M.; Irwin, Mary E.; Gao, Yin; Ban, Kechen; Shi, Ping; Arlinghaus, Ralph B.; Amin, Hesham M.; Chandra, Joya
2011-01-01
Background Patients with blast crisis phase chronic myelogeneous leukemia (CML) have poor response to tyrosine kinase inhibitors designed to inhibit the BCR-ABL1 oncogene. Recent work has shown that heme oxygenase 1 (HO-1) expression is increased in BCR-ABL1 expressing cells and that inhibition of HO-1 in CML leads to reduced cellular growth suggesting HO-1 may be a plausible target for therapy. Here we sought to clarify the mechanism of HO-1 overexpression and the role of the NADPH oxidase as a contributor to this mechanism in CML. Methods HO-1 expression was evaluated in CML bone marrow specimens from patients in various stages of disease, in a transplant based model for CML and in CML cell lines. Chemical and genetic inhibition of the NADPH oxidase was carried out in CML cells. Results Blast crisis CML patient specimens displayed higher levels of HO-1 staining than chronic or accelerated phase. HO-1 upregulation in BCR-ABL1 expressing cells was suppressed by diphenyliodonium (DPI), a chemical inhibitor of the NADPH oxidase. Targeting the NADPH oxidase through RNAi to Rac1, a dominant negative Rac1 construct or an inhibitor of Rac1 activity also blunted HO-1 protein expression. Moreover, inhibition of the NADPH oxidase by RNAi directed towards p47phox similarly abrogated HO-1 levels. Conclusion BCR-ABL1 expression upregulates HO-1, a survival factor for CML cells. This upregulation is more pronounced in blast crisis CML relative to early stage disease and is mediated by the NADPH oxidase components Rac1 and p47phox. Expression of p47phox is increased in BCR-ABL1 expressing cells. PMID:22139798
A Novel Role of Proline Oxidase in HIV-1 Envelope Glycoprotein-induced Neuronal Autophagy*
Pandhare, Jui; Dash, Sabyasachi; Jones, Bobby; Villalta, Fernando; Dash, Chandravanu
2015-01-01
Proline oxidase (POX) catalytically converts proline to pyrroline-5-carboxylate. This catabolic conversion generates reactive oxygen species (ROS) that triggers cellular signaling cascades including autophagy and apoptosis. This study for the first time demonstrates a role of POX in HIV-1 envelope glycoprotein (gp120)-induced neuronal autophagy. HIV-1 gp120 is a neurotoxic factor and is involved in HIV-1-associated neurological disorders. However, the mechanism of gp120-mediated neurotoxicity remains unclear. Using SH-SY5Y neuroblastoma cells as a model, this study demonstrates that gp120 treatment induced POX expression and catalytic activity. Concurrently, gp120 also increased intracellular ROS levels. However, increased ROS had a minimal effect on neuronal apoptosis. Further investigation indicated that the immediate cellular response to increased ROS paralleled with induction of autophagy markers, beclin-1 and LC3-II. These data lead to the hypothesis that neuronal autophagy is activated as a cellular protective response to the toxic effects of gp120. A direct and functional role of POX in gp120-mediated neuronal autophagy was examined by inhibition and overexpression studies. Inhibition of POX activity by a competitive inhibitor “dehydroproline” decreased ROS levels concomitant with reduced neuronal autophagy. Conversely, overexpression of POX in neuronal cells increased ROS levels and activated ROS-dependent autophagy. Mechanistic studies suggest that gp120 induces POX by targeting p53. Luciferase reporter assays confirm that p53 drives POX transcription. Furthermore, data demonstrate that gp120 induces p53 via binding to the CXCR4 co-receptor. Collectively, these results demonstrate a novel role of POX as a stress response metabolic regulator in HIV-1 gp120-associated neuronal autophagy. PMID:26330555
Tang, Ling; Zeng, Jun; Geng, Pengyu; Fang, Chengnan; Wang, Yang; Sun, Mingju; Wang, Changsong; Wang, Jiao; Yin, Peiyuan; Hu, Chunxiu; Guo, Lei; Yu, Jane; Gao, Peng; Li, Enyou; Zhuang, Zhengping; Xu, Guowang; Liu, Yang
2018-01-15
Purpose: Metabolic reprogramming is frequently identified in hepatocellular carcinoma (HCC), which is the most common type of liver malignancy. The reprogrammed cellular metabolisms promote tumor cell survival, proliferation, angiogenesis, and metastasis. However, the mechanisms of this process remain unclear in HCC. Experimental Design: The global nontargeted metabolic study in 69 paired hepatic carcinomas and adjacent tissue specimens was performed using capillary electrophoresis-time of flight mass spectrometry-based approach. Key findings were validated by targeted metabolomic approach. Biological studies were also performed to investigate the role of proline biosynthesis in HCC pathogenesis. Results: Proline metabolism was markedly changed in HCC tumor tissue, characterized with accelerated consumption of proline and accumulation of hydroxyproline, which significantly correlated with α-fetoprotein levels and poor prognosis in HCC. In addition, we found that hydroxyproline promoted hypoxia- and HIF-dependent phenotype in HCC. Moreover, we demonstrated that hypoxia activated proline biosynthesis via upregulation of ALDH18A1 , subsequently leading to accumulation of hydroxyproline via attenuated PRODH2 activity. More importantly, we showed that glutamine, proline, and hydroxyproline metabolic axis supported HCC cell survival through modulating HIF1α stability in response to hypoxia. Finally, inhibition of proline biosynthesis significantly enhanced cytotoxicity of sorafenib in vitro and in vivo Conclusions: Our results demonstrate that hypoxic microenvironment activates proline metabolism, resulting in accumulation of hydroxyproline that promotes HCC tumor progression and sorafenib resistance through modulating HIF1α. These findings provide the proof of concept for targeting proline metabolism as a potential therapeutic strategy for HCC. Clin Cancer Res; 24(2); 474-85. ©2017 AACR . ©2017 American Association for Cancer Research.
Clelland, James D; Read, Laura L; Drouet, Valérie; Kaon, Angela; Kelly, Alexandra; Duff, Karen E; Nadrich, Robert H; Rajparia, Amit; Clelland, Catherine L
2014-06-01
25-Hydroxyvitamin D (25(OH)D) deficits have been associated with schizophrenia susceptibility and supplementation has been recommended for those at-risk. Although the mechanism by which a deficit confers risk is unknown, vitamin D is a potent transcriptional modulator and can regulate proline dehydrogenase (PRODH) expression. PRODH maps to chromosome 22q11, a region conferring the highest known genetic risk of schizophrenia, and encodes proline oxidase, which catalyzes proline catabolism. l-Proline is a neuromodulator at glutamatergic synapses, and peripheral hyperprolinemia has been associated with decreased IQ, cognitive impairment, schizoaffective disorder, and schizophrenia. We investigated the relationship between 25(OH)D and schizophrenia, comparing fasting plasma 25(OH)D in 64 patients and 90 matched controls. We then tested for a mediating effect of hyperprolinemia on the association between 25(OH)D and schizophrenia. 25(OH)D levels were significantly lower in patients, and 25(OH)D insufficiency associated with schizophrenia (OR 2.1, adjusted p=0.044, 95% CI: 1.02-4.46). Moreover, 25(OH)D insufficient subjects had three times greater odds of hyperprolinemia than those with optimal levels (p=0.035, 95% CI: 1.08-8.91), and formal testing established that hyperprolinemia is a significantly mediating phenotype that may explain over a third of the effect of 25(OH)D insufficiency on schizophrenia risk. This study presents a mechanism by which 25(OH)D insufficiency confers risk of schizophrenia; via proline elevation due to reduced PRODH expression, and a concomitant dysregulation of neurotransmission. Although definitive causality cannot be confirmed, these findings strongly support vitamin D supplementation in patients, particularly for those with elevated proline, who may represent a large subgroup of the schizophrenia population. Copyright © 2014 Elsevier B.V. All rights reserved.
Singh, Ruchi; Pandey, Neha; Naskar, Jishnu; Shirke, Pramod A
2015-03-01
Cotton is mostly cultivated under rain-fed conditions in India, thus faces frequent drought conditions during its life cycle. Drought being a major stress factor responsible for yield penalty, there has always been a high priority to generate knowledge on adaptation and tolerance of cotton. In the present study, four cotton varieties, JKC-770 and KC-2 (Gossypium hirsutum), and JKC-717 and RAHS-187(Gossypium herbaceum), were imposed to drought. Under drought condition, differential changes in physiological characters like net photosynthesis, transpiration, stomatal conductance, chlorophyll fluorescence, relative water content (RWC), and predawn water potential (ψ 0) showed a change. While proline, malondialdehyde (MDA), and glutathione-S-transferase (GST) content increased along with a concomitant change in the expression of their associated genes. Under moderate stress, tolerant varieties maintain lower ψ 0 probably due to higher proline content as compared to sensitive varieties. Cyclic electron flow (CEF) also plays an important role in tolerance under mild water stress in G. hirsutum varieties. CEF not only activates at high light but also initiates at a very low light intensity. Expression analysis of genes reveals that drought-tolerant varieties showed enhanced detoxifying mechanism by up-regulation of asparagine synthase (AS), glutathione-S-transferase (GST), and methyl glyoxalase (GlyI) genes under drought stress. Up-regulation of Δ(1)-pyrroline-5-carboxylase synthase (Δ(1)P5CS) enhanced accumulation of proline, an osmolyte, under drought in tolerant varieties. While the drought-sensitive varieties showed up-regulation of ethylene responsive factor (ERF) and down-regulation of WRKY70 responsible for senescence of the leaf which correlated well with the high rate of leaf fall in sensitive varieties under water stress.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Chaoyun; He, Yanhao; Department of Pharmacology, Xi'an Jiaotong University School of Medicine, Key Laboratory of Environment and Genes Related to Disease, Ministry of Education, Xi'an, Shaanxi 710061
Intracellular reactive oxygen species (ROS) are derived from nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Angiotensin II (Ang II) can cause endothelial dysfunction by promoting intracellular ROS generation. Safflor yellow B (SYB) effectively inhibits ROS generation by upregulating Bcl-2 expression. In this study, we examined the effects of SYB on Ang II-induced injury to human umbilical vein endothelial cells (HUVECs), and elucidated the roles of NADPH oxidase and Bcl-2. We treated cultured HUVECs with Ang II, SYB, and Bcl-2 siRNA, and determined NADPH oxidase activity and ROS levels. Furthermore, cellular and mitochondrial physiological states were evaluated, and the expression levels ofmore » target proteins were analyzed. Ang II significantly enhanced intracellular ROS levels, caused mitochondrial membrane dysfunction, and decreased cell viability, leading to apoptosis. This was associated with increased expression of AT1R and p22{sup phox}, increased NADPH oxidase activity, and an increased ratio of Bax/Bcl-2, leading to decreases in antioxidant enzyme activities, which were further strengthened after blocking Bcl-2. Compared to Ang II treatment alone, co-treatment with SYB significantly reversed HUVEC injury. Taken together, these results demonstrate that SYB could significantly protect endothelial cells from Ang II-induced cell damage, and that it does so by upregulating Bcl-2 expression and inhibiting ROS generation. - Highlights: • Angiotensin II depresses mitochondria physiological function. • Angiotensin II activates NADPH oxidase via up-regulating expresion of p22{sup phox}. • Bcl-2 plays a pivotal role in improving mitochondria function and regulates ROS level. • Inhibitor of Bcl-2 promotes angiotensin II mediated HUVEC injury. • SYB attenuates angiotensin II mediated HUVEC injury via up regulating Bcl-2 expression.« less
Faccio, Greta; Kruus, Kristiina; Buchert, Johanna; Saloheimo, Markku
2010-08-20
Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.
Zarzuelo, María José; López-Sepúlveda, Rocío; Sánchez, Manuel; Romero, Miguel; Gómez-Guzmán, Manuel; Ungvary, Zoltan; Pérez-Vizcaíno, Francisco; Jiménez, Rosario; Duarte, Juan
2013-05-01
Vascular aging is characterized by up-regulation of NADPH oxidase, oxidative stress and endothelial dysfunction. Previous studies demonstrate that the activity of the evolutionarily conserved NAD(+)-dependent deacetylase SIRT1 declines with age and that pharmacological activators of SIRT1 confer significant anti-aging cardiovascular effects. To determine whether dysregulation of SIRT1 promotes NADPH oxidase-dependent production of reactive oxygen species (ROS) and impairs endothelial function we assessed the effects of three structurally different inhibitors of SIRT1 (nicotinamide, sirtinol, EX527) in aorta segments isolated from young Wistar rats. Inhibition of SIRT1 induced endothelial dysfunction, as shown by the significantly reduced relaxation to the endothelium-dependent vasodilators acetylcholine and the calcium ionophore A23187. Endothelial dysfunction induced by SIRT1 inhibition was prevented by treatment of the vessels with the NADPH oxidase inhibitor apocynin or superoxide dismutase. Inhibition of SIRT1 significantly increased vascular superoxide production, enhanced NADPH oxidase activity, and mRNA expression of its subunits p22(phox) and NOX4, which were prevented by resveratrol. Peroxisome proliferator-activated receptor-α (PPARα) activation mimicked the effects of resveratrol while PPARα inhibition prevented the effects of this SIRT1 activator. SIRT1 co-precipitated with PPARα and nicotinamide increased the acetylation of the PPARα coactivator PGC-1α, which was suppressed by resveratrol. In conclusion, impaired activity of SIRT1 induces endothelial dysfunction and up-regulates NADPH oxidase-derived ROS production in the vascular wall, mimicking the vascular aging phenotype. Moreover, a new mechanism for controlling endothelial function after SIRT1 activation involves a decreased PGC-1α acetylation and the subsequent PPARα activation, resulting in both decreased NADPH oxidase-driven ROS production and NO inactivation. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Nakamura, Ryuhei; Kamiya, Kazuhide; Hashimoto, Kazuhito
2010-10-01
Herein, the electron-transfer reactions occurring at the interface between bilirubin oxidase (BOD) and nanocrystalline hematite (α-Fe 2O 3) were characterized. Cyclic voltammograms indicated that BOD has an affinity for hematite surfaces and establishes a direct electron-transfer (DET) conduit between the primary electron acceptor T1 site and the conduction band of α-Fe 2O 3. DET was also confirmed photo-electrochemically, as cathodic photocurrents were generated when a nanocomposite of BOD and α-Fe 2O 3 was illuminated under oxygenated conditions. A proline residue displayed a high-binding affinity for hematite surfaces and is therefore likely part of an orientation-controlled motif which serves to locate BOD at the T1 site at a suitable distance for DET to α-Fe 2O 3.
Konior, Anna; Klemenska, Emilia; Brudek, Magdalena; Podolecka, Ewa; Czarnowska, Elżbieta; Beręsewicz, Andrzej
2011-04-01
Seasonality in endothelial dysfunction and oxidative stress was noted in humans and rats, suggesting it is a common phenomenon of a potential clinical relevance. We aimed at studying (i) seasonal variations in cardiac superoxide (O(2)(-)) production in rodents and in 8-isoprostane urinary excretion in humans, (ii) the mechanism of cardiac O(2)(-) overproduction occurring in late spring/summer months in rodents, (iii) whether this seasonal O(2)(-)-overproduction is associated with a pro-inflammatory endothelial activation, and (iv) how the summer-associated changes compare to those caused by diabetes, a classical cardiovascular risk factor. Langendorff-perfused guinea-pig and rat hearts generated ~100% more O(2)(-), and human subjects excreted 65% more 8-isoprostane in the summer vs. other seasons. Inhibitors of NADPH oxidase, xanthine oxidase, and NO synthase inhibited the seasonal O(2)(-)-overproduction. In the summer vs. other seasons, cardiac NADPH oxidase and xanthine oxidase activity, and protein expression were increased, the endothelial NO synthase and superoxide dismutases were downregulated, and, in guinea-pig hearts, adhesion molecules upregulation and the endothelial glycocalyx destruction associated these changes. In guinea-pig hearts, the summer and a streptozotocin-induced diabetes mediated similar changes, yet, more severe endothelial activation associated the diabetes. These findings suggest that the seasonal oxidative stress is a common phenomenon, associated, at least in guinea-pigs, with the endothelial activation. Nonetheless, its biological meaning (regulatory vs. deleterious) remains unclear. Upregulated NADPH oxidase and xanthine oxidase and uncoupled NO synthase are the sources of the seasonal O(2)(-)-overproduction. Copyright © 2010 Elsevier Ltd. All rights reserved.
Nadeem, Ahmed; Ahmad, Sheikh F; Al-Harbi, Naif O; El-Sherbeeny, Ahmed M; Al-Harbi, Mohammed M; Almukhlafi, Talal S
2017-05-01
The gut is densely inhabited by commensal bacteria, which metabolize dietary fibers/undigested carbohydrates and produce short-chain fatty acids such as acetate. GPR43 is one of the receptors to sense short-chain fatty acids, and expressed in various immune and non-immune cells. Acetate/GPR43 signaling has been shown to affect various inflammatory diseases through Th17 responses and NADPH oxidase (NOX)-derived reactive oxygen species (ROS) generation. However, no study has previously explored the effects of GPR43 activation during psoriasis-like inflammation. Therefore, this study investigated the effect of acetate/phenylacetamide (GPR43 agonists) on imiquimod induced skin inflammation in mice. Mice were administered phenylacetamide/acetate followed by assessment of skin inflammation, NOXs (NOX-2, NOX-4, dual oxidases), and Th17 related signaling. Our study showed induction of epidermal GPR43 after imiquimod treatment, i.e. psoriasis-like inflammation. Acetate administration in psoriatic mice led to further increase in skin inflammation (ear thickness/myeloperoxidase activity) with concurrent increase in Th17 immune responses and epidermal dual oxidase-2 signaling. Further, topical application of GPR43 agonist, phenylacetamide led to enhanced ear thickness with concomitant epidermal IL-6 signaling as well as dual oxidase-2 upregulation which may be responsible for increased psoriasis-like inflammation. Taken together, dual oxidase-2 and IL-6 play important roles in GPR43-mediated skin inflammation. The current study suggests that GPR43 activation in psoriatic patients may lead to aggravation of psoriatic inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.
Musicki, Biljana; Burnett, Arthur L.
2016-01-01
Erectile dysfunction (ED) associated with type 2 diabetes mellitus (T2DM) involves dysfunctional nitric oxide (NO) signaling and increased oxidative stress in the penis. However, the mechanisms of endothelial NO synthase (eNOS) and neuronal NO synthase (nNOS) dysregulation, and the sources of oxidative stress, are not well defined, particularly at the human level. The objective of this study was to define whether uncoupled eNOS and nNOS, and NADPH oxidase upregulation, contribute to the pathogenesis of ED in T2DM men. Penile erectile tissue was obtained from 9 T2DM patients with ED who underwent penile prosthesis surgery for ED, and from 6 control patients without T2DM or ED who underwent penectomy for penile cancer. The dimer-to-monomer protein expression ratio, an indicator of uncoupling for both eNOS and nNOS, total protein expressions of eNOS and nNOS, as well as protein expressions of NADPH oxidase catalytic subunit gp91phox (an enzymatic source of oxidative stress) and 4-hydroxy-2-nonenal [4-HNE] and nitrotyrosine (markers of oxidative stress) were measured by Western blot in this tissue. In the erectile tissue of T2DM men, eNOS and nNOS uncoupling and protein expressions of NADPH oxidase subunit gp91phox, 4-HNE- and nitrotyrosine-modified proteins were significantly (p<0.05) increased compared to control values. Total eNOS and nNOS protein expressions were not significantly different between the groups. In conclusion, mechanisms of T2DM-associated ED in the human penis may involve uncoupled eNOS and nNOS and NADPH oxidase upregulation. Our description of molecular factors contributing to the pathogenesis of T2DM-associated ED at the human level is relevant for advancing clinically therapeutic approaches to restore erectile function in T2DM patients. PMID:28076881
TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4
DOE Office of Scientific and Technical Information (OSTI.GOV)
St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.
2008-10-24
Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitromore » and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.« less
In vivo low-level light therapy increases cytochrome oxidase in skeletal muscle.
Hayworth, Christopher R; Rojas, Julio C; Padilla, Eimeira; Holmes, Genevieve M; Sheridan, Eva C; Gonzalez-Lima, F
2010-01-01
Low-level light therapy (LLLT) increases survival of cultured cells, improves behavioral recovery from neurodegeneration and speeds wound healing. These beneficial effects are thought to be mediated by upregulation of mitochondrial proteins, especially the respiratory enzyme cytochrome oxidase. However, the effects of in vivo LLLT on cytochrome oxidase in intact skeletal muscle have not been previously investigated. We used a sensitive method for enzyme histochemistry of cytochrome oxidase to examine the rat temporalis muscle 24 h after in vivo LLLT. The findings showed for the first time that in vivo LLLT induced a dose- and fiber type-dependent increase in cytochrome oxidase in muscle fibers. LLLT was particularly effective at enhancing the aerobic capacity of intermediate and red fibers. The findings suggest that LLLT may enhance the oxidative energy metabolic capacity of different types of muscle fibers, and that LLLT may be used to enhance the aerobic potential of skeletal muscle.
Dattaroy, Diptadip; Pourhoseini, Sahar; Das, Suvarthi; Alhasson, Firas; Seth, Ratanesh Kumar; Nagarkatti, Mitzi; Michelotti, Gregory A; Diehl, Anna Mae; Chatterjee, Saurabh
2015-02-15
Hepatic fibrosis in nonalcoholic steatohepatitis (NASH) is the common pathophysiological process resulting from chronic liver inflammation and oxidative stress. Although significant research has been carried out on the role of leptin-induced NADPH oxidase in fibrogenesis, the molecular mechanisms that connect the leptin-NADPH oxidase axis in upregulation of transforming growth factor (TGF)-β signaling have been unclear. We aimed to investigate the role of leptin-mediated upregulation of NADPH oxidase and its subsequent induction of micro-RNA 21 (miR21) in fibrogenesis. Human NASH livers and a high-fat (60% kcal) diet-fed chronic mouse model, where hepatotoxin bromodichloromethane was used to induce NASH, were used for this study. To prove the role of the leptin-NADPH oxidase-miR21 axis, mice deficient in genes for leptin, p47phox, and miR21 were used. Results showed that wild-type mice and human livers with NASH had increased oxidative stress, increased p47phox expression, augmented NF-κB activation, and increased miR21 levels. These mice and human livers showed increased TGF-β, SMAD2/3-SMAD4 colocalizations in the nucleus, increased immunoreactivity against Col1α, and α-SMA with a concomitant decrease in protein levels of SMAD7. Mice that were deficient in leptin or p47phox had decreased activated NF-κB and miR21 levels, suggesting the role of leptin and NADPH oxidase in inducing NF-κB-mediated miR21 expression. Further miR21 knockout mice had decreased colocalization events of SMAD2/3-SMAD4 in the nucleus, increased SMAD7 levels, and decreased fibrogenesis. Taken together, the studies show the novel role of leptin-NADPH oxidase induction of miR21 as a key regulator of TGF-β signaling and fibrogenesis in experimental and human NASH. Copyright © 2015 the American Physiological Society.
Feng, Chencheng; He, Jinyue; Zhang, Yang; Lan, Minghong; Yang, Minghui; Liu, Huan; Huang, Bo; Pan, Yong; Zhou, Yue
2017-07-01
N-acetylated proline-glycine-proline (N-Ac-PGP) is a chemokine involved in inflammatory diseases and is found to accumulate in degenerative discs. N-Ac-PGP has been demonstrated to have a pro-inflammatory effect on human cartilage endplate stem cells. However, the effect of N-Ac-PGP on human intervertebral disc cells, especially nucleus pulposus (NP) cells, remains unknown. The purpose of this study was to investigate the effect of N-Ac-PGP on the expression of pro-inflammatory factors and extracellular matrix (ECM) proteases in NP cells and the molecular mechanism underlying this effect. Therefore, Milliplex assays were used to detect the levels of various inflammatory cytokines in conditioned culture medium of NP cells treated with N-Ac-PGP, including interleukin-1β (IL-1β), IL-6, IL-17, tumor necrosis factor-α (TNF-α) and C-C motif ligand 2 (CCL2). RT-qPCR was also used to determine the expression of pro-inflammatory cytokines and ECM proteases in the NP cells treated with N-Ac-PGP. Moreover, the role of nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways in mediating the effect of N-Ac-PGP on the phenotype of NP cells was investigated using specific signaling inhibitors. Milliplex assays showed that NP cells treated with N-Ac-PGP (10 and 100 µg/ml) secreted higher levels of IL-1β, IL-6, IL-17, TNF-α and CCL2 compared with the control. RT-qPCR assays showed that NP cells treated with N-Ac-PGP (100 µg/ml) had markedly upregulated expression of matrix metalloproteinase 3 (MMP3), MMP13, a disintegrin and metalloproteinase with thrombospondin motif 4 (ADAMTS4), ADAMTS5, IL-6, CCL-2, CCL-5 and C-X-C motif chemokine ligand 10 (CXCL10). Moreover, N-Ac-PGP was shown to activate the MAPK and NF-κB signaling pathways in NP cells. MAPK and NF-κB signaling inhibitors suppressed the upregulation of proteases and pro-inflammatory cytokines in NP cells treated with N-Ac-PGP. In conclusion, N-Ac-PGP induces the expression of pro-inflammatory cytokines and matrix catabolic enzymes in NP cells via the NF-κB and MAPK signaling pathways. N-Ac-PGP is a novel therapeutic target for intervertebral disc degeneration.
2012-01-01
Background During the bread-making process, industrial baker's yeast, mostly Saccharomyces cerevisiae, is exposed to baking-associated stresses, such as air-drying and freeze-thaw stress. These baking-associated stresses exert severe injury to yeast cells, mainly due to the generation of reactive oxygen species (ROS), leading to cell death and reduced fermentation ability. Thus, there is a great need for a baker's yeast strain with higher tolerance to baking-associated stresses. Recently, we revealed a novel antioxidative mechanism in a laboratory yeast strain that is involved in stress-induced nitric oxide (NO) synthesis from proline via proline oxidase Put1 and N-acetyltransferase Mpr1. We also found that expression of the proline-feedback inhibition-less sensitive mutant γ-glutamyl kinase (Pro1-I150T) and the thermostable mutant Mpr1-F65L resulted in an enhanced fermentation ability of baker's yeast in bread dough after freeze-thaw stress and air-drying stress, respectively. However, baker's yeast strains with high fermentation ability under multiple baking-associated stresses have not yet been developed. Results We constructed a self-cloned diploid baker's yeast strain with enhanced proline and NO synthesis by expressing Pro1-I150T and Mpr1-F65L in the presence of functional Put1. The engineered strain increased the intracellular NO level in response to air-drying stress, and the strain was tolerant not only to oxidative stress but also to both air-drying and freeze-thaw stresses probably due to the reduced intracellular ROS level. We also showed that the resultant strain retained higher leavening activity in bread dough after air-drying and freeze-thaw stress than that of the wild-type strain. On the other hand, enhanced stress tolerance and fermentation ability did not occur in the put1-deficient strain. This result suggests that NO is synthesized in baker's yeast from proline in response to oxidative stresses that induce ROS generation and that increased NO plays an important role in baking-associated stress tolerance. Conclusions In this work, we clarified the importance of Put1- and Mpr1-mediated NO generation from proline to the baking-associated stress tolerance in industrial baker's yeast. We also demonstrated that baker's yeast that enhances the proline and NO synthetic pathway by expressing the Pro1-I150T and Mpr1-F65L variants showed improved fermentation ability under multiple baking-associated stress conditions. From a biotechnological perspective, the enhancement of proline and NO synthesis could be promising for breeding novel baker's yeast strains. PMID:22462683
Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi
2012-04-01
During the bread-making process, industrial baker's yeast, mostly Saccharomyces cerevisiae, is exposed to baking-associated stresses, such as air-drying and freeze-thaw stress. These baking-associated stresses exert severe injury to yeast cells, mainly due to the generation of reactive oxygen species (ROS), leading to cell death and reduced fermentation ability. Thus, there is a great need for a baker's yeast strain with higher tolerance to baking-associated stresses. Recently, we revealed a novel antioxidative mechanism in a laboratory yeast strain that is involved in stress-induced nitric oxide (NO) synthesis from proline via proline oxidase Put1 and N-acetyltransferase Mpr1. We also found that expression of the proline-feedback inhibition-less sensitive mutant γ-glutamyl kinase (Pro1-I150T) and the thermostable mutant Mpr1-F65L resulted in an enhanced fermentation ability of baker's yeast in bread dough after freeze-thaw stress and air-drying stress, respectively. However, baker's yeast strains with high fermentation ability under multiple baking-associated stresses have not yet been developed. We constructed a self-cloned diploid baker's yeast strain with enhanced proline and NO synthesis by expressing Pro1-I150T and Mpr1-F65L in the presence of functional Put1. The engineered strain increased the intracellular NO level in response to air-drying stress, and the strain was tolerant not only to oxidative stress but also to both air-drying and freeze-thaw stresses probably due to the reduced intracellular ROS level. We also showed that the resultant strain retained higher leavening activity in bread dough after air-drying and freeze-thaw stress than that of the wild-type strain. On the other hand, enhanced stress tolerance and fermentation ability did not occur in the put1-deficient strain. This result suggests that NO is synthesized in baker's yeast from proline in response to oxidative stresses that induce ROS generation and that increased NO plays an important role in baking-associated stress tolerance. In this work, we clarified the importance of Put1- and Mpr1-mediated NO generation from proline to the baking-associated stress tolerance in industrial baker's yeast. We also demonstrated that baker's yeast that enhances the proline and NO synthetic pathway by expressing the Pro1-I150T and Mpr1-F65L variants showed improved fermentation ability under multiple baking-associated stress conditions. From a biotechnological perspective, the enhancement of proline and NO synthesis could be promising for breeding novel baker's yeast strains.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys
Peck, Ammon B.; Khan, Saeed R.
2013-01-01
A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917
Huang, Xian-Ju; Wang, Xu; Ihsan, Awais; Liu, Qin; Xue, Xi-Juan; Su, Shi-Jia; Yang, Chun-Hui; Zhou, Wen; Yuan, Zong-Hui
2010-10-05
High doses of mequindox (MEQ) are associated with oxidative stress and pathological toxicity in the kidney. In this study, we demonstrated long term effects of MEQ on intra- or extra-adrenal renin-angiotensin-aldosterone system (RAAS) in vivo. RAAS plays a major role in aldosterone secretion. High doses of MEQ in the diet for 180 days in male rats led to inhibition of intra- and extra-adrenal RAAS, concident with down-regulation of Na(+)/K(+)-ATPase (NAKA) and mineralocorticoid receptor (MR), the downstream of aldosterone action. Significant changes of malondialdehyde (MDA), reduced glutathione (GSH), and superoxide dismutase (SOD) in kidney were also observed in the high doses (110, 275mg/kg) groups. The mRNA levels of most subunits of NADPH oxidase were significantly upregulated at low doses (25-110mg/kg) but the upregulation was diminished at higher doses in both kidney and adrenal gland, indicating a complicated and contradictory effect of MEQ on NADPH. These results highlight the complex interactions of drug metabolism, RAAS, NADPH oxidase and oxidative stress in response to MEQ-induced tissue toxicity and aldosterone secretion. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Hoffmann, Tamara; Wensing, Annette; Brosius, Margot; Steil, Leif; Völker, Uwe
2013-01-01
Glycine betaine is an effective osmoprotectant for Bacillus subtilis. Its import into osmotically stressed cells led to the buildup of large pools, whose size was sensitively determined by the degree of the osmotic stress imposed. The amassing of glycine betaine caused repression of the formation of an osmostress-adaptive pool of proline, the only osmoprotectant that B. subtilis can synthesize de novo. The ABC transporter OpuA is the main glycine betaine uptake system of B. subtilis. Expression of opuA was upregulated in response to both sudden and sustained increases in the external osmolarity. Nonionic osmolytes exerted a stronger inducing effect on transcription than ionic osmolytes, and this was reflected in the development of corresponding OpuA-mediated glycine betaine pools. Primer extension analysis and site-directed mutagenesis pinpointed the osmotically controlled opuA promoter. Deviations from the consensus sequence of SigA-type promoters serve to keep the transcriptional activity of the opuA promoter low in the absence of osmotic stress. opuA expression was downregulated in a finely tuned manner in response to increases in the intracellular glycine betaine pool, regardless of whether this osmoprotectant was imported or was newly synthesized from choline. Such an effect was also exerted by carnitine, an effective osmoprotectant for B. subtilis that is not a substrate for the OpuA transporter. opuA expression was upregulated in a B. subtilis mutant that was unable to synthesize proline in response to osmotic stress. Collectively, our data suggest that the intracellular solute pool is a key determinant for the osmotic control of opuA expression. PMID:23175650
Biochemical response of hybrid black poplar tissue culture (Populus × canadensis) on water stress.
Popović, B M; Štajner, D; Ždero-Pavlović, R; Tari, I; Csiszár, J; Gallé, Á; Poór, P; Galović, V; Trudić, B; Orlović, S
2017-05-01
In this study, poplar tissue culture (hybrid black poplar, M1 genotype) was subjected to water stress influenced by polyethyleneglycol 6000 (100 and 200 mOsm PEG 6000). The aim of the research was to investigate the biochemical response of poplar tissue culture on water deficit regime. Antioxidant status was analyzed including antioxidant enzymes, superoxide-dismutase (SOD), catalase (CAT), guiacol-peroxidase (GPx), glutathione-peroxidase (GSH-Px), glutathione-reductase, reduced glutathione, total phenol content, Ferric reducing antioxidant power and DPPH radical antioxidant power. Polyphenol oxidase and phenylalanine-ammonium-lyase were determined as enzymatic markers of polyphenol metabolism. Among oxidative stress parameters lipid peroxidation, carbonyl-proteins, hydrogen-peroxide, reactive oxygen species, nitric-oxide and peroxynitrite were determined. Proline, proline-dehydrogenase and glycinebetaine were measured also as parameters of water stress. Cell viability is finally determined as a biological indicator of osmotic stress. It was found that water stress induced reactive oxygen and nitrogen species and lipid peroxidation in leaves of hybrid black poplar and reduced cell viability. Antioxidant enzymes including SOD, GPx, CAT and GSH-Px were induced but total phenol content and antioxidant capacity were reduced by PEG 6000 mediated osmotic stress. The highest biochemical response and adaptive reaction was the increase of proline and GB especially by 200 mOsm PEG. While long term molecular analysis will be necessary to fully address the poplar potentials for water stress adaptation, our results on hybrid black poplar suggest that glycine-betaine, proline and PDH enzyme might be the most important markers of poplar on water stress and that future efforts should be focused on these markers and strategies to enhance their concentration in poplar.
Li, Yajun; Zhang, Jiachang; Zhang, Juan; Hao, Ling; Hua, Jinping; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu
2013-08-01
LOS5/ABA3 gene encoding molybdenum cofactor sulphurase is involved in aldehyde oxidase (AO) activity in Arabidopsis, which indirectly regulates ABA biosynthesis and increased stress tolerance. Here, we used a constitutive super promoter to drive LOS5/ABA3 overexpression in soybean (Glycine max L.) to enhance drought tolerance in growth chamber and field conditions. Expression of LOS5/ABA3 was up-regulated by drought stress, which led to increasing AO activity and then a notable increase in ABA accumulation. Transgenic soybean under drought stress had reduced water loss by decreased stomatal aperture size and transpiration rate, which alleviated leaf wilting and maintained higher relative water content. Exposed to drought stress, transgenic soybean exhibited reduced cell membrane damage by reducing electrolyte leakage and production of malondialdehyde and promoting proline accumulation and antioxidant enzyme activities. Also, overexpression of LOS5/ABA3 enhanced expression of stress-up-regulated genes. Furthermore, the seed yield of transgenic plants is at least 21% higher than that of wide-type plants under drought stress conditions in the field. These data suggest that overexpression of LOS5/ABA3 could improve drought tolerance in transgenic soybean via enhanced ABA accumulation, which could activate expression of stress-up-regulated genes and cause a series of physiological and biochemical resistant responses. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Rincón, J; Correia, D; Arcaya, J L; Finol, E; Fernández, A; Pérez, M; Yaguas, K; Talavera, E; Chávez, M; Summer, R; Romero, F
2015-03-01
Activation of the renin-angiotensin system (RAS), renal oxidative stress and inflammation are constantly present in experimental hypertension. Nitric oxide (NO) inhibition with N(w)-nitro-L-arginine methyl ester (L-NAME) has previously been reported to produce hypertension, increased expression of Angiotensin II (Ang II) and renal dysfunction. The use of Losartan, an Ang II type 1 receptor (AT1R) antagonist has proven to be effective reducing hypertension and renal damage; however, the mechanism by which AT1R blockade reduced kidney injury and normalizes blood pressure in this experimental model is still complete unknown. The current study was designed to test the hypothesis that AT1R activation promotes renal NAD(P)H oxidase up-regulation, oxidative stress and cytokine production during L-NAME induced-hypertension. Male Sprague-Dawley rats were distributed in three groups: L-NAME, receiving 70 mg/100ml of L-NAME, L-NAME+Los, receiving 70 mg/100ml of L-NAME and 40 mg/kg/day of Losartan; and Controls, receiving water instead of L-NAME or L-NAME and Losartan. After two weeks, L-NAME induced high blood pressure, renal overexpression of AT1R, NAD(P)H oxidase sub-units gp91, p22 and p47, increased levels of oxidative stress, interleukin-6 (IL-6) and interleukin-17 (IL-17). Also, we found increased renal accumulation of lymphocytes and macrophages. Losartan treatment abolished the renal expression of gp91, p22, p47, oxidative stress and reduced NF-κB activation and IL-6 expression. These findings indicate that NO induced-hypertension is associated with up-regulation of NADPH oxidase, oxidative stress production and overexpression of key inflammatory mediators. These events are associated with up-regulation of AT1R, as evidenced by their reversal with AT1R blocker treatment. Copyright © 2015 Elsevier Inc. All rights reserved.
Rac1 Is Required for Cardiomyocyte Apoptosis During Hyperglycemia
Shen, E.; Li, Yanwen; Li, Ying; Shan, Limei; Zhu, Huaqing; Feng, Qingping; Arnold, J. Malcolm O.; Peng, Tianqing
2009-01-01
OBJECTIVE Hyperglycemia induces reactive oxygen species (ROS) and apoptosis in cardiomyocytes, which contributes to diabetic cardiomyopathy. The present study was to investigate the role of Rac1 in ROS production and cardiomyocyte apoptosis during hyperglycemia. RESEARCH DESIGN AND METHODS Mice with cardiomyocyte-specific Rac1 knockout (Rac1-ko) were generated. Hyperglycemia was induced in Rac1-ko mice and their wild-type littermates by injection of streptozotocin (STZ). In cultured adult rat cardiomyocytes, apoptosis was induced by high glucose. RESULTS The results showed a mouse model of STZ-induced diabetes, 7 days of hyperglycemia-upregulated Rac1 and NADPH oxidase activation, elevated ROS production, and induced apoptosis in the heart. These effects of hyperglycemia were significantly decreased in Rac1-ko mice or wild-type mice treated with apocynin. Interestingly, deficiency of Rac1 or apocynin treatment significantly reduced hyperglycemia-induced mitochondrial ROS production in the heart. Deficiency of Rac1 also attenuated myocardial dysfunction after 2 months of STZ injection. In cultured cardiomyocytes, high glucose upregulated Rac1 and NADPH oxidase activity and induced apoptotic cell death, which were blocked by overexpression of a dominant negative mutant of Rac1, knockdown of gp91phox or p47phox, or NADPH oxidase inhibitor. In type 2 diabetic db/db mice, administration of Rac1 inhibitor, NSC23766, significantly inhibited NADPH oxidase activity and apoptosis and slightly improved myocardial function. CONCLUSIONS Rac1 is pivotal in hyperglycemia-induced apoptosis in cardiomyocytes. The role of Rac1 is mediated through NADPH oxidase activation and associated with mitochondrial ROS generation. Our study suggests that Rac1 may serve as a potential therapeutic target for cardiac complications of diabetes. PMID:19592621
Nie, Huibin; Xue, Xia; Liu, Gang; Guan, Guangju; Liu, Haiying; Sun, Lina; Zhao, Long; Wang, Xueling; Chen, Zhixin
2016-01-01
Nitroalkene derivative of oleic acid (OA-NO 2 ), due to its ability to mediate revisable Michael addition, has been demonstrated to have various biological properties and become a therapeutic agent in various diseases. Though its antioxidant properties have been reported in different models of acute kidney injury (AKI), the mechanism by which OA-NO 2 attenuates intracellular oxidative stress is not well investigated. Here, we elucidated the anti-oxidative mechanism of OA-NO 2 in an in vitro model of renal ischemia/reperfusion (I/R) injury. Human tubular epithelial cells were subjected to oxygen and glucose deprivation/re-oxygenation (OGD/R) injury. Pretreatment with OA-NO 2 (1.25 μM, 45 min) attenuated OGD/R triggered reactive oxygen species (ROS) generation and subsequent mitochondrial membrane potential disruption. This action was mediated via up-regulating endogenous antioxidant defense components including superoxide dismutase (SOD1), heme oxygenase 1 (HO-1), and γ-glutamyl cysteine ligase modulatory subunits (GCLM). Moreover, subcellular fractionation analyses demonstrated that OA-NO 2 promoted nuclear translocation of nuclear factor-E2- related factor-2 (Nrf2) and Nrf2 siRNA partially abrogated these protective effects. In addition, OA-NO 2 inhibited NADPH oxidase activation and NADPH oxidase 4 (NOX4), NADPH oxidase 2 (NOX2) and p22 phox up-regulation after OGD/R injury, which was not relevant to Nrf2. These results contribute to clarify that the mechanism of OA-NO 2 reno-protection involves both inhibition of NADPH oxidase activity and induction of SOD1, Nrf2-dependent HO-1, and GCLM.
Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying
2013-09-01
Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.
Smith, Susan M E; Min, Jaeki; Ganesh, Thota; Diebold, Becky; Kawahara, Tsukasa; Zhu, Yerun; McCoy, James; Sun, Aiming; Snyder, James P; Fu, Haian; Du, Yuhong; Lewis, Iestyn; Lambeth, J David
2012-06-22
NADPH oxidases (Nox) are a primary source of reactive oxygen species (ROS), which function in normal physiology and, when overproduced, in pathophysiology. Recent studies using mice deficient in Nox2 identify this isoform as a novel target against Nox2-implicated inflammatory diseases. Nox2 activation depends on the binding of the proline-rich domain of its heterodimeric partner p22phox to p47phox. A high-throughput screen that monitored this interaction via fluorescence polarization identified ebselen and several of its analogs as inhibitors. Medicinal chemistry was performed to explore structure-activity relationships and to optimize potency. Ebselen and analogs potently inhibited Nox1 and Nox2 activity but were less effective against other isoforms. Ebselen also blocked translocation of p47phox to neutrophil membranes. Thus, ebselen and its analogs represent a class of compounds that inhibit ROS generation by interrupting the assembly of Nox2-activating regulatory subunits. Copyright © 2012 Elsevier Ltd. All rights reserved.
Yang, Long; Xie, Peng; Wu, Jianjiang; Yu, Jin; Yu, Tian; Wang, Haiying; Wang, Jiang; Xia, Zhengyuan; Zheng, Hong
2016-01-01
Background: Sevoflurane postconditioning (SPostC) can exert myocardial protective effects similar to ischemic preconditioning. However, the exact myocardial protection mechanism by SPostC is unclear. Studies indicate that hypoxia-inducible factor-1 (HIF-1) maintains cellular respiration homeostasis by regulating mitochondrial respiratory chain enzyme activity under hypoxic conditions. This study investigated whether SPostC could regulate the expression of myocardial HIF-1α and to improve mitochondrial respiratory function, thereby relieving myocardial ischemia-reperfusion injury in rats. Methods: The myocardial ischemia-reperfusion rat model was established using the Langendorff isolated heart perfusion apparatus. Additionally, postconditioning was performed using sevoflurane alone or in combination with the HIF-1α inhibitor 2-methoxyestradiol (2ME2). The changes in hemodynamic parameters, HIF-1α protein expression levels, mitochondrial respiratory function and enzyme activity, mitochondrial reactive oxygen species (ROS) production rates, and mitochondrial ultrastructure were measured or observed. Results: Compared to the ischemia-reperfusion (I/R) group, HIF-1α expression in the SPostC group was significantly up-regulated. Additionally, cardiac function indicators, mitochondrial state 3 respiratory rate, respiratory control ratio (RCR), cytochrome C oxidase (CcO), NADH oxidase (NADHO), and succinate oxidase (SUCO) activities, mitochondrial ROS production rate, and mitochondrial ultrastructure were significantly better than those in the I/R group. However, these advantages were completely reversed by the HIF-1α specific inhibitor 2ME2 (P<0.05). Conclusion: The myocardial protective function of SPostC might be associated with the improvement of mitochondrial respiratory function after up-regulation of HIF-1α expression. PMID:27830025
Yang, Long; Xie, Peng; Wu, Jianjiang; Yu, Jin; Yu, Tian; Wang, Haiying; Wang, Jiang; Xia, Zhengyuan; Zheng, Hong
2016-01-01
Sevoflurane postconditioning (SPostC) can exert myocardial protective effects similar to ischemic preconditioning. However, the exact myocardial protection mechanism by SPostC is unclear. Studies indicate that hypoxia-inducible factor-1 (HIF-1) maintains cellular respiration homeostasis by regulating mitochondrial respiratory chain enzyme activity under hypoxic conditions. This study investigated whether SPostC could regulate the expression of myocardial HIF-1α and to improve mitochondrial respiratory function, thereby relieving myocardial ischemia-reperfusion injury in rats. The myocardial ischemia-reperfusion rat model was established using the Langendorff isolated heart perfusion apparatus. Additionally, postconditioning was performed using sevoflurane alone or in combination with the HIF-1α inhibitor 2-methoxyestradiol (2ME2). The changes in hemodynamic parameters, HIF-1α protein expression levels, mitochondrial respiratory function and enzyme activity, mitochondrial reactive oxygen species (ROS) production rates, and mitochondrial ultrastructure were measured or observed. Compared to the ischemia-reperfusion (I/R) group, HIF-1α expression in the SPostC group was significantly up-regulated. Additionally, cardiac function indicators, mitochondrial state 3 respiratory rate, respiratory control ratio (RCR), cytochrome C oxidase (C c O), NADH oxidase (NADHO), and succinate oxidase (SUCO) activities, mitochondrial ROS production rate, and mitochondrial ultrastructure were significantly better than those in the I/R group. However, these advantages were completely reversed by the HIF-1α specific inhibitor 2ME2 ( P <0.05). The myocardial protective function of SPostC might be associated with the improvement of mitochondrial respiratory function after up-regulation of HIF-1α expression.
Huang, Tengfang; Jander, Georg
2017-10-01
Whereas proline accumulates through de novo biosynthesis in plants subjected to osmotic stress, leucine, isoleucine, and valine accumulation in drought-stressed Arabidopsis thaliana is caused by abscisic acid-regulated protein degradation. In response to several kinds of abiotic stress, plants greatly increase their accumulation of free amino acids. Although stress-induced proline increases have been studied the most extensively, the fold-increase of other amino acids, in particular branched-chain amino acids (BCAAs; leucine, isoleucine, and valine), is often higher than that of proline. In Arabidopsis thaliana (Arabidopsis), BCAAs accumulate in response to drought, salt, mannitol, polyethylene glycol, herbicide treatment, and nitrogen starvation. Plants that are deficient in abscisic acid signaling accumulate lower amounts of BCAAs, but not proline and most other amino acids. Previous bioinformatic studies had suggested that amino acid synthesis, rather than protein degradation, is responsible for the observed BCAA increase in osmotically stressed Arabidopsis. However, whereas treatment with the protease inhibitor MG132 decreased drought-induced BCAA accumulation, inhibition of BCAA biosynthesis with the acetolactate synthase inhibitors chlorsulfuron and imazapyr did not. Additionally, overexpression of BRANCHED-CHAIN AMINO ACID TRANSFERASE2 (BCAT2), which is upregulated in response to osmotic stress and functions in BCAA degradation, decreased drought-induced BCAA accumulation. Together, these results demonstrate that BCAA accumulation in osmotically stressed Arabidopsis is primarily the result of protein degradation. After relief of the osmotic stress, BCAA homeostasis is restored over time by amino acid degradation involving BCAT2. Thus, drought-induced BCAA accumulation is different from that of proline, which is accumulated due to de novo synthesis in an abscisic acid-independent manner and remains elevated for a more prolonged period of time after removal of the osmotic stress.
Polyunsaturated fatty acids balance affects platelet NOX2 activity in patients with liver cirrhosis.
Basili, Stefania; Raparelli, Valeria; Napoleone, Laura; Del Ben, Maria; Merli, Manuela; Riggio, Oliviero; Nocella, Cristina; Carnevale, Roberto; Pignatelli, Pasquale; Violi, Francesco
2014-07-01
NADPH-oxidase-2 up-regulation has been suggested in liver damage perpetuation via an oxidative stress-mediated mechanism. n-6/n-3 polyunsaturated fatty acids ratio derangement has been reported in liver disease. To explore polyunsaturated fatty acids balance and its interplay with platelet oxidative stress in liver cirrhosis. A cross-sectional study in 51 cirrhotic patients and sex- and age-matched controls was performed. Serum polyunsaturated fatty acids and oxidative stress markers (urinary isoprostanes and serum soluble NADPH-oxidase-2-derived peptide) were measured. The effect on platelet oxidative stress of n-6/n-3 polyunsaturated fatty acids ratio in vitro and in vivo (1-week supplementation with 3g/daily n-3-polyunsaturated fatty acids) was tested. Compared to controls, cirrhotic patients had significantly higher n-6/n-3 polyunsaturated fatty acids ratio. n-6/n-3 polyunsaturated fatty acids ratio correlated significantly with disease severity and oxidative stress markers. In vitro experiments showed that in Child-Pugh C patients' platelets incubation with low n-6/n-3 polyunsaturated fatty acids ratio resulted in dose-dependent decrease of radical oxigen species (-39%), isoprostanes (-25%) and NADPH-oxidase-2 regulation (-51%). n-3 polyunsaturated fatty acids supplemented patients showed significant oxidative stress indexes reduction. In cirrhosis, n-6/n-3 polyunsaturated fatty acids imbalance up-regulates platelet NADPH-oxidase-2 with ensuing oxidative stress. Further study to evaluate if n-3 supplementation may reduce disease progression is warranted. Copyright © 2014 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
Delayed inflammatory mRNA and protein expression after spinal cord injury
2011-01-01
Background Spinal cord injury (SCI) induces secondary tissue damage that is associated with inflammation. We have previously demonstrated that inflammation-related gene expression after SCI occurs in two waves - an initial cluster that is acutely and transiently up-regulated within 24 hours, and a more delayed cluster that peaks between 72 hours and 7 days. Here we extend the microarray analysis of these gene clusters up to 6 months post-SCI. Methods Adult male rats were subjected to mild, moderate or severe spinal cord contusion injury at T9 using a well-characterized weight-drop model. Tissue from the lesion epicenter was obtained 4 hours, 24 hours, 7 days, 28 days, 3 months or 6 months post-injury and processed for microarray analysis and protein expression. Results Anchor gene analysis using C1qB revealed a cluster of genes that showed elevated expression through 6 months post-injury, including galectin-3, p22PHOX, gp91PHOX, CD53 and progranulin. The expression of these genes occurred primarily in microglia/macrophage cells and was confirmed at the protein level using both immunohistochemistry and western blotting. As p22PHOX and gp91PHOX are components of the NADPH oxidase enzyme, enzymatic activity and its role in SCI were assessed and NADPH oxidase activity was found to be significantly up-regulated through 6 months post-injury. Further, treating rats with the nonspecific, irreversible NADPH oxidase inhibitor diphenylene iodinium (DPI) reduced both lesion volume and expression of chronic gene cluster proteins one month after trauma. Conclusions These data demonstrate that inflammation-related genes are chronically up-regulated after SCI and may contribute to further tissue loss. PMID:21975064
He, Yuehui; Gan, Susheng
2004-01-01
Seed dormancy is an important developmental process that prevents pre-harvest sprouting in many grains and other seeds. Abscisic acid (ABA), a plant hormone, plays a crucial role in regulating dormancy but the underlying molecular regulatory mechanisms are not fully understood. An Arabidopsis zinc-finger gene, MEDIATOR OF ABA-REGULATED DORMANCY 1 ( MARD1 ) was identified and functionally analyzed. MARD1 expression is up-regulated by ABA. A T-DNA insertion in the promoter region downstream of two ABA-responsive elements (ABREs) renders MARD1 unable to respond to ABA. The mard1 seeds are less dormant and germinate in total darkness; their germination is resistant to external ABA at the stage of radicle protrusion. These results suggest that this novel zinc-finger protein with a proline-rich N-terminus is an important downstream component of the ABA signaling pathway that mediates ABA-regulated seed dormancy in Arabidopsis.
Metabolic Effects of Avocado/Soy Unsaponifiables on Articular Chondrocytes
Nardo, Joseph V.; Harlan, Robert; Chiou, Tiffany
2008-01-01
Avocado/soy unsaponifiable (ASU) components are reported to have a chondroprotective effect by virtue of anti-inflammatory and proanabolic effects on articular chondrocytes. The identity of the active component(s) remains unknown. In general, sterols, the major component of unsaponifiable plant material have been demonstrated to be anti-inflammatory in vitro and in animal models. These studies were designed to clarify whether the sterol content of ASU preparations were the primary contributors to biological activity in articular chondrocytes. ASU samples were analyzed by high pressure liquid chromatography (HPLC) and GC mass spectrometry. The sterol content was normalized between diverse samples prior to in vitro testing on bovine chondrocytes. Anabolic activity was monitored by uptake of 35-sulfate into proteoglycans and quantitation of labeled hydroxyproline and proline content after incubation with labeled proline. Anti-inflammatory activity was assayed by measuring reduction of interleukin-1 (IL-1)-induced synthesis of PGE2 and metalloproteases and release of label from tissue prelabeled with S-35.All ASU samples exerted a similar time-dependent up-regulation of 35-sulfate uptake in bovine cells reaching a maximum of greater than 100% after 72 h at sterol doses of 1–10 μg/ml. Non-collagenous protein (NCP) and collagen synthesis were similarly up-regulated. All ASU were equally effective in dose dependently inhibiting IL-1-induced MMP-3 activity (23–37%), labeled sulfate release (15–23%) and PGE2 synthesis (45–58%). Up-regulation of glycosaminoglycan and collagen synthesis and reduction of IL-1 effects in cartilage are consistent with chondroprotective activity. The similarity of activity of ASU from diverse sources when tested at equal sterol levels suggests sterols are important for biologic effects in articular chondrocytes. PMID:18604259
Perspectives on the Role and Relevance of Copper in Cardiac Disease.
Medeiros, Denis M
2017-03-01
Cardiac hypertrophy as a result of dietary copper deficiency has been studied for 40 plus years and is the subject of this review. While connective tissue anomalies occur, a hallmark pathology is cardiac hypertrophy, increased mitochondrial biogenesis, with disruptive cristae, vacuolization of mitochondria, and deposition of lipid droplets. Electrocardiogram abnormalities have been demonstrated along with biochemical changes especially as it relates to the copper-containing enzyme cytochrome c oxidase. The master controller of mitochondrial biogenesis, PGC1-α expression and protein, along with other proteins and transcriptional factors that play a role are upregulated. Nitric oxide, vascular endothelial growth factor, and cytochrome c oxidase all may enhance the upregulation of mitochondrial biogenesis. Marginal copper intakes reveal similar pathologies in the absence of cardiac hypertrophy. Reversibility of the copper-deficient rat heart with a copper-replete diet has resulted in mixed results, depending on both the animal model used and temporal relationships. New information has revealed that copper supplementation may rescue cardiac hypertrophy induced by pressure overload.
Christou, Anastasis; Antoniou, Chrystalla; Christodoulou, Charalampia; Hapeshi, Evroula; Stavrou, Ioannis; Michael, Costas; Fatta-Kassinos, Despo; Fotopoulos, Vasileios
2016-07-01
Pharmaceutically active compounds (PhACs) have been recently shown to exert phytotoxic effects. The present study explores the uptake, systemic translocation, and abiotic stress responses and detoxification mechanisms induced by the exposure of alfalfa plants grown in sand under greenhouse conditions to four common, individually applied PhACs (10μgL(-1)) (diclofenac, sulfamethoxazole, trimethoprim, 17a-ethinylestradiol) and their mixture. Stress physiology markers (lipid peroxidation, proline, H2O2 and NO content, antioxidant activity assays) and gene expression levels of key plant detoxification components (including glutathione S-transferases, GST7, GST17; superoxide dismutases, CuZnSOD, FeSOD; proton pump, H(+)-ATP, and cytochrome c oxidase, CytcOx), were evaluated. PhACs were detected in significantly higher concentrations in roots compared with leaves. Stress related effects, manifested via membrane lipid peroxidation and oxidative burst, were local (roots) rather than systemic (leaves), and exacerbated when the tested PhACs were applied in mixture. Systemic accumulation of H2O2 in leaves suggests its involvement in signal transduction and detoxification responses. Increased antioxidant enzymatic activities, as well as upregulated transcript levels of GST7, GST17, H(+)-ATPase and CytcOx, propose their role in the detoxification of the selected PhACs in plants. The current findings provide novel biochemical and molecular evidence highlighting the studied PhACs as an emerging abiotic stress factor, and point the need for further research on wastewater flows under natural agricultural environments. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bolloskis, Michael P.; Carvalho, Fabiana P.; Loo, George, E-mail: g_loo@uncg.edu
Some of the health-promoting properties of cruciferous vegetables are thought to be partly attributed to isothiocyanates. These phytochemicals can upregulate the expression of certain cytoprotective stress genes, but it is unknown if a particular nutrient is involved. Herein, the objective was to ascertain if adequate iron is needed for enabling HCT116 cells to optimally express heme oxygenase-1 (HO-1) when induced by phenethyl isothiocyanate (PEITC). PEITC increased HO-1 expression and also nuclear translocation of Nrf2, which is a transcription factor known to activate the HO-1 gene. However, in HCT116 cells that were made iron-deficient by depleting intracellular iron with deferoxamine (DFO),more » PEITC was less able to increase HO-1 expression and nuclear translocation of Nrf2. These suppressive effects of DFO were overcome by replenishing the iron-deficient cells with the missing iron. To elucidate these findings, it was found that PEITC-induced HO-1 upregulation can be inhibited with thiol antioxidants (glutathione and N-acetylcysteine). Furthermore, NADPH oxidase inhibitors (diphenyleneiodonium and apocynin) and a superoxide scavenger (Tiron) each inhibited PEITC-induced HO-1 upregulation. In doing so, diphenyleneiodonium was the most potent and also inhibited nuclear translocation of redox-sensitive Nrf2. Collectively, the results imply that the HO-1 upregulation by PEITC involves an iron-dependent, oxidant signaling pathway. Therefore, it is concluded that ample iron is required to enable PEITC to fully upregulate HO-1 expression in HCT116 cells. As such, it is conceivable that iron-deficient individuals may not reap the full health benefits of eating PEITC-containing cruciferous vegetables that via HO-1 may help protect against multiple chronic diseases. - Highlights: • PEITC increased HO-1 expression in HCT116 cells. • PEITC-induced HO-1 upregulation was impaired in iron-depleted HCT116 cells. • Impairment of PEITC-induced HO-1 upregulation was reversible with iron restoration. • PEITC increased nuclear expression of Nrf2 but not in iron-depleted cells. • NADPH oxidase inhibitors inhibited PEITC-induced HO-1 upregulation.« less
Li, Meng-Jun; Qiao, Yu; Li, Ya-Qing; Shi, Zhan-Liang; Zhang, Nan; Bi, Cai-Li; Guo, Jin-Kao
2016-11-01
We isolated the TaMYBsm1 genes, encoding R2R3-type MYB proteins in common wheat, aimed to uncover the possible molecular mechanisms related to drought response. The TaMYBsm1 genes, TaMYBsm1-A, TaMYBsm1-B and TaMYBsm1-D, were isolated and analyzed from the common wheat cultivar Shimai 15. Their expression patterns under PEG 6000 and mannitol were monitored by semi-quantitative RT-PCR and β-glucuronidase (Gus) assay. The function of TaMYBsm1-D under drought stress in transgenic Arabidopsis plants was investigated, and the germination rate, water loss rate, as well as the proline and malondialdehyde (MDA) content were compared with that in wild type (WT) plants. The expression of three downstream genes (DREB2A, P5CS1 and RD29A) in TaMYBsm1-D transgenic plants was analyzed. The R2R3-MYB domains of the MYBsm1 proteins were highly conserved in plants. In addition, the TaMYBsm1 proteins were targeted to the nucleus and contained transcriptional activation domains (TADs). Gus assay and semi-quantitative RT-PCR analysis demonstrated that the TaMYBsm1 genes were up-regulated when the wheat was treated by PEG and mannitol. Compared with WT plants, the germination rates were much higher, but the water loss rates were much lower in TaMYBsm1-D overexpression plants. TaMYBsm1-D transgenic plants showed distinct higher proline contents but a lower MDA content than the WT plants. The three downstream genes were highly expressed in TaMYBsm1-D transgenic plants. We concluded from these results that TaMYBsm1 genes play an important role in plant drought stress tolerance through up-regulation of DREB2A, P5CS1 and RD29A. The increase of proline content and decrease of MDA content may also be involved in the drought response.
NADPH oxidases in the arbuscular mycorrhizal symbiosis.
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.
Muzaffar, S; Shukla, N; Bond, M; Sala-Newby, G B; Newby, A C; Angelini, G D; Jeremy, J Y
2008-11-01
To determine whether there is an association between vascular NADPH oxidase (NOX), superoxide, the small GTPase Rac(1) and PDE type 5 (PDE5) in human vascular smooth muscle cell (hVSMCs). hVSMCs were incubated with xanthine-xanthine oxidase (X-XO; a superoxide generating system) or the thromboxane A(2) analogue, U46619 (+/-superoxide dismutase (SOD) or apocynin) for 16 h. The expression of PDE5 and NOX-1 was assessed using Western blotting and superoxide measured. The role of Rac(1) in superoxide generation was assessed by overexpressing either the dominant-negative or constitutively active Rac isoforms. The effects of iloprost, DETA-NONOate and the Rho-kinase inhibitor, Y27632, on PDE5 and NOX-1 expression were also studied. Following 16 h incubation, U46619 and X-XO promoted the expression of PDE5 and NOX-1, an effect blocked by SOD or apocynin when co-incubated over the same time course. X-XO and U46619 both promoted the formation of superoxide. Overexpression of dominant-negative Rac(1) or addition of iloprost, DETA-NONOate or Y27632 completely blocked both superoxide release and PDE5 protein expression and activity. These data demonstrate that superoxide derived from NOX upregulates the expression of PDE5 in human VSMCs. As PDE5 hydrolyses cyclic GMP, this effect may blunt the vasculoprotective actions of NO.
Beerlage, Christiane; Greb, Jessica; Kretschmer, Dorothee; Assaggaf, Mohammad; Trackman, Philip C.; Hansmann, Martin-Leo; Bonin, Michael; Eble, Johannes A.; Peschel, Andreas; Brüne, Bernhard
2013-01-01
Hypoxia-inducible factor 1 (HIF-1) is the key transcription factor involved in the adaptation of mammals to hypoxia and plays a crucial role in cancer angiogenesis. Recent evidence suggests a leading role for HIF-1 in various inflammatory and infectious diseases. Here we describe the role of HIF-1 in Staphylococcus aureus infections by investigating the HIF-1-dependent host cell response. For this purpose, transcriptional profiling of HIF-1α-deficient HepG2 and control cells, both infected with Staphylococcus aureus, was performed. Four hours after infection, the expression of 190 genes, 24 of which were regulated via HIF-1, was influenced. LOX (encoding lysyl oxidase) was one of the upregulated genes with a potential impact on the course of S. aureus infection. LOX is an amine oxidase required for biosynthetic cross-linking of extracellular matrix components. LOX was upregulated in vitro in different cell cultures infected with S. aureus and also in vivo, in kidney abscesses of mice intravenously infected with S. aureus and in clinical skin samples from patients with S. aureus infections. Inhibition of LOX by β-aminopropionitrile (BAPN) did not affect the bacterial load in kidneys or blood but significantly influenced abscess morphology and collagenization. Our data provide evidence for a crucial role of HIF-1-regulated LOX in abscess formation. PMID:23649089
Stepien, Piotr; Johnson, Giles N
2009-02-01
The effects of short-term salt stress on gas exchange and the regulation of photosynthetic electron transport were examined in Arabidopsis (Arabidopsis thaliana) and its salt-tolerant close relative Thellungiella (Thellungiella halophila). Plants cultivated on soil were challenged for 2 weeks with NaCl. Arabidopsis showed a much higher sensitivity to salt than Thellungiella; while Arabidopsis plants were unable to survive exposure to greater than 150 mM salt, Thellugiella could tolerate concentrations as high as 500 mM with only minimal effects on gas exchange. Exposure of Arabidopsis to sublethal salt concentrations resulted in stomatal closure and inhibition of CO2 fixation. This lead to an inhibition of electron transport though photosystem II (PSII), an increase in cyclic electron flow involving only PSI, and increased nonphotochemical quenching of chlorophyll fluorescence. In contrast, in Thellungiella, although gas exchange was marginally inhibited by high salt and PSI was unaffected, there was a large increase in electron flow involving PSII. This additional electron transport activity is oxygen dependent and sensitive to the alternative oxidase inhibitor n-propyl gallate. PSII electron transport in Thellungiella showed a reduced sensitivity to 2'-iodo-6-isopropyl-3-methyl-2',4,4'-trinitrodiphenylether, an inhibitor of the cytochrome b6f complex. At the same time, we observed a substantial up-regulation of a protein reacting with antibodies raised against the plastid terminal oxidase. No such up-regulation was seen in Arabidopsis. We conclude that in salt-stressed Thellungiella, plastid terminal oxidase acts as an alternative electron sink, accounting for up to 30% of total PSII electron flow.
USDA-ARS?s Scientific Manuscript database
Eicosanoids mediate cellular immune responses in insects, including phagocytosis of invading microbes. Phagocytosis entails two major steps, the internalization of microbes and the subsequent killing of them via formation of reactive oxygen species (ROS). Here, we posed the hypothesis that eicosanoi...
Condino-Neto, A; Whitney, C; Newburger, P E
1998-11-01
We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
NADPH oxidases in the arbuscular mycorrhizal symbiosis
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627
Hasanuzzaman, Mirza; Alam, Md. Mahabub; Rahman, Anisur; Hasanuzzaman, Md.; Nahar, Kamrun; Fujita, Masayuki
2014-01-01
The present study investigates the roles of exogenous proline (Pro, 5 mM) and glycine betaine (GB, 5 mM) in improving salt stress tolerance in salt sensitive (BRRI dhan49) and salt tolerant (BRRI dhan54) rice (Oryza sativa L.) varieties. Salt stresses (150 and 300 mM NaCl for 48 h) significantly reduced leaf relative water (RWC) and chlorophyll (chl) content and increased endogenous Pro and increased lipid peroxidation and H2O2 levels. Ascorbate (AsA), glutathione (GSH) and GSH/GSSG, ascorbate peroxidae (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR), glutathione peroxidase (GPX), catalase (CAT), and glyoxalase I (Gly I) activities were reduced in sensitive variety and these were increased in tolerant variety due to salt stress. The glyoxalase II (Gly II), glutathione S-transferase (GST), and superoxide dismutase (SOD) activities were increased in both cultivars by salt stress. Exogenous Pro and GB application with salt stress improved physiological parameters and reduced oxidative damage in both cultivars where BRRI dhan54 showed better tolerance. The result suggests that exogenous application of Pro and GB increased rice seedlings' tolerance to salt-induced oxidative damage by upregulating their antioxidant defense system where these protectants rendered better performance to BRRI dhan54 and Pro can be considered as better protectant than GB. PMID:24991566
Muzaffar, S; Shukla, N; Bond, M; Sala-Newby, G B; Newby, A C; Angelini, G D; Jeremy, J Y
2008-01-01
Background and purpose: To determine whether there is an association between vascular NADPH oxidase (NOX), superoxide, the small GTPase Rac1 and PDE type 5 (PDE5) in human vascular smooth muscle cell (hVSMCs). Experimental approach: hVSMCs were incubated with xanthine–xanthine oxidase (X-XO; a superoxide generating system) or the thromboxane A2 analogue, U46619 (±superoxide dismutase (SOD) or apocynin) for 16 h. The expression of PDE5 and NOX-1 was assessed using Western blotting and superoxide measured. The role of Rac1 in superoxide generation was assessed by overexpressing either the dominant-negative or constitutively active Rac isoforms. The effects of iloprost, DETA-NONOate and the Rho-kinase inhibitor, Y27632, on PDE5 and NOX-1 expression were also studied. Key results: Following 16 h incubation, U46619 and X-XO promoted the expression of PDE5 and NOX-1, an effect blocked by SOD or apocynin when co-incubated over the same time course. X-XO and U46619 both promoted the formation of superoxide. Overexpression of dominant-negative Rac1 or addition of iloprost, DETA-NONOate or Y27632 completely blocked both superoxide release and PDE5 protein expression and activity. Conclusions and implications: These data demonstrate that superoxide derived from NOX upregulates the expression of PDE5 in human VSMCs. As PDE5 hydrolyses cyclic GMP, this effect may blunt the vasculoprotective actions of NO. PMID:18660830
Zheng, Shuai; Zhong, Zhao-Ming; Qin, Shuai; Chen, Guo-Xian; Wu, Qian; Zeng, Ji-Huan; Ye, Wen-Bin; Li, Wei; Yuan, Kai; Yao, Ling; Chen, Jian-Ting
2013-01-01
Advanced oxidation protein products (AOPPs), a marker of oxidative stress, are prevalent in many kinds of disorders. Rheumatoid arthritis (RA), mainly resulting from the dysfunction of fibroblast-like synoviocytes (FLSs), is related to oxidative stress. Although the increased levels of AOPPs in RA patients were reported, the effect of AOPPs on FLSs function still remains unclear. Therefore, our study aims to investigate whether AOPPs have an effect on the inflammatory response of FLSs in vitro. FLSs obtained from both knees of rats were treated with or without AOPPs-modified rat serum albumin (AOPPs-RSA) in vitro. The mRNA and protein expression of tumor necrosis factor (TNF)-α, interleukin(IL)-1β, matrix metalloproteinases(MMP)-3, MMP-13 and vascular endothelial growth factor (VEGF) were measured by real-time quantitative polymerase chain reaction and enzyme-linked immunosorbent assay (ELISA), respectively. Reactive oxygen species (ROS) generation was detected by fluorescent microscope and fluorescence microplate reader. Immunoprecipitation, Co-Immunoprecipitation and western blot were performed to examine the activity of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase and nuclear factor kappa B (NF-κB). Exposure of FLSs to AOPPs upregulated the mRNA and protein expression of TNF-α, IL-1β, MMP-3, MMP-13 and VEGF in a concentration dependent manner. AOPPs treatment triggered ROS production in FLSs, which was significantly abolished by ROS scavenger N-acetyl-L-cysteine (NAC), superoxide dismutase (SOD), NADPH oxidase inhibitors diphenyleneiodonium (DPI) and apocynin. Challenged AOPPs induced phosphorylation of p47(phox), triggered an interaction between p47(phox), p22(phox) and gp91(phox), and significantly upregulated expression of NADPH oxidase subunits p47(phox), p22(phox) and gp91(phox). IκB degradation and nuclear translocation of NF-κB p65 induced by AOPPs were significantly blocked by SOD, NAC, DPI and apocynin. These data indicate that AOPPs induce inflammatory response in FLSs is medicated through NADPH oxidase-dependent activation of NF-κB. © 2013 S. Karger AG, Basel
Midaoui, Adil El; Talbot, Sébastien; Lahjouji, Karim; Dias, Jenny Pena; Fantus, I George; Couture, Réjean
2015-06-01
To investigate the impact of alpha-lipoic acid on superoxide anion production and NADPH oxidase activity as well as on the expression of kinin B1 and B2 receptors in key organs of obese Zucker Diabetic Fatty rats. Superoxide anion production was measured by lucigenin chemiluminescence. Kinin B1 and B2 receptors expression was measured at protein and mRNA levels by western blot and qRT-PCR in key organs of Zucker Diabetic Fatty and Zucker lean control rats treated for a period of 6 weeks with a standard diet or a diet containing the antioxidant α-lipoic acid (1 g/kg). Superoxide anion production and NADPH oxidase activity were significantly enhanced in aorta and adipose tissue of Zucker Diabetic Fatty rats. Kinin B1 and B2 receptors expression levels were also significantly increased in the liver and the gastrocnemius muscle of Zucker Diabetic Fatty rats. Expression of both receptors was not altered in the pancreas of Zucker Diabetic Fatty rats and was undetectable in white retroperitoneal adipose tissue. Alpha-lipoic acid prevented the rise in NADPH oxidase activity in aorta and epididymal adipose tissue of Zucker Diabetic Fatty rats and the upregulation of kinin B1 receptor in liver and gastrocnemius muscle and that of kinin B2 receptor in the liver. Alpha-lipoic acid treatment was found to prevent the final body weight increase without affecting significantly hyperglycemia, hyperinsulinemia and insulin resistance index in Zucker Diabetic Fatty rats. Findings support the hypothesis that oxidative stress is implicated in the induction of kinin B1 receptor in Zucker Diabetic Fatty rats. The ability of α-lipoic acid to blunt the body weight gain appears to be mediated in part by preventing NADPH oxidase activity rise in adipose tissue and reversing the hepatic upregulation of kinin B1 receptor in Zucker Diabetic Fatty rats.
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
NASA Astrophysics Data System (ADS)
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Baltanás, Ana; Solesio, Maria E; Zalba, Guillermo; Galindo, María F; Fortuño, Ana; Jordán, Joaquín
2013-12-01
Herein, we investigate whether the NADPH oxidase might be playing a key role in the degree of oxidative stress in the senescence-accelerated mouse prone-8 (SAM-P8). To this end, the activity and expression of the NADPH oxidase, the ratio of glutathione and glutathione disulfides (GSH/GSSG), and the levels of malonyl dialdehyde (MDA) and nitrotyrosine (NT) were determined in renal tissue from SAM-P8 mice at the age of 1 and 6 months. The senescence-accelerated-resistant mouse (SAM-R1) was used as control. At the age of 1 month, NADPH oxidase activity and Nox2 protein expression were higher in SAM-P8 than in SAM-R1 mice. However, we found no differences in the GSH/GSSG ratio, MDA, NT, and Nox4 levels between both groups of animals. At the age of 6 months, SAM-R1 mice in comparison to SAM-P8 mice showed an increase in NADPH oxidase activity, which is associated with higher levels of NT and increased Nox4 and Nox2 expression levels. Furthermore, we found oxidative stress hallmarks including depletion in GSH/GSSG ratio and increase in MDA levels in the kidney of SAM-P8 mice. Finally, NADPH oxidase activity positively correlated with Nox2 expression in all the animals (r = 0.382, P < 0.05). Taken together, our data allow us to suggest that an increase in NADPH oxidase activity might be an early hallmark to predict future oxidative stress in renal tissue during the aging process that takes place in SAM-P8 mice.
Chatterjee, Saurabh; Rana, Ritu; Corbett, Jean; Kadiiska, Maria B.; Goldstein, Joyce; Mason, Ronald P.
2012-01-01
While some studies show that carbon tetrachloride-mediated metabolic oxidative stress exacerbates steatohepatitic-like lesions in obese mice, the redox mechanisms that trigger the innate immune system and accentuate the inflammatory cascade remain unclear. Here we have explored the role of the purinergic receptor P2X7-NADPH oxidase axis as a primary event in recognizing the heightened release of extracellular ATP from CCl4-treated hepatocytes and generating redoxmediated Kupffer cell activation in obese mice. We found that an underlying condition of obesity led to the formation of protein radicals and post-translational nitration, primarily in Kupffer cells, at 24 h post-CCl4 administration. The free radical-mediated oxidation of cellular macromolecules, which was NADPH oxidase- and P2X7 receptor-dependent, correlated well with the release of TNF- α and MCP-2 from Kupffer cells. The Kupffer cells in CCl4-treated mice exhibited increased expression of MHC Class II proteins and showed an activated phenotype. Increased expression of MHC Class II was inhibited by the NADPH oxidase inhibitor apocynin , P2X7 receptor antagonist A438709 hydrochloride, and genetic deletions of the NADPH oxidase p47 phox subunit or the P2X7 receptor. The P2X7 receptor acted upstream of NADPH oxidase activation by up-regulating the expression of the p47 phox subunit and p47 phox binding to the membrane subunit, gp91 phox. We conclude that the P2X7 receptor is a primary mediator of oxidative stress-induced exacerbation of inflammatory liver injury in obese mice via NADPH oxidase-dependent mechanisms. PMID:22343416
NASA Astrophysics Data System (ADS)
Yang, Lijuan; Yang, Daibin; Yan, Xiaojing; Cui, Li; Wang, Zhenying; Yuan, Huizhu
2016-11-01
Chilling stress during germination often causes severe injury. In the present study, maize seed germination and shoot growth under chilling stress were negatively correlated with the dose of tebuconazole in an exponential manner as predicted by the model Y = A + B × e(-x/k). Microencapsulation was an effective means of eliminating potential phytotoxic risk. The gibberellins (GAs) contents were higher after microencapsulation treatment than after conventional treatment when the dose of tebuconazole was higher than 0.12 g AI (active ingredient) kg-1 seed. Further analysis indicated that microencapsulation can stimulate ent-kaurene oxidase (KO) activity to some extent, whereas GA 3-oxidase (GA3ox) and GA 2-oxidase (GA2ox) activities remained similar to those in the control. Genes encoding GA metabolic enzymes exhibited different expression patterns. Transcript levels of ZmKO1 increased in the microcapsule treatments compared to the control. Even when incorporated into microcapsules, tebuconazole led to the upregulation of ZmGA3ox1 at doses of less than 0.12 g AI kg-1 seed and to the upregulation of ZmGA3ox2 when the dose was higher than 0.12 g AI kg-1 seed. With increasing doses of microencapsulated tebuconazole, the transcript levels of ZmGA2ox4, ZmGA2ox5 and ZmGA2ox6 exhibited upward trends, whereas the transcript levels of ZmGA2ox7 exhibited a downward trend.
Small GTPases and Stress Responses of vvran1 in the Straw Mushroom Volvariella volvacea
Yan, Jun-Jie; Xie, Bin; Zhang, Lei; Li, Shao-Jie; van Peer, Arend F.; Wu, Ta-Ju; Chen, Bing-Zhi; Xie, Bao-Gui
2016-01-01
Small GTPases play important roles in the growth, development and environmental responses of eukaryotes. Based on the genomic sequence of the straw mushroom Volvariella volvacea, 44 small GTPases were identified. A clustering analysis using human small GTPases as the references revealed that V. volvacea small GTPases can be grouped into five families: nine are in the Ras family, 10 are in the Rho family, 15 are in the Rab family, one is in the Ran family and nine are in the Arf family. The transcription of vvran1 was up-regulated upon hydrogen peroxide (H2O2) stress, and could be repressed by diphenyleneiodonium chloride (DPI), a NADPH oxidase-specific inhibitor. The number of vvran1 transcripts also increased upon cold stress. Diphenyleneiodonium chloride, but not the superoxide dismutase (SOD) inhibitor diethy dithiocarbamate (DDC), could suppress the up-regulation of vvran1 gene expression to cold stress. These results combined with the high correlations between gene expression and superoxide anion (O2−) generation indicated that vvran1 could be one of the candidate genes in the downstream of O2− mediated pathways that are generated by NADPH oxidase under low temperature and oxidative stresses. PMID:27626406
Mercury-induced oxidative stress and impact on antioxidant enzymes in Chlamydomonas reinhardtii.
Elbaz, Abdelrahman; Wei, Yuan Yuan; Meng, Qian; Zheng, Qi; Yang, Zhi Min
2010-10-01
Investigation of mercury toxicology in green algae is of great importance from ecological point of view, because mercury has become a major contaminant in recent years. In higher plants, accumulation of mercury modifies many aspects of cellular functions. However, the process that mercury exerts detrimental effects on green algae is largely unknown. In this study, we performed an experiment focusing on the biological responses of Chlamydomonas reinhardtii, a unicellular model organism, to Hg(2+)-induced toxicity. C. reinhardtii was exposed to 0, 1, 2, 4, 6, and 8 μM Hg in media. Concentrations of Hg were negatively correlated with the cell growth. Treatment with Hg induced accumulation of reactive oxygen species and peroxidative products. Endogenous proline levels increased in Hg-exposed algae. Hg exposure activated superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX). To get insights into the molecular response, a RT-PCR-based assay was performed to analyze the transcript abundance of Mn-SOD, CAT and APX. Our analysis revealed that expression of the genes was up-regulated by Hg exposure, with a pattern similar to the enzyme activities. Additional investigation was undertaken on the effect of Hg on the transcript amount of ∆(1)-pyrroline-5-carboxylate synthetase, a key enzyme of proline biosynthesis and on that of heme oxygenase-1 (HO-1), an enzyme regulating heavy metal tolerance. Expressions of both P5CS and HO-1 were up-regulated by Hg. These data indicate that Hg-induced oxidative stress was responsible for the disturbance of the growth and antioxidant defensive systems in C. reinhardtii.
A multicopper oxidase contributes to the copper tolerance of Brucella melitensis 16M.
Wu, Tonglei; Wang, Shaohua; Wang, Zhen; Peng, Xiaowei; Lu, Yanli; Wu, Qingmin
2015-06-01
Copper is a potent antimicrobial agent. Multiple mechanisms of copper tolerance are utilized by some pathogenic bacteria. BMEII0580, which is significantly similar to the multicopper oxidase from Escherichia coli, was predicted to be the probable blue copper protein YacK precursor in Brucella melitensis 16M, and was designated as Brucella multicopper oxidase (BmcO). A bioinformatics analysis indicated that the typical motifs of multicopper oxidases are present in BmcO. BmcO, the expression of which was up-regulated by copper, could catalyze the oxidation of 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), dimethoxyphenol (DMP) and para-phenylenediamine (pPD), which are widely used as substrates for multicopper oxidase. Additionally, BmcO exhibited ferroxidase activity, which indicated that it might play an important role in the Fe(2+) uptake of B. melitensis. Importantly, the mutant strain 16MΔbmcO was more sensitive to copper than the wild-type strain B. melitensis 16M as well as its complementation strain 16MΔbmcO(bmcO). The infection assays of cells showed that similar bacterial numbers of B. melitensis 16M, 16MΔbmcO and 16MΔbmcO(bmcO) strains were recovered from the infected macrophages. This result indicated that BmcO was not essential for B. melitensis intracellular growth. In conclusion, our results confirm that BmcO is a multicopper oxidase and contributes to the copper tolerance of B. melitensis 16M. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Proline dehydrogenase promotes senescence through the generation of reactive oxygen species.
Nagano, Taiki; Nakashima, Akio; Onishi, Kengo; Kawai, Kosuke; Awai, Yuto; Kinugasa, Mizuki; Iwasaki, Tetsushi; Kikkawa, Ushio; Kamada, Shinji
2017-04-15
Cellular senescence is a complex stress response characterized by permanent loss of proliferative capacity and is implicated in age-related disorders. Although the transcriptional activity of p53 (encoded by TP53 ) is known to be vital for senescence induction, the downstream effector genes critical for senescence remain unsolved. Recently, we have identified the proline dehydrogenase gene ( PRODH ) to be upregulated specifically in senescent cells in a p53-dependent manner, and the functional relevance of this to senescence is yet to be defined. Here, we conducted functional analyses to explore the relationship between PRODH and the senescence program. We found that genetic and pharmacological inhibition of PRODH suppressed senescent phenotypes induced by DNA damage. Furthermore, ectopic expression of wild-type PRODH, but not enzymatically inactive forms, induced senescence associated with the increase in reactive oxygen species (ROS) and the accumulation of DNA damage. Treatment with N-acetyl-L-cysteine, a ROS scavenger, prevented senescence induced by PRODH overexpression. These results indicate that PRODH plays a causative role in DNA damage-induced senescence through the enzymatic generation of ROS. © 2017. Published by The Company of Biologists Ltd.
Taamalli, Manel; D'Alessandro, Angelo; Marrocco, Cristina; Gevi, Federica; Timperio, Anna Maria; Zolla, Lello
2015-04-01
Recent physiological reports have documented how Cakile maritima Scop. Sea Rocket could accumulate high doses of Cd without altering its physiological parameters. In the present study, we performed an integrated proteomics (2DE) and metabolomics (HPLC-MS) investigation to determine the molecular mechanisms underlying cadmium (Cd) tolerance of this halophyte. Peculiar features were observed: (i) up-regulation of thiol compound anabolism, including glutathione and phytochelatin homeostasis, which allows an intracellular chelation of Cd and its compartmentalization into vacuole by a significant up-regulation of vacuolar transporters; (ii) up-regulation of the PPP and Calvin cycle (both at the enzyme and metabolite level), which utterly promoted the maintenance of NADPH/NADP(+) homeostasis, other than the accumulation of triose-phosphates (serving as anabolic intermediates for triacylglycerol biosynthesis) and the glyoxylate precursor phosphoglycolate, to promote photorespiration and consequently CO2 release. An up-regulation of carbonic anhydrase was also observed. This halophyte is also correlated with a highly efficient antioxidant system, especially a high up-regulation of SOD1, resulting more efficient in coping with heavy metals stress than common plants. Interestingly, exposure to high Cd concentrations partly affected photosystem integrity and metabolic activity, through the up-regulation of enzymes from the Calvin cycle and glutathione-ascorbate homeostasis and PAP3 which stabilizes thylakoid membrane structures. In addition, up-regulation of Peptidyl-prolyl isomerase CYP38 increases stability and biogenesis of PSII. Finally, metabolomics results confirmed proteomics and previous physiological evidence, also suggesting that osmoprotectants, betaine and proline, together with plant hormones, methyl jasmonate and salicylic acid, might be involved in mediating responses to Cd-induced stress. Taken together, these peculiar features confirm that Cakile maritima Scop. Sea Rocket seemed to be naturally equipped to withstand even high doses of Cd pollution.
Targeting Mechanisms of Resistance to Taxane-Based Chemotherapy
2008-09-01
12]. Another interesting gene ; monoamine oxidase A ( MAOA ) was upregulated in patients with PSA relapse (Figure 8A). Quantitative real-time PCR (qRT...from prostate. After excluding genes previously shown to be influenced by the radical prostatectomy procedure, we identified 51 genes with significant...analyses confirmed overexpression of GDF15 may confer resistance to chemotherapy in prostate cancer cells. Gene expression changes after
Zhang, Yu-Ping; Huo, Yan-Li; Fang, Zhi-Qin; Wang, Xue-Fang; Li, Jian-Dong; Wang, Hai-Ping; Peng, Wei; Johnson, Alan Kim; Xue, Baojian
2018-05-01
Accumulating evidence indicates that maternal high-fat diet (HFD) is associated with metabolic syndrome and cardiovascular disease in adult offspring. The present study tested the hypothesis that maternal HFD modulates the brain renin-angiotensin system (RAS), oxidative stress, and proinflammatory cytokines that alter angiotensin II (ANG II) and TNF-α actions and sensitize the ANG II-elicited hypertensive response in adult offspring. All offspring were cross fostered by dams on the same or opposite diet to yield the following four groups: offspring from normal-fat control diet-fed dams suckled by control diet-fed dams (OCC group) or by HFD-fed dams (OCH group) and offspring from HFD-fed dams fed a HFD suckled by control diet-fed dams (OHC group) or by HFD-fed dams (OHH group). RT-PCR analyses of the lamina terminalis and paraventricular nucleus indicated upregulation of mRNA expression of several RAS components, NADPH oxidase, and proinflammatory cytokines in 10-wk-old male offspring of dams fed a HFD during either pregnancy, lactation, or both (OHC, OCH, and OHH groups). These offspring also showed decreased cardiac baroreflex sensitivity and increased pressor responses to intracerebroventricular microinjection of either ANG II or TNF-α. Furthermore, chronic systemic infusion of ANG II resulted in enhanced upregulation of mRNA expression of RAS components, NADPH oxidase, and proinflammatory cytokines in the lamina terminalis and paraventricular nucleus and an augmented hypertensive response in the OHC, OCH, and OHH groups compared with the OCC group. The results suggest that maternal HFD blunts cardiac baroreflex function and enhances pressor responses to ANG II or proinflammatory cytokines through upregulation of the brain RAS, oxidative stress, and inflammation. NEW & NOTEWORTHY The results of our study indicate that a maternal high-fat diet during either pregnancy or lactation is sufficient for perinatal programming of sensitization for hypertension, which is associated with hyperreactivity of central cardiovascular nuclei that, in all likelihood, involves elevated expression of the renin-angiotensin system, NADPH oxidase, and proinflammatory cytokines. The present study demonstrates, for the first time, the central mechanism underlying maternal high-fat diet sensitization of the hypertensive response in adult offspring.
Spermine oxidase is up-regulated and promotes tumor growth in hepatocellular carcinoma.
Hu, Tingting; Sun, Dalong; Zhang, Jie; Xue, Ruyi; Janssen, Harry L A; Tang, Wenqing; Dong, Ling
2018-06-20
The polyamine catabolic enzyme, spermine oxidase (SMOX) is up-regulated in chronic inflammatory conditions and linked to increased reactive oxygen species (ROS) and DNA damage in various forms of cancers. The present study aims to explore the expression pattern and biological function of SMOX in hepatocellular carcinoma (HCC). We used qRT-PCR, Western blotting and immunohistochemistry to examine SMOX expression in four HCC cell lines and 120 cases of HCC clinical samples, and the clinical significance of SMOX was analyzed. The biological function of SMOX on HCC cells were detected both in vitro and in vivo. It showed that SMOX was overexpressed in HCC cell lines and clinical HCC tissues. Moreover, SMOX expression levels were gradually increased in normal liver, chronic hepatitis and HCC tissues. Increased SMOX expression was correlated with poor clinical features of HCC. Patients with positive SMOX expression in tumor tissues indicated worse overall survival (P = 0.008) and shorter relapse-free survival (P = 0.002). Knockdown of SMOX inhibited HCC cell proliferation, arrested cell cycle at S phase and resulted in an increase of apoptosis. The in vivo study showed that inhibition of SMOX in HCC cells significantly repressed tumor growth in nude mice. Furthermore, we demonstrated that SMOX may exert its function by regulating PI3K/Akt signaling pathway. Our data indicated that SMOX upregulation may be a critical oncogene in HCC and might serve as a valuable prognostic marker and potential therapeutic target for HCC. This article is protected by copyright. All rights reserved.
Wang, Xinlong; Tian, Fenghua; Reddy, Divya D; Nalawade, Sahil S; Barrett, Douglas W; Gonzalez-Lima, Francisco; Liu, Hanli
2017-12-01
Transcranial infrared laser stimulation (TILS) is a noninvasive form of brain photobiomulation. Cytochrome-c-oxidase (CCO), the terminal enzyme in the mitochondrial electron transport chain, is hypothesized to be the primary intracellular photoacceptor. We hypothesized that TILS up-regulates cerebral CCO and causes hemodynamic changes. We delivered 1064-nm laser stimulation to the forehead of healthy participants ( n = 11), while broadband near-infrared spectroscopy was utilized to acquire light reflectance from the TILS-treated cortical region before, during, and after TILS. Placebo experiments were also performed for accurate comparison. Time course of spectroscopic readings were analyzed and fitted to the modified Beer-Lambert law. With respect to the placebo readings, we observed (1) significant increases in cerebral concentrations of oxidized CCO (Δ[CCO]; >0.08 µM; p < 0.01), oxygenated hemoglobin (Δ[HbO]; >0.8 µM; p < 0.01), and total hemoglobin (Δ[HbT]; >0.5 µM; p < 0.01) during and after TILS, and (2) linear interplays between Δ[CCO] versus Δ[HbO] and between Δ[CCO] versus Δ[HbT]. Ratios of Δ[CCO]/Δ[HbO] and Δ[CCO]/Δ[HbT] were introduced as TILS-induced metabolic-hemodynamic coupling indices to quantify the coupling strength between TILS-enhanced cerebral metabolism and blood oxygen supply. This study provides the first demonstration that TILS causes up-regulation of oxidized CCO in the human brain, and contributes important insight into the physiological mechanisms.
Ianniello, R G; Zheng, J; Zotta, T; Ricciardi, A; Gänzle, M G
2015-09-01
This study evaluated the aerobic and respiratory metabolism in Lactobacillus reuteri and Lactobacillus spicheri, two heterofermentative species used in sourdough fermentation. In silico genome analysis, production of metabolites and gene expression of pyruvate oxidase, pyruvate dehydrogenase and cytochrome oxidase were assessed in anaerobic and aerobic cultures of Lact. reuteri and Lact. spicheri. Respiring homofermentative Lactobacillus casei N87 and Lact. rhamnosus N132 were used for comparison. Aerobiosis and respiration increased the biomass production of heterofermentative strains compared to anaerobic cultivation. Respiration led to acetoin production by Lact. rhamnosus and Lact. casei, but not in heterofermentative strains, in which lactate and acetate were the major end-products. Lactobacillus spicheri LP38 showed the highest oxygen uptake. Pyruvate oxidase, respiratory cytochromes, NADH oxidase and NADH peroxidase were present in the genome of Lact. spicheri LP38. Both Lact. spicheri LP38 and Lact. rhamnosus N132 overexpressed pox in aerobic cultures, while cydA was up-regulated only when haeme was supplied; pdh was repressed during aerobic growth. Aerobic and respiratory growth provided physiological and metabolic advantages also in heterofermentative lactobacilli. The exploitation of oxygen-tolerant phenotypes of Lact. spicheri may be useful for the development of improved starter cultures. © 2015 The Society for Applied Microbiology.
Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L
2012-08-01
Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (P<0.05) protein expression of NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) , 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P<0.05) the abnormalities in protein expressions of p47(phox) , gp91(phox) (but not p67(phox) ) and 4-HNE, but only slightly (P>0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.
Targeting NADPH Oxidase Decreases Oxidative Stress in the Transgenic Sickle Cell Mouse Penis
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F.; Burnett, Arthur L.
2012-01-01
Introduction Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. Aims We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. Methods SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67phox, p47phox, and gp91phox), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Main Outcome Measures Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Results Relative to hemi mice, SCD increased (P < 0.05) protein expression of NADPH oxidase subunits p67phox, p47phox, and gp91phox, 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P < 0.05) the abnormalities in protein expressions of p47phox, gp91phox (but not p67phox) and 4-HNE, but only slightly (P > 0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. Conclusion NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. PMID:22620981
Minelli, Alba; Conte, Carmela; Grottelli, Silvia; Bellezza, Maria; Cacciatore, Ivana; Bolaños, Juan P
2009-01-01
Hystidyl-proline [cyclo(His-Pro)] is an endogenous cyclic dipeptide produced by the cleavage of thyrotropin releasing hormone. Previous studies have shown that cyclo(His-Pro) protects against oxidative stress, although the underlying mechanism has remained elusive. Here, we addressed this issue and found that cyclo(His-Pro) triggered nuclear accumulation of NF-E2-related factor-2 (Nrf2), a transcription factor that up-regulates antioxidant-/electrophile-responsive element (ARE-EpRE)-related genes, in PC12 cells. Cyclo(His-Pro) attenuated reactive oxygen species production, and prevented glutathione depletion caused by glutamate, rotenone, paraquat and β-amyloid treatment. Moreover, real-time PCR analyses revealed that cyclo(His-Pro) induced the expression of a number of ARE-related genes and protected cells against hydrogen peroxide-mediated apoptotic death. Furthermore, these effects were abolished by RNA interference-mediated Nrf2 knockdown. Finally, pharmacological inhibition of p-38 MAPK partially prevented both cyclo(His-Pro)-mediated Nrf2 activation and cellular protection. These results suggest that the signalling mechanism responsible for the cytoprotective actions of cyclo(His-Pro) would involve p-38 MAPK activation leading to Nrf2-mediated up-regulation of antioxidant cellular defence. PMID:18373731
Integrating Candida albicans metabolism with biofilm heterogeneity by transcriptome mapping
NASA Astrophysics Data System (ADS)
Rajendran, Ranjith; May, Ali; Sherry, Leighann; Kean, Ryan; Williams, Craig; Jones, Brian L.; Burgess, Karl V.; Heringa, Jaap; Abeln, Sanne; Brandt, Bernd W.; Munro, Carol A.; Ramage, Gordon
2016-10-01
Candida albicans biofilm formation is an important virulence factor in the pathogenesis of disease, a characteristic which has been shown to be heterogeneous in clinical isolates. Using an unbiased computational approach we investigated the central metabolic pathways driving biofilm heterogeneity. Transcripts from high (HBF) and low (LBF) biofilm forming isolates were analysed by RNA sequencing, with 6312 genes identified to be expressed in these two phenotypes. With a dedicated computational approach we identified and validated a significantly differentially expressed subnetwork of genes associated with these biofilm phenotypes. Our analysis revealed amino acid metabolism, such as arginine, proline, aspartate and glutamate metabolism, were predominantly upregulated in the HBF phenotype. On the contrary, purine, starch and sucrose metabolism was generally upregulated in the LBF phenotype. The aspartate aminotransferase gene AAT1 was found to be a common member of these amino acid pathways and significantly upregulated in the HBF phenotype. Pharmacological inhibition of AAT1 enzyme activity significantly reduced biofilm formation in a dose-dependent manner. Collectively, these findings provide evidence that biofilm phenotype is associated with differential regulation of metabolic pathways. Understanding and targeting such pathways, such as amino acid metabolism, is potentially useful for developing diagnostics and new antifungals to treat biofilm-based infections.
Activation of Nrf2 in keratinocytes causes chloracne (MADISH)-like skin disease in mice
Schäfer, Matthias; Willrodt, Ann-Helen; Kurinna, Svitlana; Link, Andrea S; Farwanah, Hany; Geusau, Alexandra; Gruber, Florian; Sorg, Olivier; Huebner, Aaron J; Roop, Dennis R; Sandhoff, Konrad; Saurat, Jean-Hilaire; Tschachler, Erwin; Schneider, Marlon R; Langbein, Lutz; Bloch, Wilhelm; Beer, Hans-Dietmar; Werner, Sabine
2014-01-01
The transcription factor Nrf2 is a key regulator of the cellular stress response, and pharmacological Nrf2 activation is a promising strategy for skin protection and cancer prevention. We show here that prolonged Nrf2 activation in keratinocytes causes sebaceous gland enlargement and seborrhea in mice due to upregulation of the growth factor epigen, which we identified as a novel Nrf2 target. This was accompanied by thickening and hyperkeratosis of hair follicle infundibula. These abnormalities caused dilatation of infundibula, hair loss, and cyst development upon aging. Upregulation of epigen, secretory leukocyte peptidase inhibitor (Slpi), and small proline-rich protein 2d (Sprr2d) in hair follicles was identified as the likely cause of infundibular acanthosis, hyperkeratosis, and cyst formation. These alterations were highly reminiscent to the phenotype of chloracne/“metabolizing acquired dioxin-induced skin hamartomas” (MADISH) patients. Indeed, SLPI, SPRR2, and epigen were strongly expressed in cysts of MADISH patients and upregulated by dioxin in human keratinocytes in an NRF2-dependent manner. These results identify novel Nrf2 activities in the pilosebaceous unit and point to a role of NRF2 in MADISH pathogenesis. PMID:24503019
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803
Targeting Mechanisms of Resistance to Taxane-Based Chemotherapy
2007-09-01
gene ; monoamine oxidase A ( MAOA ) was upregulated in patients with PSA relapse (Figure 5A). Quantitative real-time PCR (qRT-PCR) was performed to...resistance and uncover mechanisms or pathways suitable for targeting with the objective of improving tumor responses to chemotherapy. Gene expression...CXCL10 but not IL8 conferring chemoresistance to prostate cancer cells. When using longer term clinical outcome, we found genes correlated with PSA
Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T
2009-10-01
Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.
Cellular antioxidant effects of atorvastatin in vitro and in vivo.
Wassmann, Sven; Laufs, Ulrich; Müller, Kirsten; Konkol, Christian; Ahlbory, Katja; Bäumer, Anselm T; Linz, Wolfgang; Böhm, Michael; Nickenig, Georg
2002-02-01
3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) may exert direct effects on vascular cells and beneficially influence endothelial dysfunction. Because reactive oxygen species (ROS) may lead to vascular damage and dysfunction, we investigated the effect of atorvastatin on ROS production and the underlying mechanisms in vitro and in vivo. Cultured rat aortic vascular smooth muscle cells were incubated with 10 micromol/L atorvastatin. Angiotensin II-induced and epidermal growth factor-induced ROS production were significantly reduced by atorvastatin (dichlorofluorescein fluorescence laser microscopy). Atorvastatin downregulated mRNA expression of the NAD(P)H oxidase subunit nox1, whereas p22phox mRNA expression was not significantly altered (reverse transcription-polymerase chain reaction, Northern analysis). Membrane translocation of rac1 GTPase, which is required for the activation of NAD(P)H oxidase, was inhibited by atorvastatin (Western blot). mRNA expression of superoxide dismutase isoforms and glutathione peroxidase was not modified by atorvastatin, whereas catalase expression was upregulated at mRNA and protein levels, resulting in an increased enzymatic activity. Effects of atorvastatin on ROS production and nox1, rac1, and catalase expression were inhibited by L-mevalonate but not by 25-hydroxycholesterol. In addition, spontaneously hypertensive rats were treated with atorvastatin for 30 days. ROS production in aortic segments was significantly reduced in statin-treated rats (lucigenin chemiluminescence). Treatment with atorvastatin reduced vascular mRNA expression of p22phox and nox1 and increased aortic catalase expression. mRNA expression of superoxide dismutases, glutathione peroxidase, and NAD(P)H oxidase subunits gp91phox, p40phox, p47phox, and p67phox remained unchanged. Translocation of rac1 from the cytosol to the cell membrane was also reduced in vivo. Thus, atorvastatin exerts cellular antioxidant effects in cultured rat vascular smooth muscle cells and in the vasculature of spontaneously hypertensive rats mediated by decreased expression of essential NAD(P)H oxidase subunits and by upregulation of catalase expression. These effects of atorvastatin may contribute to the vasoprotective effects of statins.
Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Sharma, Sandeep; Verslues, Paul E
2016-10-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1 pro :LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1 pro :LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1 pro :LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1 pro :LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4 These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. © 2016 American Society of Plant Biologists. All Rights Reserved.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.
2016-01-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016
Physiological and Molecular Responses to Excess Boron in Citrus macrophylla W.
Martínez-Cuenca, Mary-Rus; Martínez-Alcántara, Belén; Quiñones, Ana; Ruiz, Marta; Iglesias, Domingo J; Primo-Millo, Eduardo; Forner-Giner, M Ángeles
2015-01-01
This work provides insight into several mechanisms involved in boron (B) regulation pathway in response to high B conditions in Citrus. The study was carried out in Citrus macrophylla W. (Cm) seedlings cultured "in vitro" in media with 50 or 400 μM H3BO3 (control, Ct, and B-excess, +B, plants, respectively). Growth parameters, B concentration, leaf chlorophyll (Chl) concentration, the expression of the main putative genes involved in B transport and distribution, and leaf and root proline and malonaldehyde (MDA) concentrations, were assessed. Excess B led to high B concentration in +B plants (3.8- and 1.4-fold in leaves and roots, respectively) when compared with Ct ones. However, a minor effect was recorded in the plant (incipient visual symptoms, less than 27% reduction in root growth and 26% decrease in Chl b concentration). B toxicity down-regulated by half the expression level of putative B transporter genes NIP5 and PIP1. CmBOR1 gene was not repressed in +B plants and B accumulated in the shoots. High B level increased the transcripts of putative gene TIP5, involved in B transport across the tonoplast, by 3.3- and 2.4-fold in leaves and roots, respectively. The activity of V-PPiase proton pump, related with the electrochemical gradient in the vacuole, was also enhanced in +B organs. B toxicity up-regulated putative BOR4 gene (2.1- and 2.7-fold in roots and leaves, respectively), which codifies for an active efflux B transporter. Accordingly, B was located in +B plants preferently in an insoluble form on cell walls. Finally, excess B caused a significant rise in proline concentration (51% and 34% in roots and leaves, respectively), while the MDA level did not exceed 20%. In conclusion, Cm tolerance to a high B level is likely based on the synergism of several specific mechanisms against B toxicity, including: 1/ down-regulation of NIP5 and PIP1 boron transporters; 2/ activation of B efflux from cells due to the up-regulation of putative BOR4 gene; 3/ compartmentation of B in the vacuole through TIP5 transporter activation and the acidification of the organelle; 4/ insolubilisation of B and deposition in cell walls preventing from cytoplasm damage; and, 5/ induction of an efficient antioxidant system through proline accumulation.
Physiological and Molecular Responses to Excess Boron in Citrus macrophylla W
Martínez-Cuenca, Mary-Rus; Martínez-Alcántara, Belén; Quiñones, Ana; Ruiz, Marta; Iglesias, Domingo J.; Primo-Millo, Eduardo; Forner-Giner, M. Ángeles
2015-01-01
This work provides insight into several mechanisms involved in boron (B) regulation pathway in response to high B conditions in Citrus. The study was carried out in Citrus macrophylla W. (Cm) seedlings cultured “in vitro” in media with 50 or 400 μM H3BO3 (control, Ct, and B-excess, +B, plants, respectively). Growth parameters, B concentration, leaf chlorophyll (Chl) concentration, the expression of the main putative genes involved in B transport and distribution, and leaf and root proline and malonaldehyde (MDA) concentrations, were assessed. Excess B led to high B concentration in +B plants (3.8- and 1.4-fold in leaves and roots, respectively) when compared with Ct ones. However, a minor effect was recorded in the plant (incipient visual symptoms, less than 27% reduction in root growth and 26% decrease in Chl b concentration). B toxicity down-regulated by half the expression level of putative B transporter genes NIP5 and PIP1. CmBOR1 gene was not repressed in +B plants and B accumulated in the shoots. High B level increased the transcripts of putative gene TIP5, involved in B transport across the tonoplast, by 3.3- and 2.4-fold in leaves and roots, respectively. The activity of V-PPiase proton pump, related with the electrochemical gradient in the vacuole, was also enhanced in +B organs. B toxicity up-regulated putative BOR4 gene (2.1- and 2.7-fold in roots and leaves, respectively), which codifies for an active efflux B transporter. Accordingly, B was located in +B plants preferently in an insoluble form on cell walls. Finally, excess B caused a significant rise in proline concentration (51% and 34% in roots and leaves, respectively), while the MDA level did not exceed 20%. In conclusion, Cm tolerance to a high B level is likely based on the synergism of several specific mechanisms against B toxicity, including: 1/ down-regulation of NIP5 and PIP1 boron transporters; 2/ activation of B efflux from cells due to the up-regulation of putative BOR4 gene; 3/ compartmentation of B in the vacuole through TIP5 transporter activation and the acidification of the organelle; 4/ insolubilisation of B and deposition in cell walls preventing from cytoplasm damage; and, 5/ induction of an efficient antioxidant system through proline accumulation. PMID:26225859
Mantilla, Brian S.; Paes, Lisvane S.; Pral, Elizabeth M. F.; Martil, Daiana E.; Thiemann, Otavio H.; Fernández-Silva, Patricio; Bastos, Erick L.; Silber, Ariel M.
2015-01-01
Proline is crucial for energizing critical events throughout the life cycle of Trypanosoma cruzi, the etiological agent of Chagas disease. The proline breakdown pathway consists of two oxidation steps, both of which produce reducing equivalents as follows: the conversion of proline to Δ1-pyrroline-5-carboxylate (P5C), and the subsequent conversion of P5C to glutamate. We have identified and characterized the Δ1-pyrroline-5-carboxylate dehydrogenase from T. cruzi (TcP5CDH) and report here on how this enzyme contributes to a central metabolic pathway in this parasite. Size-exclusion chromatography, two-dimensional gel electrophoresis, and small angle x-ray scattering analysis of TcP5CDH revealed an oligomeric state composed of two subunits of six protomers. TcP5CDH was found to complement a yeast strain deficient in PUT2 activity, confirming the enzyme's functional role; and the biochemical parameters (Km, kcat, and kcat/Km) of the recombinant TcP5CDH were determined, exhibiting values comparable with those from T. cruzi lysates. In addition, TcP5CDH exhibited mitochondrial staining during the main stages of the T. cruzi life cycle. mRNA and enzymatic activity levels indicated the up-regulation (6-fold change) of TcP5CDH during the infective stages of the parasite. The participation of P5C as an energy source was also demonstrated. Overall, we propose that this enzymatic step is crucial for the viability of both replicative and infective forms of T. cruzi. PMID:25623067
Qiao, Haowen; Zhou, Yu; Qin, Xingping; Cheng, Jing; He, Yun; Jiang, Yugang
2018-01-01
Bone marrow-derived mesenchymal stem cells (BMSCs) have blossomed into an effective approach with great potential for the treatment of liver fibrosis. The aim of this study was to investigate the underlying antifibrosis mechanisms by which the BMSC inhibit activated hepatic stellate cells (HSCs) in vivo and in vitro. To study the effect of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) on activated HSCs, we used HSCs and the coculture systems to evaluate the inhibition of activated HSCs from the aspects of the apoptosis of activated HSCs. In addition, activation of NADPH oxidase pathway and the changes in liver histopathology were tested by using the carbon tetrachloride- (CCl 4 -) induced liver fibrosis in mice. Introduction of hBM-MSCs significantly inhibited the proliferation of activated HSCs by inducing the apoptosis process of activated HSCs. The effect of hBM-MSCs reduced the signaling pathway of NADPH oxidase in activated HSCs. Besides, the signaling pathway of NADPH oxidase mediated hBM-MSC upregulation of the expression of the peroxisome proliferator-activated receptor γ and downregulation of the expression of α 1(I) collagen and alpha-smooth muscle actin ( α -SMA) in activated HSCs. Moreover, the hBM-MSC-induced decrease in the signaling pathway of NADPH oxidase was accompanied by the decrease of the activated HSC number and liver fibrosis in a mouse model of CCl 4 -induced liver fibrosis. The hBM-MSCs act as a promising drug source against liver fibrosis development with respect to hepatopathy as a therapeutic target.
Endo, Daiki; Fujimoto, Kenta; Hirose, Rika; Yamanaka, Hiroko; Homme, Mizuki; Ishibashi, Ken-Ichi; Miura, Noriko; Ohno, Naohito; Aratani, Yasuaki
2017-02-01
Patients with chronic granulomatous disease (CGD) have mutated phagocyte NADPH oxidase, resulting in reduced production of reactive oxygen species (ROS). While the mechanism underlying hyperinfection in CGD is well understood, the basis for inflammatory disorders that arise in the absence of evident infection has not been fully explained. This study aimed to evaluate the effect of phagocyte NADPH oxidase deficiency on lung inflammation induced by nonviable Candida albicans (nCA). Mice deficient in this enzyme (CGD mice) showed more severe neutrophilic pneumonia than nCA-treated wild-type mice, which exhibited significantly higher lung concentrations of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and keratinocyte-derived chemokine (KC). Neutralization of these proinflammatory mediators significantly reduced neutrophil infiltration. In vitro, production of IL-1β and TNF-α from neutrophils and that of KC from macrophages was enhanced in nCA-stimulated neutrophils from CGD mice. Expression of IL-1β mRNA was higher in the stimulated CGD neutrophils than in the stimulated wild-type cells, concomitant with upregulation of nuclear factor (NF)-κB and its upstream regulator extracellular-signal regulated kinase (ERK) 1/2. Pretreatment with an NADPH oxidase inhibitor significantly enhanced IL-1β production in the wild-type neutrophils stimulated with nCA. These results suggest that lack of ROS production because of NADPH oxidase deficiency results in the production of higher levels of proinflammatory mediators from neutrophils and macrophages, which may at least partly contribute to the exacerbation of nCA-induced lung inflammation in CGD mice.
Vara, Dina; Watt, Joanna M.; Fortunato, Tiago M.; Mellor, Harry; Burgess, Matthew; Wicks, Kate; Mace, Kimberly; Reeksting, Shaun; Lubben, Anneke; Wheeler-Jones, Caroline P.D.
2018-01-01
Abstract Aims: Deoxyribose-1-phosphate (dRP) is a proangiogenic paracrine stimulus released by cancer cells, platelets, and macrophages and acting on endothelial cells. The objective of this study was to clarify how dRP stimulates angiogenic responses in human endothelial cells. Results: Live cell imaging, electron paramagnetic resonance, pull-down of dRP-interacting proteins, followed by immunoblotting, gene silencing of different NADPH oxidases (NOXs), and their regulatory cosubunits by small interfering RNA (siRNA) transfection, and experiments with inhibitors of the sugar transporter glucose transporter 1 (GLUT1) were utilized to demonstrate that dRP acts intracellularly by directly activating the endothelial NOX2 complex, but not NOX4. Increased reactive oxygen species generation in response to NOX2 activity leads to redox-dependent activation of the transcription factor nuclear factor kappa B (NF-κB), which, in turn, induces vascular endothelial growth factor receptor 2 (VEGFR2) upregulation. Using endothelial tube formation assays, gene silencing by siRNA, and antibody-based receptor inhibition, we demonstrate that the activation of NF-κB and VEGFR2 is necessary for the angiogenic responses elicited by dRP. The upregulation of VEGFR2 and NOX2-dependent stimulation of angiogenesis by dRP were confirmed in excisional wound and Matrigel plug vascularization assays in vivo using NOX2−/− mice. Innovation: For the first time, we demonstrate that dRP acts intracellularly and stimulates superoxide anion generation by direct binding and activation of the NOX2 enzymatic complex. Conclusions: This study describes a novel molecular mechanism underlying the proangiogenic activity of dRP, which involves the sequential activation of NOX2 and NF-κB and upregulation of VEGFR2. Antioxid. Redox Signal. 28, 110–130. PMID:28793782
Modulation of IgE-dependent COX-2 gene expression by reactive oxygen species in human neutrophils.
Vega, Antonio; Chacón, Pedro; Alba, Gonzalo; El Bekay, Rajaa; Martín-Nieto, José; Sobrino, Francisco
2006-07-01
Cyclooxygenase (COX) is a key enzyme in prostaglandin (PG) synthesis. Up-regulation of its COX-2 isoform is responsible for the increased PG release, taking place under inflammatory conditions, and also, is thought to be involved in allergic and inflammatory diseases. In the present work, we demonstrate that COX-2 expression becomes highly induced by anti-immunoglobulin E (IgE) antibodies and by antigens in human neutrophils from allergic patients. This induction was detected at mRNA and protein levels and was accompanied by a concomitant PGE(2) and thromboxane A(2) release. We also show evidence that inhibitors of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, such as 4-(2-aminoethyl)benzenesulphonyl fluoride and 4-hydroxy-3-methoxyaceto-phenone, completely cancelled anti-IgE-induced COX-2 protein up-regulation, suggesting that this process is mediated by reactive oxygen species (ROS) derived from NADPH oxidase activity. Moreover, the mitogen-activated protein kinases (MAPKs), p38 and extracellular signal-regulated kinase, and also, the transcription factor, nuclear factor (NF)-kappaB, are involved in the up-regulation of COX-2 expression, as specific chemical inhibitors of these two kinases, such as SB203580 and PD098059, and of the NF-kappaB pathway, such as N(alpha)-benzyloxycarbonyl-l-leucyl-l-leucyl-l-leucinal, abolished IgE-dependent COX-2 induction. Evidence is also presented, using Fe(2)(+)/Cu(2)(+) ions, that hydroxyl radicals generated from hydrogen peroxide through Fenton reactions could constitute candidate modulators able to directly trigger anti-IgE-elicited COX-2 expression through MAPK and NF-kappaB pathways. Present results underscore a new role for ROS as second messengers in the modulation of COX-2 expression by human neutrophils in allergic conditions.
2012-01-01
Background Lipoteichoic acid (LTA) is a component of gram-positive bacterial cell walls and may be elevated in the cerebrospinal fluid of patients suffering from meningitis. Among matrix metalloproteinases (MMPs), MMP-9 has been observed in patients with brain inflammatory diseases and may contribute to the pathology of brain diseases. Moreover, several studies have suggested that increased oxidative stress is implicated in the pathogenesis of brain inflammation and injury. However, the molecular mechanisms underlying LTA-induced redox signal and MMP-9 expression in brain astrocytes remain unclear. Objective Herein we explored whether LTA-induced MMP-9 expression was mediated through redox signals in rat brain astrocytes (RBA-1 cells). Methods Upregulation of MMP-9 by LTA was evaluated by zymographic and RT-PCR analyses. Next, the MMP-9 regulatory pathways were investigated by pretreatment with pharmacological inhibitors or transfection with small interfering RNAs (siRNAs), Western blotting, and chromatin immunoprecipitation (ChIP)-PCR and promoter activity reporter assays. Moreover, we determined the cell functional changes by migration assay. Results These results showed that LTA induced MMP-9 expression via a PKC(α)-dependent pathway. We further demonstrated that PKCα stimulated p47phox/NADPH oxidase 2 (Nox2)-dependent reactive oxygen species (ROS) generation and then activated the ATF2/AP-1 signals. The activated-ATF2 bound to the AP-1-binding site of MMP-9 promoter, and thereby turned on MMP-9 gene transcription. Additionally, the co-activator p300 also contributed to these responses. Functionally, LTA-induced MMP-9 expression enhanced astrocytic migration. Conclusion These results demonstrated that in RBA-1 cells, activation of ATF2/AP-1 by the PKC(α)-mediated Nox(2)/ROS signals is essential for upregulation of MMP-9 and cell migration enhanced by LTA. PMID:22643046
p53 as a retrovirus-induced oxidative stress modulator.
Kim, Soo Jin; Wong, Paul K Y
2015-01-01
Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.
McGowan, Kevin B; Sah, Robert L
2005-05-01
Integrative repair of cartilage was previously found to depend on collagen synthesis and maturation. beta-aminopropionitrile (BAPN) treatment, which irreversibly blocks lysyl oxidase, inhibited the formation of collagen crosslinks, prevented development of adhesive strength, and caused a buildup of GuHCl-extractable collagen crosslink precursors. This buildup of crosslink precursor in the tissue may be useful for enhancing integrative repair. We tested in vitro the hypothesis that pre-treatment of cartilage with BAPN, followed by washout before implantation, could be a useful therapeutic strategy to accelerate subsequent collagen maturation. In individual cartilage disks, collagen processing was reversibly blocked by BAPN treatment (0.1 mM) as indicated by a BAPN-induced increase in the total and proportion of incorporated radiolabel that was extractable by 4M guanidine-HCl, followed by a decrease, within 3-4 days of BAPN washout, in the proportion of extractable radiolabel to control levels. With a similar pattern, integration between pairs of apposed cartilage blocks was reversibly blocked by BAPN treatment, and followed by an enhancement of integration after BAPN washout. The low and high levels of integration were associated with enrichment in [(3)H]proline in a form that was susceptible and resistant, respectively, to extraction. With increasing duration up to 7 days after BAPN pre-treatment, the levels of [(3)H]proline extraction decreased, and the development of adhesive strength increased. Thus, BAPN can be used to modulate integrative cartilage repair.
Cortical metabolic activity matches the pattern of visual suppression in strabismus.
Adams, Daniel L; Economides, John R; Sincich, Lawrence C; Horton, Jonathan C
2013-02-27
When an eye becomes deviated in early childhood, a person does not experience double vision, although the globes are aimed at different targets. The extra image is prevented from reaching perception in subjects with alternating exotropia by suppression of each eye's peripheral temporal retina. To test the impact of visual suppression on neuronal activity in primary (striate) visual cortex, the pattern of cytochrome oxidase (CO) staining was examined in four macaques raised with exotropia by disinserting the medial rectus muscles shortly following birth. No ocular dominance columns were visible in opercular cortex, where the central visual field is represented, indicating that signals coming from the central retina in each eye were perceived. However, the border strips at the edges of ocular dominance columns appeared pale, reflecting a loss of activity in binocular cells from disruption of fusion. In calcarine cortex, where the peripheral visual field is represented, there were alternating pale and dark bands resembling ocular dominance columns. To interpret the CO staining pattern, [(3)H]proline was injected into the right eye in two monkeys. In the right calcarine cortex, the pale CO columns matched the labeled proline columns of the right eye. In the left calcarine cortex, the pale CO columns overlapped the unlabeled columns of the left eye in the autoradiograph. Therefore, metabolic activity was reduced in the ipsilateral eye's ocular dominance columns which serve peripheral temporal retina, in a fashion consistent with the topographic organization of suppression scotomas in humans with exotropia.
Phosphate alleviation of glyphosate-induced toxicity in Hydrocharis dubia (Bl.) Backer.
Zhong, Guidi; Wu, Zhonghua; Liu, Nian; Yin, Jun
2018-05-30
Glyphosate, as a broad-spectrum herbicide, is frequently detected in water, and phosphorus widely enters the water due to the extensive use of phosphorus-containing substances in agriculture, industries and daily life. Thus, aquatic ecosystems are exposed to both glyphosate and phosphorus, which may affect aquatic organisms. In the present research, we studied the physiological responses of the floating aquatic plant species H. dubia to different concentrations of glyphosate (0, 1, 5, 15 mg/L) with different levels of phosphate (0, 50, 100 mg/L) after 14 days (d) of treatment. We explored glyphosate toxicity in H. dubia and investigated whether phosphate addition mitigates glyphosate toxicity in this species, which will provide a theoretical basis for the ecotoxicological study of aquatic plants. The results show that glyphosate significantly reduced the chlorophyll content, leaf number and root length of H. dubia, while it significantly increased the malondialdehyde (MDA), hydrogen peroxide (H 2 O 2 ), shikimate, proline, and soluble protein content and enzyme activities (superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (POD), ascorbate peroxidase (APX) and polyphenol oxidase (PPO)) in H. dubia. After phosphate supplement, the MDA, H 2 O 2 , proline, and soluble protein contents and enzyme activities in the plants treated with glyphosate decreased. These results indicate that the concentration of glyphosate investigated in our study can cause oxidative stress and affect the growth of H. dubia. Phosphate can alleviate glyphosate-induced oxidative stress in H. dubia. Copyright © 2018 Elsevier B.V. All rights reserved.
Martin, Natalia; Patel, Satyakam; Segre, Julia A.
2004-01-01
Mammalian epidermis provides a permeability barrier between an organism and its environment. Under homeostatic conditions, epidermal cells produce structural proteins, which are cross-linked in an orderly fashion to form a cornified envelope (CE). However, under genetic or environmental stress, specific genes are induced to rapidly build a temporary barrier. Small proline-rich (SPRR) proteins are the primary constituents of the CE. Under stress the entire family of 14 Sprr genes is upregulated. The Sprr genes are clustered within the larger epidermal differentiation complex on mouse chromosome 3, human chromosome 1q21. The clustering of the Sprr genes and their upregulation under stress suggest that these genes may be coordinately regulated. To identify enhancer elements that regulate this stress response activation of the Sprr locus, we utilized bioinformatic tools and classical biochemical dissection. Long-range comparative sequence analysis identified conserved noncoding sequences (CNSs). Clusters of epidermal-specific DNaseI-hypersensitive sites (HSs) mapped to specific CNSs. Increased prevalence of these HSs in barrier-deficient epidermis provides in vivo evidence of the regulation of the Sprr locus by these conserved sequences. Individual components of these HSs were cloned, and one was shown to have strong enhancer activity specific to conditions when the Sprr genes are coordinately upregulated. PMID:15574822
Baker, J L; Derr, A M; Karuppaiah, K; MacGilvray, M E; Kajfasz, J K; Faustoferri, R C; Rivera-Ramos, I; Bitoun, J P; Lemos, J A; Wen, Z T; Quivey, R G
2014-06-01
NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD(+). The critical nature of Nox is 2-fold: it serves to regenerate NAD(+), a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD(+) have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD(+) affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Wu, Ying-Hui; Fischer, David F; Swaab, Dick F
2007-09-05
Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
Implication of NADPH Oxidases in the Early Inflammation Process Generated by Cystic Fibrosis Cells
Pongnimitprasert, Nushjira; Hurtado, Margarita; Lamari, Foudil; El Benna, Jamel; Dupuy, Corinne; Fay, Michèle; Foglietti, Marie-José; Bernard, Maguy; Gougerot-Pocidalo, Marie-Anne; Braut-Boucher, Françoise
2012-01-01
In cystic fibrosis (CF) patients, pulmonary inflammation is a major cause of morbidity and mortality. The aim of this study was to further investigate whether oxidative stress could be involved in the early inflammatory process associated with CF pathogenesis. We used a model of CFTR defective epithelial cell line (IB3-1) and its reconstituted CFTR control (S9) cell line cultured in various ionic conditions. This study showed that IB3-1 and S9 cells expressed the NADPH oxidases (NOXs) DUOX1/2 and NOX2 at the same level. Nevertheless, several parameters participating in oxidative stress (increased ROS production and apoptosis, decreased total thiol content) were observed in IB3-1 cells cultured in hypertonic environment as compared to S9 cells and were inhibited by diphenyleneiodonium (DPI), a well-known inhibitor of NOXs; besides, increased production of the proinflammatory cytokines IL-6 and IL-8 by IB3-1 cells was also inhibited by DPI as compared to S9 cells. Furthermore, calcium ionophore (A23187), which upregulates DUOX and NOX2 activities, strongly induced oxidative stress and IL-8 and IL-6 overexpression in IB3-1 cells. All these events were suppressed by DPI, supporting the involvement of NOXs in the oxidative stress, which can upregulate proinflammatory cytokine production by the airway CFTR-deficient cells and trigger early pulmonary inflammation in CF patients. PMID:24049649
Wang, Xinlong; Tian, Fenghua; Soni, Sagar S.; Gonzalez-Lima, F.; Liu, Hanli
2016-01-01
Photobiomodulation, also known as low-level laser/light therapy (LLLT), refers to the use of red-to-near-infrared light to stimulate cellular functions for physiological or clinical benefits. The mechanism of LLLT is assumed to rely on photon absorption by cytochrome c oxidase (CCO), the terminal enzyme in the mitochondrial respiratory chain that catalyzes the reduction of oxygen for energy metabolism. In this study, we used broadband near-infrared spectroscopy (NIRS) to measure the LLLT-induced changes in CCO and hemoglobin concentrations in human forearms in vivo. Eleven healthy participants were administered with 1064-nm laser and placebo treatments on their right forearms. The spectroscopic data were analyzed and fitted with wavelength-dependent, modified Beer-Lambert Law. We found that LLLT induced significant increases of CCO concentration (Δ[CCO]) and oxygenated hemoglobin concentration (Δ[HbO]) on the treated site as the laser energy dose accumulated over time. A strong linear interplay between Δ[CCO] and Δ[HbO] was observed for the first time during LLLT, indicating a hemodynamic response of oxygen supply and blood volume closely coupled to the up-regulation of CCO induced by photobiomodulation. These results demonstrate the tremendous potential of broadband NIRS as a non-invasive, in vivo means to study mechanisms of photobiomodulation and perform treatment evaluations of LLLT. PMID:27484673
NASA Astrophysics Data System (ADS)
Wang, Xinlong; Tian, Fenghua; Soni, Sagar S.; Gonzalez-Lima, F.; Liu, Hanli
2016-08-01
Photobiomodulation, also known as low-level laser/light therapy (LLLT), refers to the use of red-to-near-infrared light to stimulate cellular functions for physiological or clinical benefits. The mechanism of LLLT is assumed to rely on photon absorption by cytochrome c oxidase (CCO), the terminal enzyme in the mitochondrial respiratory chain that catalyzes the reduction of oxygen for energy metabolism. In this study, we used broadband near-infrared spectroscopy (NIRS) to measure the LLLT-induced changes in CCO and hemoglobin concentrations in human forearms in vivo. Eleven healthy participants were administered with 1064-nm laser and placebo treatments on their right forearms. The spectroscopic data were analyzed and fitted with wavelength-dependent, modified Beer-Lambert Law. We found that LLLT induced significant increases of CCO concentration (Δ[CCO]) and oxygenated hemoglobin concentration (Δ[HbO]) on the treated site as the laser energy dose accumulated over time. A strong linear interplay between Δ[CCO] and Δ[HbO] was observed for the first time during LLLT, indicating a hemodynamic response of oxygen supply and blood volume closely coupled to the up-regulation of CCO induced by photobiomodulation. These results demonstrate the tremendous potential of broadband NIRS as a non-invasive, in vivo means to study mechanisms of photobiomodulation and perform treatment evaluations of LLLT.
Wang, Xinlong; Tian, Fenghua; Soni, Sagar S; Gonzalez-Lima, F; Liu, Hanli
2016-08-03
Photobiomodulation, also known as low-level laser/light therapy (LLLT), refers to the use of red-to-near-infrared light to stimulate cellular functions for physiological or clinical benefits. The mechanism of LLLT is assumed to rely on photon absorption by cytochrome c oxidase (CCO), the terminal enzyme in the mitochondrial respiratory chain that catalyzes the reduction of oxygen for energy metabolism. In this study, we used broadband near-infrared spectroscopy (NIRS) to measure the LLLT-induced changes in CCO and hemoglobin concentrations in human forearms in vivo. Eleven healthy participants were administered with 1064-nm laser and placebo treatments on their right forearms. The spectroscopic data were analyzed and fitted with wavelength-dependent, modified Beer-Lambert Law. We found that LLLT induced significant increases of CCO concentration (Δ[CCO]) and oxygenated hemoglobin concentration (Δ[HbO]) on the treated site as the laser energy dose accumulated over time. A strong linear interplay between Δ[CCO] and Δ[HbO] was observed for the first time during LLLT, indicating a hemodynamic response of oxygen supply and blood volume closely coupled to the up-regulation of CCO induced by photobiomodulation. These results demonstrate the tremendous potential of broadband NIRS as a non-invasive, in vivo means to study mechanisms of photobiomodulation and perform treatment evaluations of LLLT.
Proteomics analysis of Fusarium proliferatum under various initial pH during fumonisin production.
Li, Taotao; Gong, Liang; Wang, Yong; Chen, Feng; Gupta, Vijai Kumar; Jian, Qijie; Duan, Xuewu; Jiang, Yueming
2017-07-05
Fusarium proliferatum as a fungal pathogen can produce fumonisin which causes a great threat to animal and human health. Proteomic approach was a useful tool for investigation into mycotoxin biosynthesis in fungal pathogens. In this study, we analyzed the fumonisin content and mycelium proteins of Fusarium proliferatum cultivated under the initial pH5 and 10. Fumonisin production after 10days was significantly induced in culture condition at pH10 than pH5. Ninety nine significantly differently accumulated protein spots under the two pH conditions were detected using two dimensional polyacrylamide gel electrophoresis and 89 of these proteins were successfully identified by MALDI-TOF/TOF and LC-ESI-MS/MS analysis. Among these 89 proteins, 45 were up-regulated at pH10 while 44 were up-accumulated at pH5. At pH10, these proteins were found to involve in the modification of fumonisin backbone including up-regulated polyketide synthase, cytochrome P450, S-adenosylmethionine synthase and O-methyltransferase, which might contribute to the induction of fumonisin production. At pH5, these up-regulated proteins such as l-amino-acid oxidase, isocitrate dehydrogenase and citrate lyase might inhibit the condensation of fumonisin backbone, resulting in reduced production of fumonisins. These results may help us to understand the molecular mechanism of the fumonisin synthesis in F. proliferatum. To extend our understanding of the mechanism of the fumonisin biosynthesis of F. proliferatum, we reported the fumonisin production in relation to the differential proteins of F. proliferatum mycelium under two pH culture conditions. Among these 89 identified spots, 45 were up-accumulated at pH10 while 44 were up-accumulated at pH5. Our results revealed that increased fumonisin production at pH10 might be related to the induction of fumonisin biosynthesis caused by up-regulation of polyketide synthase, cytochrome P450, S-adenosylmethionine synthase and O-methyltransferase. Meanwhile, the up-regulation of l-amino-acid oxidase, isocitrate dehydrogenase and citrate lyase at pH5 might be related to the inhibition of the condensation of fumonisin backbone, resulting in reduced production of fumonisin. These results may help us to understand better the molecular mechanism of the fumonisin synthesis in F. proliferatum and then broaden the current knowledge of the mechanism of the fumonisin biosynthesis. Copyright © 2017 Elsevier B.V. All rights reserved.
Yu, Zhaoxiao; Zhang, Chenhui; Zhou, Mingliang; Li, Qiming; Li, Hui; Duan, Wei; Li, Xue; Feng, Yonghong; Xie, Jianping
2017-09-01
Tuberculosis (TB), caused by Mycobacterium tuberculosis, remains a formidable threat to global public health. The successful intracellular persistence of M. tuberculosis significantly contributes to the intractability of tuberculosis. Proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) are mycobacterial exclusive protein families that widely reported to be involved in the bacterial virulence, physiology and interaction with host. Rv2770c (PPE44), a predicted virulence factor, was up-regulated upon the infected guinea pig lungs. To investigate the role of Rv2770c, we heterologously expressed the PPE44 in the nonpathogenic fast-growing M. smegmatis strain. Subcellular location analysis demonstrated that Rv2770c is a cell wall associated protein, suggestive of a potential candidate involved in host-pathogen interaction. The Rv2770c can enhance M. smegmatis survival within macrophages and under stresses such as H 2 O 2 , SDS, diamide exposure, and low pH condition. M. smegmatis expressing Rv2770c is more virulent as testified by the increased death of macrophages and the increased expression of interlukin-6 (IL-6) and interlukin-12p40 (IL-12p40). Moreover, Rv2770c altered the secretion of IL-6 and IL-12p40 of macrophages via NF-κB, ERK1/2 and p38 MAPK axis. Taken together, this study implicated that Rv2770c was a virulent factor actively engaged in the interaction with host macrophage. Copyright © 2017. Published by Elsevier B.V.
Xue, Beibei; Zhang, Aying; Jiang, Mingyi
2009-03-01
Using pharmacological and biochemical approaches, the role of maize polyamine oxidase (MPAO) in abscisic acid (ABA)-induced antioxidant defense in leaves of maize (Zea mays L.) plants was investigated. Exogenous ABA treatment enhanced the expression of the MPAO gene and the activities of apoplastic MPAO. Pretreatment with two different inhibitors for apoplastic MPAO partly reduced hydrogen peroxide (H2O2) accumulation induced by ABA and blocked the ABA-induced expression of the antioxidant genes superoxide dismutase 4 and cytosolic ascorbate peroxidase and the activities of the cytosolic antioxidant enzymes. Treatment with spermidine, the optimum substrate of MPAO, also induced the expression and the activities of the antioxidant enzymes, and the upregulation of the antioxidant enzymes was prevented by two inhibitors of MPAO and two scavengers of H2O2. These results suggest that MPAO contributes to ABA-induced cytosolic antioxidant defense through H2O2, a Spd catabolic product.
Shah, Anu; Xia, Ling; Goldberg, Howard; Lee, Ken W.; Quaggin, Susan E.; Fantus, I. George
2013-01-01
Thioredoxin-interacting protein (TxNIP) is up-regulated by high glucose and is associated with oxidative stress. It has been implicated in hyperglycemia-induced β-cell dysfunction and apoptosis. As high glucose and oxidative stress mediate diabetic nephropathy (DN), the contribution of TxNIP was investigated in renal mesangial cell reactive oxygen species (ROS) generation and collagen synthesis. To determine the role of TxNIP, mouse mesangial cells (MC) cultured from wild-type C3H and TxNIP-deficient Hcb-19 mice were incubated in HG. Confocal microscopy was used to measure total and mitochondrial ROS production (DCF and MitoSOX) and collagen IV. Trx and NADPH oxidase activities were assayed and NADPH oxidase isoforms, Nox2 and Nox4, and antioxidant enzymes were determined by immunoblotting. C3H MC exposed to HG elicited a significant increase in cellular and mitochondrial ROS as well as Nox4 protein expression and NADPH oxidase activation, whereas Hcb-19 MC showed no response. Trx activity was attenuated by HG only in C3H MC. These defects in Hcb-19 MC were not due to increased antioxidant enzymes or scavenging of ROS, but associated with decreased ROS generation. Adenovirus-mediated overexpression of TxNIP in Hcb-19 MC and TxNIP knockdown with siRNA in C3H confirmed the specific role of TxNIP. Collagen IV accumulation in HG was markedly reduced in Hcb-19 cells. TxNIP is a critical component of the HG-ROS signaling pathway, required for the induction of mitochondrial and total cell ROS and the NADPH oxidase isoform, Nox4. TxNIP is a potential target to prevent DN. PMID:23329835
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Bai, Yong-Ping; Hu, Chang-Ping; Yuan, Qiong; Peng, Jun; Shi, Rui-Zheng; Yang, Tian-Lun; Cao, Ze-Hong; Li, Yuan-Jian; Cheng, Guangjie; Zhang, Guo-Gang
2013-01-01
Myeloperoxidase (MPO) is an important enzyme involved in the genesis and development of atherosclerosis. Vascular peroxidase 1 (VPO1) is a newly discovered member of the peroxidase family that is mainly expressed in vascular endothelial cells and smooth muscle cells and has structural characteristics and biological activity similar to those of MPO. Our specific aims were to explore the effects of VPO1 on endothelial cell apoptosis induced by oxidized low-density lipoprotein (ox-LDL) and the underlying mechanisms. The results showed that ox-LDL induced endothelial cell apoptosis and the expression of VPO1 in endothelial cells in a concentration- and time-dependent manner concomitant with increased intracellular reactive oxygen species (ROS) and hypochlorous acid (HOCl) generation, and up-regulated protein expression of the NADPH oxidase gp91phox subunit and phosphorylation of p38 MAPK. All these effects of ox-LDL were inhibited by VPO1 gene silencing and NADPH oxidase gp91phox subunit gene silencing or by pretreatment with the NADPH oxidase inhibitor apocynin or diphenyliodonium. The p38 MAPK inhibitor SB203580 or the caspase-3 inhibitor DEVD-CHO significantly inhibited ox-LDL-induced endothelial cell apoptosis, but had no effect on intracellular ROS and HOCl generation or the expression of NADPH oxidase gp91phox subunit or VPO1. Collectively, these findings suggest for the first time that VPO1 plays a critical role in ox-LDL-induced endothelial cell apoptosis and that there is a positive feedback loop between VPO1/HOCl and the now-accepted dogma that the NADPH oxidase/ROS/p38 MAPK/caspase-3 pathway is involved in ox-LDL-induced endothelial cell apoptosis. PMID:21820048
Morgan, Alexander A.; Rubenstein, Edward
2013-01-01
Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex. PMID:23372670
Proline puckering parameters for collagen structure simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Di, E-mail: diwu@fudan.edu.cn
Collagen is made of triple helices rich in proline residues, and hence is influenced by the conformational motions of prolines. Because the backbone motions of prolines are restricted by the helical structures, the only side chain motion—proline puckering—becomes an influential factor that may affect the stability of collagen structures. In molecular simulations, a proper proline puckering population is desired so to yield valid results of the collagen properties. Here we design the proline puckering parameters in order to yield suitable proline puckering populations as demonstrated in the experimental results. We test these parameters in collagen and the proline dipeptide simulations.more » Compared with the results of the PDB and the quantum calculations, we propose the proline puckering parameters for the selected collagen model simulations.« less
Pörn, M I; Slotte, J P
1990-01-01
Plasma-membrane sphingomyelin appears to be one of the major determinants of the preferential allocation of cell cholesterol into the plasma-membrane compartment, since removal of sphingomyelin leads to a dramatic redistribution of cholesterol within the cell [Slotte & Bierman (1988) Biochem. J. 250, 653-658]. In the present study we examined the long-term effects of sphingomyelin degradation on cholesterol redistribution in cells and determined the reversibility of the process. In a human lung fibroblast-cell line, removal of 80% of the sphingomyelin led to a rapid and transient up-regulation (3-fold) of acyl-CoA:cholesterol acyltransferase (ACAT) activity, and also, within 30 h, to the translocation of about 50% of the cell non-esterified cholesterol from a cholesterol oxidase-susceptible compartment (i.e. the cell surface) to oxidase-resistant compartments. At 49 h after the initial sphingomyelin degradation, the cell sphingomyelin level was back to 45% of the control level, and the direction of cell cholesterol flow was toward the cell surface, although the original distribution was not achieved. In a transformed neuroblastoma cell line (SH-SY5Y), the depletion of sphingomyelin led to a similarly rapid and transient up-regulation of ACAT activity, and to the translocation of about 25% of cell-surface cholesterol into internal membranes (within 3 h). The flow of cholesterol back to the cholesterol oxidase-susceptible pool was rapid, and a pretreatment cholesterol distribution was reached within 20-49 h. Also, the resynthesis of sphingomyelin was faster in SH-SY5Y neuroblastoma cells and reached control levels within 24 h. The findings of the present study show that the cellular redistribution of cholesterol, as induced by sphingomyelin degradation, is reversible and suggest that the normalization of cellular cholesterol distribution is linked to the re-synthesis of sphingomyelin. PMID:2222406
Proline: Mother Nature’s cryoprotectant applied to protein crystallography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.
The amino acid l-proline is shown to be a good cryoprotectant for protein crystals. Four examples are provided; the range of proline used for cryoprotection is 2.0–3.0 M. l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included themore » commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography.« less
Servillo, Luigi; Giovane, Alfonso; Balestrieri, Maria Luisa; Cautela, Domenico; Castaldo, Domenico
2011-01-12
The content of proline and various compounds deriving from its metabolism (4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine) was determined in fruits and seeds of Bergamot (Citrus bergamia Risso et Poit), growing in the Calabria region (South Italy). A HPLC-ESI-tandem mass spectrometry method, which allowed rapid determination of L-proline, 4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine in juice and extracts of bergamot fruit with minimum sample preparation and short analysis time (about 10 min), is presented. Proline and 4-hydroxy-L-proline levels in the samples were also determined by HPLC analysis with fluorescence detection and the results compared to those obtained with HPLC-ESI-tandem mass spectrometry. For the first time, the presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine in the fruits of a plant of the Citrus genus is reported.
Proline: Mother Nature;s cryoprotectant applied to protein crystallography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.
L-Proline is one of Mother Nature's cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that L-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6-8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration neededmore » for cryoprotection of these crystals is in the range 2.0-3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that L-proline is an effective cryoprotectant for protein crystallography.« less
Proline: Mother Nature’s cryoprotectant applied to protein crystallography
Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.
2012-01-01
l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography. PMID:22868767
The Sodium/Proline Transporter PutP of Helicobacter pylori
Rivera-Ordaz, Araceli; Bracher, Susanne; Sarrach, Sannia; Li, Zheng; Shi, Lei; Quick, Matthias; Hilger, Daniel; Haas, Rainer; Jung, Heinrich
2013-01-01
Helicobacter pylori is cause of chronic gastritis, duodenal ulcer and gastric carcinoma in humans. L-proline is a preferred energy source of the microaerophilic bacterium. Previous analyses revealed that HpputP and HpputA, the genes that are predicted to play a central role in proline metabolism as they encode for the proline transporter and proline dehydrogenase, respectively, are essential for stomach colonization. Here, the molecular basis of proline transport in H. pylori by HpPutP was investigated experimentally for the first time. Measuring radiolabeled substrate transport in H. pylori and E. coli heterologously expressing HpputP as well as in proteoliposomes reconstituted with HpPutP, we demonstrate that the observed proline transport in H. pylori is mediated by HpPutP. HpPutP is specific and exhibits a high affinity for L-proline. Notably, L-proline transport is exclusively dependent on Na+ as coupling ion, i.e., Na+/L-proline symport, reminiscent to the properties of PutP of E. coli even though H. pylori lives in a more acidic environment. Homology model-based structural comparisons and substitution analyses identified amino acids crucial for function. HpPutP-catalyzed proline uptake was efficiently inhibited by the known proline analogs 3,4-dehydro-D,L-proline and L-azetidine-2-carboxylic acid. PMID:24358297
Hampel, Annegret; Huber, Claudia; Geffers, Robert; Spona-Friedl, Marina; Eisenreich, Wolfgang; Bange, Franz-Christoph
2015-01-01
Mycobacterium tuberculosis (Mtb) possesses a genetic repertoire for metabolic pathways, which are specific and fit to its intracellular life style. Under in vitro conditions, Mtb is known to use arginine as a nitrogen source, but the metabolic pathways for arginine utilization have not been identified. Here we show that, in the presence of arginine, Mtb upregulates a gene cluster which includes an ornithine aminotransferase (rocD) and Rv2323c, a gene of unknown function. Isotopologue analysis by using 13C- or 15N-arginine revealed that in Mtb arginine is not only used as nitrogen source but also as carbon source for the formation of amino acids, in particular of proline. Surprisingly, rocD, which is widespread in other bacteria and is part of the classical arginase pathway turned out to be naturally deleted in Mtb, but not in non-tuberculous mycobacteria. Mtb lacking Rv2323c showed a growth defect on arginine, did not produce proline from arginine, and incorporated less nitrogen derived from arginine in its core nitrogen metabolism. We conclude that the highly induced pathway for arginine utilization in Mtb differs from that of other bacteria including non-tuberculous mycobacteria, probably reflecting a specific metabolic feature of intracellular Mtb. PMID:26368558
The puckering free-energy surface of proline
NASA Astrophysics Data System (ADS)
Wu, Di
2013-03-01
Proline has two preferred puckering states, which are often characterized by the pseudorotation phase angle and amplitude. Although proline's five endocyclic torsion angles can be utilized to calculate the phase angle and amplitude, it is not clear if there is any direct correlation between each torsion angle and the proline-puckering pathway. Here we have designed five proline puckering pathways utilizing each torsion angle χj (j = 1˜5) as the reaction coordinate. By examining the free-energy surfaces of the five puckering pathways, we find they can be categorized into two groups. The χ2 pathway (χ2 is about the Cβ—Cγ bond) is especially meaningful in describing proline puckering: it changes linearly with the puckering amplitude and symmetrically with the phase angle. Our results show that this conclusion applies to both trans and cis proline conformations. We have also analyzed the correlations of proline puckering and its backbone torsion angles ϕ and ψ. We show proline has preferred puckering states at the specific regions of ϕ, ψ angles. Interestingly, the shapes of ψ-χ2 free-energy surfaces are similar among the trans proline in water, cis proline in water and cis proline in the gas phase, but they differ substantially from that of the trans proline in the gas phase. Our calculations are conducted using molecular simulations; we also verify our results using the proline conformations selected from the Protein Data Bank. In addition, we have compared our results with those calculated by the quantum mechanical methods.
Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi
2013-02-01
Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.
2012-01-01
Background Matrix metalloproteinase-9 (MMP-9) plays a crucial role in pathological processes of brain inflammation, injury, and neurodegeneration. Moreover, bradykinin (BK) induces the expression of several inflammatory proteins in brain astrocytes. Recent studies have suggested that increased oxidative stress is implicated in the brain inflammation and injury. However, whether BK induced MMP-9 expression mediated through oxidative stress remains virtually unknown. Herein we investigated the role of redox signals in BK-induced MMP-9 expression in rat brain astrocytes (RBA-1 cells). Results In the study, we first demonstrated that reactive oxygen species (ROS) plays a crucial role in BK-induced MMP-9 expression in cultured brain astrocytes (in vitro) and animal brain tissue (in vivo) models. Next, BK-induced MMP-9 expression is mediated through a Ca2+-mediated PKC-α linking to p47phox/NADPH oxidase 2 (Nox2)/ROS signaling pathway. Nox2-dependent ROS generation led to activation and up-regulation of the downstream transcriptional factor AP-1 (i.e. c-Fos and c-Jun), which bound to MMP-9 promoter region, and thereby turned on transcription of MMP-9 gene. Functionally, BK-induced MMP-9 expression enhanced astrocytic migration. Conclusions These results demonstrated that in RBA-1 cells, activation of AP-1 (c-Fos/c-Jun) by the PKC-α-mediated Nox2/ROS signals is essential for up-regulation of MMP-9 and cell migration enhanced by BK. PMID:23176293
Falcioni, Francesco; Blank, Lars M.; Frick, Oliver; Karau, Andreas; Schmid, Andreas
2013-01-01
Microbial physiology plays a crucial role in whole-cell biotransformation, especially for redox reactions that depend on carbon and energy metabolism. In this study, regio- and enantio-selective proline hydroxylation with recombinant Escherichia coli expressing proline-4-hydroxylase (P4H) was investigated with respect to its interconnectivity to microbial physiology and metabolism. P4H production was found to depend on extracellular proline availability and on codon usage. Medium supplementation with proline did not alter p4h mRNA levels, indicating that P4H production depends on the availability of charged prolyl-tRNAs. Increasing the intracellular levels of soluble P4H did not result in an increase in resting cell activities above a certain threshold (depending on growth and assay temperature). Activities up to 5-fold higher were reached with permeabilized cells, confirming that host physiology and not the intracellular level of active P4H determines the achievable whole-cell proline hydroxylation activity. Metabolic flux analysis revealed that tricarboxylic acid cycle fluxes in growing biocatalytically active cells were significantly higher than proline hydroxylation rates. Remarkably, a catalysis-induced reduction of substrate uptake was observed, which correlated with reduced transcription of putA and putP, encoding proline dehydrogenase and the major proline transporter, respectively. These results provide evidence for a strong interference of catalytic activity with the regulation of proline uptake and metabolism. In terms of whole-cell biocatalyst efficiency, proline uptake and competition of P4H with proline catabolism are considered the most critical factors. PMID:23455348
A rapid, ideal, and eco-friendlier protocol for quantifying proline.
Shabnam, Nisha; Tripathi, Indu; Sharmila, P; Pardha-Saradhi, P
2016-11-01
Proline, a stress marker, is routinely quantified by a protocol that essentially uses hazardous toluene. Negative impacts of toluene on human health prompted us to develop a reliable alternate protocol for proline quantification. Absorbance of the proline-ninhydrin condensation product formed by reaction of proline with ninhydrin at 100 °C in the reaction mixture was significantly higher than that recorded after its transfer to toluene, revealing that toluene lowers sensitivity of this assay. λ max of the proline-ninhydrin complex in the reaction mixture and toluene were 508 and 513 nm, respectively. Ninhydrin in glacial acetic acid yielded higher quantity of the proline-ninhydrin condensation product compared to ninhydrin in mixture of glacial acetic acid and H 3 PO 4 , indicating negative impact of H 3 PO 4 on proline quantification. Further, maximum yield of the proline-ninhydrin complex with ninhydrin in glacial acetic acid and ninhydrin in mixture of glacial acetic acid and H 3 PO 4 was achieved within 30 and 60 min, respectively. This revealed that H 3 PO 4 has negative impact on the reaction rate and quantity of the proline-ninhydrin complex formed. In brief, our proline quantification protocol involves reaction of a 1-ml proline sample with 2 ml of 1.25 % ninhydrin in glacial acetic acid at 100 °C for 30 min, followed by recording absorbance of the proline-ninhydrin condensation product in the reaction mixture itself at 508 nm. Amongst proline quantification protocols known till date, our protocol is the most simple, rapid, reliable, cost-effective, and eco-friendlier.
Kong, Yingying; Wang, Ting; Wang, Rong; Ma, Yichuan; Song, Shanshan; Liu, Juan; Hu, Weiwei; Li, Shengtian
2017-06-01
The idea of aromatherapy, using essential oils, has been considered as an alternative antidepressant treatment. In the present study, we investigated the effect of Roman chamomile essential oil inhalation for two weeks on depressive-like behaviors in Wistar-Kyoto (WKY) rats. We found that inhalation of either Roman chamomile or one of its main components α-pinene, attenuated depressive-like behavior in WKY rats in the forced swim test. Using isobaric tags for relative and absolute quantitation analysis (iTRAQ), we found that inhalation of α-pinene increased expression of proteins that are involved in oxidative phosphorylation, such as cytochrome c oxidase subunit 6C-2, cytochrome c oxidase subunit 7A2, ATPase inhibitor in the hippocampus, and cytochrome c oxidase subunit 6C-2, ATP synthase subunit e, Acyl carrier protein, and Cytochrome b-c1 complex subunit 6 in the PFC (prefrontal cortex). In addition, using the quantitative real-time polymerase chain reaction technique, we confirmed an increase of parvalbumin mRNA expression in the hippocampus, which was shown to be upregulated by 2.8-fold in iTRAQ analysis, in α-pinene treated WKY rats. These findings collectively suggest the involvement of mitochondrial functions and parvalbumin-related signaling in the antidepressant effect of α-pinene inhalation.
Huang, Yongqi; Gao, Meng; Su, Zhengding
2018-02-01
Three-dimensional (3D) domain swapping is a mechanism to form protein oligomers. It has been proposed that several factors, including proline residues in the hinge region, may affect the occurrence of 3D domain swapping. Although introducing prolines into the hinge region has been found to promote domain swapping for some proteins, the opposite effect has also been observed in several studies. So far, how proline affects 3D domain swapping remains elusive. In this work, based on a large set of 3D domain-swapped structures, we performed a systematic analysis to explore the correlation between the presence of proline in the hinge region and the occurrence of 3D domain swapping. We further analyzed the conformations of proline and pre-proline residues to investigate the roles of proline in 3D domain swapping. We found that more than 40% of the domain-swapped structures contained proline residues in the hinge region. Unexpectedly, conformational transitions of proline residues were rarely observed upon domain swapping. Our analyses showed that hinge regions containing proline residues preferred more extended conformations, which may be beneficial for the occurrence of domain swapping by facilitating opening of the exchanged segments.
Clelland, C L; Drouet, V; Rilett, K C; Smeed, J A; Nadrich, R H; Rajparia, A; Read, L L; Clelland, J D
2016-09-13
Elevated peripheral proline is associated with psychiatric disorders, and there is evidence that proline is a neuromodulator. The proline dehydrogenase (PRODH) gene, which encodes the enzyme that catalyzes proline catabolism, maps to human chromosome 22q11.2, a region conferring risk of schizophrenia. In the Prodh-null mouse, an interaction between elevated peripheral proline and another 22q11.2 gene, catechol-O-methyltransferase (COMT), on neurotransmission and behavior has been reported. We explored the relationship between fasting plasma proline levels and COMT Val(158)Met genotype on symptoms (positive, negative and total) in schizophrenia patients. In an exploratory study we also examined symptom change in patients with bipolar disorder. There was a significant interaction between peripheral proline and COMT on negative symptoms in schizophrenia (P<0.0001, n=95). In COMT Val/Val patients, high proline was associated with low Scale for the Assessment of Negative Symptom (SANS) scores. In contrast, high proline was associated with high SANS scores in patients carrying a Met allele. The relationship between proline and COMT also appears to modify negative symptoms across psychiatric illness. In bipolar disorder, a significant interaction was also observed on negative-symptom change (P=0.007, n=43). Negative symptoms are intractable and largely unaddressed by current medications. These data indicate a significant interaction between peripheral proline and COMT genotype, influencing negative symptoms in schizophrenia and bipolar disorder. That high proline has converse effects on symptoms by COMT genotype, may have implications for therapeutic decisions.
Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold; Davies, Kelvin Paul
2009-10-01
Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism.
Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold
2009-01-01
Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism. PMID:19657052
Varona, Saray; García-Redondo, Ana B; Martínez-González, Jose; Salaices, Mercedes; Briones, Ana M; Rodríguez, Cristina
Lysyl oxidase (LOX) participates in the assembly of collagen and elastin fibres. The impact of vascular LOX over-expression on extracellular matrix (ECM) structure and its contribution to oxidative stress has been analysed. Studies were conducted on mice over-expressing LOX (Tg), specifically in smooth muscle cells (VSMC). Gene expression was assessed by real-time PCR analysis. Sirius Red staining, H 2 O 2 production and NADPH oxidase activity were analysed in different vascular beds. The size and number of fenestra of the internal elastic lamina were determined by confocal microscopy. LOX activity was up-regulated in VSMC of transgenic mice compared with cells from control animals. At the same time, transgenic cells deposited more organised elastin fibres and their supernatants induced a stronger collagen assembly in in vitro assays. Vascular collagen cross-linking was also higher in Tg mice, which showed a decrease in the size of fenestrae and an enhanced expression of Fibulin-5. Interestingly, higher H 2 O 2 production and NADPH oxidase activity was detected in the vascular wall from transgenic mice. The H 2 O 2 scavenger catalase attenuated the stronger deposition of mature elastin fibres induced by LOX transgenesis. LOX over-expression in VSMC was associated with a change in the structure of collagen and elastin fibres. LOX could constitute a novel source of oxidative stress that might participate in elastin changes and contribute to vascular remodelling. Copyright © 2017 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.
Teklić, Tihana; Spoljarević, Marija; Stanisavljević, Aleksandar; Lisjak, Miroslav; Vinković, Tomislav; Parađiković, Nada; Andrić, Luka; Hancock, John T
2010-01-01
A method which is widely accepted for the analysis of free proline content in plant tissues is based on the use of 3% sulfosalicylic acid as an extractant, followed by spectrophotometric quantification of a proline-ninhydrin complex in toluene. However, sample preparation and storage may influence the proline actually measured. This may give misleading or difficult to compare data. To evaluate free proline levels fresh and frozen strawberry (Fragaria × ananassa Duch.) leaves and soybean [Glycine max (L.) Merr.] hypocotyl tissues were used. These were ground with or without liquid nitrogen and proline extracted with sulfosalicylic acid. A particular focus was the influence of plant sample cold storage duration (1, 4 and 12 weeks at -20°C) on tissue proline levels measured. The free proline content analyses, carried out in leaves of Fragaria × ananassa Duch. as well as in hypocotyls of Glycine max (L.) Merr., showed a significant influence of the sample preparation method and cold storage period. Long-term storage of up to 12 weeks at -20°C led to a significant increase in the measured proline in all samples analysed. The observed changes in proline content in plant tissue samples stored at -20°C indicate the likelihood of the over-estimation of the proline content if the proline analyses are delayed. Plant sample processing and cold storage duration seem to have an important influence on results of proline analyses. Therefore it is recommended that samples should be ground fresh and analysed immediately. Copyright © 2010 John Wiley & Sons, Ltd.
Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren
2015-01-01
Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054
Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji
2017-03-15
The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.
Takagi, Hiroshi
2008-11-01
Proline is an important amino acid in terms of its biological functions and biotechnological applications. In response to osmotic stress, proline is accumulated in many bacterial and plant cells as an osmoprotectant. However, it has been shown that proline levels are not increased under various stress conditions in the yeast Saccharomyces cerevisiae cells. Proline is believed to serve multiple functions in vitro such as protein and membrane stabilization, lowering the T (m) of DNA, and scavenging of reactive oxygen species, but the mechanisms of these functions in vivo are poorly understood. Yeast cells biosynthesize proline from glutamate in the cytoplasm via the same pathway found in bacteria and plants and also convert excess proline to glutamate in the mitochondria. Based on the fact that proline has stress-protective activity, S. cerevisiae cells that accumulate proline were constructed by disrupting the PUT1 gene involved in the degradation pathway and by expressing the mutant PRO1 gene encoding the feedback inhibition-less sensitive gamma-glutamate kinase to enhance the biosynthetic activity. The engineered yeast strains successfully showed enhanced tolerance to many stresses, including freezing, desiccation, oxidation, and ethanol. However, the appropriate cellular level and localization of proline play pivotal roles in the stress-protective effect. These results indicate that the increased stress protection is observed in yeast cells under the artificial condition of proline accumulation. Proline is expected to contribute to yeast-based industries by improving the production of frozen dough and alcoholic beverages or breakthroughs in bioethanol production.
Barbieri, Giancarlo; Vallone, Simona; Orsini, Francesco; Paradiso, Roberta; De Pascale, Stefania; Negre-Zakharov, Florence; Maggio, Albino
2012-11-15
Increasing salinity tolerance and water-use efficiency in crop plants are two major challenges that agriculture must face in the next decades. Many physiological mechanisms and molecular components mediating crop response to environmental stresses have been identified. However, the functional inter-links between stress adaptation responses have not been completely understood. Using two basil cultivars (Napoletano and Genovese) with contrasting ability to respond to salt stress, here we demonstrate that reduced stomatal density, high ascorbate level and polyphenol oxidase (PPO) activity coordinately contribute to improve basil adaptation and water use efficiency (WUE) in saline environment. The constitutively reduced stomatal density was associated with a "delayed" accumulation of stress molecules (and growth inhibiting signals) such as abscisic acid (ABA) and proline, in the more tolerant Genovese. Leaf volatile profiling also revealed cultivar-specific patterns, which may suggest a role for the volatile phenylpropanoid eugenol and monoterpenes in conferring stress tolerance via antioxidant and signalling functions. Copyright © 2012 Elsevier GmbH. All rights reserved.
Zou, Ying-Ning; Wu, Qiang-Sheng; Huang, Yong-Ming; Ni, Qiu-Dan; He, Xin-Hua
2013-01-01
Proline accumulation was often correlated with drought tolerance of plants infected by arbuscular mycorrhizal fungi (AMF), whereas lower proline in some AM plants including citrus was also found under drought stress and the relevant mechanisms have not been fully elaborated. In this study proline accumulation and activity of key enzymes relative to proline biosynthesis (▵1-pyrroline-5-carboxylate synthetase, P5CS; ornithine-δ-aminotransferase, OAT) and degradation (proline dehydrogenase, ProDH) were determined in trifoliate orange (Poncirus trifoliata, a widely used citrus rootstock) inoculated with or without Funneliformis mosseae and under well-watered (WW) or water deficit (WD). AMF colonization significantly increased plant height, stem diameter, leaf number, root volume, biomass production of both leaves and roots and leaf relative water content, irrespectively of water status. Water deficit induced more tissue proline accumulation, in company with an increase of P5CS activity, but a decrease of OAT and ProDH activity, no matter whether under AM or no-AM. Compared with no-AM treatment, AM treatment resulted in lower proline concentration and content in leaf, root, and total plant under both WW and WD. The AMF colonization significantly decreased the activity of both P5CS and OAT in leaf, root, and total plant under WW and WD, except for an insignificant difference of root OAT under WD. The AMF inoculation also generally increased tissue ProDH activity under WW and WD. Plant proline content significantly positively correlated with plant P5CS activity, negatively with plant ProDH activity, but not with plant OAT activity. These results suggest that AM plants may suffer less from WD, thereby inducing lower proline accumulation, which derives from the integration of an inhibition of proline synthesis with an enhancement of proline degradation. PMID:24260421
Cooperative Formation of Icosahedral Proline Clusters from Dimers
NASA Astrophysics Data System (ADS)
Jacobs, Alexander D.; Jovan Jose, K. V.; Horness, Rachel; Raghavachari, Krishnan; Thielges, Megan C.; Clemmer, David E.
2018-01-01
Ion mobility spectrometry-mass spectrometry and Fourier transform infrared spectroscopy (FTIR) techniques were combined with quantum chemical calculations to examine the origin of icosahedral clusters of the amino acid proline. When enantiopure proline solutions are electrosprayed (using nanospray) from 100 mM ammonium acetate, only three peaks are observed in the mass spectrum across a concentration range of five orders of magnitude: a monomer [Pro+H]+ species, favored from 0.001 to 0.01 mM proline concentrations; a dimer [2Pro+H]+ species, the most abundant species for proline concentrations above 0.01 mM; and, the dimer and dodecamer [12Pro+2H]2+ for 1.0 mM and more concentrated proline solutions. Electrospraying racemic D/ L-proline solutions from 100 mM ammonium acetate leads to a monomer at low proline concentrations (0.001 to 0.1 mM), and a dimer at higher concentrations (>0.09 mM), as well as a very small population of 8 to 15 Pro clusters that comprise <0.1% of the total ion signals even at the highest proline concentration. Solution FTIR studies show unique features that increase in intensity in the enantiopure proline solutions, consistent with clustering, presumably from the icosahedral geometry in bulk solution. When normalized for the total proline, these results are indicative of a cooperative formation of the enantiopure 12Pro species from 2Pro. [Figure not available: see fulltext.
Shamsir, Mohd S.; Dalby, Andrew R.
2007-01-01
Previous molecular dynamic simulations have reported elongation of the existing β-sheet in prion proteins. Detailed examination has shown that these elongations do not extend beyond the proline residues flanking these β-sheets. In addition, proline has also been suggested to possess a possible structural role in preserving protein interaction sites by preventing invasion of neighboring secondary structures. In this work, we have studied the possible structural role of the flanking proline residues by simulating mutant structures with alternate substitution of the proline residues with valine. Simulations showed a directional inhibition of elongation, with the elongation progressing in the direction of valine including evident inhibition of elongation by existing proline residues. This suggests that the flanking proline residues in prion proteins may have a containment role and would confine the β-sheet within a specific length. PMID:17172295
Sun, Li; Di, Dongwei; Li, Guangjie; Kronzucker, Herbert J; Shi, Weiming
2017-05-01
Ammonium (NH 4 + ) is the predominant nitrogen (N) source in many natural and agricultural ecosystems, including flooded rice fields. While rice is known as an NH 4 + -tolerant species, it nevertheless suffers NH 4 + toxicity at elevated soil concentrations. NH 4 + excess rapidly leads to the disturbance of various physiological processes that ultimately inhibit shoot and root growth. However, the global transcriptomic response to NH 4 + stress in rice has not been examined. In this study, we mapped the spatio-temporal specificity of gene expression profiles in rice under excess NH 4 + and the changes in gene expression in root and shoot at various time points by RNA-Seq (Quantification) using Illumina HiSeqTM 2000. By comparative analysis, 307 and 675 genes were found to be up-regulated after 4h and 12h of NH 4 + exposure in the root, respectively. In the shoot, 167 genes were up-regulated at 4h, compared with 320 at 12h. According to KEGG analysis, up-regulated DEGs mainly participate in phenylpropanoid (such as flavonoid) and amino acid (such as proline, cysteine, and methionine) metabolism, which is believed to improve NH 4 + stress tolerance through adjustment of energy metabolism in the shoot, while defense and signaling pathways, guiding whole-plant acclimation, play the leading role in the root. We furthermore critically assessed the roles of key phytohormones, and found abscisic acid (ABA) and ethylene (ET) to be the major regulatory molecules responding to excess NH 4 + and activating the MAPK (mitogen-activated protein kinase) signal-transduction pathway. Moreover, we found up-regulated hormone-associated genes are involved in regulating flavonoid biosynthesis and are regulated by tissue flavonoid accumulation. Copyright © 2017 Elsevier GmbH. All rights reserved.
Iyer, Sapna; Park, Min-Jung; Moons, David; Kwan, Raymond; Liao, Jian; Liu, Li; Omary, M Bishr
2017-01-22
Acute pancreatitis has several underlying etiologies, and results in consequences ranging from mild to complex multi-organ failure. The wide range of pathology suggests a genetic predisposition for progression. We compared the susceptibility to acute pancreatitis in BALB/c and FVB/N mice, coupled with proteomic analysis, in order to identify potential protein associations with pancreatitis progression. Pancreatitis was induced in BALB/c and FVB/N mice by administration of cerulein or feeding a choline-deficient, ethionine-supplemented (CDE) diet. Histology and changes in serum amylase were examined. Proteome profiling in cerulein-treated mice was performed using 2-dimensional differential in gel electrophoresis (2D-DIGE) followed by mass spectrometry analysis and biochemical validation. Male and female FVB/N mice manifested more severe cerulein-induced pancreatitis as compared with BALB/c mice, but both strains were similarly susceptible to CDE-induced pancreatitis. Few of the 2D-DIGE alterations were validated by immunoblotting. Clusterin was markedly up-regulated after cerulein-induced pancreatitis in FVB/N but less-so in BALB/c mice. Pyrroline-5-carboxylate reductase (Pycr1), an enzyme involved in proline biosynthesis, had higher basal levels in FVB/N male and female mouse pancreata compared with BALB/c pancreata, and was relatively more resistant to degradation in FVB/N pancreata. However, serum and pancreas tissue proline levels were similar in the two strains. FVB/N is more susceptible than BALB/c mice to cerulein-induced but not CDE-induced pancreatitis. Most of the 2D-DIGE alterations in the two strains likely relate to posttranslational modifications rather than protein level differences. Clusterin levels increase dramatically in association with pancreatitis severity, while Pycr1 is higher in FVB/N versus BALB/c pancreata basally and after induction of pancreatitis. Changes in proline metabolism may represent a novel potential genetic modifier in the context of pancreatitis. Published by Elsevier Inc.
PPE57 induces activation of macrophages and drives Th1-type immune responses through TLR2.
Xu, Ying; Yang, Enzhuo; Huang, Qi; Ni, Wenwen; Kong, Cong; Liu, Guoyuan; Li, Guanghua; Su, Haibo; Wang, Honghai
2015-06-01
Proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) are related proteins exclusive to Mycobacteria that play diverse roles in modulating critical innate immune pathways. In this study, we observed that the PPE57 protein is associated with the cell wall and is exposed on the cell surface. PPE57 enhances Mycobacterium spp. entering into macrophages and plays a role in macrophage phagocytosis. To explore the underlying mechanism, we demonstrated that PPE57 is able to recognise Toll-like receptor 2 (TLR2) and further induce macrophage activation by augmenting the expression of several cell surface molecules (CD40, CD80, CD86 and MHC class II) and pro-inflammatory cytokines (TNF-α, IL-6 and IL-12p40) within macrophages. These molecules are involved in the mitogen-activated protein kinase (MAPK) and nuclear factor κB (NF-κB) signalling pathways. We demonstrated that PPE57 effectively polarises T cells to secrete interferon (IFN)-γ and IL-2 and to up-regulate CXCR3 expression in vivo and in vitro, suggesting that this protein may contribute to Th1 polarisation during the immune response. Moreover, recombinant Bacillus Calmette-Guérin (BCG) over-expressing PPE57 could provide better protective efficacy against Mycobacterium tuberculosis challenge compared with BCG. Taken together, our data provides several pieces of evidence that PPE57 may regulate innate and adaptive immunity by interacting with TLR2. These findings indicate that PPE57 protein is a potential antigen for the rational design of an efficient vaccine against M. tuberculosis. PPE57 is located on the cell surface and enhances mycobacterium entry into macrophage. PPE57 interacts directly with TLR2 on macrophages. PPE57 plays a key role in the activation of macrophages in a TLR2-dependent manner. PPE57 induces a Th1 immune response via TLR2-mediated macrophage functions. Recombinant BCG over-expressing PPE57 could improve protective efficacy against M. tuberculosis.
Role of proline under changing environments
Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Nasser; Wani, Arif Shafi; Pichtel, John; Ahmad, Aqil
2012-01-01
When exposed to stressful conditions, plants accumulate an array of metabolites, particularly amino acids. Amino acids have traditionally been considered as precursors to and constituents of proteins, and play an important role in plant metabolism and development. A large body of data suggests a positive correlation between proline accumulation and plant stress. Proline, an amino acid, plays a highly beneficial role in plants exposed to various stress conditions. Besides acting as an excellent osmolyte, proline plays three major roles during stress, i.e., as a metal chelator, an antioxidative defense molecule and a signaling molecule. Review of the literature indicates that a stressful environment results in an overproduction of proline in plants which in turn imparts stress tolerance by maintaining cell turgor or osmotic balance; stabilizing membranes thereby preventing electrolyte leakage; and bringing concentrations of reactive oxygen species (ROS) within normal ranges, thus preventing oxidative burst in plants. Reports indicate enhanced stress tolerance when proline is supplied exogenously at low concentrations. However, some reports indicate toxic effects of proline when supplied exogenously at higher concentrations. In this article, we review and discuss the effects of exogenous proline on plants exposed to various abiotic stresses. Numerous examples of successful application of exogenous proline to improve stress tolerance are presented. The roles played by exogenous proline under varying environments have been critically examined and reviewed. PMID:22951402
Zhang, Qin; Rao, Xiuwen; Zhang, Lubin; He, Congcong; Yang, Fang; Zhu, Shijiang
2016-01-01
Internal browning (IB), a physiological disorder (PD) that causes severe losses in harvested pineapple, can be induced by exogenous gibberellins (GAs). Over the years, studies have focused on roles of Gibberellin 2-oxidase (GA2oxs), the major GAs catabolic enzyme in plants, in the regulation of changes in morphology or biomass. However, whether GA2oxs could regulate PD has not been reported. Here, a full-length AcGA2ox cDNA was isolated from pineapple, with the putative protein sharing 23.59% to 72.92% identity with GA2oxs from five other plants. Pineapples stored at 5 °C stayed intact, while those stored at 20 °C showed severe IB. Storage at 5 °C enhanced AcGA2ox expression and decreased levels of a GAs (GA4) ‘compared with storage at 20 °C. However, at 20 °C, exogenous application of abscisic acid (ABA) significantly suppressed IB. ABA simultaneously upregulated AcGA2ox and reduced GA4. Ectopic expression of AcGA2ox in Arabidopsis resulted in reduced GA4, lower seed germination, and shorter hypocotyls and roots, all of which were restored by exogenous GA4/7. Moreover, in pineapple, GA4/7 upregulated polyphenol oxidase, while storage at 5 °C and ABA downregulated it. These results strongly suggest the involvement of AcGA2ox in regulation of GAs levels and a role of AcGA2ox in regulating IB. PMID:27982026
Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.
Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H
2009-05-01
Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.
Kanda, Atsuhiro; Ishizuka, Erdal Tan; Shibata, Atsushi; Matsumoto, Takahiro; Toyofuku, Hidekazu; Noda, Kousuke; Namba, Kenichi; Ishida, Susumu
2017-06-16
The receptor-associated prorenin system (RAPS) refers to the pathogenic mechanism whereby prorenin binding to the (pro)renin receptor [(P)RR] dually activates the tissue renin-angiotensin system (RAS) and RAS-independent intracellular signaling. Here we revealed significant upregulation of prorenin and soluble (P)RR levels in the vitreous fluid of patients with uveitis compared to non-inflammatory controls, together with a positive correlation between these RAPS components and monocyte chemotactic protein-1 among several upregulated cytokines. Moreover, we developed a novel single-strand RNAi agent, proline-modified short hairpin RNA directed against human and mouse (P)RR [(P)RR-PshRNA], and we determined its safety and efficacy in vitro and in vivo. Application of (P)RR-PshRNA in mice caused significant amelioration of acute (uveitic) and chronic (diabetic) models of ocular inflammation with no apparent adverse effects. Our findings demonstrate the significant implication of RAPS in the pathogenesis of human uveitis and the potential usefulness of (P)RR-PshRNA as a therapeutic agent to reduce ocular inflammation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Transcriptome Response Mediated by Cold Stress in Lotus japonicus.
Calzadilla, Pablo I; Maiale, Santiago J; Ruiz, Oscar A; Escaray, Francisco J
2016-01-01
Members of the Lotus genus are important as agricultural forage sources under marginal environmental conditions given their high nutritional value and tolerance of various abiotic stresses. However, their dry matter production is drastically reduced in cooler seasons, while their response to such conditions is not well studied. This paper analyzes cold acclimation of the genus by studying Lotus japonicus over a stress period of 24 h. High-throughput RNA sequencing was used to identify and classify 1077 differentially expressed genes, of which 713 were up-regulated and 364 were down-regulated. Up-regulated genes were principally related to lipid, cell wall, phenylpropanoid, sugar, and proline regulation, while down-regulated genes affected the photosynthetic process and chloroplast development. Together, a total of 41 cold-inducible transcription factors were identified, including members of the AP2/ERF, NAC, MYB, and WRKY families; two of them were described as putative novel transcription factors. Finally, DREB1/CBFs were described with respect to their cold stress expression profiles. This is the first transcriptome profiling of the model legume L. japonicus under cold stress. Data obtained may be useful in identifying candidate genes for breeding modified species of forage legumes that more readily acclimate to low temperatures.
Gao, Ruimin; Ng, Florence Kai Lin; Liu, Peng; Wong, Sek-Man
2012-12-01
In both Hibiscus chlorotic ringspot virus (HCRSV)-infected and HCRSV coat protein (CP) agroinfiltrated plant leaves, we showed that sulfur metabolism pathway related genes-namely, sulfite oxidase (SO), sulfite reductase, and adenosine 5'-phosphosulfate kinase-were upregulated. It led us to examine a plausible relationship between sulfur-enhanced resistance (SED) and HCRSV infection. We broadened an established method to include different concentrations of sulfur (0S, 1S, 2S, and 3S) to correlate them to symptom development of HCRSV-infected plants. We treated plants with glutathione and its inhibitor to verify the SED effect. Disease resistance was induced through elevated glutathione contents during HCRSV infection. The upregulation of SO was related to suppression of symptom development induced by sulfur treatment. In this study, we established that HCRSV-CP interacts with SO which, in turn, triggers SED and leads to enhanced plant resistance. Thus, we have discovered a new function of SO in the SED pathway. This is the first report to demonstrate that the interaction of a viral protein and host protein trigger SED in plants. It will be interesting if such interaction applies generally to other host-pathogen interactions that will lead to enhanced pathogen defense.
Pandey, Anil K.; Naduthambi, Devan; Thomas, Krista M.; Zondlo, Neal J.
2013-01-01
Functionalized proline residues have diverse applications. Herein we describe a practical approach, proline editing, for the synthesis of peptides with stereospecifically modified proline residues. Peptides are synthesized by standard solid-phase-peptide-synthesis to incorporate Fmoc-Hydroxyproline (4R-Hyp). In an automated manner, the Hyp hydroxyl is protected and the remainder of the peptide synthesized. After peptide synthesis, the Hyp protecting group is orthogonally removed and Hyp selectively modified to generate substituted proline amino acids, with the peptide main chain functioning to “protect” the proline amino and carboxyl groups. In a model tetrapeptide (Ac-TYPN-NH2), 4R-Hyp was stereospecifically converted to 122 different 4-substituted prolyl amino acids, with 4R or 4S stereochemistry, via Mitsunobu, oxidation, reduction, acylation, and substitution reactions. 4-Substituted prolines synthesized via proline editing include incorporated structured amino acid mimetics (Cys, Asp/Glu, Phe, Lys, Arg, pSer/pThr), recognition motifs (biotin, RGD), electron-withdrawing groups to induce stereoelectronic effects (fluoro, nitrobenzoate), handles for heteronuclear NMR (19F:fluoro; pentafluorophenyl or perfluoro-tert-butyl ether; 4,4-difluoro; 77SePh) and other spectroscopies (fluorescence, IR: cyanophenyl ether), leaving groups (sulfonate, halide, NHS, bromoacetate), and other reactive handles (amine, thiol, thioester, ketone, hydroxylamine, maleimide, acrylate, azide, alkene, alkyne, aryl halide, tetrazine, 1,2-aminothiol). Proline editing provides access to these proline derivatives with no solution phase synthesis. All peptides were analyzed by NMR to identify stereoelectronic and steric effects on conformation. Proline derivatives were synthesized to permit bioorthogonal conjugation reactions, including azide-alkyne, tetrazinetrans-cyclooctene, oxime, reductive amination, native chemical ligation, Suzuki, Sonogashira, cross-metathesis, and Diels-Alder reactions. These proline derivatives allowed three parallel bioorthogonal reactions to be conducted in one solution. PMID:23402492
Ning, R B; Zhu, J; Chai, D J; Xu, C S; Xie, H; Lin, X Y; Zeng, J Z; Lin, J X
2013-12-13
An inflammatory response induced by high glucose is a cause of endothelial dysfunction in diabetes and is an important contributing link to atherosclerosis. Diabetes is an independent risk factor of atherosclerosis and activation of retinoid X receptor (RXR) has been shown to exert anti-atherogenic effects. In the present study, we examined the effects of the RXR ligands 9-cis-retinoic acid (9-cis-RA) and SR11237 on high glucose-induced inflammation in human umbilical endothelial vein endothelial cells (HUVECs) and explored the potential mechanism. Our results showed that the inflammation induced by high-glucose in HUVECs was mainly mediated by the activation of nuclear factor-B (NF- κB). High glucose-induced expression of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were in comparison, significantly decreased by treatment with RXR. The effect of RXR agonists was mainly due to the inhibition of NF-κB activation. Using pharmacological inhibitors and siRNA, we confirmed that nicotinamide adenine dinucleotide phosphate (NADPH) oxidase was an upstream activator of NF-κB. Furthermore, RXR agonists significantly inhibited high glucose-induced activation of NADPH oxidase and significantly decreased the production of reactive oxygen species (ROS). To explore whether the rapid inhibitory effects of RXR agonists were in fact mediated by RXR, we examined the effect of RXR downregulation by RXR siRNA. Our results showed that RXR siRNA largely abrogated the effects of RXR agonists, suggesting the requirement of RXR expression. Therefore, we have shown that RXR is involved in the regulation of NADPH oxidase- NF-κB signal pathway, as the RXR ligands antagonized the inflammatory response in HUVECs induced by high glucose.
Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi
2012-05-01
Freeze tolerance is a necessary characteristic for industrial baker's yeast because frozen-dough baking is one of the key technologies for supplying oven-fresh bakery products to consumers. Both proline and trehalose are known to function as cryoprotectants in yeast cells. In order to enhance the freeze tolerance of yeast cells, we constructed a self-cloning diploid baker's yeast strain with simultaneous accumulation of proline, by expressing the PRO1-I150T allele, encoding the proline-feedback inhibition-less sensitive γ-glutamyl kinase, and trehalose, by disrupting the NTH1 gene, encoding neutral trehalase. The resultant strain retained higher tolerance to oxidative and freezing stresses than did the single proline- or trehalose-accumulating strain. Interestingly, our results suggest that proline and trehalose protect yeast cells from short-term and long-term freezing, respectively. Simultaneous accumulation of proline and trehalose in industrial baker's yeast also enhanced the fermentation ability in the frozen dough compared with the single accumulation of proline or trehalose. These results indicate that baker's yeast that accumulates both proline and trehalose is applicable for frozen-dough baking. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Role of proline and GABA in sexual reproduction of angiosperms
Biancucci, Marco; Mattioli, Roberto; Forlani, Giuseppe; Funck, Dietmar; Costantino, Paolo; Trovato, Maurizio
2015-01-01
Two glutamate derivatives, proline and γ-aminobutyric acid (GABA), appear to play pivotal roles in different aspects of sexual reproduction in angiosperms, although their precise function in plant reproduction and the molecular basis of their action are not yet fully understood. Proline and GABA have long been regarded as pivotal amino acids in pollen vitality and fertility. Proline may constitute up to 70% of the free amino acid pool in pollen grains and it has been recently shown that Arabidopsis mutants affected in the first and rate-limiting step in proline synthesis produce aberrant and infertile pollen grains, indicating that proline synthesis is required for pollen development and fertility. Concerning GABA, a large body of evidence points to this glutamate derivative as a key determinant of post-pollination fertilization. Intriguingly, proline has also been associated with pollination, another aspect of sexual reproduction, since honeybees were reported to show a strong preference for proline-enriched nectars. In this review, we survey current knowledge on the roles of proline and GABA in plant fertility, and discuss future perspectives potentially capable to improve our understanding on the functions of these amino acids in pollen development, pollination, and pollen tube guidance. PMID:26388884
Ashtari, M; Cann, N M
2012-11-23
Poly-proline chains and derivatives have been recently examined as the basis for new chiral stationary phases in high performance liquid chromatography. The selectivity of poly-proline has been measured for peptides with up to ten proline units. In this article, we employ molecular dynamics simulations to examine the interfacial structure and solvation of surface-bound poly-proline chiral selectors. Specifically, we study the interfacial structure of trimethylacetyl-terminated poly-proline chains with three-to-six prolines. The surface includes silanol groups and end-caps, to better capture the characteristics of the stationary phase, and the solvent is either a polar water/methanol or a relatively apolar n-hexane/2-propanol mixture. We begin with a comprehensive ab initio study of the conformers, their energies, and an assessment of conformer flexibility. Force fields have been developed for each poly-proline selector. Molecular dynamics simulations are employed to study the preferred backbone conformations and solvent hydrogen bonding for different poly-proline/solvent interfaces. For triproline, the effect of two different terminal groups, trimethylacetyl and t-butyl carbamate are compared. Copyright © 2012 Elsevier B.V. All rights reserved.
Liu, Bing; Gao, Yankun; Ruan, Hai-Bin; Chen, Yue
2016-01-01
Proline hydroxylation is a critical cellular mechanism regulating oxygen-response pathways in tumor initiation and progression. Yet, its substrate diversity and functions remain largely unknown. Here, we report a system-wide analysis to characterize proline hydroxylation substrates in cancer cells using an immunoaffinity-purification assisted proteomics strategy. We identified 562 sites from 272 proteins in HeLa cells. Bioinformatic analysis revealed that proline hydroxylation substrates are significantly enriched with mRNA processing and stress-response cellular pathways with canonical and diverse flanking sequence motifs. Structural analysis indicates a significant enrichment of proline hydroxylation participating in the secondary structure of substrate proteins. Our study identified and validated Brd4, a key transcription factor, as a novel proline hydroxylation substrate. Functional analysis showed that the inhibition of proline hydroxylation pathway significantly reduced the proline hydroxylation abundance on Brd4 and affected Brd4-mediated transcriptional activity as well as cell proliferation in AML leukemia cells. Taken together, our study identified a broad regulatory role of proline hydroxylation in cellular oxygen-sensing pathways and revealed potentially new targets that dynamically respond to hypoxia microenvironment in tumor cells. PMID:27764789
Iqbal, Noushina; Umar, Shahid; Khan, Nafees A
2015-04-15
Proline content and ethylene production have been shown to be involved in salt tolerance mechanisms in plants. To assess the role of nitrogen (N) in the protection of photosynthesis under salt stress, the effect of N (0, 5, 10, 20 mM) on proline and ethylene was studied in mustard (Brassica juncea). Sufficient N (10 mM) optimized proline production under non-saline conditions through an increase in proline-metabolizing enzymes, leading to osmotic balance and protection of photosynthesis through optimal ethylene production. Excess N (20 mM), in the absence of salt stress, inhibited photosynthesis and caused higher ethylene evolution but lower proline production compared to sufficient N. In contrast, under salt stress with an increased demand for N, excess N optimized ethylene production, which regulates the proline content resulting in recovered photosynthesis. The effect of excess N on photosynthesis under salt stress was further substantiated by the application of the ethylene biosynthesis inhibitor, 1-aminoethoxy vinylglycine (AVG), which inhibited proline production and photosynthesis. Without salt stress, AVG promoted photosynthesis in plants receiving excess N by inhibiting stress ethylene production. The results suggest that a regulatory interaction exists between ethylene, proline and N for salt tolerance. Nitrogen differentially regulates proline production and ethylene formation to alleviate the adverse effect of salinity on photosynthesis in mustard. Copyright © 2015 Elsevier GmbH. All rights reserved.
Pallotta, Maria Luigia
2014-01-01
L-Proline (pyrrolidine-2-carboxylic acid) is a distinctive metabolite both biochemically and biotechnologically and is currently recognized to have a cardinal role in gene expression and cellular signaling pathways in stress response. Proline-fueled mitochondrial metabolism involves the oxidative conversion of L-Proline to L-Glutamate in two enzymatic steps by means of Put1p and Put2p that help Saccharomyces cerevisiae to respond to changes in the nutritional environment by initiating the breakdown of L-Proline as a source for nitrogen, carbon, and energy. Compartmentalization of L-Proline catabolic pathway implies that extensive L-Proline transport must take place between the cytosol where its biogenesis via Pro1p, Pro2p, Pro3p occurs and mitochondria. L-Proline uptake in S. cerevisiae purified and active mitochondria was investigated by swelling experiments, oxygen uptake and fluorimetric measurement of a membrane potential generation (ΔΨ). Our results strongly suggest that L-Proline uptake occurs via a carried-mediated process as demonstrated by saturation kinetics and experiments with N-ethylmaleimide, a pharmacological compound that is a cysteine-modifying reagent in hydrophobic protein domains and that inhibited mitochondrial transport. Plasticity of S. cerevisiae cell biochemistry according to background fluctuations is an important factor of adaptation to stress. Thus L-Proline → Glutamate route feeds Krebs cycle providing energy and anaplerotic carbon for yeast survival.
Use of 5-deazaFAD to study hydrogen transfer in the D-amino acid oxidase reaction.
Hersh, L B; Jorns, M S
1975-11-25
The apoprotein of hog kidney D-amino acid oxidase was reconstituted with 5-deazaflavin adenine dinucleotide (5-deazaFAD) to yield a protein which contains 1.5 mol of 5-deazaFAD/mol of enzyme. The deazaFAD-containing enzyme forms complexes with benzoate, 2-amino benzoate, and 4-aminobenzoate which are both qualitatively and quantitatively similar to those observed with native enzyme. The complex with 2-aminobenzoate exhibits a new long wavelength absorption band characteristic of a flavin charge-transfer complex. The reconstituted enzyme exhibits no activity when assayed by D-alanine oxidation. However, the bound chromophore can be reduced by alanine, phenylalanine, proline, methionine, and valine, but not by glutamate or aspartate, indicating the deazaFAD enzyme retains the substrate specificity of the native enzyme. Reduction of the enzyme by D-alanine exhibits a 1.6-fold deuterium isotope effect. Reoxidation of the reduced enzyme occurred in the presence of pyruvate plus ammonia, but not with pyruvate alone or ammonia alone. beta-Phenylpyruvate and alpha-ketobutyrate, but not alpha-ketoglutarate could replace pyruvate. Reduced enzyme isolated following reaction with [alpha-3H]alanine was found to contain 0.5 mol of tritium/mol of deazaFADH2. After denaturation of the tritium-labeled enzyme, the radioactivity was identified as deazaFADH2. Reaction of the reduced tritium-labeled enzyme with pyruvate plus ammonia prior to denaturation yields [alpha-3H]alanine and unlabeled deazaFAD. These results suggest that reduction and reoxidation of enzyme-bound deazaFAD involves the stereo-specific transfer of alpha-hydrogen from substrate to deazaFAD.
Evidence for Pipecolate Oxidase in Mediating Protection Against Hydrogen Peroxide Stress.
Natarajan, Sathish Kumar; Muthukrishnan, Ezhumalai; Khalimonchuk, Oleh; Mott, Justin L; Becker, Donald F
2017-07-01
Pipecolate, an intermediate of the lysine catabolic pathway, is oxidized to Δ 1 -piperideine-6-carboxylate (P6C) by the flavoenzyme l-pipecolate oxidase (PIPOX). P6C spontaneously hydrolyzes to generate α-aminoadipate semialdehyde, which is then converted into α-aminoadipate acid by α-aminoadipatesemialdehyde dehydrogenase. l-pipecolate was previously reported to protect mammalian cells against oxidative stress. Here, we examined whether PIPOX is involved in the mechanism of pipecolate stress protection. Knockdown of PIPOX by small interference RNA abolished pipecolate protection against hydrogen peroxide-induced cell death in HEK293 cells suggesting a critical role for PIPOX. Subcellular fractionation analysis showed that PIPOX is localized in the mitochondria of HEK293 cells consistent with its role in lysine catabolism. Signaling pathways potentially involved in pipecolate protection were explored by treating cells with small molecule inhibitors. Inhibition of both mTORC1 and mTORC2 kinase complexes or inhibition of Akt kinase alone blocked pipecolate protection suggesting the involvement of these signaling pathways. Phosphorylation of the Akt downstream target, forkhead transcription factor O3 (FoxO3), was also significantly increased in cells treated with pipecolate, further implicating Akt in the protective mechanism and revealing FoxO3 inhibition as a potentially key step. The results presented here demonstrate that pipecolate metabolism can influence cell signaling during oxidative stress to promote cell survival and suggest that the mechanism of pipecolate protection parallels that of proline, which is also metabolized in the mitochondria. J. Cell. Biochem. 118: 1678-1688, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Effect of l-Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae
Takagi, Hiroshi; Takaoka, Miki; Kawaguchi, Akari; Kubo, Yoshito
2005-01-01
During the fermentation of sake, cells of Saccharomyces cerevisiae are exposed to high concentrations of ethanol, thereby damaging the cell membrane and functional proteins. l-Proline protects yeast cells from damage caused by freezing or oxidative stress. In this study, we evaluated the role of intracellular l-proline in cells of S. cerevisiae grown under ethanol stress. An l-proline-accumulating laboratory strain carries a mutant allele of PRO1, pro1D154N, which encodes the Asp154Asn mutant γ-glutamyl kinase. This mutation increases the activity of γ-glutamyl kinase and γ-glutamyl phosphate reductase, which catalyze the first two steps of l-proline synthesis and which together may form a complex in vivo. When cultured in liquid medium in the presence of 9% and 18% ethanol under static conditions, the cell viability of the l-proline-accumulating laboratory strain is greater than the cell viability of the parent strain. This result suggests that intracellular accumulation of l-proline may confer tolerance to ethanol stress. We constructed a novel sake yeast strain by disrupting the PUT1 gene, which is required for l-proline utilization, and replacing the wild-type PRO1 allele with the pro1D154N allele. The resultant strain accumulated l-proline and was more tolerant to ethanol stress than was the control strain. We used the strain that could accumulate l-proline to brew sake containing five times more l-proline than what is found in sake brewed with the control strain, without affecting the fermentation profiles. PMID:16332860
The γ-Aminobutyrate Permease GabP Serves as the Third Proline Transporter of Bacillus subtilis
Zaprasis, Adrienne; Hoffmann, Tamara; Stannek, Lorena; Gunka, Katrin; Commichau, Fabian M.
2014-01-01
PutP and OpuE serve as proline transporters when this imino acid is used by Bacillus subtilis as a nutrient or as an osmostress protectant, respectively. The simultaneous inactivation of the PutP and OpuE systems still allows the utilization of proline as a nutrient. This growth phenotype pointed to the presence of a third proline transport system in B. subtilis. We took advantage of the sensitivity of a putP opuE double mutant to the toxic proline analog 3,4-dehydro-dl-proline (DHP) to identify this additional proline uptake system. DHP-resistant mutants were selected and found to be defective in the use of proline as a nutrient. Whole-genome resequencing of one of these strains provided the lead that the inactivation of the γ-aminobutyrate (GABA) transporter GabP was responsible for these phenotypes. DNA sequencing of the gabP gene in 14 additionally analyzed DHP-resistant strains confirmed this finding. Consistently, each of the DHP-resistant mutants was defective not only in the use of proline as a nutrient but also in the use of GABA as a nitrogen source. The same phenotype resulted from the targeted deletion of the gabP gene in a putP opuE mutant strain. Hence, the GabP carrier not only serves as an uptake system for GABA but also functions as the third proline transporter of B. subtilis. Uptake studies with radiolabeled GABA and proline confirmed this conclusion and provided information on the kinetic parameters of the GabP carrier for both of these substrates. PMID:24142252
Brunton, Janet A; Baldwin, Mark P; Hanna, Rodney A; Bertolo, Robert F
2012-06-01
Proline and arginine are each indispensable during parenteral feeding due to limited interconversion by an atrophied gut. Commercial amino acid parenteral products designed for neonates contain proline concentrations that differ by almost 4-fold. To assess the adequacy of the lowest concentration of proline provided in commercial total parenteral nutrition (TPN) products, we compared rates of tissue-specific protein synthesis and nitrogen balance in neonatal piglets provided TPN at 2 different proline concentrations. Yucatan miniature piglets (9-11 d old, n = 12) were randomized to complete isonitrogenous TPN diets with low proline (LP; L-proline as 3% of amino acids) or proline supplemented (PS; 9%). After 7 d of receiving TPN, rates of protein synthesis in liver, gastrocnemius muscle, jejunal mucosa, and skin were determined by the flooding dose technique and tissue free amino acids were measured. Nitrogen balance was assessed during the last 3 d. The LP TPN resulted in lower free proline concentrations in plasma, muscle, and skin (P < 0.05) and lower rates of protein synthesis in the jejunum (by 25%; P = 0.02), muscle (by 45%; P = 0.015), and skin (by 60%; P = 0.01); there was no difference in liver. Nitrogen retention was 20% lower in the LP group (P = 0.01). In conclusion, muscle and skin protein synthesis was profoundly sensitive to parenteral proline supply and the reduced protein synthesis in the intestine could affect intestinal integrity. Low-proline TPN solutions that are currently in wide use in neonatal care may result in impaired tissue growth.
Bhattacharya, Rahul; Singh, Poonam; John, Jebin Jacob; Gujar, Niranjan L
2018-04-03
Cyanide-induced chemical hypoxia is responsible for pronounced oxidative damage in the central nervous system. The disruption of mitochondrial oxidative metabolism has been associated with upregulation of uncoupling proteins (UCPs). The present study addresses the dose- and time-dependent effect of sub-acute cyanide exposure on various non-enzymatic and enzymatic oxidative stress markers and their correlation with inducible-nitric oxide synthase (iNOS) and uncoupling protein-2 (UCP-2) expression. Animals received (oral) triple distilled water (vehicle control), 0.25 LD50 potassium cyanide (KCN) or 0.50 LD50 KCN daily for 21 d. Animals were sacrificed on 7, 14 and 21 d post-exposure to measure serum cyanide and nitrite, and brain malondialdehyde (MDA), reduced glutathione (GSH), glutathione disulfide (GSSG), cytochrome c oxidase (CCO), superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione reductase (GR) and catalase (CA) levels, together with iNOS and UCP-2 expression, and DNA damage. The study revealed that a dose- and time-dependent increase in cyanide concentration was accompanied by corresponding CCO inhibition and elevated MDA levels. Decrease in GSH levels was not followed by reciprocal change in GSSG levels. Diminution of SOD, GPx, GR and CA activity was congruent with elevated nitrite levels and upregulation of iNOS and UCP-2 expression, without any DNA damage. It was concluded that long-term cyanide exposure caused oxidative stress, accompanied by upregulation of iNOS. The upregulation of UCP-2 further sensitized the cells to cyanide and accentuated the oxidative stress, which was independent of DNA damage.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kan-o, Keiko; Matsumoto, Koichiro, E-mail: koichi@kokyu.med.kyushu-u.ac.jp; Asai-Tajiri, Yukari
Highlights: •Double-stranded RNA upregulates B7-H1 on BEAS-2B airway epithelial cells. •The upregulation of B7-H1 is attenuated by inhibition of PI3Kδ isoform. •PI3Kδ-mediated upregulation of B7-H1 is independent of NF-κB activation. •Inhibition of PI3Kδ may prevent persistent viral infection induced by B7-H1. -- Abstract: Airway viral infection disturbs the health-related quality of life. B7-H1 (also known as PD-L1) is a coinhibitory molecule associated with the escape of viruses from the mucosal immunity, leading to persistent infection. Most respiratory viruses generate double-stranded (ds) RNA during replication. The stimulation of cultured airway epithelial cells with an analog of viral dsRNA, polyinosinic-polycytidylic acid (polymore » IC) upregulates the expression of B7-H1 via activation of the nuclear factor κB(NF-κB). The mechanism of upregulation was investigated in association with phosphatidylinositol 3-kinases (PI3Ks). Poly IC-induced upregulation of B7-H1 was profoundly suppressed by a pan-PI3K inhibitor and partially by an inhibitor or a small interfering (si)RNA for PI3Kδ in BEAS-2B cells. Similar results were observed in the respiratory syncytial virus-infected cells. The expression of p110δ was detected by Western blot and suppressed by pretreatment with PI3Kδ siRNA. The activation of PI3Kδ is typically induced by oxidative stress. The generation of reactive oxygen species was increased by poly IC. Poly IC-induced upregulation of B7-H1 was attenuated by N-acetyl-L-cysteine, an antioxidant, or by oxypurinol, an inhibitor of xanthine oxidase. Poly IC-induced activation of NF-κB was suppressed by a pan-PI3K inhibitor but not by a PI3Kδ inhibitor. These results suggest that PI3Kδ mediates dsRNA-induced upregulation of B7-H1 without affecting the activation of NF-κB.« less
Kumar, Ritesh; Zhao, Suwen; Vetting, Matthew W.; Wood, B. McKay; Sakai, Ayano; Cho, Kyuil; Solbiati, José; Almo, Steven C.; Sweedler, Jonathan V.; Jacobson, Matthew P.; Gerlt, John A.; Cronan, John E.
2014-01-01
ABSTRACT Through the use of genetic, enzymatic, metabolomic, and structural analyses, we have discovered the catabolic pathway for proline betaine, an osmoprotectant, in Paracoccus denitrificans and Rhodobacter sphaeroides. Genetic and enzymatic analyses showed that several of the key enzymes of the hydroxyproline betaine degradation pathway also function in proline betaine degradation. Metabolomic analyses detected each of the metabolic intermediates of the pathway. The proline betaine catabolic pathway was repressed by osmotic stress and cold stress, and a regulatory transcription factor was identified. We also report crystal structure complexes of the P. denitrificans HpbD hydroxyproline betaine epimerase/proline betaine racemase with l-proline betaine and cis-hydroxyproline betaine. PMID:24520058
Unusual properties of aqueous solutions of L-proline: A molecular dynamics study
NASA Astrophysics Data System (ADS)
Civera, Monica; Sironi, Maurizio; Fornili, Sandro L.
2005-11-01
Aqueous solutions of the bioprotectant proline are simulated for solute molar fractions ranging from 2.0 × 10 -3 to 2.3 × 10 -1. Statistical analyses show that proline affects the water structure more strongly than glycine betaine and trimethylamine- N-oxide, two of the most effective bioprotectants widely diffuse in nature, and as strongly as tert-butyl alcohol, a protein denaturant which at high concentration self-aggregates. No evidence is found, however, that proline self-aggregates as it has been previously suggested to explain experimental findings on concentrated proline solutions. Nevertheless, the behavior of the diffusion coefficients of proline and water vs. solute concentration qualitatively agrees with such results.
Ren, Yongbing; Miao, Min; Meng, Yun; Cao, Jiasheng; Fan, Tingting; Yue, Junyang; Xiao, Fangming; Liu, Yongsheng; Cao, Shuqing
2018-06-26
Proline accumulation is one of the most important adaptation mechanisms for plants to cope with environmental stresses, such as drought and freezing. However, the molecular mechanism of proline homeostasis under these stresses is largely unknown. Here, we identified a mitochondrial protein, DFR1, involved in the inhibition of proline degradation in Arabidopsis. DFR1 was strongly induced by drought and cold stresses. The dfr1 knockdown mutants showed hypersensitivity to drought and freezing stresses, whereas the DFR1 overexpression plants exhibited enhanced tolerance, which was positively correlated with proline levels. DFR1 interacts with proline degradation enzymes PDH1/2 and P5CDH and compromises their activities. Genetic analysis showed that DFR1 acts upstream of PDH1/2 and P5CDH to positively regulate proline accumulation. Our results demonstrate a regulatory mechanism by which, under drought and freezing stresses, DFR1 interacts with PDH1/2 and P5CDH to abrogate their activities to maintain proline homeostasis, thereby conferring drought and freezing tolerance. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Exogenous proline enhances the sensitivity of Tobacco BY-2 cells to arsenate.
Nahar, Mst Nur-E-Nazmun; Islam, Mohammad Muzahidul; Hoque, Md Anamul; Yonezawa, Anna; Prodhan, Md Yeasin; Nakamura, Toshiyuki; Nakamura, Yoshimasa; Munemasa, Shintaro; Murata, Yoshiyuki
2017-09-01
Arsenic causes physiological and structural disorders in plants. Proline is accumulated as a compatible solute in plants under various stress conditions and mitigates stresses. Here, we investigated the effects of exogenous proline on tobacco Bright Yellow-2 (BY-2) cultured cells under [Formula: see text] stress. Arsenate did not inhibit BY-2 cell growth at 40 and 50 μM but did it at 60 μM. Proline at 0.5 to 10 mM did not affect the cell growth but delayed it at 20 mM. At 40 μM [Formula: see text], neither 0.5 mM nor 1 mM proline affected the cell growth but 10 mM proline inhibited it. In the presence of [Formula: see text], 10 mM proline increased the number of Evans Blue-stained (dead) cells and decreased the number of total cells. Together, our results suggest that exogenous proline does not alleviate arsenate toxicity but enhances the sensitivity of BY-2 cells to arsenate.
Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade.
Crabtree, Gregg W; Park, Alan J; Gordon, Joshua A; Gogos, Joseph A
2016-10-04
Proline dehydrogenase (PRODH), which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh-deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Vermeer, Louic S; Lan, Yun; Abbate, Vincenzo; Ruh, Emrah; Bui, Tam T; Wilkinson, Louise J; Kanno, Tokuwa; Jumagulova, Elmira; Kozlowska, Justyna; Patel, Jayneil; McIntyre, Caitlin A; Yam, W C; Siu, Gilman; Atkinson, R Andrew; Lam, Jenny K W; Bansal, Sukhvinder S; Drake, Alex F; Mitchell, Graham H; Mason, A James
2012-10-05
We used a combination of fluorescence, circular dichroism (CD), and NMR spectroscopies in conjunction with size exclusion chromatography to help rationalize the relative antibacterial, antiplasmodial, and cytotoxic activities of a series of proline-free and proline-containing model antimicrobial peptides (AMPs) in terms of their structural properties. When compared with proline-free analogs, proline-containing peptides had greater activity against Gram-negative bacteria, two mammalian cancer cell lines, and intraerythrocytic Plasmodium falciparum, which they were capable of killing without causing hemolysis. In contrast, incorporation of proline did not have a consistent effect on peptide activity against Mycobacterium tuberculosis. In membrane-mimicking environments, structures with high α-helix content were adopted by both proline-free and proline-containing peptides. In solution, AMPs generally adopted disordered structures unless their sequences comprised more hydrophobic amino acids or until coordinating phosphate ions were added. Proline-containing peptides resisted ordering induced by either method. The roles of the angle subtended by positively charged amino acids and the positioning of the proline residues were also investigated. Careful positioning of proline residues in AMP sequences is required to enable the peptide to resist ordering and maintain optimal antibacterial activity, whereas varying the angle subtended by positively charged amino acids can attenuate hemolytic potential albeit with a modest reduction in potency. Maintaining conformational flexibility improves AMP potency and selectivity toward bacterial, plasmodial, and cancerous cells while enabling the targeting of intracellular pathogens.
NASA Astrophysics Data System (ADS)
Nath, Mala; Jairath, Ruchi; Eng, George; Song, Xueqing; Kumar, Ashok
2005-12-01
New organotin(IV) complexes of the general formula R 3Sn(L) (where R = Me, n-Bu and HL = L-proline; R = Me, Ph and HL = trans-hydroxy- L-proline and L-glutamine) and R 2Sn(L) 2 (where R = n-Bu, Ph and HL = L-proline; R = Ph, HL = trans-hydroxy- L-proline) have been synthesized by the reaction of R nSnCl 4- n (where n = 2 or 3) with sodium salt of the amino acid (HL). n-Bu 2Sn(Pro) 2 was synthesized by the reaction of n-Bu 2SnO with L-proline under azeotropic removal of water. The bonding and coordination behavior in these complexes have been discussed on the basis of IR and 119Sn Mössbauer spectroscopic studies in the solid-state. Their coordination behavior in solution has been discussed with the help of multinuclear ( 1H, 13C and 119Sn) NMR spectral studies. The 119Sn Mössbauer and IR studies indicate that L-proline and trans-hydroxy- L-proline show similar coordination behavior towards organotin(IV) compounds. Pentacoordinate trigonal-bipyramidal and hexacoordinate octahedral structures, respectively, have been proposed for the tri- and diorganotin(IV) complexes of L-proline and trans-hydroxy- L-proline, in which the carboxylate group acts as bidentate group. L-Glutamine shows different coordination behavior towards organotin(IV) compounds, it acts as monoanionic bidentate ligand coordinating through carboxylate and amino group. The triorganotin(IV) complexes of L-glutamine have been proposed to have trigonal-bipyramidal environment around tin. The newly synthesized complexes have been tested for their antiinflammatory and cardiovascular activities. Their LD 50 values are >1000 mg kg -1.
Browne, P; O'Cuinn, G
1983-12-01
The degradation of thyroliberin (less than Glu-His-Pro-NH2) to its component amino acids by the soluble fraction of guinea pig brain is catalysed by four enzymes namely a pyroglutamate aminopeptidase, a post-proline cleaving enzyme, a post-proline dipeptidyl aminopeptidase and a proline dipeptidase. 1. The pyroglutamate aminopeptidase was purified to over 90% homogeneity with a purification factor of 2868-fold and a yield of 5.7%. In addition to catalysing the hydrolysis of thyroliberin, acid thyroliberin and pyroglutamate-7-amido-4-methylcoumarin the pyroglutamate aminopeptidase catalysed the hydrolysis of the peptide bond adjacent to the pyroglutamic acid residue in luliberin, neurotensin bombesin, bradykinin-potentiating peptide B, the anorexogenic peptide and the dipeptides pyroglutamyl alanine and pyroglutamyl valine. Pyroglutamyl proline and eledoisin were not hydrolysed. 2. The post-proline cleaving enzyme was purified to apparent electrophoretic homogeneity with a purification factor of 2298-fold and a yield of 10.6%. The post-proline cleaving enzyme catalysed the hydrolysis of thyroliberin and N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. It did not catalyse the hydrolysis of glycylproline-7-amido-4-methylcoumarin or His-Pro-NH2. 3. The post-proline dipeptidyl aminopeptidase was partially purified with a purification factor of 301-fold and a yield of 8.9%. The post-proline dipeptidyl aminopeptidase catalysed the hydrolysis of His-Pro-NH2 and glycylproline-7-amido-4-methylcoumarin but did not exhibit any post-proline cleaving endopeptidase activity against thyroliberin or N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. 4. Studies with various functional reagents indicated that the pyroglutamate aminopeptidase could be specifically inhibited by 2-iodoacetamide (100% inhibition at an inhibitor concentration of 5 microM), the post-proline cleaving enzyme by bacitracin (IC50 = 42 microM) and the post-proline dipeptidyl aminopeptidase by puromycin (IC50 = 46 microM). Because of their specific inhibitory effects these three reagents were key elements in the elucidation of the overall pathway for the metabolism of thyroliberin by guinea pig brain tissue enzymes.
Kawaguchi, Takumi; Ueno, Takato; Nogata, Yoichi; Hayakawa, Masako; Koga, Hironori; Torimura, Takuji
2017-02-01
Whole-wheat intake is known to reduce the risk of metabolic syndrome. However, the active component remains unclear. Recently, we identified bioactive peptides [leucine-arginine-proline (LRP) and leucine-glutamine‑proline (LQP)] from wheat bran autolytic hydrolysate. The present study aimed to investigate the effects of LRP and LQP on non-alcoholic steatohepatitis (NASH) in a mouse model. We also evaluated the effects of these peptides on oxidative stress and on the AMP-activated protein kinase (AMPK) signaling pathway, two major pathogenic factors of NASH. Seven‑week-old male C57BL/6 mice were fed a high-fat diet for 10 weeks and administered water supplemented with 0.05% LRP, 0.20% LRP, 0.05% LQP, or 0.20% LQP (each n=5) or distilled water (control; n=5) ad libitum. Oxidative stress was evaluated by measuring the serum levels of diacron reactive oxygen metabolite (d-ROM) and biological antioxidant potential (BAP). Hepatic expression of phosphorylated AMPK and phosphorylated acetyl-CoA carboxylase (ACC) were evaluated by immunoblotting. The result showed that non‑alcoholic fatty liver disease activity score was significantly decreased in all types of treatment. Serum d-ROM levels were significantly decreased in the 0.20% LRP group, but not in the 0.05% LRP, 0.05% LQP, and 0.20% LQP groups. Serum BAP levels were significantly increased in the 0.05% LRP and 0.20% LRP groups, but not in the 0.05% LQP and 0.20% LQP groups. Immunoblotting analysis revealed that the expression of phospho-AMPK was increased whereas that of phospho-ACC was decreased in the 0.20% LQP group. In conclusion, we demonstrated that both LRP and LQP alleviated the severity of NASH in a high-fat diet-induced NASH mouse model. In addition, we showed that LRP and LQP modulated oxidative stress and upregulated AMPK/ACC, respectively. Thus, LRP and LQP may constitute clinically applicable therapeutic agents for NASH.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Chuen-Mao, E-mail: chuenmao@mail.cgu.edu.tw; Heart Failure Center, Division of Cardiology, Department of Internal Medicine, Chang Gung Memorial Hospital at Keelung, Keelung, Taiwan; Lee, I-Ta
TNF-α plays a mediator role in the pathogenesis of chronic heart failure contributing to cardiac remodeling and peripheral vascular disturbances. The implication of TNF-α in inflammatory responses has been shown to be mediated through up-regulation of matrix metalloproteinase-9 (MMP-9). However, the detailed mechanisms of TNF-α-induced MMP-9 expression in rat embryonic-heart derived H9c2 cells are largely not defined. We demonstrated that in H9c2 cells, TNF-α induced MMP-9 mRNA and protein expression associated with an increase in the secretion of pro-MMP-9. TNF-α-mediated responses were attenuated by pretreatment with the inhibitor of ROS (N-acetyl-L-cysteine, NAC), NADPH oxidase [apocynin (APO) or diphenyleneiodonium chloride (DPI)],more » MEK1/2 (U0126), p38 MAPK (SB202190), JNK1/2 (SP600125), NF-κB (Bay11-7082), or PYK2 (PF-431396) and transfection with siRNA of TNFR1, p47{sup phox}, p42, p38, JNK1, p65, or PYK2. Moreover, TNF-α markedly induced NADPH oxidase-derived ROS generation in these cells. TNF-α-enhanced p42/p44 MAPK, p38 MAPK, JNK1/2, and NF-κB (p65) phosphorylation and in vivo binding of p65 to the MMP-9 promoter were inhibited by U0126, SB202190, SP600125, NAC, DPI, or APO. In addition, TNF-α-mediated PYK2 phosphorylation was inhibited by NAC, DPI, or APO. PYK2 inhibition could reduce TNF-α-stimulated MAPKs and NF-κB activation. Thus, in H9c2 cells, we are the first to show that TNF-α-induced MMP-9 expression is mediated through a TNFR1/NADPH oxidase/ROS/PYK2/MAPKs/NF-κB cascade. We demonstrated that NADPH oxidase-derived ROS generation is involved in TNF-α-induced PYK2 activation in these cells. Understanding the regulation of MMP-9 expression and NADPH oxidase activation by TNF-α on H9c2 cells may provide potential therapeutic targets of chronic heart failure. - Highlights: • TNF-α induces MMP-9 secretion and expression via a TNFR1-dependent pathway. • TNF-α induces ROS/PYK2-dependent MMP-9 expression in H9c2 cells. • TNF-α induces MMP-9 expression via a NADPH oxidase/ROS-dependent NF-κB signaling. • TNF-α activates MAPK phosphorylation through NADPH oxidase/ROS generation.« less
Mia, Masum M.; Boersema, Miriam; Bank, Ruud A.
2014-01-01
One of the most potent pro-fibrotic cytokines is transforming growth factor (TGFβ). TGFβ is involved in the activation of fibroblasts into myofibroblasts, resulting in the hallmark of fibrosis: the pathological accumulation of collagen. Interleukin-1β (IL1β) can influence the severity of fibrosis, however much less is known about the direct effects on fibroblasts. Using lung and dermal fibroblasts, we have investigated the effects of IL1β, TGFβ1, and IL1β in combination with TGFβ1 on myofibroblast formation, collagen synthesis and collagen modification (including prolyl hydroxylase, lysyl hydroxylase and lysyl oxidase), and matrix metalloproteinases (MMPs). We found that IL1β alone has no obvious pro-fibrotic effect on fibroblasts. However, IL1β is able to inhibit the TGFβ1-induced myofibroblast formation as well as collagen synthesis. Glioma-associated oncogene homolog 1 (GLI1), the Hedgehog transcription factor that is involved in the transformation of fibroblasts into myofibroblasts is upregulated by TGFβ1. The addition of IL1β reduced the expression of GLI1 and thereby also indirectly inhibits myofibroblast formation. Other potentially anti-fibrotic effects of IL1β that were observed are the increased levels of MMP1, −2, −9 and −14 produced by fibroblasts exposed to TGFβ1/IL1β in comparison with fibroblasts exposed to TGFβ1 alone. In addition, IL1β decreased the TGFβ1-induced upregulation of lysyl oxidase, an enzyme involved in collagen cross-linking. Furthermore, we found that lung and dermal fibroblasts do not always behave identically towards IL1β. Suppression of COL1A1 by IL1β in the presence of TGFβ1 is more pronounced in lung fibroblasts compared to dermal fibroblasts, whereas a higher upregulation of MMP1 is seen in dermal fibroblasts. The role of IL1β in fibrosis should be reconsidered, and the differences in phenotypical properties of fibroblasts derived from different organs should be taken into account in future anti-fibrotic treatment regimes. PMID:24622053
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Xianwei, E-mail: XWang2@UAMS.edu; Lu, Jingjun; Khaidakov, Magomed
Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiacmore » fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac fibroblast growth and collagen formation. ► Aspirin decreases the transcription of angiotensin II type 1 receptor by inhibiting NADPH oxidase–NF-κB pathway. ► The inhibition of angiotensin II type 1 receptor expression may be the basis for reduction in fibroblast growth and collagen formation. ► The effects of aspirin appear to be mediated via its salicylate moiety.« less
Uehara, Eriko; Hokazono, Hideki; Hida, Mariko; Sasaki, Takako; Yoshioka, Hidekatsu; Matsuo, Noritaka
2017-06-01
The multiple physiological effects of γ-aminobutyric acid (GABA) as a functional food component have been recently reported. We previously reported that GABA upregulated the expression of type I collagen in human dermal fibroblasts (HDFs), and that oral administration of GABA significantly increased skin elasticity. However, details of the regulatory mechanism still remain unknown. In this study, we further examined the effects of GABA on elastin synthesis and elastin fiber formation in HDFs. Real-time PCR indicated that GABA significantly increased the expression of tropoelastin transcript in a dose-dependent manner. Additionally, the expression of fibrillin-1, fibrillin-2, and fibulin-5/DANCE, but not lysyl oxidase and latent transforming factor-β-binding protein 4, were also significantly increased in HDFs. Finally, immunohistochemical analysis confirmed that treatment with GABA dramatically increased the formation of elastic fibers in HDFs. Taken together, our results showed that GABA improves skin elasticity in HDFs by upregulating elastin synthesis and elastin fiber formation.
Influence of proline position upon the ion channel activity of alamethicin.
Kaduk, C; Duclohier, H; Dathe, M; Wenschuh, H; Beyermann, M; Molle, G; Bienert, M
1997-01-01
Alamethicin, a 20-residue peptaibol, induces voltage-dependent ion channels in lipid bilayers according to the barrel-stave model. To study relationships between the proline-14-induced kink region and the channel-forming behavior of the peptide, a set of alamethicin analogs with proline incorporated at positions 11, 12, 13, 14, 15, 16, and 17, respectively, as well as an analog with alanine instead of proline at position 14 were synthesized. Macroscopic conductance experiments show that the voltage dependence of the peptides is conserved although slightly influenced, but the apparent mean number of monomers forming the channels is significantly reduced when proline is not located at position 14. This is confirmed in single-channel experiments. The analogs with proline next to position 14 (i.e., 13, 15, 16) show stable conductance levels, but of reduced number, which follows the order Alam-P14 > Alam-P15 > Alam-P16 > Alam-P13. This reduction in the number of levels is connected with changes in the lifetime of the channels. Analogs with proline at position 11, 12, or 17 produce erratic, extremely short-lived current events that could not be resolved. The changes in functional properties are related to structural properties as probed by circular dichroism. The results indicate that proline at position 14 results in optimal channel activity, whereas channels formed by the analogs bearing proline at different positions are considerably less stable. PMID:9129817
Penultimate proline in neuropeptides.
Glover, Matthew S; Bellinger, Earl P; Radivojac, Predrag; Clemmer, David E
2015-08-18
A recent ion mobility spectrometry-mass spectrometry (IMS-MS) study revealed that tryptic peptide ions containing a proline residue at the second position from the N-terminus (i.e., penultimate proline) frequently adopt multiple conformations, owing to the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds [J. Am. Soc. Mass Spectrom. 2015, 26, 444]. Here, we present a statistical analysis of a neuropeptide database that illustrates penultimate proline residues are frequently found in neuropeptides. In order to probe the effect of penultimate proline on neuropeptide conformations, IMS-MS experiments were performed on two model peptides in which penultimate proline residues were known to be important for biological activity: the N-terminal region of human neuropeptide Y (NPY1-9, Tyr(1)-Pro(2)-Ser(3)-Lys(4)-Pro(5)-Asp(6)-Asn(7)-Pro(8)-Gly(9)-NH2) and a tachykinin-related peptide (CabTRP Ia, Ala(1)-Pro(2)-Ser(3)-Gly(4)-Phe(5)-Leu(6)-Gly(7)-Met(8)-Arg(9)-NH2). From these studies, it appears that penultimate prolines allow neuropeptides to populate multiple conformations arising from the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds. Although it is commonly proposed that the role of penultimate proline residues is to protect peptides from enzymatic degradation, the present results indicate that penultimate proline residues also are an important means of increasing the conformational heterogeneity of neuropeptides.
Hydroxyproline Ring Pucker Causes Frustration of Helix Parameters in the Collagen Triple Helix
NASA Astrophysics Data System (ADS)
Ying Chow, W.; Bihan, Dominique; Forman, Chris J.; Slatter, David A.; Reid, David G.; Wales, David J.; Farndale, Richard W.; Duer, Melinda J.
2015-07-01
Collagens, the most abundant proteins in mammals, are defined by their triple-helical structures and distinctive Gly-Xaa-Yaa repeating sequence, where Xaa is often proline and Yaa, hydroxyproline (Hyp/O). It is known that hydroxyproline in the Yaa position stabilises the triple helix, and that lack of proline hydroxylation in vivo leads to dysfunctional collagen extracellular matrix assembly, due to a range of factors such as a change in hydration properties. In addition, we note that in model peptides, when Yaa is unmodified proline, the Xaa proline has a strong propensity to adopt an endo ring conformation, whilst when Yaa is hydroxyproline, the Xaa proline adopts a range of endo and exo conformations. Here we use a combination of solid-state NMR spectroscopy and potential energy landscape modelling of synthetic triple-helical collagen peptides to understand this effect. We show that hydroxylation of the Yaa proline causes the Xaa proline ring conformation to become metastable, which in turn confers flexibility on the triple helix.
Hydroxyproline Ring Pucker Causes Frustration of Helix Parameters in the Collagen Triple Helix
Ying Chow, W.; Bihan, Dominique; Forman, Chris J.; Slatter, David A.; Reid, David G.; Wales, David J.; Farndale, Richard W.; Duer, Melinda J.
2015-01-01
Collagens, the most abundant proteins in mammals, are defined by their triple-helical structures and distinctive Gly-Xaa-Yaa repeating sequence, where Xaa is often proline and Yaa, hydroxyproline (Hyp/O). It is known that hydroxyproline in the Yaa position stabilises the triple helix, and that lack of proline hydroxylation in vivo leads to dysfunctional collagen extracellular matrix assembly, due to a range of factors such as a change in hydration properties. In addition, we note that in model peptides, when Yaa is unmodified proline, the Xaa proline has a strong propensity to adopt an endo ring conformation, whilst when Yaa is hydroxyproline, the Xaa proline adopts a range of endo and exo conformations. Here we use a combination of solid-state NMR spectroscopy and potential energy landscape modelling of synthetic triple-helical collagen peptides to understand this effect. We show that hydroxylation of the Yaa proline causes the Xaa proline ring conformation to become metastable, which in turn confers flexibility on the triple helix. PMID:26220399
Enthalpy characteristics of L-proline dissolution in certain water-organic mixtures at 298.15 K
NASA Astrophysics Data System (ADS)
Badelin, V. G.; Smirnov, V. I.
2017-01-01
A thermochemical study of the processes of L-proline dissolution in aqueous solutions of acetonitrile, 1,4-dioxane, acetone, dimethyl sulfoxide, nitromethane and tetrahydrofuran at T = 298.15 K in the range of organic solvent concentrations x2 = 0-0.25 mole fractions is performed. Standard values of the enthalpies of solution and transfer of L-proline from water to mixed solvent, and the enthalpy coefficients of pairwise interactions between L-proline and molecules of organic solvents, are calculated. The effect the composition of a water-organic mixture and the structure of organic solvents have on the enthalpy characteristics of L-proline dissolution and transfer is examined. The effect the energy properties of intermolecular interactions between components of a mixed solvent has on the intermolecular interactions between L-proline and molecules of cosolvent is estimated. The correlation between the enthalpy characteristics of L-proline dissolution and electron-donor properties of organic cosolvent in aqueous solutions is determined.
Nadeem, Ahmed; Ahmad, Sheikh F; Bakheet, Saleh A; Al-Harbi, Naif O; Al-Ayadhi, Laila Y; Attia, Sabry M; Zoheir, Khairy M A
2017-03-01
Autism spectrum disorders (ASD) affect millions of children worldwide, and are characterized by impairment in social interaction and communication, and specific repetitive behavioral patterns. Growing evidence highlights a role of toll-like receptors (TLRs) in the pathogenesis of ASD. Specifically, TLR-4 activation has been shown to be associated with increased pro-inflammatory cytokines as well as autistic symptoms in offspring. NADPH oxidase (NOX-2) derived reactive oxygen species (ROS) have also been shown to play pathogenic role under inflammatory conditions. However, the role of TLR-4 in the regulation of NOX-2 derived ROS has not been explored in ASD, particularly in T cells. Therefore, this study explored TLR-4 and NOX-2 related signaling in peripheral T cells of ASD patients (n=35) and age-matched typically developing children (n=30). In this study, we find that ASD individuals have increased TLR-4 expression on T cells which is associated with increased NOX-2 expression and ROS generation as compared to typically developing children. Moreover, activation of TLR-4 on T cells by lipopolysaccharide (LPS) in vitro leads to enhanced generation of NOX-2 derived ROS via nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) pathway. These data support a link between T cell TLR-4 activation and NOX-2/ROS upregulation in ASD patients. Our study has implications in the context of neuroinflammation observed in ASD patients as ROS may lead to amplification and perpetuation of inflammation both in the periphery and central nervous system. Our data also suggest that therapeutic targeting of TLR-4 signaling may lead to reduction in inflammation of ASD patients. Copyright © 2016 Elsevier Inc. All rights reserved.
Jeannotte, Guillaume; Lubell, William D
2004-11-10
For the first time, the influence of a fused Delta3-arylproline on peptide conformation has been studied by the synthesis and comparison of the conformations of peptides containing proline and pyrrolo-proline, 3 (PyPro). Pyrrolo-proline was demonstrated to be a conservative replacement for Pro in model beta-turns, 4 and 5, as shown by their similar DMSO titration curves, cis/trans-isomer populations, and NOESY spectral data. Pyrrolo-proline may thus be used for studying the structure activity relationships of Pro-containing peptides with minimal modification of secondary structures.
Rubio, Maria C; Bustos-Sanmamed, Pilar; Clemente, Maria R; Becana, Manuel
2009-03-01
Salt stress negatively affects many physiological processes in plants. Some of these effects may involve the oxidative damage of cellular components, which can be promoted by reactive oxygen species and prevented by antioxidants. The protective role of antioxidants was investigated in Lotus japonicus exposed to two salinization protocols: S1 (150 mM NaCl for 7 d) and S2 (50, 100 and 150 mM NaCl, each concentration for 6 d). Several markers of salt stress were measured and the expression of antioxidant genes was analyzed using quantitative reverse transcription–polymerase chain reaction and, in some cases, immunoblots and enzyme activity assays. Leaves of S1 plants suffered from mild osmotic stress, accumulated proline but noNa+, and showed induction of many superoxide dismutase and glutathione peroxidase genes. Leaves of S2 plants showed increases in Na+ and Ca2+, decreases in K+, and accumulation of proline and malondialdehyde. In leaves and roots of S1 and S2 plants, the mRNA, protein and activity levels of the ascorbate-glutathione enzymes remained constant, with a few exceptions. Notably, there was consistent up-regulation of the gene encoding cytosolic dehydroascorbate reductase, and this was possibly related to its role in ascorbate recycling in the apoplast. The overall results indicate that L. japonicus is more tolerant to salt stress than other legumes, which can be attributed to the capacity of the plant to prevent Na+reaching the shoot and to activate antioxidant defenses.
Karim, Sumera; Liaskou, Evaggelia; Fear, Janine; Garg, Abhilok; Reynolds, Gary; Claridge, Lee; Adams, David H; Newsome, Philip N; Lalor, Patricia F
2014-12-15
Insulin resistance is common in patients with chronic liver disease (CLD). Serum levels of soluble vascular adhesion protein-1 (VAP-1) are also increased in these patients. The amine oxidase activity of VAP-1 stimulates glucose uptake via translocation of transporters to the cell membrane in adipocytes and smooth muscle cells. We aimed to document human hepatocellular expression of glucose transporters (GLUTs) and to determine if VAP-1 activity influences receptor expression and hepatic glucose uptake. Quantitative PCR and immunocytochemistry were used to study human liver tissue and cultured cells. We also used tissue slices from humans and VAP-1-deficient mice to assay glucose uptake and measure hepatocellular responses to stimulation. We report upregulation of GLUT1, -3, -5, -6, -7, -8, -9, -10, -11, -12, and -13 in CLD. VAP-1 expression and enzyme activity increased in disease, and provision of substrate to hepatic VAP-1 drives hepatic glucose uptake. This effect was sensitive to inhibition of VAP-1 and could be recapitulated by H2O2. VAP-1 activity also altered expression and subcellular localization of GLUT2, -4, -9, -10, and -13. Therefore, we show, for the first time, alterations in hepatocellular expression of glucose and fructose transporters in CLD and provide evidence that the semicarbazide-sensitive amine oxidase activity of VAP-1 modifies hepatic glucose homeostasis and may contribute to patterns of GLUT expression in chronic disease. Copyright © 2014 the American Physiological Society.
Paradoxical roles of dual oxidases in cancer biology.
Little, Andrew C; Sulovari, Arvis; Danyal, Karamatullah; Heppner, David E; Seward, David J; van der Vliet, Albert
2017-09-01
Dysregulated oxidative metabolism is a well-recognized aspect of cancer biology, and many therapeutic strategies are based on targeting cancers by altering cellular redox pathways. The NADPH oxidases (NOXes) present an important enzymatic source of biological oxidants, and the expression and activation of several NOX isoforms are frequently dysregulated in many cancers. Cell-based studies have demonstrated a role for several NOX isozymes in controlling cell proliferation and/or cell migration, further supporting a potential contributing role for NOX in promoting cancer. While various NOX isoforms are often upregulated in cancers, paradoxical recent findings indicate that dual oxidases (DUOXes), normally prominently expressed in epithelial lineages, are frequently suppressed in epithelial-derived cancers by epigenetic mechanisms, although the functional relevance of such DUOX silencing has remained unclear. This review will briefly summarize our current understanding regarding the importance of reactive oxygen species (ROS) and NOXes in cancer biology, and focus on recent observations indicating the unique and seemingly opposing roles of DUOX enzymes in cancer biology. We will discuss current knowledge regarding the functional properties of DUOX, and recent studies highlighting mechanistic consequences of DUOX1 loss in lung cancer, and its consequences for tumor invasiveness and current anticancer therapy. Finally, we will also discuss potentially unique roles for the DUOX maturation factors. Overall, a better understanding of mechanisms that regulate DUOX and the functional consequences of DUOX silencing in cancer may offer valuable new diagnostic insights and novel therapeutic opportunities. Copyright © 2017 Elsevier Inc. All rights reserved.
Cao, Qi; Mak, Ki M; Lieber, Charles S
2005-07-01
Kupffer cells become activated in response to elevated levels of LPS during ethanol feeding, but the role of ethanol in the molecular processes of activation remains unclear. Because cytochrome P4502E1 (CYP2E1) is upregulated in Kupffer cells after ethanol, we hypothesized that this effect primes Kupffer cells, sensitizing them to increase TNF-alpha production in response to LPS. However, cultured Kupffer cells rapidly lose their CYP2E1. This difficulty was overcome by transfecting CYP2E1 to RAW 264.7 macrophages. Macrophages with stable increased CYP2E1 expression (E2) displayed increased levels of CD14/Toll-like receptor 4, NADPH oxidase and H2O2, accompanied by activation of ERK1/2, p38, and NF-kappaB. These increases primed E2 cells, sensitizing them to LPS stimuli, with amplification of LPS signaling, resulting in increased TNF-alpha production. Diphenyleneiodonium, a NADPH oxidase inhibitor, and diallyl sulfide, a CYP2E1 inhibitor, decreased approximately equally H2O2 levels in E2 cells, suggesting that NADPH oxidase and CYP2E1 contribute equally to H2O2 generation. Because CYP2E1 expression also enhanced the levels of the membrane localized NADPH oxidase subunits p47phox and p67phox, thereby contributing to the oxidase activation, it may augment H2O2 generation via this mechanism. H2O2, derived in part from NADPH and CYP2E1, activated ERK1/2 and p38. ERK1/2 stimulated TNF-alpha production via activation of NF-kappaB, whereas p38 promoted TNF-alpha production by stabilizing TNF-alpha mRNA. Oxidant generation after CYP2E1 overexpression appears to be central to macrophage priming and their sensitization to LPS. Accordingly, CYP2E1 priming could explain the sensitization of Kupffer cells to LPS activation by ethanol, a critical early step in alcoholic liver disease.
Michalkova, Veronika; Weiss, Brian L.; Attardo, Geoffrey M.; Aksoy, Serap
2014-01-01
The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. PMID:25038091
Lee, Chewook; Kalmar, Lajos; Xue, Bin; Tompa, Peter; Daughdrill, Gary W; Uversky, Vladimir N; Han, Kyou-Hoon
2014-03-01
IDPs function without relying on three-dimensional structures. No clear rationale for such a behavior is available yet. PreSMos are transient secondary structures observed in the target-free IDPs and serve as the target-binding "active" motifs in IDPs. Prolines are frequently found in the flanking regions of PreSMos. Contribution of prolines to the conformational stability of the helical PreSMos in IDPs is investigated. MD simulations are performed for several IDP segments containing a helical PreSMo and the flanking prolines. To measure the influence of flanking-prolines on the structural content of a helical PreSMo calculations were done for wild type as well as for mutant segments with Pro→Asp, His, Lys, or Ala. The change in the helicity due to removal of a proline was measured both for the PreSMo region and for the flanking regions. The α-helical content in ~70% of the helical PreSMos at the early stage of simulation decreases due to replacement of an N-terminal flanking proline by other residues whereas the helix content in nearly all PreSMos increases when the same replacements occur at the C-terminal flanking region. The helix destabilizing/terminating role of the C-terminal flanking prolines is more pronounced than the helix promoting effect of the N-terminal flanking prolines. This work represents a novel example demonstrating that a proline is encoded in an IDP with a defined purpose. The helical PreSMos presage their target-bound conformations. As they most likely mediate IDP-target binding via conformational selection their helical content can be an important feature for IDP function. Copyright © 2013 Elsevier B.V. All rights reserved.
Michalkova, Veronika; Benoit, Joshua B; Weiss, Brian L; Attardo, Geoffrey M; Aksoy, Serap
2014-09-01
The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Liu, Jianghai; Wang, Rui; Desai, Kaushik; Wu, Lingyun
2011-12-01
Methylglyoxal (MG) overproduction has been reported in metabolic syndrome with hyperglycaemia (diabetes) or without hyperglycaemia (hypertension), and the underlying mechanism was investigated. Contributions of different pathways or enzymes to MG formation were evaluated in aorta or cultured vascular smooth muscle cells (VSMCs). In all four animal models of metabolic syndrome, i.e. chronically fructose-fed hypertensive Sprague-Dawley rats, spontaneously hypertensive rats, obese non-diabetic Zucker rats, and diabetic Zucker rats, serum and aortic MG and fructose levels were increased, and the expression of GLUT5 (transporting fructose) and aldolase B (converting fructose to MG) in aorta were up-regulated. Aortic expressions of aldolase A, semicarbazide-sensitive amine oxidase (SSAO), and cytochrome P450 2E1 (CYP 2E1), accounting for MG formation during glycolysis, protein, and lipid metabolism, respectively, was unchanged/reduced. Fructose (25 mM) treatment of VSMCs up-regulated the expression of GLUT5 and aldolase B and accelerated MG formation. Insulin (100 nM) increased GLUT5 expression and augmented fructose-increased cellular fructose accumulation and MG formation. Glucose (25 mM) treatment activated the polyol pathway and enhanced fructose formation, leading to aldolase B upregulation and MG overproduction. Inhibition of the polyol pathway reduced the glucose-increased aldolase B expression and MG generation. The excess formation of MG in under these conditions was eliminated by knock-down of aldolase B, but not by knock-down of aldolase A or inhibition of SSAO or CYP 2E1. Upregulation of aldolase B by accumulated fructose is a common mechanism for MG overproduction in VSMCs and aorta in different models of metabolic syndrome.
NASA Astrophysics Data System (ADS)
Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L. C.
2011-12-01
We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D2O and compare with experimental observations.
Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L C
2011-12-21
We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D(2)O and compare with experimental observations.
Proline accumulation and its implication in cold tolerance of regenerable maize callus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, D.R.; Widholm, J.M.
1987-03-01
Embryogenic callus of maize (Zea mays L.) inbreds B37wx, H99, H99/sup 3/H95, Mo17, and Pa91 accumulated proline to levels 2.1 to 2.5 times that of control callus when subjected to mannitol-induced water stress, cool temperatures (19/sup 0/C) and abscisic acid (ABA). A combination of 0.53 molar mannitol plus 0.1 millimolar ABA induced a proline accumulation to about 4.5 times that of control callus, equivalent to approximately 0.18 millimoles proline per gram fresh weight of callus. Proline accumulation was directly related to the level of mannitol in the medium. Levels of ABA greater than 1.0 micromolar were required in the mediummore » to induce proline accumulation comparable to that induced by mannitol. Mannitol and ABA levels that induced maximum accumulation of proline also inhibited callus growth and increased tolerance to cold. Proline (12 millimolar) added to culture media also increased the tolerance of callus to 4/sup 0/C. The increased cold tolerance induced by the combination of mannitol and ABA has permitted the storage of the maize inbreds A632, A634Ht, B37wx, C103DTrf, Fr27rhm, H99, Pa91, Va35, and W117Ht at 4/sup 0/C for 90 days which is more than double the typical survival time of callus. These studies show that proline accumulation increase the cold tolerance of regenerable maize callus.« less
Arrieta-Cruz, Isabel; Su, Ya; Knight, Colette M; Lam, Tony K T; Gutiérrez-Juárez, Roger
2013-04-01
The metabolism of lactate to pyruvate in the mediobasal hypothalamus (MBH) regulates hepatic glucose production. Because astrocytes and neurons are functionally linked by metabolic coupling through lactate transfer via the astrocyte-neuron lactate shuttle (ANLS), we reasoned that astrocytes might be involved in the hypothalamic regulation of glucose metabolism. To examine this possibility, we used the gluconeogenic amino acid proline, which is metabolized to pyruvate in astrocytes. Our results showed that increasing the availability of proline in rats either centrally (MBH) or systemically acutely lowered blood glucose. Pancreatic clamp studies revealed that this hypoglycemic effect was due to a decrease of hepatic glucose production secondary to an inhibition of glycogenolysis, gluconeogenesis, and glucose-6-phosphatase flux. The effect of proline was mimicked by glutamate, an intermediary of proline metabolism. Interestingly, proline's action was markedly blunted by pharmacological inhibition of hypothalamic lactate dehydrogenase (LDH) suggesting that metabolic flux through LDH was required. Furthermore, short hairpin RNA-mediated knockdown of hypothalamic LDH-A, an astrocytic component of the ANLS, also blunted the glucoregulatory action of proline. Thus our studies suggest not only a new role for proline in the regulation of hepatic glucose production but also indicate that hypothalamic astrocytes are involved in the regulatory mechanism as well.
Huang, Zengrong; Zhao, Long; Chen, Dandan; Liang, Mingxiang; Liu, Zhaopu; Shao, Hongbo; Long, Xiaohua
2013-01-01
Proline accumulation is an important mechanism for osmotic regulation under salt stress. In this study, we evaluated proline accumulation profiles in roots, stems and leaves of Jerusalem artichoke (Helianthus tuberosus L.) plantlets under NaCl stress. We also examined HtP5CS, HtOAT and HtPDH enzyme activities and gene expression patterns of putative HtP5CS1, HtP5CS2, HtOAT, HtPDH1, and HtPDH2 genes. The objective of our study was to characterize the proline regulation mechanisms of Jerusalem artichoke, a moderately salt tolerant species, under NaCl stress. Jerusalem artichoke plantlets were observed to accumulate proline in roots, stems and leaves during salt stress. HtP5CS enzyme activities were increased under NaCl stress, while HtOAT and HtPDH activities generally repressed. Transcript levels of HtP5CS2 increased while transcript levels of HtOAT, HtPDH1 and HtPDH2 generally decreased in response to NaCl stress. Our results supports that for Jerusalem artichoke, proline synthesis under salt stress is mainly through the Glu pathway, and HtP5CS2 is predominant in this process while HtOAT plays a less important role. Both HtPDH genes may function in proline degradation.
Rosales, Miguel A; Ocampo, Edilia; Rodríguez-Valentín, Rocío; Olvera-Carrillo, Yadira; Acosta-Gallegos, Jorge; Covarrubias, Alejandra A
2012-07-01
Terminal drought is a major problem for common bean production because it occurs during the reproductive stage, importantly affecting seed yield. Diverse common bean cultivars with different drought susceptibility have been selected from different gene pools in several drought environments. To better understand the mechanisms associated with terminal drought resistance in a particular common bean race (Durango) and growth habit (type-III), we evaluated several metabolic and physiological parameters using two cultivars, Bayo Madero and Pinto Saltillo, with contrasting drought susceptibility. The common bean cultivars were submitted to moderate and severe terminal drought treatments under greenhouse conditions. We analyzed the following traits: relative growth rate, photosynthesis and transpiration rates, stomatal conductance, water-use efficiency, relative water content, proline accumulation, glycolate oxidase activity and their antioxidant response. Our results indicate that the competence of the drought-resistant cultivar (Pinto Saltillo) to maintain seed production upon terminal drought relies on an early response and fine-tuning of stomatal conductance, CO₂ diffusion and fixation, and by an increased water use and avoidance of ROS accumulation. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Chirally directed formation of nanometer-scale proline clusters.
Myung, Sunnie; Fioroni, Marco; Julian, Ryan R; Koeniger, Stormy L; Baik, Mu-Hyun; Clemmer, David E
2006-08-23
Ion mobility measurements, combined with molecular mechanics simulations, are used to study enantiopure and racemic proline clusters formed by electrospray ionization. Broad distributions of cluster sizes and charge states are observed, ranging from clusters containing only a few proline units to clusters that contain more than 100 proline units (i.e., protonated clusters of the form [xPro + nH](n+) with x = 1 to >100 and n = 1-7). As the sizes of clusters increase, there is direct evidence for nanometer scale, chirally induced organization into specific structures. For n = 4 and 5, enantiopure clusters of approximately 50 to 100 prolines assemble into structures that are more elongated than the most compact structure that is observed from the racemic proline clusters. A molecular analogue, cis-4-hydroxy-proline, displays significantly different behavior, indicating that in addition to the rigidity of the side chain ring, intermolecular interactions are important in the formation of chirally directed clusters. This is the first case in which assemblies of chirally selective elongated structures are observed in this size range of amino acid clusters. Relationships between enantiopurity, cluster shape, and overall energetics are discussed.
Mouse d-Amino-Acid Oxidase: Distribution and Physiological Substrates
Koga, Reiko; Miyoshi, Yurika; Sakaue, Hiroaki; Hamase, Kenji; Konno, Ryuichi
2017-01-01
d-Amino-acid oxidase (DAO) catalyzes the oxidative deamination of d-amino acids. DAO is present in a wide variety of organisms and has important roles. Here, we review the distribution and physiological substrates of mouse DAO. Mouse DAO is present in the kidney, brain, and spinal cord, like DAOs in other mammals. However, in contrast to other animals, it is not present in the mouse liver. Recently, DAO has been detected in the neutrophils, retina, and small intestine in mice. To determine the physiological substrates of mouse DAO, mutant mice lacking DAO activity are helpful. As DAO has wide substrate specificity and degrades various d-amino acids, many d-amino acids accumulate in the tissues and body fluids of the mutant mice. These amino acids are d-methionine, d-alanine, d-serine, d-leucine, d-proline, d-phenylalanine, d-tyrosine, and d-citrulline. Even in wild-type mice, administration of DAO inhibitors elevates D-serine levels in the plasma and brain. Among the above d-amino acids, the main physiological substrates of mouse DAO are d-alanine and d-serine. These two d-amino acids are most abundant in the tissues and body fluids of mice. d-Alanine derives from bacteria and produces bactericidal reactive oxygen species by the action of DAO. d-Serine is synthesized by serine racemase and is present especially in the central nervous system, where it serves as a neuromodulator. DAO is responsible for the metabolism of d-serine. Since DAO has been implicated in the etiology of neuropsychiatric diseases, mouse DAO has been used as a representative model. Recent reports, however, suggest that mouse DAO is different from human DAO with respect to important properties. PMID:29255714
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra
2013-01-01
Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573
Wang, Haibo; Han, Xiaokun; Wittchen, Erika S; Hartnett, M Elizabeth
2016-01-01
Inflammation, oxidative stress, and angiogenesis have been proposed to interact in age-related macular degeneration. It has been postulated that external stimuli that cause oxidative stress can increase production of vascular endothelial growth factor (VEGF) in retinal pigment epithelial (RPE) cells. In this study, we tested the hypothesis that the inflammatory cytokine, tumor necrosis factor alpha (TNF-α), contributed to choroidal neovascularization (CNV) by upregulating VEGF in RPE through intracellular reactive oxygen species (ROS)-dependent signaling and sought to understand the mechanisms involved. In a murine laser-induced CNV model, 7 days after laser treatment and intravitreal neutralizing mouse TNF-α antibody or isotype immunoglobulin G (IgG) control, the following measurements were made: 1) TNF-α protein and VEGF protein in RPE/choroids with western blot, 2) CNV volume in RPE/choroidal flatmounts, and 3) semiquantification of oxidized phospholipids stained with E06 antibody within CNV with immunohistochemistry (IHC). In cultured human RPE cells treated with TNF-α or PBS control, 1) ROS generation was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFDA) fluorescence assay, and 2) NOX4 protein and VEGF protein or mRNA were measured with western blot or quantitative real-time PCR in cells pretreated with apocynin or nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) inhibitor, VAS 2870, or transfected with p22phox siRNA, and each was compared to its appropriate control. Western blots of phosphorylated p65 (p-p65), total p65 and β-actin, and quantitative real-time PCR of VEGF mRNA were measured in human RPE cells treated with TNF-α and pretreatment with the nuclear factor kappa B inhibitor, Bay 11-7082 or control. Western blots of β-catenin, VEGF, and p22phox and coimmunoprecipitation of β-catenin and T-cell transcriptional factor were performed in human RPE cells treated with TNF-α following pretreatment with β-catenin transcriptional inhibitors, XAV939 or JW67, or transfection with p22phox siRNA and compared to appropriate controls. Compared to the non-lasered control, TNF-α and VEGF protein were increased in the RPE/choroids in a murine laser-induced CNV model (p<0.05). An intravitreal neutralizing antibody to mouse TNF-α reduced CNV volume, and VEGF protein in the RPE/choroids (p<0.01) and oxidized phospholipids within CNV compared to IgG control (p<0.05). In cultured RPE cells and compared to controls, TNF-α induced ROS generation and increased activation of NOX4, an isoform of NADPH oxidase; both were prevented by pretreatment with the apocynin or VAS2870 or knockdown of p22phox, a subunit of NADPH oxidase. TNF-α treatment increased VEGF expression (p<0.001) and the formation of a transcriptional complex of β-catenin and T-cell transcriptional factor; both were prevented by pretreatment with apocynin or knockdown of p22phox. Inhibition of β-catenin by XAV939, but not the nuclear factor kappa B inhibitor, Bay 11-7082, prevented TNF-α-induced VEGF upregulation. Our results support the thinking that TNF-α contributes to CNV by upregulating VEGF production in RPE cells through ROS-dependent activation of β-catenin signaling. These results provide mechanisms of crosstalk between inflammatory mediator, TNF-α, and ROS in RPE cells.
Sasano, Yu; Haitani, Yutaka; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi
2012-01-03
During bread-making processes, yeast cells are exposed to various baking-associated stresses. High-sucrose concentrations exert severe osmotic stress that seriously damages cellular components by generation of reactive oxygen species (ROS). Previously, we found that the accumulation of proline conferred freeze-thaw stress tolerance and the baker's yeast strain that accumulated proline retained higher-level fermentation abilities in frozen doughs than the wild-type strain. In this study, we constructed self-cloning diploid baker's yeast strains that accumulate proline. These resultant strains showed higher cell viability and lower intracellular oxidation levels than that observed in the wild-type strain under high-sucrose stress condition. Proline accumulation also enhanced the fermentation ability in high-sucrose-containing dough. These results demonstrate the usefulness of proline-accumulating baker's yeast for sweet dough baking. Copyright © 2011 Elsevier B.V. All rights reserved.
Hamasu, Kousuke; Shigemi, Kazutaka; Kabuki, Yusuke; Tomonaga, Shozo; Denbow, D Michael; Furuse, Mitsuhiro
2009-08-21
Using microdialysis, we investigated the effect of l-proline on monoamine release in the medio-rostral neostriatum/hyperstriatum ventrale (MNH) of freely moving and restricted chicks. A 30 min handling-stress resulted in a significant increase in extracellular homovallinic acid (HVA), a dopamine metabolite, and 5-hydroxyindoleacetic acid (5-HIAA), a serotonin metabolite, in the MNH. l-Proline, perfused through the microdialysis probe into the MNH during the stressed condition, significantly attenuated the average dialysate concentration of HVA produced by handling-stress. Handling-stress resulted in a significant increase in 5-HIAA levels in the control group, which were attenuated by profusion with l-proline. l-Proline did not significantly modify basal concentrations of HVA or 5-HIAA in the MNH during control conditions. These results show that perfusion of l-proline modified the turnover/metabolism of dopamine and serotonin in the MNH caused by handling-stress.
Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism
Bouillaut, Laurent; Self, William T.
2013-01-01
Clostridium difficile, a proteolytic Gram-positive anaerobe, has emerged as a significant nosocomial pathogen. Stickland fermentation reactions are thought to be important for growth of C. difficile and appear to influence toxin production. In Stickland reactions, pairs of amino acids donate and accept electrons, generating ATP and reducing power in the process. Reduction of the electron acceptors proline and glycine requires the d-proline reductase (PR) and the glycine reductase (GR) enzyme complexes, respectively. Addition of proline in the medium increases the level of PR protein but decreases the level of GR. We report the identification of PrdR, a protein that activates transcription of the PR-encoding genes in the presence of proline and negatively regulates the GR-encoding genes. The results suggest that PrdR is a central metabolism regulator that controls preferential utilization of proline and glycine to produce energy via the Stickland reactions. PMID:23222730
Proline accumulation in lemongrass (Cymbopogon flexuosus Stapf.) due to heavy metal stress.
Handique, G K; Handique, A K
2009-03-01
Toxic heavy metals viz. lead, mercury and cadmium induced differential accumulation of proline in lemongrass (Cymbopogon flexuosus Stapf.) grown in soil amended with 50, 100, 200, 350 and 500 mg kg(-1) of the metals have been studied. Proline accumulation was found to be metal specific, organ specific and linear dose dependant. Further, proline accumulation following short term exposure (two months after transplantation) was higher than long term exposure (nine months after transplantation). Proline accumulation following short term exposure was 2.032 to 3.839 micro moles g(-1) for cadmium (50-200 mg kg(-1)); the corresponding range for mercury was 1.968 to 5.670 micro moles g(-1) and 0.830 to 4.567 micro moles g(-1) for lead (50-500 mg kg(-1) for mercury and lead). Proline accumulation was consistently higher in young tender leaf than old leaf, irrespective of the metal or duration of exposure. For cadmium treatment proline level was 2.032 to 3.839 micro moles g(-1) for young leaves while the corresponding value for old leaf was 1.728 to 2.396 micro moles g(-1) following short term exposure. The same trend was observed for the other two metals and duration of exposure. For control set proline accumulation in root was 0.425 micro moles g(-1) as against 0.805 and 0.533 micro moles g(-1) in young and old leaves respectively indicating that proline accumulation in root are lower than leaves, under both normal and stressed condition.
Positional preference of proline in alpha-helices.
Kim, M. K.; Kang, Y. K.
1999-01-01
Conformational free energy calculations have been carried out for proline-containing alanine-based pentadecapeptides with the sequence Ac-(Ala)n-Pro-(Ala)m-NHMe, where n + m = 14, to figure out the positional preference of proline in alpha-helices. The relative free energy of each peptide was calculated by subtracting the free energy of the extended conformation from that of the alpha-helical one, which is used here as a measure of preference. The highest propensity is found for the peptide with proline at the N-terminus (i.e., Ncap + 1 position), and the next propensities are found at Ncap, N' (Ncap - 1), and C' (Ccap + 1) positions. These computed results are reasonably consistent with the positional propensities estimated from X-ray structures of proteins. The breaking in hydrogen bonds around proline is found to play a role in destabilizing alpha-helical conformations, which, however, provides the favored hydration of the corresponding N-H and C=O groups. The highest preference of proline at the beginning of alpha-helix appears to be due to the favored electrostatic and nonbonded energies between two residues preceding proline and the intrinsic stability of alpha-helical conformation of the proline residue itself as well as no disturbance in hydrogen bonds of alpha-helix by proline. The average free energy change for the substitution of Ala by Pro in a alpha-helix is computed to be 4.6 kcal/mol, which is in good agreement with the experimental value of approximately 4 kcal/mol estimated for an oligopeptide dimer and proteins of barnase and T4 lysozyme. PMID:10422838
Usui, Ippei; Schmidt, Stefan; Breit, Bernhard
2009-03-19
The dual Pd/proline-catalyzed alpha-allylation reaction of a variety of enolizable ketones and aldehydes with allylic alcohols is described. In this reaction, the choice of a large-bite angle ligand Xantphos and proline as the organocatalyst was essential for generation of the crucial pi-allyl Pd intermediate from allylic alcohol, followed by nucleophilic attack of the enamine formed in situ from the corresponding enolizable carbonyl substrate and proline.
l-Proline and RNA Duplex m-Value Temperature Dependence.
Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J
2017-08-03
The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.
Proline Scan of the hERG Channel S6 Helix Reveals the Location of the Intracellular Pore Gate
Thouta, Samrat; Sokolov, Stanislav; Abe, Yuki; Clark, Sheldon J.; Cheng, Yen M.; Claydon, Tom W.
2014-01-01
In Shaker-like channels, the activation gate is formed at the bundle crossing by the convergence of the inner S6 helices near a conserved proline-valine-proline motif, which introduces a kink that allows for electromechanical coupling with voltage sensor motions via the S4-S5 linker. Human ether-a-go-go-related gene (hERG) channels lack the proline-valine-proline motif and the location of the intracellular pore gate and how it is coupled to S4 movement is less clear. Here, we show that proline substitutions within the S6 of hERG perturbed pore gate closure, trapping channels in the open state. Performing a proline scan of the inner S6 helix, from Ile655 to Tyr667 revealed that gate perturbation occurred with proximal (I655P-Q664P), but not distal (R665P-Y667P) substitutions, suggesting that Gln664 marks the position of the intracellular gate in hERG channels. Using voltage-clamp fluorimetry and gating current analysis, we demonstrate that proline substitutions trap the activation gate open by disrupting the coupling between the voltage-sensing unit and the pore of the channel. We characterize voltage sensor movement in one such trapped-open mutant channel and demonstrate the kinetics of what we interpret to be intrinsic hERG voltage sensor movement. PMID:24606930
Ahmad, Ayaz; Hadi, Fazal; Ali, Nasir
2015-01-01
The comparative effect of fertilizers (NPK), plant growth regulators (GA3, IAA, Zeatin) and sodium chloride (NaCl) on Cd phytoaccumulation, proline and phenolics production in Cannabis sativa was evaluated. Proline and phenolices were correlated with Cd contents in plant. Cd significantly reduced the plant growth. Fertilizers application (in combination) most significantly increased the growth (19 cm root and 47 cm shoot) on Cd contaminated soil. All treatments increased the Cd contents in plant tissues. This increase was highly significant in fertilizers treated plants (1101, 121 and 544 ppm in roots, stem and leaves respectively). Significantly positive correlation was found between Cd concentration and dry biomass of root (R2=0.7511) and leaves (R2=0.5524). All treatments significantly increased the proline and total phenolics and maximum was recorded in NaCl treated plants followed by fertilizers. Proline was higher in roots while phenolics in leaves. The correlation between proline and phenolics was positive in leaf (R2=0.8439) and root (R2=0.5191). Proline and phenolics showed positive correlation with Cd concentration in plant. Conclusively, fertilizers in combination seem to be the better option for Cd phytoextraction. Further investigation is suggested to study the role of phenolics and proline in Cd phytoextraction.
De Blasio, Miles J; Huynh, Karina; Qin, Chengxue; Rosli, Sarah; Kiriazis, Helen; Ayer, Anita; Cemerlang, Nelly; Stocker, Roland; Du, Xiao-Jun; McMullen, Julie R; Ritchie, Rebecca H
2015-10-01
Diabetes-induced cardiac complications include left ventricular (LV) dysfunction and heart failure. We previously demonstrated that LV phosphoinositide 3-kinase p110α (PI3K) protects the heart against diabetic cardiomyopathy, associated with reduced NADPH oxidase expression and activity. Conversely, in dominant negative PI3K(p110α) transgenic mice (dnPI3K), reduced cardiac PI3K signaling exaggerated diabetes-induced cardiomyopathy, associated with upregulated NADPH oxidase. The goal was to examine whether chronic supplementation with the antioxidant coenzyme Q(10) (CoQ(10)) could attenuate LV superoxide and diabetic cardiomyopathy in a setting of impaired PI3K signaling. Diabetes was induced in 6-week-old nontransgenic and dnPI3K male mice via streptozotocin. After 4 weeks of diabetes, CoQ(10) supplementation commenced (10 mg/kg ip, 3 times/week, 8 weeks). At study end (12 weeks of diabetes), markers of LV function, cardiomyocyte hypertrophy, collagen deposition, NADPH oxidase, oxidative stress (3-nitrotyrosine), and concentrations of CoQ(9) and CoQ(10) were determined. LV NADPH oxidase (Nox2 gene expression and activity, and lucigenin-enhanced chemiluminescence), as well as oxidative stress, were increased by diabetes, exaggerated in diabetic dnPI3K mice, and attenuated by CoQ(10). Diabetes-induced LV diastolic dysfunction (prolonged deceleration time, elevated end-diastolic pressure, impaired E/A ratio), cardiomyocyte hypertrophy and fibrosis, expression of atrial natriuretic peptide, connective tissue growth factor, and β-myosin heavy chain were all attenuated by CoQ(10). Chronic CoQ(10) supplementation attenuates aspects of diabetic cardiomyopathy, even in a setting of reduced cardiac PI3K protective signaling. Given that CoQ(10) supplementation has been suggested to have positive outcomes in heart failure patients, chronic CoQ(10) supplementation may be an attractive adjunct therapy for diabetic heart failure. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Oakley, Clinton A.; Hopkinson, Brian M.; Schmidt, Gregory W.
2014-06-01
A terminal electron acceptor alternative to mitochondrial cytochrome c oxidase (COX), mitochondrial alternative oxidase (AOX), is ubiquitous in higher plants and represented in nearly every algal taxon but is poorly documented in dinoflagellates. AOX competes for electrons with the conventional COX and has been hypothesized to function as a means of reducing oxidative stress in mitochondria, as well as a potential mechanism for ameliorating thermal and other physiological stressors. Here, the presence of an active AOX in cultured Symbiodinium was assayed by the response of oxygen consumption to the AOX inhibitor salicylhydroxamic acid (SHAM) and the COX inhibitor cyanide (CN). CN-insensitive, SHAM-sensitive oxygen consumption was found to account for a large portion (26 %) of Symbiodinium dark respiration and is consistent with high levels of AOX activity. This experimental evidence of the existence of a previously unreported terminal oxidase was further corroborated by analysis of publicly available Symbiodinium transcriptome data. The potential for enhanced AOX expression to play a compensatory role in mediating thermal stress was supported by inhibitor assays of cultured Symbiodinium at low (18 °C), moderate (26 °C), and high (32 °C) temperature conditions. Maximum capacity of the putative AOX pathway as a proportion of total dark oxygen consumption was found to increase from 26 % at 26 °C to 45 % and 53 % at 18 °C and 32 °C, respectively, when cells were acclimated to the treatment temperatures. Cells assayed at 18 and 32 °C without acclimation exhibited either the same or lower AOX capacity as controls, suggesting that the AOX protein is upregulated under temperature stress. The physiological implications for the presence of AOX in the coral/algal symbiosis and its potential role in response to many forms of biotic and abiotic stress, particularly oxidative stress, are discussed.
Saibi, Walid; Feki, Kaouthar; Ben Mahmoud, Rihem; Brini, Faiçal
2015-11-01
The wheat dehydrin (DHN-5) gives birth to salinity tolerance to transgenic Arabidopsis plants by the regulation of proline metabolism and the ROS scavenging system. Dehydrins (DHNs) are involved in plant abiotic stress tolerance. In this study, we reported that salt tolerance of transgenic Arabidopsis plants overexpressing durum wheat dehydrin (DHN-5) was closely related to the activation of the proline metabolism enzyme (P5CS) and some antioxidant biocatalysts. Indeed, DHN-5 improved P5CS activity in the transgenic plants generating a significant proline accumulation. Moreover, salt tolerance of Arabidopsis transgenic plants was accompanied by an excellent activation of antioxidant enzymes like catalase (CAT), superoxide dismutase (SOD) and peroxide dismutase (POD) and generation of a lower level of hydrogen peroxide (H2O2) in leaves compared to the wild-type plants. The enzyme activities were enhanced in these transgenic plants in the presence of exogenous proline. Nevertheless, proline accumulation was slightly reduced in transgenic plants promoting chlorophyll levels. All these results suggest the crucial role of DHN-5 in response to salt stress through the activation of enzymes implicated in proline metabolism and in ROS scavenging enzymes.
Mikhailov, D; Daragan, V A; Mayo, K H
1995-01-01
13CH2-multiplet nuclear magnetic resonance relaxation studies on proline (P)-containing glycine (G)-based peptides, GP, PG, GPG, PGG, and GPGG, provided numerous dipolar auto- and cross-correlation times for various motional model analyses of backbone and proline-ring bond rotations. Molecular dynamics simulations and bond rotation energy profiles were calculated to assess which motions could contribute most to observed relaxation phenomena. Results indicate that proline restricts backbone psi 1, psi 2, and phi 2 motions by 50% relative to those found for a polyglycine control peptide. psi 1 rotations are more restricted in the trans-proline isomer state than in the cis form. A two-state jump model best approximates proline ring puckering which in water could occur either by the C gamma endo-exo or by the C2 interconversion mechanism. The temperature dependence (5 degrees to 75 degrees C) of C beta, and C gamma, and C delta angular changes is rather flat, suggesting a near zero enthalpic contribution to the ring puckering process. In lower dielectric solvents, dimethylsulfoxide and methanol, which may mimic the hydrophobic environment within a protein, the endo-exo mechanism is preferred. PMID:7787039
Proline Can Have Opposite Effects on Fast and Slow Protein Folding Phases
Osváth, Szabolcs; Gruebele, Martin
2003-01-01
Proline isomerization is well known to cause additional slow phases during protein refolding. We address a new question: does the presence of prolines significantly affect the very fast kinetics that lead to the formation of folding intermediates? We examined both the very slow (10–100 min) and very fast (4 μs–2.5 ms) folding kinetics of the two-domain enzyme yeast phosphoglycerate kinase by temperature-jump relaxation. Phosphoglycerate kinase contains a conserved cis-proline in position 204, in addition to several trans-prolines. Native cis-prolines have the largest effect on folding kinetics because the unfolded state favors trans isomerization, so we compared the kinetics of a P204H mutant with the wild-type as a proof of principle. The presence of Pro-204 causes an additional slow phase upon refolding from the cold denatured state, as reported in the literature. Contrary to this, the fast folding events are sped up in the presence of the cis-proline, probably by restriction of the conformational space accessible to the molecule. The wild-type and Pro204His mutant would be excellent models for off-lattice simulations probing the effects of conformational restriction on short timescales. PMID:12885665
Chirality transfer effects in proline-substituted coumarin compounds.
Park, Eun-Kyung; Park, Bongjeong; Choi, Jun-Ho; Choi, Kihang; Cho, Minhaeng
2009-08-13
Conformations of proline-substituted chromophores are determined by using circular dichroism (CD) spectroscopy and quantum chemistry calculation method. Coumarin is chosen for the optical chromophore and proline amino acid is attached to its C7 position. The coumarin-proline conjugate considered contains both fluorophore and peptide linker where any polypeptides or biomolecules can be additionally connected to the free carboxyl group of the proline. Thus, the coumarin-proline is a potentially useful composite chirality-probe system for studies of protein dynamics in solution. However, detailed conformation of coumarin ring with respect to the proline ring has to be determined first. We found that there are two possible conformers, which differ from each other by the relative orientation of the coumarin ring. Comparing the measured CD spectra with the calculated ones, we directly show that only one of the two conformers is dominant in polar solvents except for water. The present study suggests that the local structure around an optical chromophore, when it is introduced to polypeptides or other biomolecules, can be studied by examining the electronic optical activity of the probe chromophore, as long as the chirality transfer from the attached amino acid to the chromophore is significantly large.
Effect of Proline Mutations on the Monomer Conformations of Amylin
Chiu, Chi-cheng; Singh, Sadanand; de Pablo, Juan J.
2013-01-01
The formation of human islet amyloid polypeptide (hIAPP) is implicated in the loss of pancreatic β-cells in type II diabetes. Rat amylin, which differs from human amylin at six residues, does not lead to formation of amyloid fibrils. Pramlintide is a synthetic analog of human amylin that shares three proline substitutions with rat amylin. Pramlintide has a much smaller propensity to form amyloid aggregates and has been widely prescribed in amylin replacement treatment. It is known that the three prolines attenuate β-sheet formation. However, the detailed effects of these proline substitutions on full-length hIAPP remain poorly understood. In this work, we use molecular simulations and bias-exchange metadynamics to investigate the effect of proline substitutions on the conformation of the hIAPP monomer. Our results demonstrate that hIAPP can adopt various β-sheet conformations, some of which have been reported in experiments. The proline substitutions perturb the formation of long β-sheets and reduce their stability. More importantly, we find that all three proline substitutions of pramlintide are required to inhibit β conformations and stabilize the α-helical conformation. Fewer substitutions do not have a significant inhibiting effect. PMID:24010666
Synthesis of acrylic polymer beads for solid-supported proline-derived organocatalysts.
Kristensen, Tor E; Vestli, Kristian; Fredriksen, Kim A; Hansen, Finn K; Hansen, Tore
2009-07-16
A completely non-chromatographic and highly large-scale adaptable synthesis of acrylic polymer beads containing proline and prolineamides has been developed. Novel monomeric proline (meth)acrylates are prepared from hydroxyproline in only one step. Free-radical copolymerization then gives solid-supported proline organocatalysts directly in as little as two steps overall, without using any prefabricated solid supports, by using either droplet or dispersion polymerization. These affordable acrylic beads have highly favorable and adjustable swelling characteristics and are excellent reusable catalysts for organocatalytic reactions.
NASA Astrophysics Data System (ADS)
Fujisawa, Ikuhide; Kitamura, Yuji; Kato, Ryo; Aoki, Katsuyuki
2018-07-01
Resorcin[4]arene (resorcinol cyclic tetramer, abbreviated as RCT) or pyrogallol[4]arene (pyrogallol cyclic tetramer, PCT) form host-guest 1:1 complexes with DL-proline (DL-Pro) or L-proline (L-Pro), [RCT·DL-Pro]·2MeOH·3.5H2O (1) and 2[PCT·L-Pro]·2EtOH·10H2O (2), whose crystal structures have been determined. In each complex, the proline ligand is incorporated into the bowl-shaped cavity of RCT or PCT host molecules through Csbnd H … π interactions between alkyl protons of the pyrrolidine ring of proline and π-rings of RCT or PCT, forming an [RCT/PCT·Pro] structural fragment. In the crystal lattice, two [RCT/PCT·Pro] fragments self-associate to form a ligand-mediated dimeric structure, [RCT·D-Pro·L-Pro·RCT] in 1 or [PCT·L-Pro·L-Pro·PCT] in 2. A 1H NMR solution study gave the host‒ligand binding constants of 10.0 ± 1.1 M-1 for the RCT-DL-Pro system and 17.3 ± 1.3 M-1 for the PCT-L-Pro system. These complexes provide a synthetic model for the recognition of the proline residue in proline-containing substrates or inhibitors by enzymes through Csbnd H … π interaction. The CSD survey revealed that the absolute value of the torsion angle N-Cα-Csbnd O1 (O1 is cis to N) about the carboxyl Cα-C bond of proline is significantly smaller than that of the Cβ-Cα-Csbnd O2 (O2 is cis to Cβ) torsion angle.
Diehl, Roger C.; Guinn, Emily J.; Capp, Michael W.; Tsodikov, Oleg V.; Record, M. Thomas
2013-01-01
To quantify interactions of the osmolyte L-proline with protein functional groups and predict its effects on protein processes, we use vapor pressure osmometry to determine chemical potential derivatives dµ2/dm3 = µ23 quantifying preferential interactions of proline (component 3) with 21 solutes (component 2) selected to display different combinations of aliphatic or aromatic C, amide, carboxylate, phosphate or hydroxyl O, and/or amide or cationic N surface. Solubility data yield µ23 values for 4 less-soluble solutes. Values of µ23 are dissected using an ASA-based analysis to test the hypothesis of additivity and obtain α-values (proline interaction potentials) for these eight surface types and three inorganic ions. Values of µ23 predicted from these α-values agree with experiment, demonstrating additivity. Molecular interpretation of α-values using the solute partitioning model yields partition coefficients (Kp) quantifying the local accumulation or exclusion of proline in the hydration water of each functional group. Interactions of proline with native protein surface and effects of proline on protein unfolding are predicted from α-values and ASA information and compared with experimental data, with results for glycine betaine and urea, and with predictions from transfer free energy analysis. We conclude that proline stabilizes proteins because of its unfavorable interactions with (exclusion from) amide oxygens and aliphatic hydrocarbon surface exposed in unfolding, and that proline is an effective in vivo osmolyte because of the osmolality increase resulting from its unfavorable interactions with anionic (carboxylate and phosphate) and amide oxygens and aliphatic hydrocarbon groups on the surface of cytoplasmic proteins and nucleic acids. PMID:23909383
Zaprasis, Adrienne; Bleisteiner, Monika; Kerres, Anne; Hoffmann, Tamara
2014-01-01
The data presented here reveal a new facet of the physiological adjustment processes through which Bacillus subtilis can derive osmostress protection. We found that the import of proteogenic (Glu, Gln, Asp, Asn, and Arg) and of nonproteogenic (Orn and Cit) amino acids and their metabolic conversion into proline enhances growth under otherwise osmotically unfavorable conditions. Osmoprotection by amino acids depends on the functioning of the ProJ-ProA-ProH enzymes, but different entry points into this biosynthetic route are used by different amino acids to finally yield the compatible solute proline. Glu, Gln, Asp, and Asn are used to replenish the cellular pool of glutamate, the precursor for proline production, whereas Arg, Orn, and Cit are converted into γ-glutamic semialdehyde/Δ1-pyrroline-5-carboxylate, an intermediate in proline biosynthesis. The import of Glu, Gln, Asp, Asn, Arg, Orn, and Cit did not lead to a further increase in the size of the proline pool that is already present in osmotically stressed cells. Hence, our data suggest that osmoprotection of B. subtilis by this group of amino acids rests on the savings in biosynthetic building blocks and energy that would otherwise have to be devoted either to the synthesis of the proline precursor glutamate or of proline itself. Since glutamate is the direct biosynthetic precursor for proline, we studied its uptake and found that GltT, an Na+-coupled symporter, is the main uptake system for both glutamate and aspartate in B. subtilis. Collectively, our data show how effectively B. subtilis can exploit environmental resources to derive osmotic-stress protection through physiological means. PMID:25344233
Troitzsch, R Z; Vass, H; Hossack, W J; Martyna, G J; Crain, J
2008-04-10
Free proline amino acid is a natural cryoprotectant expressed by numerous organisms under low-temperature stress. Previous reports have suggested that complex assemblies underlie its functional properties. We investigate here aqueous proline solutions as a function of temperature using combinations of Raman spectroscopy, Rayleigh-Brillouin light scattering, and molecular dynamics simulations with the view to revealing the molecular origins of the mixtures' functionality as a cryoprotectant. The evolution of the Brillouin frequency shifts and line widths with temperature shows that, above a critical proline concentration, the water-like dynamics is suppressed and viscoelastic behavior emerges: Here, the Landau-Placzek ratio also shows a temperature-independent maximum arising from concentration fluctuations. Molecular dynamics simulations reveal that the water-water correlations in the mixtures depend much more weakly on temperature than does bulk water. By contrast, the water OH Raman bands exhibit strong red-shifts on cooling similar to those seen in ices; however, no evidence of ice lattice phonons is observed in the low-frequency spectrum. We attribute this primarily to enhanced proline-water hydrogen bonding. In general, the picture that emerges is that aqueous proline is a heterogeneous mixture on molecular length scales (characterized by significant concentration fluctuations rather than well-defined aggregates). Simulations reveal that proline also appears to suppress the normal dependence of water structure on temperature and preserves the ambient-temperature correlations even in very cold solutions. The water structure in cold proline solutions therefore appears to be similar to that at a higher effective temperature. This, coupled with the emergence of glassy dynamics offers a molecular explanation for the functional properties of proline as a cryoprotectant without the need to invoke previously proposed complex aggregates.
Hamson, Elizabeth J; Keane, Fiona M; Tholen, Stefan; Schilling, Oliver; Gorrell, Mark D
2014-06-01
Fibroblast activation protein (FAP) is best known for its heightened expression in tumour stroma. This atypical serine protease has both dipeptidyl peptidase and endopeptidase activities, cleaving substrates at a post-proline bond. FAP expression is difficult to detect in non-diseased adult organs, but is greatly upregulated in sites of tissue remodelling, which include liver fibrosis, lung fibrosis, atherosclerosis, arthritis, tumours and embryonic tissues. Due to its restricted expression pattern and dual enzymatic activities, FAP is emerging as a unique therapeutic target. However, methods to exploit and target this protease are advancing more rapidly than knowledge of the fundamental biology of FAP. This review highlights this imbalance, emphasising the need to better define the substrate repertoire and expression patterns of FAP to elucidate its role in biological and pathological processes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pinpointing proline substitution to be responsible for the loss of amyloidogenesis in IAPP.
Chakraborty, Sandipan; Mukherjee, Barnali; Basu, Soumalee
2013-10-01
Human islet amyloid polypeptide (hIAPP) is highly amyloidogenic, whereas its homologs in rodents are non-amyloidogenic. This observed non-amyloidogenecity of rodent IAPP has been attributed to substitutions by proline in a region of IAPP that forms the core of the fibril. By employing molecular dynamics simulation, we have analyzed effects of position-specific proline substitution on amyloidogenesis of the core region of the hIAPP fibril (22-28). We depict that substitution to proline at the 25th position is primarily responsible for the loss of amyloidogenecity of the peptide. In addition, 25th and 26th double mutation to proline and valine has been observed to show significant fibril destabilizing ability. On the contrary, substitution at 28th position to proline has the least ability to destabilize the amyloid fibril. Results obtained from this study are particularly important to design variants of the existing antihyperglycemic drug with minimalistic mutation approach for use in patients with diabetes. © 2013 John Wiley & Sons A/S.
Vyklický, L; Vyskocil, F; Kolaj, M; Jastreboff, P
1982-10-08
To test the hypothesis that L-proline acts as an antagonist on glutamate receptors [17, 18], the interaction between L-glutamate and L-proline was studied in the isolated spinal cord of the frog. Glutamate at concentrations of 10(-6) -5 x 10(-3) mol/l depolarized the primary afferent fibres and increased extracellular potassium concentration, [K+]e, by 0.3-4 mmol/l. Repeated applications lead to inactivation of the response. L-Proline at 5 x 10(-3) -10(-2) mol/l, also depolarized the primary afferents and increased [K+]e by 0.5-2 mmol/l, but there was only a slight decrease of the effects after repeated application. The effects were additive when the amino acids were applied simultaneously. The effect of L-proline was still present when it was applied during inactivation of the glutamate receptors. This suggests that L-glutamate and L-proline act on different receptors.
Elmasry, Khaled; Ibrahim, Ahmed S; Saleh, Heba; Elsherbiny, Nehal; Elshafey, Sally; Hussein, Khaled A; Al-Shabrawey, Mohamed
2018-05-01
Our earlier studies have established the role of 12/15-lipoxygenase (LO) in mediating the inflammatory reaction in diabetic retinopathy. However, the exact mechanism is still unclear. The goal of the current study was to identify the potential role of endoplasmic reticulum (ER) stress as a major cellular stress response in the 12/15-LO-induced retinal changes in diabetic retinopathy. We used in vivo and in vitro approaches. For in vivo studies, experimental diabetes was induced in wild-type (WT) mice and 12/15-Lo (also known as Alox15) knockout mice (12/15-Lo -/- ); ER stress was then evaluated after 12-14 weeks of diabetes. We also tested the effect of intravitreal injection of 12-hydroxyeicosatetraenoic acid (HETE) on retinal ER stress in WT mice and in mice lacking the catalytic subunit of NADPH oxidase, encoded by Nox2 (also known as Cybb) (Nox2 -/- mice). In vitro studies were performed using human retinal endothelial cells (HRECs) treated with 15-HETE (0.1 μmol/l) or vehicle, with or without ER stress or NADPH oxidase inhibitors. This was followed by evaluation of ER stress response, NADPH oxidase expression/activity and the levels of phosphorylated vascular endothelial growth factor receptor-2 (p-VEGFR2) by western blotting and immunoprecipitation assays. Moreover, real-time imaging of intracellular calcium (Ca 2+ ) release in HRECs treated with or without 15-HETE was performed using confocal microscopy. Deletion of 12/15-Lo significantly attenuated diabetes-induced ER stress in mouse retina. In vitro, 15-HETE upregulated ER stress markers such as phosphorylated RNA-dependent protein kinase-like ER-regulated kinase (p-PERK), activating transcription factor 6 (ATF6) and protein disulfide isomerase (PDI) in HRECs. Inhibition of ER stress reduced 15-HETE-induced-leucocyte adhesion, VEGFR2 phosphorylation and NADPH oxidase expression/activity. However, inhibition of NADPH oxidase or deletion of Nox2 had no effect on ER stress induced by the 12/15-LO-derived metabolites both in vitro and in vivo. We also found that 15-HETE increases the intracellular calcium in HRECs. ER stress contributes to 12/15-LO-induced retinal inflammation in diabetic retinopathy via activation of NADPH oxidase and VEGFR2. Perturbation of calcium homeostasis in the retina might also play a role in linking 12/15-LO to retinal ER stress and subsequent microvascular dysfunction in diabetic retinopathy.
WANG, QING; WANG, YAN-LIN; WANG, KAI; YANG, JIAN-LIN; CAO, CHUN-YU
2015-01-01
The aim of the present study was to investigate the effects of the novel polyamine analog tetrabutyl propanediamine (TBP) on the growth of K562 chronic myelogenous leukemia (CML) cells and the underlying mechanism of these effects. MTT was used for the analysis of cell proliferation and flow cytometry was performed to analyze cell cycle distribution. DNA fragmentation analysis and Annexin V/propidium iodide double staining were used to identify apoptotic cells. The activity of the key enzymes in polyamine catabolism was detected using chemiluminescence. TBP can induce apoptosis and significantly inhibit K562 cell proliferation in a time- and dose-dependent manner. TBP treatment significantly induced the enzyme activity of spermine oxidase and acetylpolyamine oxidase in K562 cells, and also enhanced the inhibitory effect of the antitumor drug doxorubicin on K562 cell proliferation. As a novel polyamine analog, TBP significantly inhibited proliferation and induced apoptosis in K562 cells by upregulating the activity of the key enzymes in the polyamine catabolic pathways. TBP also increased the sensitivity of the K562 cells to the antitumor drug doxorubicin. These data indicate an important potential value of TBP for clinical therapy of human CML. PMID:25435975
Chung, Young C; Kim, Sang R; Jin, Byung K
2010-07-15
The present study examined whether the antidepressant paroxetine promotes the survival of nigrostriatal dopaminergic (DA) neurons in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson's disease. MPTP induced degeneration of nigrostriatal DA neurons and glial activation as visualized by tyrosine hydroxylase, macrophage Ag complex-1, and/or glial fibrillary acidic protein immunoreactivity. Real-time PCR, Western blotting, and immunohistochemistry showed upregulation of proinflammatory cytokines, activation of microglial NADPH oxidase and astroglial myeloperoxidase, and subsequent reactive oxygen species production and oxidative DNA damage in the MPTP-treated substantia nigra. Treatment with paroxetine prevented degeneration of nigrostriatal DA neurons, increased striatal dopamine levels, and improved motor function. This neuroprotection afforded by paroxetine was associated with the suppression of astroglial myeloperoxidase expression and/or NADPH oxidase-derived reactive oxygen species production and reduced expression of proinflammatory cytokines, including IL-1beta, TNF-alpha, and inducible NO synthase, by activated microglia. The present findings show that paroxetine may possess anti-inflammatory properties and inhibit glial activation-mediated oxidative stress, suggesting that paroxetine and its analogues may have therapeutic value in the treatment of aspects of Parkinson's disease related to neuroinflammation.
Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid
Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R.; Masliah, Eliezer; Lipton, Stuart A.
2015-01-01
Cyanide is a life threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species (ROS). This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain-barrier to upregulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human induced pluripotent stem cell (hiPSC)-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino (NSA) mouse model of cyanide poisoning that simulates damage observed in the human brain. PMID:25692407
Infectious Agents in Atherosclerotic Cardiovascular Diseases through Oxidative Stress
Di Pietro, Marisa; Filardo, Simone; Falasca, Francesca; Turriziani, Ombretta; Sessa, Rosa
2017-01-01
Accumulating evidence demonstrates that vascular oxidative stress is a critical feature of atherosclerotic process, potentially triggered by several infectious agents that are considered as risk co-factors for the atherosclerotic cardiovascular diseases (CVDs). C. pneumoniae has been shown to upregulate multiple enzymatic systems capable of producing reactive oxygen species (ROS) such as NADPH oxidase (NOX) and cyclooxygenase in vascular endothelial cells, NOX and cytochrome c oxidase in macrophages as well as nitric oxide synthase and lipoxygenase in platelets contributing to both early and late stages of atherosclerosis. P. gingivalis seems to be markedly involved in the atherosclerotic process as compared to A. actinomycetemcomitans contributing to LDL oxidation and foam cell formation. Particularly interesting is the evidence describing the NLRP3 inflammasome activation as a new molecular mechanism underlying P. gingivalis-induced oxidative stress and inflammation. Amongst viral agents, immunodeficiency virus-1 and hepatitis C virus seem to have a major role in promoting ROS production, contributing, hence, to the early stages of atherosclerosis including endothelial dysfunction and LDL oxidation. In conclusion, oxidative mechanisms activated by several infectious agents during the atherosclerotic process underlying CVDs are very complex and not well-known, remaining, thus, an attractive target for future research. PMID:29156574
Infectious Agents in Atherosclerotic Cardiovascular Diseases through Oxidative Stress.
Di Pietro, Marisa; Filardo, Simone; Falasca, Francesca; Turriziani, Ombretta; Sessa, Rosa
2017-11-18
Accumulating evidence demonstrates that vascular oxidative stress is a critical feature of atherosclerotic process, potentially triggered by several infectious agents that are considered as risk co-factors for the atherosclerotic cardiovascular diseases (CVDs). C. pneumoniae has been shown to upregulate multiple enzymatic systems capable of producing reactive oxygen species (ROS) such as NADPH oxidase (NOX) and cyclooxygenase in vascular endothelial cells, NOX and cytochrome c oxidase in macrophages as well as nitric oxide synthase and lipoxygenase in platelets contributing to both early and late stages of atherosclerosis. P. gingivalis seems to be markedly involved in the atherosclerotic process as compared to A. actinomycetemcomitans contributing to LDL oxidation and foam cell formation. Particularly interesting is the evidence describing the NLRP3 inflammasome activation as a new molecular mechanism underlying P. gingivalis -induced oxidative stress and inflammation. Amongst viral agents, immunodeficiency virus-1 and hepatitis C virus seem to have a major role in promoting ROS production, contributing, hence, to the early stages of atherosclerosis including endothelial dysfunction and LDL oxidation. In conclusion, oxidative mechanisms activated by several infectious agents during the atherosclerotic process underlying CVDs are very complex and not well-known, remaining, thus, an attractive target for future research.
Cerebroprotective functions of HO-2.
Parfenova, Helena; Leffler, Charles W
2008-01-01
The constitutive isoform of heme oxygenase, HO-2, is highly expressed in the brain and in cerebral vessels. HO-2 functions in the brain have been evaluated using pharmacological inhibitors of the enzyme and HO-2 gene deletion in in vivo animal models and in cultured cells (neurons, astrocytes, cerebral vascular endothelial cells). Rapid activation of HO-2 via post-translational modifications without upregulation of HO-2 expression or HO-1 induction coincides with the increase in cerebral blood flow aimed at maintaining brain homeostasis and neuronal survival during seizures, hypoxia, and hypotension. Pharmacological inhibition or gene deletion of brain HO-2 exacerbates oxidative stress induced by seizures, glutamate, and inflammatory cytokines, and causes cerebral vascular injury. Carbon monoxide (CO) and bilirubin, the end products of HO-catalyzed heme degradation, have distinct cytoprotective functions. CO, by binding to a heme prosthetic group, regulates the key components of cell signaling, including BK(Ca) channels, guanylyl cyclase, NADPH oxidase, and the mitochondria respiratory chain. Cerebral vasodilator effects of CO are mediated via activation of BK(Ca) channels and guanylyl cyclase. CO, by inhibiting the major components of endogenous oxidant-generating machinery, NADPH oxidase and the cytochrome C oxidase of the mitochondrial respiratory chain, blocks formation of reactive oxygen species. Bilirubin, via redox cycling with biliverdin, is a potent oxidant scavenger that removes preformed oxidants. Overall, HO-2 has dual housekeeping cerebroprotective functions by maintaining autoregulation of cerebral blood flow aimed at improving neuronal survival in a changing environment, and by providing an effective defense mechanism that blocks oxidant formation and prevents cell death caused by oxidative stress.
Comparative Aspects of Tissue Glutamine and Proline Metabolism
USDA-ARS?s Scientific Manuscript database
The cellular metabolism of glutamine and proline are closely interrelated since they can be interconverted with glutamate and ornithine via the mitochondrial pathway involving pyrolline-5-carboxylate (P5C). In adults, glutamine and proline are converted via P5C to citrulline in the gut, then citrul...
Cotton Effect in Copper-Proline Complexes in the Visible Region
ERIC Educational Resources Information Center
Volkov, Victor; Pfister, Rolf
2005-01-01
The electronic properties of Cu(II) complex with proline are considered to demonstrate the Cotton effect in the visible region. A series of experiments in optical rotatory dispersion spectroscopy with free D- and L-proline and their complexes with the Cu(II) ion in aqueous solution is suggested.
Harris, Jonathan P; Logan, Barry A
2018-02-17
Mastocarpus stellatus and Chondrus crispus often co-occur in the lower intertidal of Northern Atlantic rocky shorelines. At our field site along the Maine coast (USA), Mastocarpus stellatus thalli possessed greater contents of proline when compared with thalli of Chondrus crispus. In addition, M. stellatus thalli acclimated to colder growth conditions in winter/early spring by increasing proline content several fold; no seasonal acclimation in proline content was observed in C. crispus. Proline accumulates in the tissues of a broad diversity of freezing-tolerant organisms and is among the most common cryoprotectant molecules. Thus, our observations provide a basis for the previously well-documented greater freezing tolerance of Mastocarpus stellatus when compared with Chondrus crispus. © 2018 Phycological Society of America.
Arrieta-Cruz, Isabel; Su, Ya; Knight, Colette M.; Lam, Tony K.T.; Gutiérrez-Juárez, Roger
2013-01-01
The metabolism of lactate to pyruvate in the mediobasal hypothalamus (MBH) regulates hepatic glucose production. Because astrocytes and neurons are functionally linked by metabolic coupling through lactate transfer via the astrocyte-neuron lactate shuttle (ANLS), we reasoned that astrocytes might be involved in the hypothalamic regulation of glucose metabolism. To examine this possibility, we used the gluconeogenic amino acid proline, which is metabolized to pyruvate in astrocytes. Our results showed that increasing the availability of proline in rats either centrally (MBH) or systemically acutely lowered blood glucose. Pancreatic clamp studies revealed that this hypoglycemic effect was due to a decrease of hepatic glucose production secondary to an inhibition of glycogenolysis, gluconeogenesis, and glucose-6-phosphatase flux. The effect of proline was mimicked by glutamate, an intermediary of proline metabolism. Interestingly, proline’s action was markedly blunted by pharmacological inhibition of hypothalamic lactate dehydrogenase (LDH) suggesting that metabolic flux through LDH was required. Furthermore, short hairpin RNA–mediated knockdown of hypothalamic LDH-A, an astrocytic component of the ANLS, also blunted the glucoregulatory action of proline. Thus our studies suggest not only a new role for proline in the regulation of hepatic glucose production but also indicate that hypothalamic astrocytes are involved in the regulatory mechanism as well. PMID:23274895
Zouari, Mohamed; Ben Ahmed, Chedlia; Elloumi, Nada; Bellassoued, Khaled; Delmail, David; Labrousse, Pascal; Ben Abdallah, Ferjani; Ben Rouina, Bechir
2016-06-01
Proline plays an important role in plant response to various environmental stresses. However, its involvement in mitigation of heavy metal stress in plants remains elusive. In this study, we examined the effectiveness of exogenous proline (10 and 20 mM) in alleviating cadmium induced inhibitory effects in young olive plants (Olea europaea L. cv. Chemlali) exposed to two Cd levels (10 and 30 mg CdCl2 kg(-1) soil). The Cd treatment induced substantial accumulation of Cd in both root and leaf tissues and a decrease in gas exchange, photosynthetic pigments contents, uptake of essential elements (Ca, Mg and K) and plant biomass. Furthermore, an elevation of antioxidant enzymes activities (superoxide dismutase, catalase, glutathione peroxydase) and proline content in association with relatively high amounts of hydrogen peroxide, thiobarbituric acid reactive substances and electrolyte leakage were observed. Interestingly, the application of exogenous proline alleviated the oxidative damage induced by Cd accumulation. In fact, Cd-stressed olive plants treated with proline showed an increase of antioxidant enzymes activities, photosynthetic activity, nutritional status, plant growth and oil content of olive fruit. Generally, it seems that proline supplementation alleviated the deleterious effects of young olive plants exposed to Cd stress. Copyright © 2016 Elsevier Inc. All rights reserved.
On the Split Personality of Penultimate Proline
Glover, Matthew S.; Shi, Liuqing; Fuller, Daniel R.; Arnold, Randy J.; Radivojac, Predrag; Clemmer, David E.
2014-01-01
The influence of the position of the amino acid proline in polypeptide sequences is examined by a combination of ion mobility spectrometry-mass spectrometry (IMS-MS), amino acid substitutions, and molecular modeling. The results suggest that when proline exists as the second residue from the N-terminus (i.e., penultimate proline), two families of conformers are formed. We demonstrate the existence of these families by a study of a series of truncated and mutated peptides derived from the 11-residue peptide Ser1-Pro2-Glu3-Leu4-Pro5-Ser6-Pro7-Gln8-Ala9-Glu10-Lys11. We find that every peptide from this sequence with a penultimate proline residue has multiple conformations. Substitution of Ala for Pro residues indicates that multiple conformers arise from the cis- trans isomerization of Xaa1–Pro2 peptide bonds as Xaa–Ala peptide bonds are unlikely to adopt the cis isomer, and examination of spectra from a library of 58 peptides indicates that ~80% of sequences show this effect. A simple mechanism suggesting that the barrier between the cis-and trans-proline forms is lowered because of low steric impedance is proposed. This observation may have interesting biological implications as well, and we note that a number of biologically active peptides have penultimate proline residues. PMID:25503299
Effect of proline mutations on the monomer conformations of amylin.
Chiu, Chi-cheng; Singh, Sadanand; de Pablo, Juan J
2013-09-03
The formation of human islet amyloid polypeptide (hIAPP) is implicated in the loss of pancreatic β-cells in type II diabetes. Rat amylin, which differs from human amylin at six residues, does not lead to formation of amyloid fibrils. Pramlintide is a synthetic analog of human amylin that shares three proline substitutions with rat amylin. Pramlintide has a much smaller propensity to form amyloid aggregates and has been widely prescribed in amylin replacement treatment. It is known that the three prolines attenuate β-sheet formation. However, the detailed effects of these proline substitutions on full-length hIAPP remain poorly understood. In this work, we use molecular simulations and bias-exchange metadynamics to investigate the effect of proline substitutions on the conformation of the hIAPP monomer. Our results demonstrate that hIAPP can adopt various β-sheet conformations, some of which have been reported in experiments. The proline substitutions perturb the formation of long β-sheets and reduce their stability. More importantly, we find that all three proline substitutions of pramlintide are required to inhibit β conformations and stabilize the α-helical conformation. Fewer substitutions do not have a significant inhibiting effect. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
TRPC3-Nox2 complex mediates doxorubicin-induced myocardial atrophy
Shimauchi, Tsukasa; Numaga-Tomita, Takuro; Ito, Tomoya; Nishimura, Akiyuki; Matsukane, Ryosuke; Oda, Sayaka; Hoka, Sumio; Ide, Tomomi; Koitabashi, Norimichi; Uchida, Koji; Sumimoto, Hideki; Mori, Yasuo
2017-01-01
Myocardial atrophy is a wasting of cardiac muscle due to hemodynamic unloading. Doxorubicin is a highly effective anticancer agent but also induces myocardial atrophy through a largely unknown mechanism. Here, we demonstrate that inhibiting transient receptor potential canonical 3 (TRPC3) channels abolishes doxorubicin-induced myocardial atrophy in mice. Doxorubicin increased production of ROS in rodent cardiomyocytes through hypoxic stress–mediated upregulation of NADPH oxidase 2 (Nox2), which formed a stable complex with TRPC3. Cardiomyocyte-specific expression of TRPC3 C-terminal minipeptide inhibited TRPC3-Nox2 coupling and suppressed doxorubicin-induced reduction of myocardial cell size and left ventricular (LV) dysfunction, along with its upregulation of Nox2 and oxidative stress, without reducing hypoxic stress. Voluntary exercise, an effective treatment to prevent doxorubicin-induced cardiotoxicity, also downregulated the TRPC3-Nox2 complex and promoted volume load–induced LV compliance, as demonstrated in TRPC3-deficient hearts. These results illustrate the impact of TRPC3 on LV compliance and flexibility and, focusing on the TRPC3-Nox2 complex, provide a strategy for prevention of doxorubicin-induced cardiomyopathy. PMID:28768915
Ju, Huai-Qiang; Ying, Haoqiang; Tian, Tian; Ling, Jianhua; Fu, Jie; Lu, Yu; Wu, Min; Yang, Lifeng; Achreja, Abhinav; Chen, Gang; Zhuang, Zhuonan; Wang, Huamin; Nagrath, Deepak; Yao, Jun; Hung, Mien-Chie; DePinho, Ronald A.; Huang, Peng; Xu, Rui-Hua; Chiao, Paul J.
2017-01-01
Kras activation and p16 inactivation are required to develop pancreatic ductal adenocarcinoma (PDAC). However, the biochemical mechanisms underlying these double alterations remain unclear. Here we discover that NAD(P)H oxidase 4 (NOX4), an enzyme known to catalyse the oxidation of NAD(P)H, is upregulated when p16 is inactivated by looking at gene expression profiling studies. Activation of NOX4 requires catalytic subunit p22phox, which is upregulated following Kras activation. Both alterations are also detectable in PDAC cell lines and patient specimens. Furthermore, we show that elevated NOX4 activity accelerates oxidation of NADH and supports increased glycolysis by generating NAD+, a substrate for GAPDH-mediated glycolytic reaction, promoting PDAC cell growth. Mechanistically, NOX4 was induced through p16-Rb-regulated E2F and p22phox was induced by KrasG12V-activated NF-κB. In conclusion, we provide a biochemical explanation for the cooperation between p16 inactivation and Kras activation in PDAC development and suggest that NOX4 is a potential therapeutic target for PDAC. PMID:28232723
Kim, Kangmin; Jang, Ye-Jin; Lee, Sang-Myeong; Oh, Byung-Taek; Chae, Jong-Chan; Lee, Kui-Jae
2014-02-01
Microbiota in the niches of the rhizosphere zones can affect plant growth and responses to environmental stress conditions via mutualistic interactions with host plants. Specifically, some beneficial bacteria, collectively referred to as Plant Growth Promoting Rhizobacteria (PGPRs), increase plant biomass and innate immunity potential. Here, we report that Enterobacter sp. EJ01, a bacterium isolated from sea china pink (Dianthus japonicus thunb) in reclaimed land of Gyehwa-do in Korea, improved the vegetative growth and alleviated salt stress in tomato and Arabidopsis. EJ01 was capable of producing 1-aminocy-clopropane-1-carboxylate (ACC) deaminase and also exhibited indole-3-acetic acid (IAA) production. The isolate EJ01 conferred increases in fresh weight, dry weight, and plant height of tomato and Arabidopsis under both normal and high salinity conditions. At the molecular level, short-term treatment with EJ01 increased the expression of salt stress responsive genes such as DREB2b, RD29A, RD29B, and RAB18 in Arabidopsis. The expression of proline biosynthetic genes (i.e. P5CS1 and P5CS2) and of genes related to priming processes (i.e. MPK3 and MPK6) were also up-regulated. In addition, reactive oxygen species scavenging activities were enhanced in tomatoes treated with EJ01 in stressed conditions. GFP-tagged EJ01 displayed colonization in the rhizosphere and endosphere in the roots of Arabidopsis. In conclusion, the newly isolated Enterobacter sp. EJ01 is a likely PGPR and alleviates salt stress in host plants through multiple mechanisms, including the rapid up-regulation of conserved plant salt stress responsive signaling pathways.
Ren, Dongqing; Jin, Juan; Li, Xiaojuan; Zeng, Guiying
2008-01-01
To explore the bio-effects of electromagnetic pulse(EMP) on mouse small intestines induced by means of gene chip. Twelve BALB/c mice were randomly assigned to the normal control group and the EMP group with 6 in each group. The EMP group was irradiated with 200 kV/m, 200 pulses EMP. 18 hours after the irradiation, the mice were sacrificed and their jejunum of small intestines were eviscerated. The fluorescent cDNA probes labeled with Cy3 and Cy5 were prepared from RNA extracted from the intestines of the two groups. Probes of the two groups were then hybridized against cDNA gene chip, the fluorescent signals were scanned with a scanner and the results were analyzed by computer. Compared with the control, 56 genes in gene expression profile were altered. The expression levels of 37 genes were up-regulated distinctly while 19 genes were down-regulated significantly. Among the 56 genes, 19 were reported with known or inferred functions, 12 up-regulated genes were catenin alpha 1 (alpha-catenin), ly-6 alloantigen(Ly-6E), fructose-6-phosphate transaminase (GF6P), ribosomal protein S17 (rpS17), small proline-rich protein 2A (Sprr2a), glandular kallikrein27 (GK27), lipoxygenase-3, aldo-keto reductase (Akr1c12), GSG1, amylase 2 (Amy2),elastase 2, p6-5 gene and 7 down-regulated genes were junctional adhesion molecule (Jam), protein arginine methyltransferase (Carm1),NNP-1, 2-5 A synthetase L2,Mlark gene, ATP synthase alpha subunit, uncoupling protein-2 (Ucp2) gene; the other 37 were reported with unknown functions. EMP irradiation could induce specific expressions of some genes in mouse small intestines and most of these genes were up-regulated ones.
Kim, Kangmin; Jang, Ye-Jin; Lee, Sang-Myeong; Oh, Byung-Taek; Chae, Jong-Chan; Lee, Kui-Jae
2014-01-01
Microbiota in the niches of the rhizosphere zones can affect plant growth and responses to environmental stress conditions via mutualistic interactions with host plants. Specifically, some beneficial bacteria, collectively referred to as Plant Growth Promoting Rhizobacteria (PGPRs), increase plant biomass and innate immunity potential. Here, we report that Enterobacter sp. EJ01, a bacterium isolated from sea china pink (Dianthus japonicus thunb) in reclaimed land of Gyehwa-do in Korea, improved the vegetative growth and alleviated salt stress in tomato and Arabidopsis. EJ01 was capable of producing 1-aminocy-clopropane-1-carboxylate (ACC) deaminase and also exhibited indole-3-acetic acid (IAA) production. The isolate EJ01 conferred increases in fresh weight, dry weight, and plant height of tomato and Arabidopsis under both normal and high salinity conditions. At the molecular level, short-term treatment with EJ01 increased the expression of salt stress responsive genes such as DREB2b, RD29A, RD29B, and RAB18 in Arabidopsis. The expression of proline biosynthetic genes (i.e. P5CS1 and P5CS2) and of genes related to priming processes (i.e. MPK3 and MPK6) were also up-regulated. In addition, reactive oxygen species scavenging activities were enhanced in tomatoes treated with EJ01 in stressed conditions. GFP-tagged EJ01 displayed colonization in the rhizosphere and endosphere in the roots of Arabidopsis. In conclusion, the newly isolated Enterobacter sp. EJ01 is a likely PGPR and alleviates salt stress in host plants through multiple mechanisms, including the rapid up-regulation of conserved plant salt stress responsive signaling pathways. PMID:24598995
Wilkinson, Ray; Wang, Xiangju; Kassianos, Andrew J.; Zuryn, Steven; Roper, Kathrein E.; Osborne, Andrew; Sampangi, Sandeep; Francis, Leo; Raghunath, Vishwas; Healy, Helen
2014-01-01
Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD) but emerging evidence is now linking many forms of acute kidney disease (AKD) with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC) are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate “real time” gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i) confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii) provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii) identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv) describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue. PMID:24475278
Hu, Qiong-Dan; Wu, Wei-Hua; Zeng, Yan; Wen, Ji; Li, Xiao-Jun; Pan, Wei; Zhang, Mao-Ping; Hu, Bo; Lei, Chun-Yan; Fan, Junming
2018-04-30
In recent years, metabolomics using high-performance liquid chromatography (UPLC) has been used to study the metabolic profiles in plasma, urine, stool and tissue in animal model of chronic kidney disease (CKD). In the previous work, we found that traditional Chinese medicine (TCM) "Kidney Flaccidity Compound" (KFC) based on "kidney flaccidity theory" can improve renal function and quality of life of patients with kidney disease. This study aimed to investigate the metabolic profiles in peripheral blood of hemodialysis patients administrated by KFC for 1.5 and 3 months and explore the potential metabolic mechanism using UPLC. Results showed that 121 metabolites were different between KFC 3-months group and untreated control, of which 75 were significantly upregulated and 46 were significantly downregulated. In the 1.5-months treatment group, there were 365 metabolites, of which 164 were significantly upregulated and 192 downregulated. There were 6 metabolites and 15 metabolites upregulated 3-fold in 3-months and 1.5-months KFC treatment group, respectively. In addition, more than 60 new metabolites were identified in the peripheral blood in KFC treated patients, including two potential diagnostic markers MGDG 30:8 and 2-(hydroxymethyl)-6-[[(1R,4S) -2,2,4-trimethyl-3-oxabicyclo[2.2.2]octan-5-yl]oxy]oxane-3,4,5-triol. The pathway enrichment analysis showed thce differential metabolites mainly enriched in Arginine and proline metabolism, Urea cycle, Tyrosine metabolism, Methionine metabolism, Tricarboxylic acid cycle, and Androgen and estrogen metabolism. The findings are helpful to reveal the mechanism of KFC protects CKD, and to provide a new strategy for recovery renal function in hemodialysis patients.
Getz, Jean; Lin, Dingbo; Medeiros, Denis M
2011-10-01
Copper is ferried in a cell complexed to chaperone proteins, and in the heart much copper is required for cytochrome c oxidase (Cox). It is not completely understood how copper status affects the levels of these proteins. Here we determined if dietary copper deficiency could up- or down-regulate select copper chaperone proteins and Cox subunits 1 and 4 in cardiac tissue of rats. Sixteen weanling male Long-Evans rats were randomized into treatment groups, one group receiving a copper-deficient diet (<1 mg Cu/kg diet) and one group receiving a diet containing adequate copper (6 mg Cu/kg diet) for 5 weeks. Hearts were removed, weighed, and non-myofibrillar proteins separated to analyze for levels of CCS, Sco1, Ctr1, Cox17, Cox1, and Cox4 by SDS-PAGE and Western blotting. No changes were observed in the concentrations of CTR1 and Cox17 between copper-adequate and copper-deficient rats. CCS and Sco1 were up-regulated and Cox1 and Cox4 were both down-regulated as a result of copper deficiency. These data suggest that select chaperone proteins and may be up-regulated, and Cox1 and 4 down-regulated, by a dietary copper deficiency, whereas others appear not to be affected by copper status.
Koštál, Vladimír; Zahradníčková, Helena; Šimek, Petr
2011-01-01
The larva of the drosophilid fly, Chymomyza costata, is probably the most complex metazoan organism that can survive submergence in liquid nitrogen (-196 °C) in a fully hydrated state. We examined the associations between the physiological and biochemical parameters of differently acclimated larvae and their freeze tolerance. Entering diapause is an essential and sufficient prerequisite for attaining high levels of survival in liquid nitrogen (23% survival to adult stage), although cold acclimation further improves this capacity (62% survival). Profiling of 61 different metabolites identified proline as a prominent compound whose concentration increased from 20 to 147 mM during diapause transition and subsequent cold acclimation. This study provides direct evidence for the essential role of proline in high freeze tolerance. We increased the levels of proline in the larval tissues by feeding larvae proline-augmented diets and found that this simple treatment dramatically improved their freeze tolerance. Cell and tissue survival following exposure to liquid nitrogen was evident in proline-fed nondiapause larvae, and survival to adult stage increased from 0% to 36% in proline-fed diapause-destined larvae. A significant statistical correlation was found between the whole-body concentration of proline, either natural or artificial, and survival to the adult stage in liquid nitrogen for diapause larvae. Differential scanning calorimetry analysis suggested that high proline levels, in combination with a relatively low content of osmotically active water and freeze dehydration, increased the propensity of the remaining unfrozen water to undergo a glass-like transition (vitrification) and thus facilitated the prevention of cryoinjury. PMID:21788482
Osmoprotection of Bacillus subtilis through Import and Proteolysis of Proline-Containing Peptides
Zaprasis, Adrienne; Brill, Jeanette; Thüring, Marietta; Wünsche, Guido; Heun, Magnus; Barzantny, Helena; Hoffmann, Tamara
2013-01-01
Bacillus subtilis can attain cellular protection against the detrimental effects of high osmolarity through osmotically induced de novo synthesis and uptake of the compatible solute l-proline. We have now found that B. subtilis can also exploit exogenously provided proline-containing peptides of various lengths and compositions as osmoprotectants. Osmoprotection by these types of peptides is generally dependent on their import via the peptide transport systems (Dpp, Opp, App, and DtpT) operating in B. subtilis and relies on their hydrolysis to liberate proline. The effectiveness with which proline-containing peptides confer osmoprotection varies considerably, and this can be correlated with the amount of the liberated and subsequently accumulated free proline by the osmotically stressed cell. Through gene disruption experiments, growth studies, and the quantification of the intracellular proline pool, we have identified the PapA (YqhT) and PapB (YkvY) peptidases as responsible for the hydrolysis of various types of Xaa-Pro dipeptides and Xaa-Pro-Xaa tripeptides. The PapA and PapB peptidases possess overlapping substrate specificities. In contrast, osmoprotection by peptides of various lengths and compositions with a proline residue positioned at their N terminus was not affected by defects in the PapA and PapB peptidases. Taken together, our data provide new insight into the physiology of the osmotic stress response of B. subtilis. They illustrate the flexibility of this ubiquitously distributed microorganism to effectively exploit environmental resources in its acclimatization to sustained high-osmolarity surroundings through the accumulation of compatible solutes. PMID:23144141
Kostál, Vladimír; Zahradnícková, Helena; Šimek, Petr
2011-08-09
The larva of the drosophilid fly, Chymomyza costata, is probably the most complex metazoan organism that can survive submergence in liquid nitrogen (-196 °C) in a fully hydrated state. We examined the associations between the physiological and biochemical parameters of differently acclimated larvae and their freeze tolerance. Entering diapause is an essential and sufficient prerequisite for attaining high levels of survival in liquid nitrogen (23% survival to adult stage), although cold acclimation further improves this capacity (62% survival). Profiling of 61 different metabolites identified proline as a prominent compound whose concentration increased from 20 to 147 mM during diapause transition and subsequent cold acclimation. This study provides direct evidence for the essential role of proline in high freeze tolerance. We increased the levels of proline in the larval tissues by feeding larvae proline-augmented diets and found that this simple treatment dramatically improved their freeze tolerance. Cell and tissue survival following exposure to liquid nitrogen was evident in proline-fed nondiapause larvae, and survival to adult stage increased from 0% to 36% in proline-fed diapause-destined larvae. A significant statistical correlation was found between the whole-body concentration of proline, either natural or artificial, and survival to the adult stage in liquid nitrogen for diapause larvae. Differential scanning calorimetry analysis suggested that high proline levels, in combination with a relatively low content of osmotically active water and freeze dehydration, increased the propensity of the remaining unfrozen water to undergo a glass-like transition (vitrification) and thus facilitated the prevention of cryoinjury.
Morita, Yuko; Nakamori, Shigeru; Takagi, Hiroshi
2003-01-01
We previously isolated a mutant which showed a high tolerance to freezing that correlated with higher levels of intracellular l-proline derived from l-proline analogue-resistant mutants. The mutation responsible for the analogue resistance and l-proline accumulation was a single nuclear dominant mutation. By introducing the mutant-derived genomic library into a non-l-proline-utilizing strain, the mutant was found to carry an allele of the wild-type PRO1 gene encoding γ-glutamyl kinase, which resulted in a single amino acid replacement; Asp (GAC) at position 154 was replaced by Asn (AAC). Interestingly, the allele of PRO1 was shown to enhance the activities of γ-glutamyl kinase and γ-glutamyl phosphate reductase, both of which catalyze the first two steps of l-proline synthesis from l-glutamate and which together may form a complex in vivo. When cultured in liquid minimal medium, yeast cells expressing the mutated γ-glutamyl kinase were found to accumulate intracellular l-proline and showed a prominent increase in cell viability after freezing at −20°C compared to the viability of cells harboring the wild-type PRO1 gene. These results suggest that the altered γ-glutamyl kinase results in stabilization of the complex or has an indirect effect on γ-glutamyl phosphate reductase activity, which leads to an increase in l-proline production in Saccharomyces cerevisiae. The approach described in this paper could be a practical method for breeding novel freeze-tolerant yeast strains. PMID:12513997
The relationship of proline content and metabolism on the productivity of maize plants
Špoljarević, Marija; Agić, Dejan; Lisjak, Miroslav; Gumze, Andrej; Wilson, Ian D; Hancock, John T
2011-01-01
The free proline content in maize ear-leaves, silk and pollen were analyzed in field grown plants which had matured to the pollination stage. Using maize hybrids PR34F02, PR35P12 and PR36B08 field trials were set up at two locations in eastern Croatia in two different years. Two enzymes of proline metabolism were analyzed in the same leaf samples and specific activities of synthetase (P5CS) and proline dehydrogenase (PDH). Plant productivity was evaluated at harvest by the estimation of total and fully developed grain number per ear and per plant, the mean single grain mass, and the mass of grain per plant. The year in which the plants were grown had a very significant effect on the free proline content in the leaf and pollen, as well as on the enzyme activities assayed. The differences between the plants from the two localities were very significant in all tested parameters of plant grain productivity. There was a significant genotype effect on proline content and P5CS total activity in leaf and on all the productivity parameters. Some of the correlations established suggest that the rate of proline synthesis and degradation in maize ear-leaf at pollination might contribute to the final grain production of the maize plant. Multiple regression analyses was used to further analyze the relationship between proline and grain productivity, but it is clear that future work should include other environmental conditions, plant species and organs such as roots. PMID:21415600
Blackmond, Donna G; Moran, Antonio; Hughes, Matthew; Armstrong, Alan
2010-06-09
An intriguing reversal in product enantioselectivity accompanied by a change in the kinetic profile is observed in the alpha-amination of aldehydes catalyzed by proline in the presence of organic bases. Implications for the prevailing stereochemical models for proline and related aminocatalytic transformations are discussed.
de Oliveira, Caroline S; Carlos, Eduardo F; Vieira, Luiz G E; Lião, Luciano M; Alcantara, Glaucia B
2014-08-01
The accumulation of proline is a typical physiological response to abiotic stresses in higher plants. 'Swingle' citrumelo, an important rootstock for citrus production, has been modified with a mutated Δ(1)-pyrroline-5-carboxylate synthetase gene (VaP5CSF129A) linked to the cauliflower mosaic virus 35S promoter to induce the overproduction of free proline. This paper presents a comparative metabolomic study of nontransgenic versus transgenic 'Swingle' citrumelo plants with high endogenous proline. (1)H high-resolution magic angle spinning nuclear magnetic resonance spectroscopy and multivariate analysis showed significant differences in some metabolites between the nontransgenic and transgenic leaves and roots. The overproduction of proline has reduced the sucrose content in transgenic leaves, revealing a metabolic cost for these plants. In roots, the high level of free proline acts for the adjustment of cation-anion balance, causing the reduction of acetic acid content. The same sucrose level in roots indicates that they can be considered as sucrose sink. Similar behavior may be waited for fruits produced on transgenic rootstock. Copyright © 2014 John Wiley & Sons, Ltd.
Quevedo, Carla V; Perassolo, María; Giulietti, Ana M; Rodríguez Talou, Julián
2012-03-01
Synthesis of anthraquinones (AQs) involves the shikimate and 2-C-methyl-D-erythritol 4-phosphate pathways. The proline cycle is linked to the pentose phosphate pathway (PPP) to generate NADPH needed in the first steps of this pathway. The effect of two proline analogs, azetidine-2-carboxylic acid (A2C) and thiazolidine-4-carboxylic acid (T4C), were evaluated in Morinda citrifolia suspension cultures. Both analogs gave higher proline accumulation after 6 and 10 days (68 and 179% after 6 days with A2C at 25 and 50 μM, respectively, and 111% with T4C added at 100 μM). Induction of the proline cycle increased the AQ content after 6 days (~40% for 50 μM A2C and 100 μM T4C). Whereas A2C (50 μM) increased only AQ production, T4C also enhanced total phenolics. However, no induction of the PPP was observed with any of the treatments. This pathway therefore does not limit the supply of carbon skeletons to secondary metabolic pathways.
Use of prolines for improving growth and other properties of plants and algae
Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.
2003-07-15
Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.
Use of prolines for improving growth and other properties of plants and algae
Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.
2004-12-14
Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.
Use of prolines for improving growth and other properties of plants and algae
Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.
2003-04-29
Increasing the concentration of prolines such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that overexpress glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramnate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.
UV photodissociation of proline-containing peptide ions: insights from molecular dynamics.
Girod, Marion; Sanader, Zeljka; Vojkovic, Marin; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérôme; Bonacic-Koutecky, Vlasta; Dugourd, Philippe
2015-03-01
UV photodissociation of proline-containing peptide ions leads to unusual product ions. In this paper, we report laser-induced dissociation of a series of proline-containing peptides at 213 nm. We observe specific fragmentation pathways corresponding to the formation of (y-2), (a + 2) and (b + 2) fragment ions. This was not observed at 266 nm or for peptides which do not contain proline residues. In order to obtain insights into the fragmentation dynamics at 213 nm, a small peptide (RPK for arginine-proline-lysine) was studied both theoretically and experimentally. Calculations of absorption spectra and non-adiabatic molecular dynamics (MD) were made. Second and third excited singlet states, S(2) and S(3), lie close to 213 nm. Non-adiabatic MD simulation starting from S(2) and S(3) shows that these transitions are followed by C-C and C-N bond activation close to the proline residue. After this first relaxation step, consecutive rearrangements and proton transfers are required to produce unusual (y-2), (a + 2) and (b + 2) fragment ions. These fragmentation mechanisms were confirmed by H/D exchange experiments.
UV Photodissociation of Proline-containing Peptide Ions: Insights from Molecular Dynamics
NASA Astrophysics Data System (ADS)
Girod, Marion; Sanader, Zeljka; Vojkovic, Marin; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérôme; Bonacic-Koutecky, Vlasta; Dugourd, Philippe
2015-03-01
UV photodissociation of proline-containing peptide ions leads to unusual product ions. In this paper, we report laser-induced dissociation of a series of proline-containing peptides at 213 nm. We observe specific fragmentation pathways corresponding to the formation of (y-2), (a + 2) and (b + 2) fragment ions. This was not observed at 266 nm or for peptides which do not contain proline residues. In order to obtain insights into the fragmentation dynamics at 213 nm, a small peptide (RPK for arginine-proline-lysine) was studied both theoretically and experimentally. Calculations of absorption spectra and non-adiabatic molecular dynamics (MD) were made. Second and third excited singlet states, S2 and S3, lie close to 213 nm. Non-adiabatic MD simulation starting from S2 and S3 shows that these transitions are followed by C-C and C-N bond activation close to the proline residue. After this first relaxation step, consecutive rearrangements and proton transfers are required to produce unusual (y-2), (a + 2) and (b + 2) fragment ions. These fragmentation mechanisms were confirmed by H/D exchange experiments.
Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.
2012-01-01
Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385
Jansman, A J; Frohlich, A A; Marquardt, R R
1994-02-01
Feeding a casein-based diet with either 400 g/kg of tannin-containing faba bean hulls (Vicia faba L.) (1.41% condensed tannins) or 60 g/kg of a tannin-rich hull extract of faba beans (1.99% condensed tannins) to rats over a period of 7 d resulted in a 2.6 and 1.5 fold increase in weight of the parotid glands, respectively, (P < 0.05) and a corresponding 5.5 and 3.7 fold increase in the level of proline-rich proteins in the glands (P < 0.05). In a dose-response experiment, increasing the level of tannin-rich hull extract in the diet (0.0, 3.8, 7.5, 15.0, 30.0 and 60.0 g/kg) resulted in a linear increase in both the relative size of parotid glands (R2 = 0.90; P < 0.05) and the quantity of proline-rich proteins in the glands (R2 = 0.89; P < 0.05). The apparent digestibility of total (R2 = 0.97) and individual amino acids (R2 varied from 0.27 to 0.99) decreased linearly (P < 0.05). The quantity of proline-rich proteins in the cecum of rats was estimated from the decrease in digestibility of proline, glycine and glutamic acid. The estimated secretions of proline-rich proteins, when calculated on the basis of the three respective amino acids, were 3.5, 3.5 and 3.9 mg of proline-rich proteins per 10 mg of additional hull extract (21.8% condensed tannins). The results indicate that tannins from faba beans stimulate the parotid glands to increase the secretion of proline-rich proteins in rats. The proline-rich proteins then interact with dietary condensed tannins to reduce their antinutritional effects.
Gas-phase conformation-specific photofragmentation of proline-containing peptide ions.
Kim, Tae-Young; Valentine, Stephen J; Clemmer, David E; Reilly, James P
2010-08-01
Singly-protonated proline-containing peptides with N-terminal arginine are photodissociated with vacuum ultraviolet (VUV) light in an ESI linear ion trap/orthogonal-TOF (LIT/o-TOF). When proline is the nth residue from the N-terminus, unusual b(n) + 2 and a(n) + 2 ions are observed. Their formation is explained by homolytic cleavage of the C(alpha)-C bond in conjunction with a rearrangement of electrons and an amide hydrogen. The latter is facilitated by a proline-stabilized gas-phase peptide conformation. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Tsong, Tian Yow; Su, Zheng-Ding
1999-10-01
Cis/trans isomerization of proline residues is known to exhibit high activation energies. These kinetic barriers often dominate the energy landscape of protein folding. There are 6 proline residues (at positions 11, 31, 42, 47, 56 and 117) in staphylococcal nuclease (SNase) [EC 3.1.31.1]. Stopped-flow CD222nm measuring the evolution of the secondary structure of protein has detected 5 kinetic barriers in SNase folding (ΔG≠ for τfr<15, τf1 16.9, τf2 18.5, τf3 19.5, and τfs 21.8 kcal/mol) and 3 kinetic barriers in unfolding (ΔG≠ for τur<15, τu1 17.4, τus 21.6 kcal/mol). To investigate systematically how individual proline residues and 6 proline residues in toto can shape the folding funnel we have expediently constructed 7 proline mutants for study. They are 6 single-proline-substituted mutants (P11A, P31A, P42A, P47A, P56A and P117A) and 1 proline-free mutant (PallA). Study of equilibrium folding/unfolding and stopped-flow kinetics of the wildtype and the 7 mutants of SNase have allowed us to identify sources of 3 main kinetic barriers in the SNase folding. The highest barrier (ΔG≠=21.8 kcal) belongs to the cis/trans isomerization of Pro117. The next barrier (ΔG≠=19.5 kcal) involves synergetic effects of proline residues which limits the rate of folding of the oligonucleotide binding (OB) domain in all 7 proline-containing SNase. For the proline-free mutant (PallA) the OB domain folds rapidly. Furthermore, we have found that the equilibrium folding/unfolding properties of these proline mutants are remarkably similar to that of the wildtype despite their startlingly different folding/unfolding kinetics. These results lead us to conclude that while free energy of folding (ΔGF=-4.5 kcal/mol) provides the driving force, it is the activation energy that forms a conduit or shapes a kinetic funnel for SNase folding. The landscape for SNase folding is extremely rugged. Data support our previously proposed Least Activation Path (LAP) model for protein folding [Su, Z.D. et al. Proc. Natl. Acad. Sci. USA 93, 2539-2544 (1996)]. The LAP concept depicts protein folding as the movement of the unfolded population of protein along deep valleys of the energy landscape to reach the free energy minimum of the native state. An analogy for the LAP model would be flow of water from a highland over the rugged surface of a landscape to reach the lowest point of the ground. The fine features of the landscape will dictate kinetics and pathways of the flow.
Cryptic Production of trans-3-Hydroxyproline in Echinocandin B Biosynthesis.
Mattay, Johanna; Houwaart, Stefanie; Hüttel, Wolfgang
2018-04-01
Echinocandins are antifungal nonribosomal hexapeptides produced by fungi. Two of the amino acids are hydroxy-l-prolines: trans -4-hydroxy-l-proline and, in most echinocandin structures, ( trans -2,3)-3-hydroxy-( trans -2,4)-4-methyl-l-proline. In the case of echinocandin biosynthesis by Glarea lozoyensis , both amino acids are found in pneumocandin A 0 , while in pneumocandin B 0 the latter residue is replaced by trans -3-hydroxy-l-proline (3-Hyp). We have recently reported that all three amino acids are generated by the 2-oxoglutarate-dependent proline hydroxylase GloF. In echinocandin B biosynthesis by Aspergillus species, 3-Hyp derivatives have not been reported. Here we describe the heterologous production and kinetic characterization of HtyE, the 2-oxoglutarate-dependent proline hydroxylase from the echinocandin B biosynthetic cluster in Aspergillus pachycristatus Surprisingly, l-proline hydroxylation with HtyE resulted in an even higher proportion (∼30%) of 3-Hyp than that with GloF. This suggests that the selectivity for methylated 3-Hyp in echinocandin B biosynthesis is due solely to a substrate-specific adenylation domain of the nonribosomal peptide synthetase. Moreover, we observed that one product of HtyE catalysis, 3-hydroxy-4-methyl-l-proline, is slowly further oxidized at the methyl group, giving 3-hydroxy-4-hydroxymethyl-l-proline, upon prolonged incubation with HtyE. This dihydroxylated amino acid has been reported as a building block of cryptocandin, an echinocandin produced by Cryptosporiopsis IMPORTANCE Secondary metabolites from bacteria and fungi are often produced by sets of biosynthetic enzymes encoded in distinct gene clusters. Usually, each enzyme catalyzes one biosynthetic step, but multiple reactions are also possible. Pneumocandins A 0 and B 0 are produced by the fungus Glarea lozoyensis They belong to the echinocandin family, a group of nonribosomal cyclic lipopeptides that exhibit a strong antifungal activity. Chemical derivatives are important drugs for the treatment of systemic fungal infections. We have recently shown that in the biosynthesis of pneumocandins A 0 and B 0 , three hydroxyproline building blocks are provided by one proline hydroxylase. Here we demonstrate that the proline hydroxylase from echinocandin B biosynthesis in Aspergillus pachycristatus produces the same hydroxyprolines, with an increased proportion of trans -3-hydroxyproline. However, echinocandin B biosynthesis does not require trans -3-hydroxyproline; its formation remains cryptic. While one can only speculate on the evolutionary background of this unexpected finding, proline hydroxylation in G. lozoyensis and A. pachycristatus provides an unusual insight into peptide antibiotic biosynthesis-namely, the complex interplay between the selectivity of a hydroxylase and the substrate specificity of a nonribosomal peptide synthetase. Copyright © 2018 American Society for Microbiology.
Position of Proline Mediates the Reactivity of S-Palmitoylation.
Khanal, Neelam; Pejaver, Vikas; Li, Zhiyu; Radivojac, Predrag; Clemmer, David E; Mukhopadhyay, Suchetana
2015-11-20
Palmitoylation, a post-translational modification in which a saturated 16-carbon chain is added predominantly to a cysteine residue, participates in various biological functions. The position of proline relative to other residues being post-translationally modified has been previously reported as being important. We determined that proline is statistically enriched around cysteines known to be S-palmitoylated. The goal of this work was to determine how the position of proline influences the palmitoylation of the cysteine residue. We established a mass spectrometry-based approach to investigate time- and temperature-dependent kinetics of autopalmitoylation in vitro and to derive the thermodynamic parameters of the transition state associated with palmitoylation; to the best of our knowledge, our work is the first to study the kinetics and activation properties of the palmitoylation process. We then used these thermochemical parameters to determine if the position of proline relative to the modified cysteine is important for palmitoylation. Our results show that peptides with proline at the -1 position of cysteine in their sequence (PC) have lower enthalpic barriers and higher entropic barriers in comparison to the same peptides with proline at the +1 position of cysteine (CP); interestingly, the free-energy barriers for both pairs are almost identical. Molecular dynamics studies demonstrate that the flexibility of the cysteine backbone in the PC-containing peptide when compared to the CP-containing peptide explains the increased entropic barrier and decreased enthalpic barrier observed experimentally.
Tsolmonbaatar, Ariunzaya; Hashida, Keisuke; Sugimoto, Yukiko; Watanabe, Daisuke; Furukawa, Shuhei; Takagi, Hiroshi
2016-12-05
During bread-making processes, yeast cells are exposed to baking-associated stresses such as freeze-thaw, air-drying, and high-sucrose concentrations. Previously, we reported that self-cloning diploid baker's yeast strains that accumulate proline retained higher-level fermentation abilities in both frozen and sweet doughs than the wild-type strain. Although self-cloning yeasts do not have to be treated as genetically modified yeasts, the conventional methods for breeding baker's yeasts are more acceptable to consumers than the use of self-cloning yeasts. In this study, we isolated mutants resistant to the proline analogue azetidine-2-carboxylate (AZC) derived from diploid baker's yeast of Saccharomyces cerevisiae. Some of the mutants accumulated a greater amount of intracellular proline, and among them, 5 mutants showed higher cell viability than that observed in the parent wild-type strain under freezing or high-sucrose stress conditions. Two of them carried novel mutations in the PRO1 gene encoding the Pro247Ser or Glu415Lys variant of γ-glutamyl kinase (GK), which is a key enzyme in proline biosynthesis in S. cerevisiae. Interestingly, we found that these mutations resulted in AZC resistance of yeast cells and desensitization to proline feedback inhibition of GK, leading to intracellular proline accumulation. Moreover, baker's yeast cells expressing the PRO1 P247S and PRO1 E415K gene were more tolerant to freezing stress than cells expressing the wild-type PRO1 gene. The approach described here could be a practical method for the breeding of proline-accumulating baker's yeasts with higher tolerance to baking-associated stresses. Copyright © 2016 Elsevier B.V. All rights reserved.
Cortes-Hernandez, Paulina
2017-01-01
Periplasmic Binding Proteins (PBPs) trap nutrients for their internalization into bacteria by ABC transporters. Ligand binding triggers PBP closure by bringing its two domains together like a Venus flytrap. The atomic determinants that control PBP opening and closure for nutrient capture and release are not known, although it is proposed that opening and ligand release occur while in contact with the ABC transporter for concurrent substrate translocation. In this paper we evaluated the effect of the isomerization of a conserved proline, located near the binding site, on the propensity of PBPs to open and close. ArgT/LAO from Salmonella typhimurium and HisJ from Escherichia coli were studied through molecular mechanics at two different temperatures: 300 and 323 K. Eight microseconds were simulated per protein to analyze protein opening and closure in the absence of the ABC transporter. We show that when the studied proline is in trans, closed empty LAO and HisJ can open. In contrast, with the proline in cis, opening transitions were much less frequent and characterized by smaller changes. The proline in trans also renders the open trap prone to close over a ligand. Our data suggest that the isomerization of this conserved proline modulates the PBP mechanism: the proline in trans allows the exploration of conformational space to produce trap opening and closure, while in cis it restricts PBP movement and could limit ligand release until in productive contact with the ABC transporter. This is the first time that a proline isomerization has been related to the control of a large conformational change like the PBP flytrap mechanism. PMID:29190818
Malo de Molina, Paula; Alvarez, Fernando; Frick, Bernhard; Wildes, Andrew; Arbe, Arantxa; Colmenero, Juan
2017-10-18
We applied quasielastic neutron scattering (QENS) techniques to samples with two different contrasts (deuterated solute/hydrogenated solvent and the opposite label) to selectively study the component dynamics of proline/water solutions. Results on diluted and concentrated solutions (31 and 6 water molecules/proline molecule, respectively) were analyzed in terms of the susceptibility and considering a recently proposed model for water dynamics [Arbe et al., Phys. Rev. Lett., 2016, 117, 185501] which includes vibrations and the convolution of localized motions and diffusion. We found that proline molecules not only reduce the average diffusion coefficient of water but also extend the time/frequency range of the crossover region ('cage') between the vibrations and purely diffusive behavior. For the high proline concentration we also found experimental evidence of water heterogeneous dynamics and a distribution of diffusion coefficients. Complementary molecular dynamics simulations show that water molecules start to perform rotational diffusion when they escape the cage regime but before the purely diffusive behavior is established. The rotational diffusion regime is also retarded by the presence of proline molecules. On the other hand, a strong coupling between proline and water diffusive dynamics which persists with decreasing temperature is directly observed using QENS. Not only are the temperature dependences of the diffusion coefficients of both components the same, but their absolute values also approach each other with increasing proline concentration. We compared our results with those reported using other techniques, in particular using dielectric spectroscopy (DS). A simple approach based on molecular hydrodynamics and a molecular treatment of DS allows rationalizing the a priori puzzling inconsistency between QENS and dielectric results regarding the dynamic coupling of the two components. The interpretation proposed is based on general grounds and therefore should be applicable to other biomolecular solutions.
Webb, Benjamin A.; Hildreth, Sherry; Helm, Richard F.
2014-01-01
Bacterial chemotaxis is an important attribute that aids in establishing symbiosis between rhizobia and their legume hosts. Plant roots and seeds exude a spectrum of molecules into the soil to attract their bacterial symbionts. The alfalfa symbiont Sinorhizobium meliloti possesses eight chemoreceptors to sense its environment and mediate chemotaxis toward its host. The methyl accepting chemotaxis protein McpU is one of the more abundant S. meliloti chemoreceptors and an important sensor for the potent attractant proline. We established a dominant role of McpU in sensing molecules exuded by alfalfa seeds. Mass spectrometry analysis determined that a single germinating seed exudes 3.72 nmol of proline, producing a millimolar concentration near the seed surface which can be detected by the chemosensory system of S. meliloti. Complementation analysis of the mcpU deletion strain verified McpU as the key proline sensor. A structure-based homology search identified tandem Cache (calcium channels and chemotaxis receptors) domains in the periplasmic region of McpU. Conserved residues Asp-155 and Asp-182 of the N-terminal Cache domain were determined to be important for proline sensing by evaluating mutant strains in capillary and swim plate assays. Differential scanning fluorimetry revealed interaction of the isolated periplasmic region of McpU (McpU40-284) with proline and the importance of Asp-182 in this interaction. Using isothermal titration calorimetry, we determined that proline binds with a Kd (dissociation constant) of 104 μM to McpU40-284, while binding was abolished when Asp-182 was substituted by Glu. Our results show that McpU is mediating chemotaxis toward host plants by direct proline sensing. PMID:24657863
Rognoni, Lorenz; Möst, Tobias; Žoldák, Gabriel; Rief, Matthias
2014-01-01
Proline switches, controlled by cis–trans isomerization, have emerged as a particularly effective regulatory mechanism in a wide range of biological processes. In this study, we use single-molecule mechanical measurements to develop a full kinetic and energetic description of a highly conserved proline switch in the force-sensing domain 20 of human filamin and how prolyl isomerization modulates the force-sensing mechanism. Proline isomerization toggles domain 20 between two conformations. A stable cis conformation with slow unfolding, favoring the autoinhibited closed conformation of filamin’s force-sensing domain pair 20–21, and a less stable, uninhibited conformation promoted by the trans form. The data provide detailed insight into the folding mechanisms that underpin the functionality of this binary switch and elucidate its remarkable efficiency in modulating force-sensing, thus combining two previously unconnected regulatory mechanisms, proline switches and mechanosensing. PMID:24706888
2009-01-01
Trans−cis isomerization of a proline peptide bond is a potential mechanism to open the channel of the 5-HT3 receptor. Here, we have used the metadynamics method to theoretically explore such a mechanism. We have determined the free energy surfaces in aqueous solution of a series of dipeptides of proline analogues and evaluated the free energy difference between the cis and trans isomers. These theoretical results were then compared with data from mutagenesis experiments, in which the response of the 5-HT3 receptor was measured when the proline at the apex of the M2-M3 transmembrane domain loop was mutated. The strong correlation between the experimental and the theoretical data supports the existence of a trans−cis proline switch for opening the 5-HT3 receptor ion channel. PMID:19663504
Melis, Claudio; Bussi, Giovanni; Lummis, Sarah C R; Molteni, Carla
2009-09-03
Trans-cis isomerization of a proline peptide bond is a potential mechanism to open the channel of the 5-HT(3) receptor. Here, we have used the metadynamics method to theoretically explore such a mechanism. We have determined the free energy surfaces in aqueous solution of a series of dipeptides of proline analogues and evaluated the free energy difference between the cis and trans isomers. These theoretical results were then compared with data from mutagenesis experiments, in which the response of the 5-HT(3) receptor was measured when the proline at the apex of the M2-M3 transmembrane domain loop was mutated. The strong correlation between the experimental and the theoretical data supports the existence of a trans-cis proline switch for opening the 5-HT(3) receptor ion channel.
SERCA2a upregulation ameliorates cellular alternans induced by metabolic inhibition
Stary, Victoria; Puppala, Dheeraj; Scherrer-Crosbie, Marielle; Dillmann, Wolfgang H.
2016-01-01
Cardiac alternans has been associated with the incidence of ventricular tachyarrhythmias and sudden cardiac death. The aim of this study was to investigate the effect of impaired mitochondrial function in the genesis of cellular alternans and to examine whether modulating the sarcoplasmic reticulum (SR) Ca2+ ameliorates the level of alternans. Cardiomyocytes isolated from control and doxycyline-induced sarco(endo)plasmic reticulum Ca2+-ATPase 2a (SERCA2a)-upregulated mice were loaded with two different Ca2+ indicators to selectively measure mitochondrial and cytosolic Ca2+ using a custom-made fluorescence photometry system. The degree of alternans was defined as the alternans ratio (AR) [1 − (small Ca2+ intensity)/(large Ca2+ intensity)]. Blocking of complex I and II, cytochrome-c oxidase, F0F1 synthase, α-ketoglutarate dehydrogenase of the electron transport chain, increased alternans in both control and SERCA2a mice (P < 0.01). Changes in AR in SERCA2a-upregulated mice were significantly less pronounced than those observed in control in seven of nine tested conditions (P < 0.04). N-acetyl-l-cysteine (NAC), rescued alternans in myocytes that were previously exposed to an oxidizing agent (P < 0.001). CGP, an antagonist of the mitochondrial Na+-Ca2+ exchanger, had the most severe effect on AR. Exposure to cyclosporin A, a blocker of the mitochondrial permeability transition pore reduced CGP-induced alternans (P < 0.0001). The major findings of this study are that impairment of mitochondrial Ca2+ cycling and energy production leads to a higher amplitude of alternans in both control and SERCA2a-upregulated mice, but changes in SERCA2a-upregulated mice are less severe, indicating that SERCA2a mice are more capable of sustaining electrical stability during stress. This suggests a relationship between sarcoplasmic Ca2+ content and mitochondrial dysfunction during alternans, which may potentially help to understand changes in Ca2+ signaling in myocytes from diseased hearts, leading to new therapeutic targets. PMID:26846549
Chan, Samuel H H; Wu, Chiung-Ai; Wu, Kay L H; Ho, Ying-Hao; Chang, Alice Y W; Chan, Julie Y H
2009-10-23
Mitochondrial uncoupling proteins (UCPs) belong to a superfamily of mitochondrial anion transporters that uncouple ATP synthesis from oxidative phosphorylation and mitigates mitochondrial reactive oxygen species production. We assessed the hypothesis that UCP2 participates in central cardiovascular regulation by maintaining reactive oxygen species homeostasis in the rostral ventrolateral medulla (RVLM), where sympathetic premotor neurons that maintain vasomotor tone located. We also elucidated the molecular mechanisms that underlie transcriptional upregulation of UCP2 in response to oxidative stress in RVLM. In Sprague-Dawley rats, transcriptional upregulation of UCP2 in RVLM by rosiglitazone, an activator of its transcription factor peroxisome proliferator-activated receptor (PPAR)gamma, reduced mitochondrial hydrogen peroxide level in RVLM and systemic arterial pressure. Oxidative stress induced by microinjection of angiotensin II into RVLM augmented UCP2 mRNA or protein expression in RVLM, which was antagonized by comicroinjection of NADPH oxidase inhibitor (diphenyleneiodonium chloride), superoxide dismutase mimetic (tempol), or p38 mitogen-activated protein kinase inhibitor (SB203580) but not by extracellular signal-regulated kinase 1/2 inhibitor (U0126). Angiotensin II also induced phosphorylation of the PPARgamma coactivator, PPARgamma coactivator (PGC)-1alpha, and an increase in formation of PGC-1alpha/PPARgamma complexes in a p38 mitogen-activated protein kinase-dependent manner. Intracerebroventricular infusion of angiotensin II promoted an increase in mitochondrial hydrogen peroxide production in RVLM and chronic pressor response, which was potentiated by gene knockdown of UCP2 but blunted by rosiglitazone. These results suggest that transcriptional upregulation of mitochondrial UCP2 in response to an elevation in superoxide plays an active role in feedback regulation of reactive oxygen species production in RVLM and neurogenic hypertension associated with chronic oxidative stress.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.
2013-08-02
Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has notmore » been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive.« less
Upregulated Copper Transporters in Hypoxia-Induced Pulmonary Hypertension
Zimnicka, Adriana M.; Tang, Haiyang; Guo, Qiang; Kuhr, Frank K.; Oh, Myung-Jin; Wan, Jun; Chen, Jiwang; Smith, Kimberly A.; Fraidenburg, Dustin R.; Choudhury, Moumita S. R.; Levitan, Irena; Machado, Roberto F.; Kaplan, Jack H.; Yuan, Jason X.-J.
2014-01-01
Pulmonary vascular remodeling and increased arterial wall stiffness are two major causes for the elevated pulmonary vascular resistance and pulmonary arterial pressure in patients and animals with pulmonary hypertension. Cellular copper (Cu) plays an important role in angiogenesis and extracellular matrix remodeling; increased Cu in vascular smooth muscle cells has been demonstrated to be associated with atherosclerosis and hypertension in animal experiments. In this study, we show that the Cu-uptake transporter 1, CTR1, and the Cu-efflux pump, ATP7A, were both upregulated in the lung tissues and pulmonary arteries of mice with hypoxia-induced pulmonary hypertension. Hypoxia also significantly increased expression and activity of lysyl oxidase (LOX), a Cu-dependent enzyme that causes crosslinks of collagen and elastin in the extracellular matrix. In vitro experiments show that exposure to hypoxia or treatment with cobalt (CoCl2) also increased protein expression of CTR1, ATP7A, and LOX in pulmonary arterial smooth muscle cells (PASMC). In PASMC exposed to hypoxia or treated with CoCl2, we also confirmed that the Cu transport is increased using 64Cu uptake assays. Furthermore, hypoxia increased both cell migration and proliferation in a Cu-dependent manner. Downregulation of hypoxia-inducible factor 1α (HIF-1α) with siRNA significantly attenuated hypoxia-mediated upregulation of CTR1 mRNA. In summary, the data from this study indicate that increased Cu transportation due to upregulated CTR1 and ATP7A in pulmonary arteries and PASMC contributes to the development of hypoxia-induced pulmonary hypertension. The increased Cu uptake and elevated ATP7A also facilitate the increase in LOX activity and thus the increase in crosslink of extracellular matrix, and eventually leading to the increase in pulmonary arterial stiffness. PMID:24614111
Altered gene expression in early postnatal monoamine oxidase A knockout mice.
Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C
2017-08-15
We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.
El-Naga, Reem N
2015-12-05
Gastric ulcer is a common gastrointestinal disorder affecting many people all over the world. Absolute ethanol (5 ml/kg) was used to induce gastric ulceration in rats. Apocynin (50 mg/kg) was given orally one hour before the administration of absolute ethanol. Omeprazole (20 mg/kg) was used as a standard. Interestingly, apocynin pre-treatment provided 93.5% gastroprotection against ethanol-induced ulceration. Biochemically, gastric mucin content was significantly increased with apocynin pre-treatment. This finding was further supported by alcian blue staining of stomach sections obtained from the different treated groups. Also, gastric juice volume and acidity were significantly reduced. Apocynin significantly ameliorated ethanol-induced oxidative stress by replenishing reduced glutathione and superoxide dismutase levels as well as reducing elevated malondialdehyde levels in gastric tissues. Besides, ethanol-induced pro-inflammatory response was significantly decreased by apocynin pre-treatment via reducing elevated levels of pro-inflammatory markers; interleukin-1β, tumor necrosis factor-α, cyclooxygenase-2 and inducible nitric oxide synthase. Additionally, caspase-3 tissue level was significantly reduced in apocynin pre-treated group. Interestingly, NADPH oxidase-1 (NOX-1) and NOX-4 up-regulation was shown to be partially involved in the pathogenesis of ethanol-induced gastric ulceration and was significantly reversed by apocynin pre-treatment. Gastroprotective properties of apocynin were confirmed by histopathological examination. It is worth mentioning that apocynin was superior in all aspects except gastric mucin content parameter where it was significantly increased by 13.5 folds in the omeprazole pre-treated group. This study was the first to show that apocynin is a promising gastroprotective agent against ethanol-induced gastric ulceration, partially via its anti-oxidant, anti-inflammatory, anti-apoptotic effects as well as down-regulating NOX-1 and NOX-4 expression. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Villeneuve, Christelle; Guilbeau-Frugier, Céline; Sicard, Pierre; Lairez, Olivier; Ordener, Catherine; Duparc, Thibaut; De Paulis, Damien; Couderc, Bettina; Spreux-Varoquaux, Odile; Tortosa, Florence; Garnier, Anne; Knauf, Claude; Valet, Philippe; Borchi, Elisabetta; Nediani, Chiara; Gharib, Abdallah; Ovize, Michel; Delisle, Marie-Bernadette; Mialet-Perez, Jeanne
2013-01-01
Abstract Aims: Oxidative stress and mitochondrial dysfunction participate together in the development of heart failure (HF). mRNA levels of monoamine oxidase-A (MAO-A), a mitochondrial enzyme that produces hydrogen peroxide (H2O2), increase in several models of cardiomyopathies. Therefore, we hypothesized that an increase in cardiac MAO-A could cause oxidative stress and mitochondrial damage, leading to cardiac dysfunction. In the present study, we evaluated the consequences of cardiac MAO-A augmentation on chronic oxidative damage, cardiomyocyte survival, and heart function, and identified the intracellular pathways involved. Results: We generated transgenic (Tg) mice with cardiac-specific MAO-A overexpression. Tg mice displayed cardiac MAO-A activity levels similar to those found in HF and aging. As expected, Tg mice showed a significant decrease in the cardiac amounts of the MAO-A substrates serotonin and norepinephrine. This was associated with enhanced H2O2 generation in situ and mitochondrial DNA oxidation. As a consequence, MAO-A Tg mice demonstrated progressive loss of cardiomyocytes by necrosis and ventricular failure, which were prevented by chronic treatment with the MAO-A inhibitor clorgyline and the antioxidant N-acetyl-cystein. Interestingly, Tg hearts exhibited p53 accumulation and downregulation of peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), a master regulator of mitochondrial function. This was concomitant with cardiac mitochondrial ultrastructural defects and ATP depletion. In vitro, MAO-A adenovirus transduction of neonatal cardiomyocytes mimicked the results in MAO-A Tg mice, triggering oxidative stress-dependent p53 activation, leading to PGC-1α downregulation, mitochondrial impairment, and cardiomyocyte necrosis. Innovation and Conclusion: We provide the first evidence that MAO-A upregulation in the heart causes oxidative mitochondrial damage, p53-dependent repression of PGC-1α, cardiomyocyte necrosis, and chronic ventricular dysfunction. Antioxid. Redox Signal. 18, 5–18. PMID:22738191
Bioluminescent bioreporter sensing of foodborne toxins
NASA Astrophysics Data System (ADS)
Fraley, Amanda C.; Ripp, Steven; Sayler, Gary S.
2004-06-01
Histamine is the primary etiological agent in the foodborne disease scombrotoxicosis, one of the most common food toxicities related to fish consumption. Procedures for detecting histamine in fish products are available, but are often too expensive or too complex for routine use. As an alternative, a bacterial bioluminescent bioreporter has been constructed to develop a biosensor system that autonomously responds to low levels of histamine. The bioreporter contains a promoterless Photorhabdus luminescens lux operon (luxCDABE) fused with the Vibrio anguillarum angR regulatory gene promoter of the anguibactin biosynthetic operon. The bioreporter emitted 1.46 times more bioluminescence than background, 30 minutes after the addition of 100mM histamine. However, specificity was not optimal, as this biosensor generated significant bioluminescence in the presence of L-proline and L-histidine. As a means towards improving histamine specificity, the promoter region of a histamine oxidase gene from Arthrobacter globiformis was cloned upstream of the promotorless lux operon from Photorhabdus luminescens. This recently constructed whole-cell, lux-based bioluminescent bioreporter is currently being tested for optimal performance in the presence of histamine in order to provide a rapid, simple, and inexpensive model sensor for the detection of foodborne toxins.
Nitrate deficiency reduces cadmium and nickel accumulation in chamomile plants.
Kovácik, Jozef; Klejdus, Borivoj; Stork, Frantisek; Hedbavny, Josef
2011-05-11
The effect of nitrogen (nitrate) deficiency (-N) on the accumulation of cadmium (Cd) and nickel (Ni) in chamomile ( Matricaria chamomilla ) plants was studied. Elimination of N from the culture medium led to decreases in N-based compounds (free amino acids and soluble proteins) and increases in C-based compounds (reducing sugars, soluble phenols, coumarins, phenolic acids, and partially flavonoids and lignin), being considerably affected by the metal presence. Proline, a known stress-protective amino acid, decreased in all -N variants. The activity of phenylalanine ammonia-lyase was stimulated only in -N control plants, whereas the activities of polyphenol oxidase and guaiacol peroxidase were never reduced in -N variants in comparison with respective +N counterparts. Among detected phenolic acids, chlorogenic acid strongly accumulated in all N-deficient variants in the free fraction and caffeic acid in the cell wall-bound fraction. Mineral nutrients were rather affected by a given metal than by N deficiency. Shoot and total root Cd and Ni amounts decreased in -N variants. On the contrary, ammonium-fed plants exposed to N deficiency did not show similar changes in Cd and Ni contents. The present findings are discussed with respect to the role of phenols and mineral nutrition in metal uptake.
Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu
2013-01-01
Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H2O2 content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses. PMID:23326325
Lu, Yao; Li, Yajun; Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu
2013-01-01
Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H(2)O(2) content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses.
l-Proline, GABA Synthesis and Gamma Oscillations in Schizophrenia.
Volk, David W; Gonzalez-Burgos, Guillermo; Lewis, David A
2016-12-01
Altered inhibition from parvalbumin-containing GABA neurons is thought to contribute to impaired gamma frequency oscillations and cognitive deficits in schizophrenia. Crabtree and colleagues report that proline dehydrogenase deficits produce excessive cytosolic levels of the GABA-mimetic l-proline which impairs GABA synthesis and gamma oscillations in a manner that mimics schizophrenia. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yamada, Nana; Sakakibara, Shota; Tsutsumi, Koichi; Waditee, Rungaroon; Tanaka, Yoshito; Takabe, Teruhiro
2011-09-15
Proline transporters (ProTs) originally described as highly selective transporters for proline, have been shown to also transport glycinebetaine (betaine). Here we examined and compared the transport properties of Bet/ProTs from betaine accumulating (sugar beet, Amaranthus, and Atriplex,) and non-accumulating (Arabidopsis) plants. Using a yeast mutant deficient for uptake of proline and betaine, it was shown that all these transporters exhibited higher affinity for betaine than proline. The uptake of betaine and proline was pH-dependent and inhibited by the proton uncoupler carbonylcyanide m-chlorophenylhydrazone (CCCP). We also investigated choline transport by using a choline transport-deficient yeast mutant. Results revealed that these transporters exhibited a higher affinity for choline uptake rather than betaine. Uptake of choline by sugar beet BvBet/ProT1 was independent of the proton gradient and the inhibition by CCCP was reduced compared with that for uptake of betaine, suggesting different proton binding properties between the transport of choline and betaine. Additionally, in situ hybridization experiments revealed the localization of sugar beet BvBet/ProT1 in phloem and xylem parenchyma cells. Copyright © 2011 Elsevier GmbH. All rights reserved.
NASA Astrophysics Data System (ADS)
Mantsyzov, Alexey B.; Savelyev, Oleg Y.; Ivantcova, Polina M.; Bräse, Stefan; Kudryavtsev, Konstantin V.; Polshakov, Vladimir I.
2018-03-01
Synthetic β-peptides are potential functional mimetics of native α-proteins. A recently developed, novel, synthetic approach provides an effective route to the broad group of β-proline oligomers with alternating patterns of stereogenic centers. Conformation of the pyrrolidine ring, Z/E isomerism of β-peptide bonds, and hindered rotation of the neighboring monomers determine the spatial structure of this group of β-proline oligopeptides. Preferences in structural organization and corresponding thermodynamic properties are determined by NMR spectroscopy, restrained molecular dynamics and quantum mechanics. The studied β-proline oligopeptides exist in dimethyl sulfoxide solution in a limited number of conformers, with compatible energy of formation and different spatial organization. In the β-proline tetrapeptide with alternating chirality of composing pyrrolidine units, one of three peptide bonds may exist in an E configuration. For the alternating β-proline pentapeptide, the presence of an E configuration for at least of one β-peptide bond is mandatory. In this case, three peptide bonds synchronously change their configurations. Larger polypeptides may only exist in the presence of several E configurations of β-peptide bonds forming a wave-like extended structure.
Mantsyzov, Alexey B; Savelyev, Oleg Y; Ivantcova, Polina M; Bräse, Stefan; Kudryavtsev, Konstantin V; Polshakov, Vladimir I
2018-01-01
Synthetic β-peptides are potential functional mimetics of native α-proteins. A recently developed, novel, synthetic approach provides an effective route to the broad group of β-proline oligomers with alternating patterns of stereogenic centers. Conformation of the pyrrolidine ring, Z / E isomerism of β-peptide bonds, and hindered rotation of the neighboring monomers determine the spatial structure of this group of β-proline oligopeptides. Preferences in their structural organization and corresponding thermodynamic properties are determined by NMR spectroscopy, restrained molecular dynamics and quantum mechanics. The studied β-proline oligopeptides exist in dimethyl sulfoxide solution in a limited number of conformers, with compatible energy of formation and different spatial organization. In the β-proline tetrapeptide with alternating chirality of composing pyrrolidine units, one of three peptide bonds may exist in an E configuration. For the alternating β-proline pentapeptide, the presence of an E configuration for at least of one β-peptide bond is mandatory. In this case, three peptide bonds synchronously change their configurations. Larger polypeptides may only exist in the presence of several E configurations of β-peptide bonds forming a wave-like extended structure.
Nepravishta, Ridvan; Mandaliti, Walter; Melino, Sonia; Eliseo, Tommaso; Paci, Maurizio
2014-12-01
The structural characterization of [W8S]contryphan Vn, an analogue of Contryphan Vn with tryptophan 8 substituted with a serine residue (W8S), was performed by NMR spectroscopy, molecular dynamics simulations and fluorescence spectroscopy. Contryphan Vn, a bioactive cyclic peptide from the venom of the cone snail Conus ventricosus, contains an S-S bridge between two cysteines and a D-tryptophan. Like other Contryphans, [W8S]contryphan Vn has proline 7 isomerized trans, while the proline 4 has nearly equivalent populations of cis and trans configurations. The thermodynamic and kinetic parameters of the trans-cis isomerization of proline 4 were measured. The isomers of [W8S]contryphan Vn with proline 4 in cis and trans show structural differences. The absence of the salt bridge between the same Asp2 and Lys6, present in Contryphan Vn, may be attributed to the lack of the hydrophobic side chain of Trp8 where it likely protects the electrostatic interactions. These results may contribute to identifying, in these cyclic peptides, the structural determinants of the mechanism of proline trans-cis isomerization, this being also an important step in protein folding.
Pneumocandin biosynthesis: involvement of a trans-selective proline hydroxylase.
Houwaart, Stefanie; Youssar, Loubna; Hüttel, Wolfgang
2014-11-03
Echinocandins are cyclic nonribosomal hexapeptides based mostly on nonproteinogenic amino acids and displaying strong antifungal activity. Despite previous studies on their biosynthesis by fungi, the origin of three amino acids, trans-4- and trans-3-hydroxyproline, as well as trans-3-hydroxy-4-methylproline, is still unknown. Here we describe the identification, overexpression, and characterization of GloF, the first eukaryotic α-ketoglutarate/Fe(II) -dependent proline hydroxylase from the pneumocandin biosynthesis cluster of the fungus Glarea lozoyensis ATCC 74030. In in vitro transformations with L-proline, GloF generates trans-4- and trans-3-hydroxyproline simultaneously in a ratio of 8:1; the latter reaction was previously unknown for proline hydroxylase catalysis. trans-4-Methyl-L-proline is converted into the corresponding trans-3-hydroxyproline. All three hydroxyprolines required for the biosynthesis of the echinocandins pneumocandins A0 and B0 in G. lozoyensis are thus provided by GloF. Sequence analyses revealed that GloF is not related to bacterial proline hydroxylases, and none of the putative proteins with high sequence similarity in the databases has been characterized so far. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Bleiholder, Christian; Suhai, Sándor; Harrison, Alex G.; Paizs, Béla
2011-06-01
The product ion spectra of proline-containing peptides are commonly dominated by y n ions generated by cleavage at the N-terminal side of proline residues. This proline effect is investigated in the current work by collision-induced dissociation (CID) of protonated Ala-Ala-Xxx-Pro-Ala (Xxx includes Ala, Ser, Leu, Val, Phe, and Trp) in an electrospray/quadrupole/time-of-flight (QqTOF) mass spectrometer and by quantum chemical calculations on protonated Ala-Ala-Ala-Pro-Ala. The CID spectra of all investigated peptides show a dominant y 2 ion (Pro-Ala sequence). Our computational results show that the proline effect mainly arises from the particularly low threshold energy for the amide bond cleavage N-terminal to the proline residue, and from the high proton affinity of the proline-containing C-terminal fragment produced by this cleavage. These theoretical results are qualitatively supported by the experimentally observed y 2 / b 3 abundance ratios for protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp). In the post-cleavage phase of fragmentation the N-terminal oxazolone fragment with the Ala-Ala-Xxx sequence and Pro-Ala compete for the ionizing proton for these peptides. As the proton affinity of the oxazolone fragment increases, the y 2 / b 3 abundance ratio decreases.
Bleiholder, Christian; Suhai, Sándor; Harrison, Alex G; Paizs, Béla
2011-06-01
The product ion spectra of proline-containing peptides are commonly dominated by y(n) ions generated by cleavage at the N-terminal side of proline residues. This proline effect is investigated in the current work by collision-induced dissociation (CID) of protonated Ala-Ala-Xxx-Pro-Ala (Xxx includes Ala, Ser, Leu, Val, Phe, and Trp) in an electrospray/quadrupole/time-of-flight (QqTOF) mass spectrometer and by quantum chemical calculations on protonated Ala-Ala-Ala-Pro-Ala. The CID spectra of all investigated peptides show a dominant y(2) ion (Pro-Ala sequence). Our computational results show that the proline effect mainly arises from the particularly low threshold energy for the amide bond cleavage N-terminal to the proline residue, and from the high proton affinity of the proline-containing C-terminal fragment produced by this cleavage. These theoretical results are qualitatively supported by the experimentally observed y(2)/b(3) abundance ratios for protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp). In the post-cleavage phase of fragmentation the N-terminal oxazolone fragment with the Ala-Ala-Xxx sequence and Pro-Ala compete for the ionizing proton for these peptides. As the proton affinity of the oxazolone fragment increases, the y(2)/b(3) abundance ratio decreases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Manea, Adrian, E-mail: adrian.manea@icbp.ro; Tanase, Laurentia I.; Raicu, Monica
Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysismore » showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.« less
Auernik, Kathryne S; Maezato, Yukari; Blum, Paul H; Kelly, Robert M
2008-02-01
Despite their taxonomic description, not all members of the order Sulfolobales are capable of oxidizing reduced sulfur species, which, in addition to iron oxidation, is a desirable trait of biomining microorganisms. However, the complete genome sequence of the extremely thermoacidophilic archaeon Metallosphaera sedula DSM 5348 (2.2 Mb, approximately 2,300 open reading frames [ORFs]) provides insights into biologically catalyzed metal sulfide oxidation. Comparative genomics was used to identify pathways and proteins involved (directly or indirectly) with bioleaching. As expected, the M. sedula genome contains genes related to autotrophic carbon fixation, metal tolerance, and adhesion. Also, terminal oxidase cluster organization indicates the presence of hybrid quinol-cytochrome oxidase complexes. Comparisons with the mesophilic biomining bacterium Acidithiobacillus ferrooxidans ATCC 23270 indicate that the M. sedula genome encodes at least one putative rusticyanin, involved in iron oxidation, and a putative tetrathionate hydrolase, implicated in sulfur oxidation. The fox gene cluster, involved in iron oxidation in the thermoacidophilic archaeon Sulfolobus metallicus, was also identified. These iron- and sulfur-oxidizing components are missing from genomes of nonleaching members of the Sulfolobales, such as Sulfolobus solfataricus P2 and Sulfolobus acidocaldarius DSM 639. Whole-genome transcriptional response analysis showed that 88 ORFs were up-regulated twofold or more in M. sedula upon addition of ferrous sulfate to yeast extract-based medium; these included genes for components of terminal oxidase clusters predicted to be involved with iron oxidation, as well as genes predicted to be involved with sulfur metabolism. Many hypothetical proteins were also differentially transcribed, indicating that aspects of the iron and sulfur metabolism of M. sedula remain to be identified and characterized.
Sharma, Anuj Kumar; Singh, Vikas; Gera, Ruchi; Purohit, Mahaveer Prasad; Ghosh, Debabrata
2017-10-01
Zinc oxide nanoparticle (ZnO-NP) is one of the most widely used engineered nanoparticles. Upon exposure, nanoparticle can eventually reach the brain through various routes, interact with different brain cells, and alter their activity. Microglia is the fastest glial cell to respond to any toxic insult. Nanoparticle exposure can activate microglia and induce neuroinflammation. Simultaneous to activation, microglial death can exacerbate the scenario. Therefore, we focused on studying the effect of ZnO-NP on microglia and finding out the pathway involved in the microglial death. The present study showed that the 24 h inhibitory concentration 50 (IC 50 ) of ZnO-NP for microglia is 6.6 μg/ml. Early events following ZnO-NP exposure involved increase in intracellular calcium level as well as reactive oxygen species (ROS). Neither of NADPH oxidase inhibitors, apocynin, (APO) and diphenyleneiodonium chloride (DPIC) were able to reduce the ROS level and rescue microglia from ZnO-NP toxicity. In contrary, N-acetyl cysteine (NAC) showed opposite effect. Exogenous supplementation of superoxide dismutase (SOD) reduced ROS significantly even beyond control level but partially rescued microglial viability. Interestingly, pyruvate supplementation rescued microglia near to control level. Following 10 h of ZnO-NP exposure, intracellular ATP level was measured to be almost 50 % to the control. ZnO-NP-induced ROS as well as ATP depletion both disturbed mitochondrial membrane potential and subsequently triggered the apoptotic pathway. The level of apoptosis-inducing proteins was measured by western blot analysis and found to be upregulated. Taken together, we have deciphered that ZnO-NP induced microglial apoptosis by NADPH oxidase-independent ROS as well as ATP depletion.
Madureira, Tânia Vieira; Castro, L Filipe C; Rocha, Eduardo
2016-02-01
Acyl-coenzyme A oxidases 1 (Acox1) and 3 (Acox3) are key enzymes in the regulation of lipid homeostasis. Endogenous and exogenous factors can disrupt their normal expression/activity. This study presents for the first time the isolation and characterization of Acox1 and Acox3 in brown trout (Salmo trutta f. fario). Additionally, as previous data point to the existence of a cross-talk between two nuclear receptors, namely peroxisome proliferator-activated receptors and estrogen receptors, it was here evaluated after in vitro exposures of trout hepatocytes the interference caused by ethynylestradiol in the mRNA levels of an inducible (by peroxisome proliferators) and a non-inducible oxidase. The isolated Acox1 and Acox3 show high levels of sequence conservation compared to those of other teleosts. Additionally, it was found that Acox1 has two alternative splicing isoforms, corresponding to 3I and 3II isoforms of exon 3 splicing variants. Both isoforms display tissue specificity, with Acox1-3II presenting a more ubiquitous expression in comparison with Acox1-3I. Acox3 was expressed in almost all brown trout tissues. According to real-time PCR data, the highest estrogenic stimulus was able to cause a down-regulation of Acox1 and an up-regulation of Acox3. So, for Acox1 we found a negative association between an estrogenic input and a directly activated PPARα target gene. In conclusion, changes in hormonal estrogenic stimulus may impact the mobilization of hepatic lipids to the gonads, with ultimate consequences in reproduction. Further studies using in vivo assays will be fundamental to clarify these issues.
Auernik, Kathryne S.; Maezato, Yukari; Blum, Paul H.; Kelly, Robert M.
2008-01-01
Despite their taxonomic description, not all members of the order Sulfolobales are capable of oxidizing reduced sulfur species, which, in addition to iron oxidation, is a desirable trait of biomining microorganisms. However, the complete genome sequence of the extremely thermoacidophilic archaeon Metallosphaera sedula DSM 5348 (2.2 Mb, ∼2,300 open reading frames [ORFs]) provides insights into biologically catalyzed metal sulfide oxidation. Comparative genomics was used to identify pathways and proteins involved (directly or indirectly) with bioleaching. As expected, the M. sedula genome contains genes related to autotrophic carbon fixation, metal tolerance, and adhesion. Also, terminal oxidase cluster organization indicates the presence of hybrid quinol-cytochrome oxidase complexes. Comparisons with the mesophilic biomining bacterium Acidithiobacillus ferrooxidans ATCC 23270 indicate that the M. sedula genome encodes at least one putative rusticyanin, involved in iron oxidation, and a putative tetrathionate hydrolase, implicated in sulfur oxidation. The fox gene cluster, involved in iron oxidation in the thermoacidophilic archaeon Sulfolobus metallicus, was also identified. These iron- and sulfur-oxidizing components are missing from genomes of nonleaching members of the Sulfolobales, such as Sulfolobus solfataricus P2 and Sulfolobus acidocaldarius DSM 639. Whole-genome transcriptional response analysis showed that 88 ORFs were up-regulated twofold or more in M. sedula upon addition of ferrous sulfate to yeast extract-based medium; these included genes for components of terminal oxidase clusters predicted to be involved with iron oxidation, as well as genes predicted to be involved with sulfur metabolism. Many hypothetical proteins were also differentially transcribed, indicating that aspects of the iron and sulfur metabolism of M. sedula remain to be identified and characterized. PMID:18083856
Blanca, Antonio J; Ruiz-Armenta, María V; Zambrano, Sonia; Salsoso, Rocío; Miguel-Carrasco, José L; Fortuño, Ana; Revilla, Elisa; Mate, Alfonso; Vázquez, Carmen M
2016-10-01
Leptin is a protein involved in the regulation of food intake and in the immune and inflammatory responses, among other functions. Evidences demonstrate that obesity is directly associated with high levels of leptin, suggesting that leptin may directly link obesity with the elevated cardiovascular and renal risk associated with increased body weight. Adverse effects of leptin include oxidative stress mediated by activation of NADPH oxidase. The aim of this study was to evaluate the effect of L-carnitine (LC) in rat renal epithelial cells (NRK-52E) exposed to leptin in order to generate a state of oxidative stress characteristic of obesity. Leptin increased superoxide anion (O2 (•) -) generation from NADPH oxidase (via PI3 K/Akt pathway), NOX2 expression and nitrotyrosine levels. On the other hand, NOX4 expression and hydrogen peroxide (H2 O2 ) levels diminished after leptin treatment. Furthermore, the expression of antioxidant enzymes, catalase, and superoxide dismutase, was altered by leptin, and an increase in the mRNA expression of pro-inflammatory factors was also found in leptin-treated cells. LC restored all changes induced by leptin to those levels found in untreated cells. In conclusion, stimulation of NRK-52E cells with leptin induced a state of oxidative stress and inflammation that could be reversed by preincubation with LC. Interestingly, LC induced an upregulation of NOX4 and restored the release of its product, hydrogen peroxide, which suggests a protective role of NOX4 against leptin-induced renal damage. J. Cell. Biochem. 117: 2281-2288, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Dysregulation of Lysyl Oxidase Expression in Lesions and Endometrium of Women With Endometriosis
Ruiz, Lynnette A.; Báez-Vega, Perla M.; Ruiz, Abigail; Peterse, Daniëlle P.; Monteiro, Janice B.; Bracero, Nabal; Beauchamp, Pedro; Fazleabas, Asgerally T.; Flores, Idhaliz
2015-01-01
Lysyl oxidases (LOXs) are enzymes involved in collagen deposition, extracellular membrane remodeling, and invasive/metastatic potential. Previous studies reveal an association of LOXs and endometriosis. We aimed to identify the mechanisms activated by upregulation of lysyl oxidases (LOX) in endometriotic cells and tissues. We hypothesized that LOX plays a role in endometriosis by promoting invasiveness and epithelial to mesenchymal transition (EMT). Methods: The LOX protein expression levels were measured by immunohistochemistry in lesions and endometrium on a tissue microarray (TMA) and in endometrial biopsies from patients and controls during the window of implantation (WOI). Estradiol regulation of LOX expression was determined by quantitative polymerase chain reaction (qPCR). Proliferation, invasion, and migration assays were performed in epithelial (endometrial epithelial cell), endometrial (human endometrial stromal cell), and endometriotic cell lines (ECL and 12Z). Pathway-focused multiplex qPCR was used to determine transcriptome changes due to LOX overexpression. Results: LOX protein was differentially expressed in ovarian versus peritoneal lesions. During WOI, LOX levels were higher in luminal epithelium of patients with endometriosis-associated infertility compared to controls. Invasive epithelial cell lines expressed higher levels of LOX than noninvasive ones. Transfection of LOX into noninvasive epithelial cells increased their migration in an LOX inhibitor-sensitive manner. Overexpression of LOX did not fully induce EMT but the expression of genes related to fibrosis and extracellular matrix remodeling were dysregulated. Conclusions: This study documents that expression of LOX is differentially regulated in endometriotic lesions and endometrium. A role for LOX in mediating proliferation, migration, and invasion of endometrial and endometriotic cells was observed, which may be implicated in the establishment and progression of endometriotic lesions. PMID:25963914
Rama Rao, Kakulavarapu V; Iring, Stephanie; Younger, Daniel; Kuriakose, Matthew; Skotak, Maciej; Alay, Eren; Gupta, Raj K; Chandra, Namas
2018-06-12
Blast-induced traumatic brain injury (bTBI) is a leading cause of morbidity in soldiers on the battlefield and in training sites with long-term neurological and psychological pathologies. Previous studies from our laboratory demonstrated activation of oxidative stress pathways after blast injury, but their distribution among different brain regions and their impact on the pathogenesis of bTBI have not been explored. The present study examined the protein expression of two isoforms: nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1 and 2 (NOX1, NOX2), corresponding superoxide production, a downstream event of NOX activation, and the extent of lipid peroxidation adducts of 4-hydroxynonenal (4HNE) to a range of proteins. Brain injury was evaluated 4 h after the shock-wave exposure, and immunofluorescence signal quantification was performed in different brain regions. Expression of NOX isoforms displayed a differential increase in various brain regions: in hippocampus and thalamus, there was the highest increase of NOX1, whereas in the frontal cortex, there was the highest increase of NOX2 expression. Cell-specific analysis of changes in NOX expression with respect to corresponding controls revealed that blast resulted in a higher increase of NOX1 and NOX 2 levels in neurons compared with astrocytes and microglia. Blast exposure also resulted in increased superoxide levels in different brain regions, and such changes were reflected in 4HNE protein adduct formation. Collectively, this study demonstrates that primary blast TBI induces upregulation of NADPH oxidase isoforms in different regions of the brain parenchyma and that neurons appear to be at higher risk for oxidative damage compared with other neural cells.
Influence of proline upon the folding and geometry of the WALP19 transmembrane peptide.
Thomas, Rachel; Vostrikov, Vitaly V; Greathouse, Denise V; Koeppe, Roger E
2009-12-22
The orientations, geometries, and lipid interactions of designed transmembrane (TM) peptides have attracted significant experimental and theoretical interest. Because the amino acid proline will introduce a known discontinuity into an alpha helix, we have sought to measure the extent of helix kinking caused by a single proline within the isolated TM helical domain of WALP19. For this purpose, we synthesized acetyl-GWWLALALAP(10)ALALALWWA-ethanolamide and included pairs of deuterated alanines by using 60-100% Fmoc-l-Ala-d(4) at selected sequence positions. Solid-state deuterium ((2)H) magnetic resonance spectra from oriented, hydrated samples (1/40, peptide/lipid; using several lipids) reveal signals from many of the alanine backbone C(alpha) deuterons as well as the alanine side-chain C(beta) methyl groups, whereas signals from C(alpha) deuterons generally have not been observed for similar peptides without proline. It is conceivable that altered peptide dynamics may be responsible for the apparent "unmasking" of the backbone resonances in the presence of the proline. Data analysis using the geometric analysis of labeled alanines (GALA) method reveals that the peptide helix is distorted due to the presence of the proline. To provide additional data points for evaluating the segmental tilt angles of the two halves of the peptide, we substituted selected leucines with l-Ala-d(4). Using this approach, we were able to deduce that the apparent average tilt of the C-terminal increases from approximately 4 degrees to approximately 12 degrees when Pro(10) is introduced. The segment N-terminal to proline is more complex and possibly is more dynamically flexible; Leu to Ala mutations within the N-terminal segment alter the average orientations of alanines in both segments. Nevertheless, in DOPC, we could estimate an apparent kink angle of approximately 19 degrees . Together, the results suggest that the central proline influences not only the geometry but also the dynamics of the membrane-spanning peptide. The results make up an important basis for understanding the functional role of proline in several families of membrane proteins.
Hu, Qiongying; Li, Jinpeng; Nitta, Kyoko; Kitada, Munehiro; Nagai, Takako; Kanasaki, Keizo; Koya, Daisuke
2018-01-15
Fibroblast growth factor receptor (FGFR) 1 plays a key role in endothelial homeostasis by inducing microRNA (miR) let-7. Our previous paper showed that anti-fibrotic effects of N-acetyl-seryl-aspartyl-lysyl-proline (AcSDKP) were associated with restoring diabetes-suppressed expression of FGFR1 and miR let-7, the key contributor of mitochondrial biogenesis, which is regulated by mitochondrial membrane GTPase proteins (MFN2 and OPA1). Here, we found that the FGFR1 signaling pathway was critical for AcSDKP in maintaining endothelial mitochondrial biogenesis through induction of miR let-7b-5p. In endothelial cells, AcSDKP restored the triple cytokines (TGF-β2, interleukin-1β, tumor necrosis factor-α)-suppressed miR let-7b-5p and protein levels of the mitochondrial membrane GTPase. This effect of AcSDKP was lost with either fibroblast growth factor receptor substrate 2 (FRS2) siRNA or neutralizing FGFR1-treated cells. Similarly, AcSDKP had no effect on the miR let-7b-5p inhibitor-suppressed GTPase levels in endothelial cells. In addition, a miR let-7b-5p mimic restored the levels of FRS2 siRNA-reduced GTPases in endothelial cells. These findings were also confirmed using MitoTracker Green and an immunofluorescence assay. Our results demonstrated that the AcSDKP-FGFR1 signaling pathway is critical for maintaining mitochondrial dynamics by control of miR let-7b-5p in endothelial cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhang, Tingting; Lu, Qianqian; Su, Chunlei; Yang, Yaru; Hu, Dan; Xu, Qinsong
2017-09-01
Mercury uptake and its effects on physiology, biochemistry and genomic stability were investigated in Lemna minor after 2 and 6d of exposure to 0-30μM Hg. The accumulation of Hg increased in a concentration- and duration-dependent manner, and was positively correlated with the leaf damage. Oxidative stress after Hg exposure was evidenced in L. minor by a significant decrease in photosynthetic pigments, an increase in malondialdehyde and lipoxygenase activities (total enzyme activity and isoenzymes activity). Fronds of L. minor exposed to Hg showed an induction of peroxidase, catalase, and ascorbate peroxidase activities (total enzyme activity and some isoenzymes activities). Exposure of L. minor to Hg reduced the activity (total enzyme activity and some isoenzymes activities) of glutathione reductase, and superoxide dismutase. Exposure to Hg produced a transient increase in the content of glutathione and ascorbic acid. The content of dehydroascorbate and oxidized glutathione in L. minor were high during the entire exposure period. Exposure of L. minor to Hg also caused the accumulation of proline and soluble sugars. The amplification of new bands and the absence of normal DNA amplicons in treated plants in the random amplified polymorphic DNA (RAPD) profile indicated that genomic template stability (GTS) was affected by Hg treatment. The accumulation of Hsp70 indicated the occurrence of a heat shock response at all Hg concentrations. These results suggest that L. minor plants were able to cope with Hg toxicity through the activation of various mechanisms involving enzymatic and non-enzymatic antioxidants, up-regulation of proline, and induction of Hsp70. Copyright © 2017 Elsevier Inc. All rights reserved.
Proline Residues as Switches in Conformational Changes Leading to Amyloid Fibril Formation
Taler-Verčič, Ajda; Hasanbašić, Samra; Berbić, Selma; Stoka, Veronika; Turk, Dušan; Žerovnik, Eva
2017-01-01
Here we discuss studies of the structure, folding, oligomerization and amyloid fibril formation of several proline mutants of human stefin B, which is a protein inhibitor of lysosomal cysteine cathepsins and a member of the cystatin family. The structurally important prolines in stefin B are responsible for the slow folding phases and facilitate domain swapping (Pro 74) and loop swapping (Pro 79). Moreover, our findings are compared to β2-microglobulin, a protein involved in dialysis-related amyloidosis. The assessment of the contribution of proline residues to the process of amyloid fibril formation may shed new light on the critical molecular events involved in conformational disorders. PMID:28272335
Synteny between the Pro/sup +/ marker and human glutamate oxaloacetate transaminase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jones, C.
1975-01-01
Chinese hamster ovary cells with a specific auxotrophy for proline were fused with human cells from a variety of sources and the resulting hybrids analyzed for human genetic markers. Of 63 hybrid clones examined, 27 possessed both proline and cytoplasmic glutamate oxaloacetate transaminase markers; 36 had neither; and no clones were found possessing one and not the other. These results constitute evidence that the proline and glutamate oxaloacetate transaminase markers are syntenic. Evidence for absence of synteny between these and a variety of other human genes is presented. Biochemical tracer experiments established that the proline biosynthetic pathway through glutamate hasmore » been restored in the Pro/sup +/ hybrids.« less
Antioxidant effects of resveratrol in the cardiovascular system.
Xia, Ning; Daiber, Andreas; Förstermann, Ulrich; Li, Huige
2017-06-01
The antioxidant effects of resveratrol (3,5,4'-trihydroxy-trans-stilbene) contribute substantially to the health benefits of this compound. Resveratrol has been shown to be a scavenger of a number of free radicals. However, the direct scavenging activities of resveratrol are relatively poor. The antioxidant properties of resveratrol in vivo are more likely to be attributable to its effect as a gene regulator. Resveratrol inhibits NADPH oxidase-mediated production of ROS by down-regulating the expression and activity of the oxidase. This polyphenolic compound reduces mitochondrial superoxide generation by stimulating mitochondria biogenesis. Resveratrol prevents superoxide production from uncoupled endothelial nitric oxide synthase by up-regulating the tetrahydrobiopterin-synthesizing enzyme GTP cyclohydrolase I. In addition, resveratrol increases the expression of various antioxidant enzymes. Some of the gene-regulating effects of resveratrol are mediated by the histone/protein deacetylase sirtuin 1 or by the nuclear factor-E2-related factor-2. In this review article, we have also summarized the cardiovascular effects of resveratrol observed in clinical trials. This article is part of a themed section on Redox Biology and Oxidative Stress in Health and Disease. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v174.12/issuetoc. © 2016 The British Pharmacological Society.
Aroma changes of black tea prepared from methyl jasmonate treated tea plants*
Shi, Jiang; Wang, Li; Ma, Cheng-ying; Lv, Hai-peng; Chen, Zong-mao; Lin, Zhi
2014-01-01
Methyl jasmonate (MeJA) was widely applied in promoting food quality. Aroma is one of the key indicators in judging the quality of tea. This study examined the effect of exogenous MeJA treatment on tea aroma. The aroma components in black tea prepared from MeJA-treated fresh tea leaves were extracted using headspace solid-phase microextraction (HS-SPME) and were analyzed using gas chromatography-mass spectrometry (GC-MS) and GC-olfactometry (GC-O). Forty-five volatile compounds were identified. The results revealed that the MeJA-treated black tea had higher levels of terpene alcohols and hexenyl esters than the untreated tea. Moreover, several newly components, including copaene, cubenol, and indole, were induced by the MeJA treatment. The activities of polyphenol oxidase and β-glucosidase in fresh tea leaves changed after the MeJA treatment. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the gene expression levels of polyphenol oxidase and β-primeverosidase were upregulated by two and three folds, respectively, by the MeJA treatment (P<0.01); however, the gene expression of β-glucosidase was downregulated to a half level. In general, the aroma quality of the MeJA-treated black tea was clearly improved. PMID:24711352
Mitochondria are an early target of oxidative modifications in senescing legume nodules.
Matamoros, Manuel A; Fernández-García, Nieves; Wienkoop, Stefanie; Loscos, Jorge; Saiz, Ana; Becana, Manuel
2013-02-01
Legume nodule senescence is a poorly understood process involving a decrease in N(2) fixation and an increase in proteolytic activity. Some physiological changes during nodule aging have been reported, but scarce information is available at the subcellular level. Biochemical, immunological and proteomic approaches were used to provide insight into the effects of aging on the mitochondria and cytosol of nodule host cells. In the mitochondria, the oxidative modification of lipids and proteins was associated with a marked decline in glutathione, a reduced capacity to regenerate ascorbate, and upregulation of alternative oxidase and manganese superoxide dismutase. In the cytosol, there were consistent reductions in the protein concentrations of carbon metabolism enzymes, inhibition of protein synthesis and increase in serine proteinase activity, disorganization of cytoskeleton, and a sharp reduction of cytosolic proteins, but no detectable accumulation of oxidized molecules. We conclude that nodule mitochondria are an early target of oxidative modifications and a likely source of redox signals. Alternative oxidase and manganese superoxide dismutase may play important roles in controlling ROS concentrations and the redox state of mitochondria. The finding that specific methionine residues of a cytosolic glutamine synthetase isoform are sulfoxidized suggests a regulatory role of this enzyme in senescing nodules. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Sorato, E; Menazza, S; Zulian, A; Sabatelli, P; Gualandi, F; Merlini, L; Bonaldo, P; Canton, M; Bernardi, P; Di Lisa, F
2014-10-01
Although mitochondrial dysfunction and oxidative stress have been proposed to play a crucial role in several types of muscular dystrophy (MD), whether a causal link between these two alterations exists remains an open question. We have documented that mitochondrial dysfunction through opening of the permeability transition pore plays a key role in myoblasts from patients as well as in mouse models of MD, and that oxidative stress caused by monoamine oxidases (MAO) is involved in myofiber damage. In the present study we have tested whether MAO-dependent oxidative stress is a causal determinant of mitochondrial dysfunction and apoptosis in myoblasts from patients affected by collagen VI myopathies. We find that upon incubation with hydrogen peroxide or the MAO substrate tyramine myoblasts from patients upregulate MAO-B expression and display a significant rise in reactive oxygen species (ROS) levels, with concomitant mitochondrial depolarization. MAO inhibition by pargyline significantly reduced both ROS accumulation and mitochondrial dysfunction, and normalized the increased incidence of apoptosis in myoblasts from patients. Thus, MAO-dependent oxidative stress is causally related to mitochondrial dysfunction and cell death in myoblasts from patients affected by collagen VI myopathies, and inhibition of MAO should be explored as a potential treatment for these diseases. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Martins, Vicente P.; Dinamarco, Taisa M.; Soriani, Frederico M.; Tudella, Valéria G.; Oliveira, Sergio C.; Goldman, Gustavo H.; Curti, Carlos; Uyemura, Sérgio A.
2011-01-01
Paracoccidioides brasiliensis is a thermodimorphic human pathogenic fungus that causes paracoccidioidomycosis (PCM), which is the most prevalent systemic mycosis in Latin America. Differentiation from the mycelial to the yeast form (M-to-Y) is an essential step for the establishment of PCM. We evaluated the involvement of mitochondria and intracellular oxidative stress in M-to-Y differentiation. M-to-Y transition was delayed by the inhibition of mitochondrial complexes III and IV or alternative oxidase (AOX) and was blocked by the association of AOX with complex III or IV inhibitors. The expression of P. brasiliensis aox (Pbaox) was developmentally regulated through M-to-Y differentiation, wherein the highest levels were achieved in the first 24 h and during the yeast exponential growth phase; Pbaox was upregulated by oxidative stress. Pbaox was cloned, and its heterologous expression conferred cyanide-resistant respiration in Saccharomyces cerevisiae and Escherichia coli and reduced oxidative stress in S. cerevisiae cells. These results reinforce the role of PbAOX in intracellular redox balancing and demonstrate its involvement, as well as that of other components of the mitochondrial respiratory chain complexes, in the early stages of the M-to-Y differentiation of P. brasiliensis. PMID:21183691
Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.
2011-01-01
The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791
Pal, Rituraj; Bajaj, Lakshya; Sharma, Jaiprakash; Palmieri, Michela; Di Ronza, Alberto; Lotfi, Parisa; Chaudhury, Arindam; Neilson, Joel; Sardiello, Marco; Rodney, George G.
2016-01-01
Oxidative stress and aberrant accumulation of misfolded proteins in the cytosol are key pathological features associated with Parkinson’s disease (PD). NADPH oxidase (Nox2) is upregulated in the pathogenesis of PD; however, the underlying mechanism(s) of Nox2-mediated oxidative stress in PD pathogenesis are still unknown. Using a rotenone-inducible cellular model of PD, we observed that a short exposure to rotenone (0.5 μM) resulted in impaired autophagic flux through activation of a Nox2 dependent Src/PI3K/Akt axis, with a consequent disruption of a Beclin1-VPS34 interaction that was independent of mTORC1 activity. Sustained exposure to rotenone at a higher dose (10 μM) decreased mTORC1 activity; however, autophagic flux was still impaired due to dysregulation of lysosomal activity with subsequent induction of the apoptotic machinery. Cumulatively, our results highlight a complex pathogenic mechanism for PD where short- and long-term oxidative stress alters different signaling pathways, ultimately resulting in anomalous autophagic activity and disease phenotype. Inhibition of Nox2-dependent oxidative stress attenuated the impaired autophagy and cell death, highlighting the importance and therapeutic potential of these pathways for treating patients with PD. PMID:26960433
Černý, Martin; Kuklová, Alena; Hoehenwarter, Wolfgang; Fragner, Lena; Novák, Ondrej; Rotková, Gabriela; Jedelsky, Petr L; Žáková, Katerina; Šmehilová, Mária; Strnad, Miroslav; Weckwerth, Wolfram; Brzobohaty, Bretislav
2013-11-01
In plants, numerous developmental processes are controlled by cytokinin (CK) levels and their ratios to levels of other hormones. While molecular mechanisms underlying the regulatory roles of CKs have been intensely researched, proteomic and metabolomic responses to CK deficiency are unknown. Transgenic Arabidopsis seedlings carrying inducible barley cytokinin oxidase/dehydrogenase (CaMV35S>GR>HvCKX2) and agrobacterial isopentenyl transferase (CaMV35S>GR>ipt) constructs were profiled to elucidate proteome- and metabolome-wide responses to down- and up-regulation of CK levels, respectively. Proteome profiling identified >1100 proteins, 155 of which responded to HvCKX2 and/or ipt activation, mostly involved in growth, development, and/or hormone and light signalling. The metabolome profiling covered 79 metabolites, 33 of which responded to HvCKX2 and/or ipt activation, mostly amino acids, carbohydrates, and organic acids. Comparison of the data sets obtained from activated CaMV35S>GR>HvCKX2 and CaMV35S>GR>ipt plants revealed unexpectedly extensive overlaps. Integration of the proteomic and metabolomic data sets revealed: (i) novel components of molecular circuits involved in CK action (e.g. ribosomal proteins); (ii) previously unrecognized links to redox regulation and stress hormone signalling networks; and (iii) CK content markers. The striking overlaps in profiles observed in CK-deficient and CK-overproducing seedlings might explain surprising previously reported similarities between plants with down- and up-regulated CK levels.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Mi Jin; Nepal, Saroj; Lee, Eung-Seok
2013-11-15
Matrix metalloproteinase-12 (MMP-12), an enzyme responsible for degradation of extracellular matrix, plays an important role in the progression of various diseases, including inflammation and fibrosis. Although most of those are pathogenic conditions induced by ethanol ingestion, the effect of ethanol on MMP-12 has not been explored. In the present study, we investigated the effect of ethanol on MMP-12 expression and its potential mechanisms in macrophages. Here, we demonstrated that ethanol treatment increased MMP-12 expression in primary murine peritoneal macrophages and RAW 264.7 macrophages at both mRNA and protein levels. Ethanol treatment also significantly increased the activity of nicotinamide adenine dinucleotidemore » (NADPH) oxidase and the expression of NADPH oxidase-2 (Nox2). Pretreatment with an anti-oxidant (N-acetyl cysteine) or a selective inhibitor of NADPH oxidase (diphenyleneiodonium chloride (DPI)) prevented ethanol-induced MMP-12 expression. Furthermore, knockdown of Nox2 by small interfering RNA (siRNA) prevented ethanol-induced ROS production and MMP-12 expression in RAW 264.7 macrophages, indicating a critical role for Nox2 in ethanol-induced intracellular ROS production and MMP-12 expression in macrophages. We also showed that ethanol-induced Nox2 expression was suppressed by transient transfection with dominant negative IκB-α plasmid or pretreatment with Bay 11-7082, a selective inhibitor of NF-κB, in RAW 264.7 macrophages. In addition, ethanol-induced Nox2 expression was also attenuated by treatment with a selective inhibitor of p38 MAPK, suggesting involvement of p38 MAPK/NF-κB pathway in ethanol-induced Nox2 expression. Taken together, these results demonstrate that ethanol treatment elicited increase in MMP-12 expression via increase in ROS production derived from Nox2 in macrophages. - Highlights: • Ethanol increases ROS production through up-regulation of Nox2 in macrophages. • Enhanced oxidative stress contributes to ethanol-induced MMP-12 expression. • p38 MAPK/NF-κB signaling pathway modulates ethanol-induced Nox2 expression.« less
Tang, Yanping; Sun, Xin; Wen, Tao; Liu, Mingjie; Yang, Mingyan; Chen, Xuefei
2017-03-01
The aim of this study is to investigate whether exogenous application of salicylic acid (SA) could modulate the photosynthetic capacity of soybean seedlings in water stress tolerance, and to clarify the potential functions of terminal oxidase (plastid terminal oxidase (PTOX) and alternative oxidase (AOX)) in SA' s regulation on photosynthesis. The effects of SA and water stress on gas exchange, pigment contents, chlorophyll fluorescence, enzymes (guaiacol peroxidase (POD; EC 1.11.1.7), superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), ascorbate peroxidase (APX; EC 1.11.1.11) and NADP-malate dehydrogenase (NADP-MDH; EC1.1.1.82)) activity and transcript levels of PTOX, AOX1, AOX2a, AOX2b were examined in a hydroponic cultivation system. Results indicate that water stress significantly decreased the photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (E), pigment contents (Chla + b, Chla/b, Car), maximum quantum yield of PSⅡphotochemistry (Fv/Fm), efficiency of excitation capture of open PSⅡcenter (Fv'/Fm'), quantum efficiency of PSⅡphotochemistry (ΦPSⅡ), photochemical quenching (qP), and increased malondialdehyde (MDA) content and the activity of all the enzymes. SA pretreatment led to significant decreases in Ci and MDA content, and increases in Pn, Gs, E, pigment contents, Fv/Fm, Fv'/Fm', ΦPSⅡ, qP, and the activity of all the enzymes. SA treatment and water stress alone significantly up-regulated the expression of PTOX, AOX1 and AOX2b. SA pretreatment further increased the transcript levels of PTOX and AOX2b of soybean seedling under water stress. These results indicate that SA application alleviates the water stress-induced decrease in photosynthesis may mainly through maintaining a lower reactive oxygen species (ROS) level, a greater PSⅡefficiency, and an enhanced alternative respiration and chlororespiration. PTOX and AOX may play important roles in SA-mediated resistance to water stress. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Bae, J H; Miller, K J
1992-02-01
The food-borne pathogen Staphylococcus aureus is distinguished from other food-borne pathogens by its ability to grow at water activity values below 0.90. Previous studies have indicated that proline accumulation mediated by transport represents a primary osmoregulatory strategy utilized by this bacterium (C. B. Anderson and L. D. Witter, Appl. Environ, Microbiol. 43:1501-1503, 1982; I. Koujima, H. Hayashi, K. Tomochika, A. Okabe, and Y. Kanemasa, Appl. Environ. Microbiol. 35:467-470, 1978; K. J. Miller, S. C. Zelt, and J.-H. Bae, Curr. Microbiol. 23:131-137, 1991). In this study, we demonstrate the presence of two proline transport systems within whole cells of S. aureus, a high-affinity transport system (Km, 7 microM) and a low-affinity transport system (Km, 420 microM). Our results indicate that the low-affinity proline transport system is osmotically activated and is the primary system responsible for the accumulation of proline by this pathogen during growth at low water activity.
Troitzsch, Raphael Z.; Tulip, Paul R.; Crain, Jason; Martyna, Glenn J.
2008-01-01
Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data. PMID:18790850
Electron-Transfer Dynamics for a Donor-Bridge-Acceptor Complex in Ionic Liquids.
DeVine, Jessalyn A; Labib, Marena; Harries, Megan E; Rached, Rouba Abdel Malak; Issa, Joseph; Wishart, James F; Castner, Edward W
2015-08-27
Intramolecular photoinduced electron transfer from an N,N-dimethyl-p-phenylenediamine donor bridged by a diproline spacer to a coumarin 343 acceptor was studied using time-resolved fluorescence measurements in three ionic liquids and in acetonitrile. The three ionic liquids have the bis[(trifluoromethyl)sulfonyl]amide anion paired with the tributylmethylammonium, 1-butyl-1-methylpyrrolidinium, and 1-decyl-1-methylpyrrolidinium cations. The dynamics in the two-proline donor-bridge-acceptor complex are compared to those observed for the same donor and acceptor connected by a single proline bridge, studied previously by Lee et al. (J. Phys. Chem. C 2012, 116, 5197). The increased conformational freedom afforded by the second bridging proline resulted in multiple energetically accessible conformations. The multiple conformations have significant variations in donor-acceptor electronic coupling, leading to dynamics that include both adiabatic and nonadiabatic contributions. In common with the single-proline bridged complex, the intramolecular electron transfer in the two-proline system was found to be in the Marcus inverted regime.
Troitzsch, Raphael Z; Tulip, Paul R; Crain, Jason; Martyna, Glenn J
2008-12-01
Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data.
Purification and Characterization of Put1p from Saccharomyces cerevisiae
Wanduragala, Srimevan; Sanyal, Nikhilesh; Liang, Xinwen; Becker, Donald F.
2010-01-01
In Saccharomyces cerevisiae, the PUT1 and PUT2 genes are required for the conversion of proline to glutamate. The PUT1 gene encodes Put1p, a proline dehydrogenase (PRODH)1 enzyme localized in the mitochondrion. Put1p was expressed and purified from Escherichia coli and shown to have a UV-visible absorption spectrum that is typical of a bound flavin cofactor. A Km value of 36 mM proline and a kcat = 27 s−1 were determined for Put1p using an artificial electron acceptor. Put1p also exhibited high activity using ubiquinone-1 (CoQ1) as an electron acceptor with a kcat = 9.6 s−1 and a Km of 33 µM for CoQ1. In addition, knockout strains of the electron transfer flavoprotein (ETF) homolog in S. cerevisiae were able to grow on proline as the sole nitrogen source demonstrating that ETF is not required for proline utilization in yeast. PMID:20450881
Willms, J Alexander; Beel, Rita; Schmidt, Martin L; Mundt, Christian
2014-01-01
Summary A new 4-hydroxy-L-proline derivative with a charged 1-ethylpyridinium-4-phenoxy substituent has been synthesized with the aim of facilitating mechanistic studies of proline-catalyzed reactions by ESI mass spectrometry. The charged residue ensures a strongly enhanced ESI response compared to neutral unmodified proline. The connection by a rigid linker fixes the position of the charge tag far away from the catalytic center in order to avoid unwanted interactions. The use of a charged catalyst leads to significantly enhanced ESI signal abundances for every catalyst-derived species which are the ones of highest interest present in a reacting solution. The new charged proline catalyst has been tested in the direct asymmetric inverse aldol reaction between aldehydes and diethyl ketomalonate. Two intermediates in accordance with the List–Houk mechanism for enamine catalysis have been detected and characterized by gas-phase fragmentation. In addition, their temporal evolution has been followed using a microreactor continuous-flow technique. PMID:25246962
Choi, Ucheor B.; Kazi, Rashek; Stenzoski, Natalie; Wollmuth, Lonnie P.; Uversky, Vladimir N.; Bowen, Mark E.
2013-01-01
The NMDA-sensitive glutamate receptor is a ligand-gated ion channel that mediates excitatory synaptic transmission in the nervous system. Extracellular zinc allosterically regulates the NMDA receptor by binding to the extracellular N-terminal domain, which inhibits channel gating. Phosphorylation of the intrinsically disordered intracellular C-terminal domain alleviates inhibition by extracellular zinc. The mechanism for this functional effect is largely unknown. Proline is a hallmark of intrinsic disorder, so we used proline mutagenesis to modulate disorder in the cytoplasmic domain. Proline depletion selectively uncoupled zinc inhibition with little effect on receptor biogenesis, surface trafficking, or ligand-activated gating. Proline depletion also reduced the affinity for a PDZ domain involved in synaptic trafficking and affected small molecule binding. To understand the origin of these phenomena, we used single molecule fluorescence and ensemble biophysical methods to characterize the structural effects of proline mutagenesis. Proline depletion did not eliminate intrinsic disorder, but the underlying conformational dynamics were changed. Thus, we altered the form of intrinsic disorder, which appears sufficient to affect the biological activity. These findings suggest that conformational dynamics within the intrinsically disordered cytoplasmic domain are important for the allosteric regulation of NMDA receptor gating. PMID:23782697
Willett, Christopher S; Burton, Ronald S
2002-08-01
Diverse organisms regulate concentrations of intracellular organic osmolytes in response to changes in environmental salinity or desiccation. In marine crustaceans, accumulation of high concentrations of proline is a dominant component of response to hyperosmotic stress. In the euryhaline copepod Tigriopus californicus, synthesis of proline from its metabolic precursor glutamate is tightly regulated by changes in environmental salinity. Here, for the first time in a marine invertebrate, the genes responsible for this pathway have been cloned and characterized. The two proteins display the sequence features of homologous enzymes identified from other eukaryotes. One of the cloned genes, delta1-pyrroline-5-carboxylase reductase (P5CR), is demonstrated to have the reductase enzyme activity when expressed in proline-auxotroph bacteria, while the second, delta1-pyrroline-5-carboxylase synthase (P5CS), does not rescue proline-auxotroph bacteria. In contrast to results from higher plants, neither levels of P5CS nor P5CR mRNAs increase in response to salinity stress in T. californicus. Hence, regulation of proline synthesis during osmotic stress in T. californicus is likely mediated by some form of post-transcriptional regulation of either P5CS or P5CR. Understanding the regulation this pathway may elucidate the mechanisms limiting the salinity ranges of marine taxa. Copyright 2002 Elsevier Science Inc.
Shimada, Takuya; Nishii, Eriko; Saitoh, Takashi
2011-12-01
Mammalian herbivores adopt various countermeasures against dietary tannins, which are among the most widespread plant secondary metabolites. The large Japanese wood mouse Apodemus speciosus produces proline-rich salivary tannin-binding proteins in response to tannins. Proline-rich proteins (PRPs) react with tannins to form stable complexes that are excreted in the feces. Here, we developed a new method for estimating the tannin intake of free-living small rodents, by measuring fecal proline content, and applied the method to a field investigation. A feeding experiment with artificial diets containing various levels of tannic acid revealed that fecal proline content was clearly related to dietary tannin content in three species (A. speciosus, Apodemus argenteus, and Myodes rufocanus). We then used fecal proline content to estimate the tannin intakes of these three forest-dwelling species in a forest in Hokkaido. In the autumn, estimated tannin intakes increased significantly in the Apodemus species, but not in M. rufocanus. We speculated that an increase in tannin intake during autumn may result from consumption of tannin-rich acorns. This hypothesis was consistent with population fluctuation patterns of the three species, which were well-synchronized with acorn abundance for the Apodemus species but not for M. rufocanus.
Zouari, M; Ben Ahmed, Ch; Zorrig, W; Elloumi, N; Rabhi, M; Delmail, D; Ben Rouina, B; Labrousse, P; Ben Abdallah, F
2016-06-01
The ability of exogenous compatible solutes, such as proline, to counteract cadmium (Cd) inhibitory effects in young date palm plants (Phoenix dactylifera L. cv Deglet Nour) was investigated. Two-year-old date palm plants were subjected for five months at different Cd stress levels (0, 10 and 30 mg CdCl2 kg(-1) soil) whether supplied or not with exogenous proline (20mM) added through the irrigation water. Different levels of Cd stress altered plant growth, gas exchanges and chlorophyll content as well as water status, but at different extent among them. In contrast, an increase of antioxidant enzymes activities of Cd-treated plants in association with high amounts of proline content, hydrogen peroxide (H2O2), thiobarbituric acid reactive substances (TBARS) and electrolyte leakage (EL) were observed. Interestingly, exogenous proline mitigated the adverse effects of Cd on young date palm. Indeed, it alleviated the oxidative damage induced by Cd accumulation and established better levels of plant growth, water status and photosynthetic activity. Moreover, proline-treated plants showed high antioxidant enzymes activities (superoxide dismutase, catalase and glutathione peroxydase) in roots and leaves as compared to Cd-treated plants. Copyright © 2016 Elsevier Inc. All rights reserved.
Zegaoui, Zahia; Planchais, Séverine; Cabassa, Cécile; Djebbar, Reda; Abrous Belbachir, Ouzna; Carol, Pierre
2017-11-01
Many landraces of cowpea [Vigna unguiculata (L.) Walp.] are adapted to particular geographical and climatic conditions. Here we describe two landraces grown respectively in arid and temperate areas of Algeria and assess their physiological and molecular responses to drought stress. As expected, when deprived of water cowpea plants lose water over time with a gradual reduction in transpiration rate. The landraces differed in their relative water content (RWC) and whole plant transpiration rate. The landrace from Menia, an arid area, retained more water in adult leaves. Both landraces responded to drought stress at the molecular level by increasing expression of stress-related genes in aerial parts, including proline metabolism genes. Expression of gene(s) encoding proline synthesis enzyme P5CS was up regulated and gene expression of ProDH, a proline catabolism enzyme, was down regulated. Relatively low amounts of proline accumulated in adult leaves with slight differences between the two landraces. During drought stress the most apical part of plants stayed relatively turgid with a high RWC compared to distal parts that wilted. Expression of key stress genes was higher and more proline accumulated at the apex than in distal leaves indicating that cowpea has a non-uniform stress response at the whole plant level. Our study reveals a developmental control of water stress through preferential proline accumulation in the upper tier of the cowpea plant. We also conclude that cowpea landraces display physiological adaptations to water stress suited to the arid and temperate climates in which they are cultivated. Copyright © 2017 Elsevier GmbH. All rights reserved.
Tamang, Aditya Moktan; Kalra, Bhawna; Parkash, Ravi
2017-01-01
Changes in the levels of energy metabolites can limit survival ability of Drosophila species under stressful conditions but this aspect has received less attention in wild populations collected in different seasons. We tested cold or desiccation triggered changes in the accumulation or utilization of two energy metabolites (trehalose and proline) in Drosophila immigrans flies reared under season specific environmental conditions. Such D.immigrans populations were subjected to different durations of cold (0°C) or desiccation stress (5% RH) or dual stress. We found stress induced effects of cold vs desiccation on the levels of trehalose as well as for proline. Different durations of cold stress led to accumulation of trehalose while desiccation stress durations revealed utilization of trehalose. In contrast, there was accumulation of proline under desiccation and utilization of proline with cold stress. Since accumulation levels were higher than utilization of each energy metabolite, the effects of dual stress showed additive effect. However, there was no utilization of total body lipids under cold or desiccation stress. We observed significant season specific differences in the amount of energy metabolites but the rate of metabolism did not vary across seasons. Stress triggered changes in trehalose and proline suggest possible link between desiccation and cold tolerance. Finally, stress specific (cold or desiccation) compensatory changes in the levels of trehalose and proline suggest possible energetic homeostasis in D.immigrans living under harsh climatic conditions of montane localities. Copyright © 2016 Elsevier Inc. All rights reserved.
Sleator, Roy D.; Gahan, Cormac G. M.; Hill, Colin
2001-01-01
Intracellular accumulation of the amino acid proline has previously been linked to the salt tolerance and virulence potential of a number of bacteria. Taking advantage of the proBA mutant Escherichia coli CSH26, we identified a listerial proBA operon coding for enzymes functionally similar to the glutamyl kinase (GK) and glutamylphosphate reductase (GPR) enzyme complex which catalyzes the first and second steps of proline biosynthesis in E. coli. The first gene of the operon, proB, is predicted to encode GK, a 276-residue protein with a calculated molecular mass of 30.03 kDa and pl of 5.2. Distal to the promoter and overlapping the 3′ end of proB by 17 bp is proA, which encodes GPR, a 415-residue protein with a calculated molecular mass of 45.50 kDa (pl 5.3). Using this information, we created a chromosomal deletion mutant by allelic exchange which is auxotrophic for proline. This mutant was used to assess the contribution of proline anabolism to osmotolerance and virulence. While inactivation of proBA had no significant effect on virulence in mouse assays (either perorally or intraperitoneally), growth at low (2 to 4% NaCl) and high (>6% NaCl) salt concentrations in complex media was significantly reduced in the absence of efficient proline synthesis. We conclude that while proline biosynthesis plays little, if any, role in the intracellular life cycle and infectious nature of Listeria monocytogenes, it can play an important role in survival in osmolyte-depleted environments of elevated osmolarity. PMID:11375165
Arentson, Benjamin W; Hayes, Erin L; Zhu, Weidong; Singh, Harkewal; Tanner, John J; Becker, Donald F
2016-12-01
Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon-helix-helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH-RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH-RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. © 2016 The Author(s).
Arentson, Benjamin W.; Hayes, Erin L.; Zhu, Weidong; Singh, Harkewal; Tanner, John J.; Becker, Donald F.
2016-01-01
Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon–helix–helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH–RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH–RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. PMID:27742866
Variation in Protein Intake Induces Variation in Spider Silk Expression
Blamires, Sean J.; Wu, Chun-Lin; Tso, I-Min
2012-01-01
Background It is energetically expensive to synthesize certain amino acids. The proteins (spidroins) of spider major ampullate (MA) silk, MaSp1 and MaSp2, differ in amino acid composition. Glutamine and proline are prevalent in MaSp2 and are expensive to synthesize. Since most orb web spiders express high proline silk they might preferentially attain the amino acids needed for silk from food and shift toward expressing more MaSp1 in their MA silk when starved. Methodology/Principal Findings We fed three spiders; Argiope aetherea, Cyrtophora moluccensis and Leucauge blanda, high protein, low protein or no protein solutions. A. aetherea and L. blanda MA silks are high in proline, while C. moluccesnsis MA silks are low in proline. After 10 days of feeding we determined the amino acid compositions and mechanical properties of each species' MA silk and compared them between species and treatments with pre-treatment samples, accounting for ancestry. We found that the proline and glutamine of A. aetherea and L. blanda silks were affected by protein intake; significantly decreasing under the low and no protein intake treatments. Glutmaine composition in C. moluccensis silk was likewise affected by protein intake. However, the composition of proline in their MA silk was not significantly affected by protein intake. Conclusions Our results suggest that protein limitation induces a shift toward different silk proteins with lower glutamine and/or proline content. Contradictions to the MaSp model lie in the findings that C. moluccensis MA silks did not experience a significant reduction in proline and A. aetherea did not experience a significant reduction in serine on low/no protein. The mechanical properties of the silks could not be explained by a MaSp1 expressional shift. Factors other than MaSp expression, such as the expression of spidroin-like orthologues, may impact on silk amino acid composition and spinning and glandular processes may impact mechanics. PMID:22363691
Chen, Kequan; Pang, Yang; Zhang, Bowen; Feng, Jiao; Xu, Sheng; Wang, Xin; Ouyang, Pingkai
2017-11-22
Understanding the bioprocess limitations is critical for the efficient design of biocatalysts to facilitate process feasibility and improve process economics. In this study, a proline hydroxylation process with recombinant Escherichia coli expressing L-proline cis-4-hydroxylase (SmP4H) was investigated. The factors that influencing the metabolism of microbial hosts and process economics were focused on for the optimization of cis-4-hydroxy-L-proline (CHOP) production. In recombinant E. coli, SmP4H synthesis limitation was observed. After the optimization of expression system, CHOP production was improved in accordance with the enhanced SmP4H synthesis. Furthermore, the effects of the regulation of proline uptake and metabolism on whole-cell catalytic activity were investigated. The improved CHOP production by repressing putA gene responsible for L-proline degradation or overexpressing L-proline transporter putP on CHOP production suggested the important role of substrate uptake and metabolism on the whole-cell biocatalyst efficiency. Through genetically modifying these factors, the biocatalyst activity was significantly improved, and CHOP production was increased by twofold. Meanwhile, to further improve process economics, a two-strain coupling whole-cell system was established to supply co-substrate (α-ketoglutarate, α-KG) with a cheaper chemical L-glutamate as a starting material, and 13.5 g/L of CHOP was successfully produced. In this study, SmP4H expression, and L-proline uptake and degradation, were uncovered as the hurdles for microbial production of CHOP. Accordingly, the whole-cell biocatalysts were metabolically engineered for enhancing CHOP production. Meanwhile, a two-strain biotransformation system for CHOP biosynthesis was developed aiming at supplying α-KG more economically. Our work provided valuable insights into the design of recombinant microorganism to improve the biotransformation efficiency that catalyzed by Fe(II)/α-KG-dependent dioxygenase.
Kadlčík, Stanislav; Kučera, Tomáš; Chalupská, Dominika; Gažák, Radek; Koběrská, Markéta; Ulanová, Dana; Kopecký, Jan; Kutejová, Eva; Najmanová, Lucie; Janata, Jiří
2013-01-01
Clinically used lincosamide antibiotic lincomycin incorporates in its structure 4-propyl-L-proline (PPL), an unusual amino acid, while celesticetin, a less efficient related compound, makes use of proteinogenic L-proline. Biochemical characterization, as well as phylogenetic analysis and homology modelling combined with the molecular dynamics simulation were employed for complex comparative analysis of the orthologous protein pair LmbC and CcbC from the biosynthesis of lincomycin and celesticetin, respectively. The analysis proved the compared proteins to be the stand-alone adenylation domains strictly preferring their own natural substrate, PPL or L-proline. The LmbC substrate binding pocket is adapted to accommodate a rare PPL precursor. When compared with L-proline specific ones, several large amino acid residues were replaced by smaller ones opening a channel which allowed the alkyl side chain of PPL to be accommodated. One of the most important differences, that of the residue corresponding to V306 in CcbC changing to G308 in LmbC, was investigated in vitro and in silico. Moreover, the substrate binding pocket rearrangement also allowed LmbC to effectively adenylate 4-butyl-L-proline and 4-pentyl-L-proline, substrates with even longer alkyl side chains, producing more potent lincosamides. A shift of LmbC substrate specificity appears to be an integral part of biosynthetic pathway adaptation to the PPL acquisition. A set of genes presumably coding for the PPL biosynthesis is present in the lincomycin--but not in the celesticetin cluster; their homologs are found in biosynthetic clusters of some pyrrolobenzodiazepines (PBD) and hormaomycin. Whereas in the PBD and hormaomycin pathways the arising precursors are condensed to another amino acid moiety, the LmbC protein is the first functionally proved part of a unique condensation enzyme connecting PPL to the specialized amino sugar building unit.
Huang, Jun; Jones, Bryan J.; Kazlauskas, Romas J.
2015-01-01
α/β-Hydrolases are important enzymes for biocatalysis, but their stability often limits their application. As a model α/β-hydrolase, we investigated a plant esterase, salicylic acid binding protein 2 (SABP2). SABP2 shows typical stability to urea (unfolding free energy 6.9±1.5 kcal/mol) and to heat inactivation (T1/215 min 49.2±0.5 °C). Denaturation in urea occurs in two steps, but heat inactivation occurs in a single step. The first unfolding step in urea eliminates catalytic activity. Surprisingly, we found that the first unfolding likely corresponds to the unfolding of the larger catalytic domain. Replacing selected amino acid residues with proline stabilized SABP2. Proline restricts the flexibility of the unfolded protein, thereby shifting the equilibrium toward the folded conformation. Seven locations for proline substitution were chosen either by amino acid sequence alignment with a more stable homolog or by targeting flexible regions in SABP2. Introducing proline in the catalytic domain stabilized SABP2 to the first unfolding in urea for three of five cases: L46P (+0.2 M urea), S70P (+0.1) and E215P (+0.9). Introducing proline in the cap domain did not (two of two cases), supporting the assignment that the first unfolding corresponds to the catalytic domain. Proline substitutions in both domains stabilized SABP2 to heat inactivation: L46P (ΔT1/215 min = +6.4 °C), S70P (+5.4), S115P (+1.8), S141P (+4.9), and E215P (+4.2). Combining substitutions did not further increase the stability to urea denaturation, but dramatically increased resistance to heat inactivation: L46P-S70P ΔT1/215 min = +25.7 °C. This straightforward proline substitution approach may also stabilize other α/β-hydrolases. PMID:26110207
Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R. R.; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A.; Vaulont, Sophie; Peyssonnaux, Carole
2013-01-01
Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2α (HIF-2α) levels, a regulator of iron absorption. HIF-2α upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter – Dmt1) and ferric reductase – Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2α-regulated iron absorption genes in the gut. Our work identifies HIF-2α as an important regulator of iron transport machinery in copper deficiency. PMID:23555700
Wang, Ying; Wang, Yan; Liu, Dan; Wang, Wang; Zhao, Huan; Wang, Min; Yin, Hongping
2015-07-10
CPS-F, a polysaccharide derived from Cordyceps sinensis, is a potential anti-inflammatory and anti-oxidative agent. We demonstrated that CPS-F not only inhibits platelet-derived growth factor BB (PDGF-BB)-induced intracellular reactive oxygen species (ROS) generation, and up-regulation of tumor necrosis factor-α (TNF-α), TNF-α receptor 1 (TNFR1), and monocyte chemotactic protein-1 (MCP-1), but also acts synergistically in combination with MAPK/ERK inhibitor U0126 and PI3K/Akt inhibitor LY294002. Additionally, up-regulation of pro-inflammatory factors was reversed by use of a combination of CPS-F and NADPH oxidase (NOX) inhibitor diphenyleneiodonium chloride (DPI) or silencing of NOX1. Furthermore, CPS-F prevents the PDGF receptor β (PDGFRβ) promoter activity induced by PDGF-BB in transfected cells and ameliorates increased levels of TNF-α, TNFR1, and MCP-1 when PDGFRβ is silenced, thereby suggesting that CPS-F possesses a bidirectional regulatory function. Our findings suggest CPS-F may exert its therapeutic effect for the treatment of glomerulonephritis related to human mesangial cells (HMCs) through the ERK1/2/Akt pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhang, Ying Qian; Tian, Feng; Chen, Jin Song; Chen, Yun Dai; Zhou, Ying; Li, Bo; Ma, Qiang; Zhang, Ying
2016-11-15
Rapamycin is an immunosuppressive agent that is added to drug eluting stents. It prevents restenosis, but it also impairs reendothelialization. Nicorandil is a hybrid agent with adenosine triphosphated (ATP)-sensitive K+ (KATP) channel opener and nitrate properties. It prevents oxidative stress and cell apoptosis induced by rapamycin in endothelial cells in vitro. However, whether nicorandil promotes reendothelialization after angioplasty delayed by rapamycin remains to be determined. Balloon injury model was established in SD rats. Nicorandil increased reendothelialization impaired by rapamycin, and it decreased xanthine oxidase (XO)-generated reactive oxygen species (ROS) induced by rapamycin. In addition, eNOS expression inhibited by rapamycin was increased by nicorandil in vivo. In vitro, rapamycin-impeded cardiac microvascular endothelial cells (CMECs) migration, proliferation and rapamycin-induced ROS production were reversed by nicorandil. Knockdown of XO partially inhibited rapamycin-induced ROS production and cell apoptosis in CMECs, and it promoted CMECs migration and proliferation suppressed by rapamycin. Knockdown of Akt partially prevents eNOS upregulation promoted by nicorandil. The beneficial effect of nicorandil is exhibited by inhibiting XO and up-regulating Akt pathway. Nicorandil combined with rapamycin in effect rescue the deficiencies of rapamycin alone in arterial healing after angioplasty.
Zhang, Ying Qian; Tian, Feng; Chen, Jin Song; Chen, Yun Dai; Zhou, Ying; Li, Bo; Ma, Qiang; Zhang, Ying
2016-01-01
Rapamycin is an immunosuppressive agent that is added to drug eluting stents. It prevents restenosis, but it also impairs reendothelialization. Nicorandil is a hybrid agent with adenosine triphosphated (ATP)-sensitive K+ (KATP) channel opener and nitrate properties. It prevents oxidative stress and cell apoptosis induced by rapamycin in endothelial cells in vitro. However, whether nicorandil promotes reendothelialization after angioplasty delayed by rapamycin remains to be determined. Balloon injury model was established in SD rats. Nicorandil increased reendothelialization impaired by rapamycin, and it decreased xanthine oxidase (XO)-generated reactive oxygen species (ROS) induced by rapamycin. In addition, eNOS expression inhibited by rapamycin was increased by nicorandil in vivo. In vitro, rapamycin-impeded cardiac microvascular endothelial cells (CMECs) migration, proliferation and rapamycin-induced ROS production were reversed by nicorandil. Knockdown of XO partially inhibited rapamycin-induced ROS production and cell apoptosis in CMECs, and it promoted CMECs migration and proliferation suppressed by rapamycin. Knockdown of Akt partially prevents eNOS upregulation promoted by nicorandil. The beneficial effect of nicorandil is exhibited by inhibiting XO and up-regulating Akt pathway. Nicorandil combined with rapamycin in effect rescue the deficiencies of rapamycin alone in arterial healing after angioplasty. PMID:27713157
Tang, Yuanman; Liu, Qiuping; Liu, Ying; Zhang, Linli; Ding, Wei
2017-01-01
Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA)-responsive genes NtPR1a/c , NtPR2 and NtCHN50 , JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26 . Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum . Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.
Sirhindi, Geetika; Mir, Mudaser Ahmad; Abd-Allah, Elsayed Fathi; Ahmad, Parvaiz; Gucel, Salih
2016-01-01
In present study, we evaluated the effects of Jasmonic acid (JA) on physio-biochemical attributes, antioxidant enzyme activity, and gene expression in soybean (Glycine max L.) plants subjected to nickel (Ni) stress. Ni stress decreases the shoot and root length and chlorophyll content by 37.23, 38.31, and 39.21%, respectively, over the control. However, application of JA was found to improve the chlorophyll content and length of shoot and root of Ni-fed seedlings. Plants supplemented with JA restores the chlorophyll fluorescence, which was disturbed by Ni stress. The present study demonstrated increase in proline, glycinebetaine, total protein, and total soluble sugar (TSS) by 33.09, 51.26, 22.58, and 49.15%, respectively, under Ni toxicity over the control. Addition of JA to Ni stressed plants further enhanced the above parameters. Ni stress increases hydrogen peroxide (H2O2) by 68.49%, lipid peroxidation (MDA) by 50.57% and NADPH oxidase by 50.92% over the control. Supplementation of JA minimizes the accumulation of H2O2, MDA, and NADPH oxidase, which helps in stabilization of biomolecules. The activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) increases by 40.04, 28.22, 48.53, and 56.79%, respectively, over the control in Ni treated seedlings and further enhancement in the antioxidant activity was observed by the application of JA. Ni treated soybean seedlings showed increase in expression of Fe-SOD by 77.62, CAT by 15.25, POD by 58.33, and APX by 80.58% over the control. Nevertheless, application of JA further enhanced the expression of the above genes in the present study. Our results signified that Ni stress caused negative impacts on soybean seedlings, but, co-application of JA facilitate the seedlings to combat the detrimental effects of Ni through enhanced osmolytes, activity of antioxidant enzymes and gene expression. PMID:27242811
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kommoju, Phaneeswara-Rao; Bruckner, Robert C.; Ferreira, Patricia
2009-10-21
NikD is a flavoprotein oxidase that catalyzes the oxidation of piperideine-2-carboxylate (P2C) to picolinate in a remarkable aromatization reaction comprising two redox cycles and at least one isomerization step. Tyr258 forms part of an 'aromatic cage' that surrounds the ring in picolinate and its precursors. Mutation of Tyr258 to Phe does not perturb the structure of nikD but does affect the coupling of the two redox cycles and causes a 10-fold decrease in turnover rate. Tyr258Phe catalyzes a quantitative two-electron oxidation of P2C, but only 60% of the resulting dihydropicolinate intermediate undergoes a second redox cycle to produce picolinate. Themore » mutation does not affect product yield with an alternate substrate (3,4-dehydro-l-proline) that is aromatized in a single two-electron oxidation step. Wild-type and mutant enzymes exhibit identical rate constants for oxidation of P2C to dihydropicolinate and isomerization of a reduced enzyme-dihydropicolinate complex. The observed rates are 200- and 10-fold faster, respectively, than the mutant turnover rate. Release of picolinate from Tyr258Phe is 100-fold faster than turnover. The presence of a bound substrate or product is a key factor in oxygen activation by wild-type nikD, as judged by the 10-75-fold faster rates observed for complexes of the reduced enzyme with picolinate, benzoate, or 1-cyclohexenoate, a 1-deaza-P2C analogue. The reduced Tyr258Phe-1-cyclohexenoate complex is 25-fold less reactive with oxygen than the wild-type complex. We postulate that mutation of Tyr258 causes subtle changes in active site dynamics that promote release of the reactive dihydropicolinate intermediate and disrupt the efficient synchronization of oxygen activation observed with wild-type nikD.« less
Foliar and Seed Application of Amino Acids Affects the Antioxidant Metabolism of the Soybean Crop.
Teixeira, Walquíria F; Fagan, Evandro B; Soares, Luís H; Umburanas, Renan C; Reichardt, Klaus; Neto, Durval D
2017-01-01
In recent years, the application of natural substances on crops has been intensified in order to increase the resistance and yield of the soybean crop. Among these products are included plant biostimulants that may contain algae extracts, amino acids, and plant regulators in their composition. However, there is little information on the isolated effect of each of these constituents. The objective of this research was to evaluate the effect of the application of isolated amino acids on the antioxidant metabolism of the soybean crop. Experiments were carried out in a greenhouse and in the field with the application of the amino acids glutamate, phenylalanine, cysteine, glycine in seed treatment, and foliar application at V 4 growth stage. Antioxidant metabolism constituents evaluated were superoxide dismutase, catalase, peroxidase, hydrogen peroxide content, proline, and lipid peroxidation. In addition, resistance enzymes as polyphenol oxidase and phenylalanine ammonia-lyase (PAL) were evaluated. In both experiments, the use of cysteine, only in seed treatment and in both seed treatment and foliar application increased the activity of the enzyme PAL and catalase. Also in both experiments, the use of phenylalanine increased the activity of the enzyme PAL when the application was carried out as foliar application or both in seed treatment and foliar application. In the field experiment, the application of glutamate led to an increase in the activity of the catalase and PAL enzymes for seed treatment and foliar application. The use of the set of amino acids was only efficient in foliar application, which led to a greater activity of the enzymes peroxidase, PAL, and polyphenol oxidase. The other enzymes as well as lipid peroxidation and hydrogen peroxide presented different results according to the experiment. Therefore, glutamate, cysteine, phenylalanine, and glycine can act as signaling amino acids in soybean plants, since small doses are enough to increase the activity of the antioxidant enzymes.
Sereflioglu, Seda; Dinler, Burcu Seckin; Tasci, Eda
2017-03-01
In this paper, we describe the alleviated effects of alpha-tocopherol (α-T) on oxidative damage and its possible role as a signal transmitter in plants during salt stress. The results show that exogenously applied α-T under salt stress increased root length and weight, but reduced hydrogen peroxide (H 2 O 2 ), superoxide anion radical (O 2 . -) and malondialdehyde (MDA) content in soybean roots. The proline content was reduced by α-T treatment. Interestingly, endogenous auxin (IAA) level was significantly increased after α-T application as compared to salt stress alone. Moreover, α-T reduced significantly superoxide dismutase (SOD) enzyme and isoenzyme activity but upregulated peroxidase (POX) 2, 3 and glutathione-s-transferase (GST) 1, 3 isoenzyme expression. However, ascorbate peroxidase (APX) enzyme activity was not affected at all. Consequently, the results show that α-T serves as a signal molecule under salinity from leaves to roots by increasing remarkably endogenous IAA levels and increasing partially antioxidant activity in roots.
Characterization of the basic charge variants of a human IgG1
Lu, Franklin; Derfus, Gayle; Kluck, Brian; Nogal, Bartek; Emery, Craig; Summers, Christie; Zheng, Kai; Bayer, Robert; Amanullah, Ashraf
2011-01-01
We report a case study of an IgG1 with a unique basic charge variant profile caused by C-terminal proline amidation on either one or two heavy chains. The proline amidation was sensitive to copper ion concentration in the production media during cell culture: the higher the Cu2+ ion concentration, the higher the level of proline amidation detected. This conclusion was supported by the analysis of samples that revealed direct correlation between the proline amidation level observed from peptide maps and the level of basic peaks measured by imaged capillary isoelectric focusing and a pH gradient ion-exchange chromatography method. The importance of these observations to therapeutic antibody production is discussed. PMID:22123059
Kaschak, Timothy; Boyd, Daniel; Lu, Franklin; Derfus, Gayle; Kluck, Brian; Nogal, Bartek; Emery, Craig; Summers, Christie; Zheng, Kai; Bayer, Robert; Amanullah, Ashraf; Yan, Boxu
2011-01-01
We report a case study of an IgG1 with a unique basic charge variant profile caused by C-terminal proline amidation on either one or two heavy chains. The proline amidation was sensitive to copper ion concentration in the production media during cell culture: the higher the Cu ( 2+) ion concentration, the higher the level of proline amidation detected. This conclusion was supported by the analysis of samples that revealed direct correlation between the proline amidation level observed from peptide maps and the level of basic peaks measured by imaged capillary isoelectric focusing and a pH gradient ion-exchange chromatography method. The importance of these observations to therapeutic antibody production is discussed.
Lang, Roman; Lang, Tatjana; Bader, Matthias; Beusch, Anja; Schlagbauer, Verena; Hofmann, Thomas
2017-03-01
Proline betaine has been proposed as a candidate dietary biomarker for citrus intake. To validate its suitability as a dietary biomarker and to gain insight into the range of this per-methylated amino acid in foods and beverages, a quick and accurate stable isotope dilution assay was developed for quantitative high-throughput HILIC-MS/MS screening of proline betaine in foods and urine after solvent-mediated matrix precipitation. Quantitative analysis of a variety of foods confirmed substantial amounts of proline betaine in citrus juices (140-1100 mg/L) and revealed high abundance in tubers of the vegetable Stachys affinis, also known as Chinese artichocke (∼700 mg/kg). Seafood including clams, shrimp, and lobster contained limited amounts (1-95 mg/kg), whereas only traces were detected in fish, cuttlefish, fresh meat, dairy products, fresh vegetable (<3 mg/kg), coffee, tea, beer, and wine (<7 mg/L). The human excretion profiles of proline betaine in urine were comparable when common portions of orange juice or fried Stachys tubers were consumed. Neither mussels nor beer provided enough proline betaine to detect significant differences between morning urine samples collected before and after consumption. As Stachys is a rather rare vegetable and not part of peoples' daily diet, the data reported here will help to monitor the subject's compliance in future nutritional human studies on citrus products or the exclusion of citrus products in the wash-out phase of an intervention study. Moreover, proline betaine measurement can contribute to the establishment of a toolbox of valid dietary biomarkers reflecting wider aspects of diet to assess metabolic profiles as measures of dietary exposure and indicators of dietary patterns, dietary changes, or effectiveness of dietary interventions.
Dhir, Bhupinder; Sharmila, P; Saradhi, P Pardha
2004-02-10
Investigations were carried out to evaluate if hydrophytes (viz. Ceratophyllum, Wolffia, and Hydrilla) can be used as markers to assess the level of heavy metal pollution in aquatic bodies. The potential of these hydrophytes for lipid peroxidation and accumulation of proline in response to cadmium (Cd2+) pollution was studied. Hydrophytes were raised in artificial pond water (APW) supplemented with various levels of Cd2+. Interestingly, unlike mesophytes none of the hydrophytes showed ability to accumulate proline. Infact, in response to Cd2+ pollution hydrophytes exhibited a decline in proline levels in comparison to controls but mesophytes (viz. Brassica juncea, Vigna radiata and Triticum aestivum) showed progressive increase in the level of proline with increase in the extent of Cd2+ pollution. Mesophytes showed six to nine-fold increase in the level of proline in response to 1 mM Cd2+. The potential of the above hydrophytes for lipid peroxidation was also low under Cd2+ stress. In contrast, as expected a significant enhancement in the lipid peroxidation was observed in all three mesophytes in response to their exposure to Cd2+. About two-fold increase in production of malondialdehyde (a cytotoxic product of lipid peroxidation) was recorded in mesophytes exposed to 1 mM Cd2+. However, a decline in chlorophyll (Chl a and Chl b) levels was recorded in response to Cd2+pollution both in hydrophytes as well as mesophytes. In summary, hydrophytes neither have potential to accumulate proline nor have ability to accelerate lipid peroxidation under heavy metal stress. This suggests that the adaptive mechanism(s) existing in hydrophytes to tackle heavy metal stress is distinct from that in mesophytes.
Jiménez, Sergio; Dridi, Jihène; Gutiérrez, Diego; Moret, David; Irigoyen, Juan J; Moreno, María A; Gogorcena, Yolanda
2013-10-01
An understanding of the mechanisms that determine plant response to reduced water availability is essential to improve water-use efficiency (WUE) of stone fruit crops. The physiological, biochemical and molecular drought responses of four Prunus rootstocks (GF 677, Cadaman, ROOTPAC 20 and ROOTPAC(®) R) budded with 'Catherina' peach cultivar were studied. Trees were grown in 15-l containers and subjected to a progressive water stress for 26 days, monitoring soil moisture content by time domain reflectometry. Photosynthetic and gas exchange parameters were determined. Root and leaf soluble sugars and proline content were also measured. At the end of the experiment, stressed plants showed lower net photosynthesis rate, stomatal conductance and transpiration rate, and higher intrinsic leaf WUE (AN/gs). Soluble sugars and proline concentration changes were observed, in both root and leaf tissues, especially in an advanced state of stress. The accumulation of proline in roots and leaves with drought stress was related to the decrease in osmotic potential and increase in WUE, whereas the accumulation of sorbitol in leaves, raffinose in roots and proline in both tissues was related only to the increase in the WUE. Owing to the putative role of raffinose and proline as antioxidants and their low concentration, they could be ameliorating deleterious effects of drought-induced oxidative stress by protecting membranes and enzymes rather than acting as active osmolytes. Higher expression of P5SC gene in roots was also consistent with proline accumulation in the tolerant genotype GF 677. These results indicate that accumulation of sorbitol, raffinose and proline in different tissues and/or the increase in P5SC expression could be used as markers of drought tolerance in peach cultivars grafted on Prunus rootstocks.
Newton, Kelly A.; Pitteri, Sharon J.; Laskowski, Michael; McLuckey, Scott A.
2005-01-01
Expanded understanding of the factors that direct polypeptide ion fragmentation can lead to improved specificity in the use of tandem mass spectrometry for the identification and characterization of proteins. Like the fragmentation of peptide cations, the dissociation of whole protein cations shows several preferred cleavages, the likelihood for which is parent ion charge dependent. While such cleavages are often observed, they are far from universally observed, despite the presence of the residues known to promote them. Furthermore, cleavages at residues not noted to be common in a variety of proteins can be dominant for a particular protein or protein ion charge state. Motivated by the ability to study a small protein, turkey ovomucoid third domain, for which a variety of single amino acid variants are available, the effects of changing the identity of one amino acid in the protein sequence on its dissociation behavior were examined. In particular, changes in amino acids associated with C-terminal aspartic acid cleavage and N-terminal proline cleavage were emphasized. Consistent with previous studies, the product ion spectra were found to be dependent upon the parent ion charge state. Furthermore, the fraction of possible C-terminal aspartic acid cleavages observed to occur for this protein was significantly larger than the fraction of possible N-terminal proline cleavages. In fact, very little N-terminal proline cleavage was noted for the wild-type protein despite the presence of three proline residues in the protein. The addition/removal of proline and aspartic acids was studied along with changes in selected residues adjacent to proline residues. Evidence for inhibition of proline cleavage by the presence of nearby basic residues was noted, particularly if the basic residue was likely to be protonated. PMID:15473693
Checler, F; Emson, P C; Vincent, J P; Kitabgi, P
1984-11-01
It was shown previously that the tridecapeptide neurotensin is inactivated by rat brain synaptic membranes and that one of the primary inactivating cleavages occurs at the Pro10-Try11 peptide bond, leading to the formation of NT1-10 and NT11-13. The present study was designed to investigate the possibility that this cleavage was catalyzed by proline endopeptidase and/or endopeptidase 24.11 (enkephalinase). Purified rat brain synaptic membranes were found to contain a N-benzyloxycarbonyl-Gly-Pro-4-methyl-coumarinyl-7-amide-hydrolyzin g activity that was markedly inhibited (93%) by the proline endopeptidase inhibitor N-benzyloxycarbonyl-Pro-Prolinal and partially blocked (25%) by an antiproline endopeptidase antiserum. In contrast, the cleavage of neurotensin at the Pro10-Tyr11 bond by synaptic membranes was not affected by N-benzyloxycarbonyl-Pro-Prolinal and the antiserum. When the conversion of NT1-10 to NT1-8 by angiotensin converting enzyme was blocked by captopril and when the processing of NT11-13 by aminopeptidase(s) was inhibited by bestatin, it was found that thiorphan, a potent endopeptidase 24.11 inhibitor, partially decreased the formation of NT1-10 and NT11-13 by synaptic membranes. (1) proline endopeptidase, although it is present in synaptic membranes, is not involved in the cleavage of neurotensin at the Pro10-Tyr11 bond; (2) endopeptidase 24.11 only partially contributes to this cleavage; (3) there exists in rat brain synaptic membranes a peptidase different from proline endopeptidase and endopeptidase 24.11 that is mainly responsible for inactivating neurotensin by cleaving at the Pro10-Tyr11 bond.
The role of proline-containing peptide triads in β-sheet formation: A kinetic study.
Takor, Gaius A; Higashiya, Seiichiro; Sikirzhytski, Vitali K; Seeley, Jason P; Lednev, Igor K; Welch, John T
2015-06-01
The design of biomimetic materials through molecular self-assembly is a growing area of modern nanotechnology. With problems of protein folding, self-assembly, and sequence-structure relationships as essential in nanotechnology as in biology, the effect of the nucleation of β-hairpin formation by proline on the folding process has been investigated in model studies. Previously such studies were limited to investigations of the influence of proline on the formation of turns in short peptide sequences. The effect of proline-based triads on the folding of an 11-kDa amyloidogenic peptide GH6[(GA)3GY(GA)3GE]8 GAH6 (YE8) was investigated by selective substitution of the proline-substituted triads at the γ-turn sites. The folding and fibrillation of the singly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]7(GA)3GY(GA)3PD-GAH6 (8PD), and doubly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD-GAH6 (4,8PD), were directly monitored by circular dichroism and deep UV resonance Raman and fluorescence spectroscopies. These findings were used to identify the essential folding domains, i.e., the minimum number of β-strands necessary for stable folding. These experimental findings may be especially useful in the design and construction of peptidic materials for a wide range of applications as well as in understanding the mechanisms of folding critical to fibril formation. © 2015 Wiley Periodicals, Inc.
Tom E. Starkey; Scott A. Enebak
2011-01-01
Laboratory, greenhouse, and field trials have shown Proline® to be efficacious against three fungal pathogens that cause damage and seedling mortality in forest seedling nurseries. Disease control using Proline® has been obtained at 365 ml/ha (5 fl oz/ac) for the control of fusiform rust (Cronartium quercuum f.sp. fusiforme) on loblolly pine (Pinus taeda) in both...
Kim, Kyung Hyun; Jia, Baolei; Jeon, Che Ok
2017-01-01
Halobacillus halophilus , a moderately halophilic bacterium, accumulates a variety of compatible solutes including glycine betaine, glutamate, glutamine, proline, and ectoine to cope with osmotic stress. Non-targeted analysis of intracellular organic compounds using 1 H-NMR showed that a large amount of trans-4-hydroxy-L-proline (Hyp), which has not been reported as a compatible solute in H. halophilus , was accumulated in response to high NaCl salinity, suggesting that Hyp may be an important compatible solute in H. halophilus . Candidate genes encoding proline 4-hydroxylase (PH-4), which hydroxylates L-proline to generate Hyp, were retrieved from the genome of H. halophilus through domain searches based on the sequences of known PH-4 proteins. A gene, HBHAL_RS11735, which was annotated as a multidrug DMT transporter permease in GenBank, was identified as the PH-4 gene through protein expression analysis in Escherichia coli . The PH-4 gene constituted a transcriptional unit with a promoter and a rho-independent terminator, and it was distantly located from the proline biosynthetic gene cluster ( pro operon). Transcriptional analysis showed that PH-4 gene expression was NaCl concentration-dependent, and was specifically induced by chloride anion, similar to the pro operon. Accumulation of intracellular Hyp was also observed in other bacteria, suggesting that Hyp may be a widespread compatible solute in halophilic and halotolerant bacteria.
Kim, Kyung Hyun; Jia, Baolei; Jeon, Che Ok
2017-01-01
Halobacillus halophilus, a moderately halophilic bacterium, accumulates a variety of compatible solutes including glycine betaine, glutamate, glutamine, proline, and ectoine to cope with osmotic stress. Non-targeted analysis of intracellular organic compounds using 1H-NMR showed that a large amount of trans-4-hydroxy-L-proline (Hyp), which has not been reported as a compatible solute in H. halophilus, was accumulated in response to high NaCl salinity, suggesting that Hyp may be an important compatible solute in H. halophilus. Candidate genes encoding proline 4-hydroxylase (PH-4), which hydroxylates L-proline to generate Hyp, were retrieved from the genome of H. halophilus through domain searches based on the sequences of known PH-4 proteins. A gene, HBHAL_RS11735, which was annotated as a multidrug DMT transporter permease in GenBank, was identified as the PH-4 gene through protein expression analysis in Escherichia coli. The PH-4 gene constituted a transcriptional unit with a promoter and a rho-independent terminator, and it was distantly located from the proline biosynthetic gene cluster (pro operon). Transcriptional analysis showed that PH-4 gene expression was NaCl concentration-dependent, and was specifically induced by chloride anion, similar to the pro operon. Accumulation of intracellular Hyp was also observed in other bacteria, suggesting that Hyp may be a widespread compatible solute in halophilic and halotolerant bacteria. PMID:29104571
Rienth, Markus; Romieu, Charles; Gregan, Rebecca; Walsh, Caroline; Torregrosa, Laurent; Kelly, Mary T
2014-04-16
A rapid and sensitive method is presented for the determination of proline in grape berries. Following acidification with formic acid, proline is derivatized by heating at 100 °C for 15 min with 3% ninhydrin in dimethyl sulfoxide, and the absorbance, which is stable for at least 60 min, is read at 520 nm. The method was statistically validated in the concentration range from 2.5 to 15 mg/L, giving a repeatability and intermediate precision of generally <3%; linearity was determined using the lack of fit test. Results obtained with this method concurred (r = 0.99) with those obtained for the same samples on an amino acid analyzer. In terms of sample preparation, a simple dilution (5-20-fold) is required, and sugars, primary amino acids, and anthocyanins were demonstrated not to interfere, as the latter are bleached by ninhydrin under the experimental conditions. The method was applied to the study of proline accumulation in the fruits of microvines grown in phytotrons, and it was established that proline accumulation and concentrations closely resemble those of field-grown macrovines.
The nature of the hydroxyapatite-binding site in salivary acidic proline-rich proteins.
Bennick, A; Cannon, M; Madapallimattam, G
1979-10-01
Protein A and C, which are major components of the acidic proline-rich proteins in human saliva, were digested, before or after adsorption to hydroxyapatite, with alkaline phosphatase, trypsin, thermolysin and a proteinase preparation from salivary sediment. The results demonstrate that the binding site is located in the proline-poor N-terminal part of the protein, possibly between residues 3 and 25. Phosphoserine is necessary for maximal adsorption of the proteins to hydroxyapatite. When proteins A and C are adsorbed to hydroxyapatite before proteolytic digestion there is a protection of some of the susceptible bonds in the N-terminal part of the proteins and a gradual removal of the proline-rich C-terminal part. Thermolysin can cleave susceptible bonds in the part of the protein that remains bound to hydroxyapatite, but at least some of the resulting peptides are retained on the mineral. Since the ability of the proteins to inhibit hydroxyapatite formation and to bind calcium is located in the N-terminal proline-poor part, it is possible that these activities are retained after proteolytic digestion of the adsorbed proteins.
Stankiewicz-Kranc, Anna; Miltyk, Wojciech; Skrzydlewska, Elzbieta
2010-01-01
The high toxicity and low selectivity of carmustine restrict its application in anticancer therapy. Therefore, proline analogs of nitrosourea have been synthesized to obtain compounds whose action on neoplastic cells is characterized by higher selectivity. The present studies have aimed at examining the influence of carmustine and a new proline analog of nitrosourea on the redox system of fibroblasts and breast cancer cells (MCF-7). Carmustine and the proline analog of nitrosourea caused an increase in hydrogen peroxide concentration both in fibroblasts and MCF-7 cells. Moreover, administration of carmustine and the new analog of nitrosourea caused a decrease in the activity of antioxidant enzymes. Observed changes in the antioxidant system correlated with an increase in concentration of dityrosine, as well as a decrease in tryptophan concentration. Changes in the antioxidant system were also accompanied by intensification of the lipid peroxidation process. In conclusion, carmustine and proline analog of nitrosourea produce similar changes in the antioxidant system in normal and cancer cells and are responsible for oxidative stress.
Joseph, Raji E; Ginder, Nathaniel D; Hoy, Julie A; Nix, Jay C; Honzatko, Richard B; Andreotti, Amy H
2011-02-01
Proline is a unique amino acid owing to the relatively small energy difference between the cis and trans conformations of its peptide bond. The X-Pro imide bond readily undergoes cis-trans isomerization in the context of short peptides as well as some proteins. However, the direct detection of cis-trans proline isomerization in folded proteins is technically challenging. NMR spectroscopy is well suited to the direct detection of proline isomerization in folded proteins. It is less clear how well X-ray crystallography can reveal this conformational exchange event in folded proteins. Conformational heterogeneity owing to cis-trans proline isomerization in the Src homology 2 (SH2) domain of the IL-2-inducible T-cell kinase (ITK) has been extensively characterized by NMR. Using the ITK SH2 domain as a test system, an attempt was made to determine whether proline isomerization could be detected in a crystal structure of the ITK SH2 domain. As a first step towards this goal, the purification, crystallization and preliminary characterization of the ITK SH2 domain are described.
Proline induced disruption of the structure and dynamics of water.
Yu, Dehong; Hennig, Marcus; Mole, Richard A; Li, Ji Chen; Wheeler, Cheryl; Strässle, Thierry; Kearley, Gordon J
2013-12-21
We use quasi-elastic neutron scattering spectroscopy to study the diffusive motion of water molecules at ambient temperature as a function of the solute molar fraction of the amino acid, proline. We validate molecular dynamics simulations against experimental quasielastic neutron scattering data and then use the simulations to reveal, and understand, a strong dependence of the translational self-diffusion coefficient of water on the distance to the amino acid molecule. An analysis based on the juxtaposition of water molecules in the simulation shows that the rigidity of proline imposes itself on the local water structure, which disrupts the hydrogen-bond network of water leading to an increase in the mean lifetime of hydrogen bonds. The net effect is some distortion of the proline molecule and a slowing down of the water mobility.
He, Rui; Yu, Guohong; Han, Xiaori; Han, Jiao; Li, Wei; Wang, Bing; Huang, Shengcai; Cheng, Xianguo
2017-12-01
An inorganic pyrophosphorylase gene, ThPP1 , modulated the accumulations of phosphate and osmolytes by up-regulating the differentially expression genes, thus enhancing the tolerance of the transgenic rice to alkali stress (AS). Inorganic pyrophosphorylase is essential in catalyzing the hydrolysis of pyrophosphate to inorganic phosphate during plant growth. Here, we report the changes of physiological osmolytes and differentially expression genes in the transgenic rice overexpressing a soluble inorganic pyrophosphatase gene ThPP1 of Thellungiella halophila in response to AS. Analyses showed that the ThPP1 gene was a PPase family I member which is located to the cytoplasm. Data showed that the transgenic lines revealed an enhanced tolerance to AS compared to the wild type, and effectively increased the accumulations of inorganic phosphate and organic small molecules starch, sucrose, proline and chlorophyll, and maintained the balance of osmotic potential by modulating the ratio of Na + /K + in plant cells. Under AS, total 379 of differentially expression genes were up-regulated in the leaves of the transgenic line compared with control, and the enhanced tolerance of the transgenic rice to the AS seemed to be associated with the up-regulations of the osmotic stress-related genes such as the L-type lectin-domain containing receptor kinase (L-type LecRK), the cation/H + antiporter gene and the vacuolar cation/proton exchanger 1 gene (CAX1), which conferred the involvements in the biosynthesis and metabolic pathways. Protein interaction showed that the ThPP1 protein specifically interacted with a 16# target partner of the photosystem II light-harvesting-Chl-binding protein. This study suggested that the ThPP1 gene plays an important regulatory role in conferring the tolerance of the transgenic rice to AS, and is an effective candidate in molecular breeding for crop cultivation of the alkali tolerance.
Ghosh, Puja; Roychoudhury, Aryadeep
2018-01-01
Accounting for aroma production in different aromatic indica rice varieties based on variations in the levels of concerned metabolites and enzymes is poorly explored. The present investigation was, therefore, focused on unraveling the differential levels of metabolites and activities of enzymes related to aroma formation in eleven indigenous aromatic rice varieties, as compared with four non-aromatic varieties. The levels of metabolites such as proline (Pro) and Δ 1 -pyrroline-5-carboxylate (P5C), and the activity of related enzymes such as proline dehydrogenase (PDH), Δ 1 -pyrroline-5-carboxylate synthetase (P5CS), and ornithine aminotransferase (OAT) were comparatively higher in the aromatic varieties, with Kalonunia and Tulaipanji registering the highest Pro, Kalonunia the highest P5C content, Gobindobhog with the highest PDH activity, Gobindobhog and Tulaipanji with the highest P5CS, and Pusa Basmati-1 with the highest OAT activity. The levels of putrescine (Put) and γ-aminobutyric acid (GABA) were comparatively lower in aromatic varieties, with concomitant higher diamine oxidase (DAO) activity, especially in the varieties Gobindobhog and Tulaipanji. The betaine-aldehyde dehydrogenase 2 (BADH2) enzyme activity was remarkably lesser in aromatic varieties, especially Radhunipagal and Gobindobhog. Though the metabolites such as glycine-betaine and higher polyamines such as spermidine and spermine showed no specific trend with respect to their quantitative level in either aromatic or non-aromatic varieties, they were notably lower in the aromatic varieties such as Gobindobhog, Kalonunia, and Tulaipanji, indicating a possibility of their involvement in aroma formation. Therefore, the levels of metabolites such as Pro, P5C and methylglyoxal (MG), and the activity of enzymes such as PDH, P5CS, OAT, and DAO were comparatively higher in the aromatic rice varieties than the non-aromatic ones, whereas the levels of Put, GABA, and BADH2 were lower. Overall, the present study showed that there exist variations in the accumulations of such metabolites as well as differential activity of enzymes controlling their production, which altogether regulate generation of aroma in aromatic varieties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mallett, A.K.; Rowland, I.R.; Walters, D.G.
1985-11-01
The urinary excretion of N-nitroso-L-(U- UC)proline by conventional microflora and germ free rats was used to assess the role of the gut bacteria and oral nitrate in the endogenous formation of N-nitroso compounds. The formation of nitrosoproline was qualitatively similar in conventional and germfree rats suggesting no involvement of the intestinal flora in this reaction. Furthermore, nitrosamino acid production was similar following the administration of nitrate and (U- UC)proline or (U- UC)proline alone, demonstrating no involvement of exogenous nitrate under the conditions of the experiment. Dietary contamination with nitrate/nitrite was negligible. The results are consistent with the suggestion that nitrate/nitritemore » reserves in the body are important in the formation of nitrosoproline in vivo.« less
Rac1 GTPase regulates 11β hydroxysteroid dehydrogenase type 2 and fibrotic remodeling.
Lavall, Daniel; Schuster, Pia; Jacobs, Nadine; Kazakov, Andrey; Böhm, Michael; Laufs, Ulrich
2017-05-05
The aim of the study was to characterize the role of Rac1 GTPase for the mineralocorticoid receptor (MR)-mediated pro-fibrotic remodeling. Transgenic mice with cardiac overexpression of constitutively active Rac1 (RacET) develop an age-dependent phenotype with atrial dilatation, fibrosis, and atrial fibrillation. Expression of MR was similar in RacET and WT mice. The expression of 11β hydroxysteroid dehydrogenase type 2 (11β-HSD2) was age-dependently up-regulated in the atria and the left ventricles of RacET mice on mRNA and protein levels. Statin treatment inhibiting Rac1 geranylgeranylation reduced 11β-HSD2 up-regulation. Samples of human left atrial myocardium showed a positive correlation between Rac1 activity and 11β-HSD2 expression ( r = 0.7169). Immunoprecipitation showed enhanced Rac1-bound 11β-HSD2 relative to Rac1 expression in RacET mice that was diminished with statin treatment. Both basal and phorbol 12-myristate 13-acetate (PMA)-induced NADPH oxidase activity were increased in RacET and correlated positively with 11β-HSD2 expression ( r = 0.788 and r = 0.843, respectively). In cultured H9c2 cardiomyocytes, Rac1 activation with l-buthionine sulfoximine increased; Rac1 inhibition with NSC23766 decreased 11β-HSD2 mRNA and protein expression. Connective tissue growth factor (CTGF) up-regulation induced by aldosterone was prevented with NSC23766. Cardiomyocyte transfection with 11β-HSD2 siRNA abolished the aldosterone-induced CTGF up-regulation. Aldosterone-stimulated MR nuclear translocation was blocked by the 11β-HSD2 inhibitor carbenoxolone. In cardiac fibroblasts, nuclear MR translocation induced by aldosterone was inhibited with NSC23766 and spironolactone. NSC23766 prevented the aldosterone-induced proliferation and migration of cardiac fibroblasts and the up-regulation of CTGF and fibronectin. In conclusion, Rac1 GTPase regulates 11β-HSD2 expression, MR activation, and MR-mediated pro-fibrotic signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Hidding, E; Swaab, H; de Sonneville, L M J; van Engeland, H; Vorstman, J A S
2016-11-01
This paper examines how COMT 158 genotypes and plasma proline levels are associated with variable penetrance of social behavioural and social cognitive problems in 22q11.2 deletion syndrome (22q11DS). Severity of autistic spectrum symptoms of 45 participants with 22q11DS was assessed using the Autism Diagnostic Interview Revised. Face and facial emotion recognition was evaluated using standardized computer-based test-paradigms. Associations with COMT 158 genotypes and proline levels were examined. High proline levels and poor face recognition in individuals with the COMT MET allele, and poor facial emotion recognition, explained almost 50% of the variance in severity of autism symptomatology in individuals with 22q11DS. High proline levels and a decreased capacity to break down dopamine as a result of the COMT MET variant are both relevant in the expression of the social phenotype in patients. This epistatic interaction effect between the COMT 158 genotype and proline on the expression of social deficits in 22q11DS shows how factors other than the direct effects of the deletion itself can modulate the penetrance of associated cognitive and behavioural outcomes. These findings are not only relevant to our insight into 22q11DS, but also provide a model to better understand the phenomenon of variable penetrance in other pathogenic genetic variants. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Moczar, M; Robert, A M; Jacotot, B; Robert, L
2001-05-01
The effect of an alpha-blocking agent and of a beta-blocking agent on the biosynthesis of extracellular matrix macromolecules of the arterial wall was investigated. Rabbit aorta explants were cultured up to 48 hours with radioactive proline, lysine or glucosamine. In presence of these drugs, at concentration shown to be effective for the inhibition of platelet-endothelial cell interactions (10(-7) M), the incorporation of 14C proline in total macromolecular proline was higher than in macromolecular hydroxyproline suggesting a relatively higher rate of biosynthesis of non-collagenous proteins as compared to collagens. The alpha-blocking increased the incorporation of 14C proline in collagenous and non-collagenous proteins after 18 hours of incubation. beta-blocking also increased the incorporation of proline in macromolecular proline and hydroxyproline as compared to control cultures. Both increased the incorporation of 3H glucosamine in newly synthesised glycosaminoglycans. beta-blocking increased mainly the neosynthesis of heparan sulphate, alpha-blocking that of hyaluronan. The incorporation of 14C-lysine in crosslinked, insoluble elastin was not modified. These experiments confirm that alpha and beta-blocking agents can influence not only the tonus of aortic smooth muscle cells but also the relative rates of biosynthesis of extracellular matrix macromolecules. This effect should be taken in consideration for the evaluation of the long range effect of alpha and beta-blocking drugs on the vascular wall.
Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu
2017-01-01
Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA−GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions. PMID:28817702
Mushtaq, Muhammad A.; Pan, Qi; Chen, Daozong; Zhang, Qinghua; Ge, Xianhong; Li, Zaiyun
2016-01-01
The purple leaf pigmentation mainly associated with anthocyanins accumulation is common in Brassica but the mechanisms of its production and its potential physiological functions are poorly understood. Here, we performed the phenotypic, cytological, physiological, and comparative leaves transcriptome analyses of 11 different varieties belonging to five Brassica species with purple or green leaves. We observed that the anthocyanin was accumulated in most of vegetative tissues in all species and also in reproduction organs of B. carinata. Anthocyanin accumulated in different part of purple leaves including adaxial and abaxial epidermal cells as well as palisade and spongy mesophyll cells. Leave transcriptome analysis showed that almost all late biosynthetic genes (LBGs) of anthocyanin, especially Dihydroflavonol 4-Reductase (DFR), Anthocyanidin Synthase (ANS) and Transparent Testa 19 (TT19), were highly up-regulated in all purple leaves. However, only one of transcript factors in anthocyanin biosynthesis pathway, Transparent Testa 8 (TT8), was up regulated along with those genes in all purple leaves, indicating its pivotal role for anthocyanin production in Brassica. Interestingly, with the up-regulation of genes for anthocyanin synthesis, Cytosolic 6-phosphogluconolactonase (PLG5) which involved in the oxidative pentose-phosphate pathway was up-regulated in all purple leaves and three genes FTSH PROTEASE 8 (FTS8), GLYCOLATE OXIDASE 1 (GOX1), and GLUTAMINE SYNTHETASE 1;4 (GLN1;4) related to degradation of photo-damaged proteins in photosystem II and light respiration were down-regulated. These results highlighted the potential physiological functions of anthocyanin accumulation related to photosynthesis which might be of great worth in future. PMID:27047501
Kuang, Qi; Zhang, Sheng; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-01-01
Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA-GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions.
Inhibition of enzymatic browning in actual food systems by the Maillard reaction products.
Mogol, Burçe Ataç; Yildirim, Asli; Gökmen, Vural
2010-12-01
The Maillard reaction occurring between amino acids and sugars produces neo-formed compounds having certain levels of antioxidant activity depending on the reaction conditions and the type of reactants. The objective of this study was to investigate enzymatic browning inhibition capacity of Maillard reaction products (MRPs) formed from different amino acids including arginine (Arg), histidine (His), lysine (Lys) and proline (Pro). The inhibitory effects of the MRPs on polyphenol oxidase (PPO) were determined. The total antioxidant capacity (TAC) of MRPs derived from different amino acids were in the order Arg > His > Lys > Pro. The TAC and PPO inhibition of MRPs were evaluated as a function of temperature (80-120 °C), time (1-6 h) and pH (2-12). Arg-Glc and His-Glc MRPs exhibited strong TAC and PPO inhibition. Increasing temperature (up to 100 °C) and time also increased TAC and PPO inhibition. Kinetics analysis indicated a mixed type inhibition of PPO by MRPs. The results indicate that the MRPs derived from Arg and His under certain reaction conditions significantly prevent enzymatic browning in actual food systems. The intermediate compounds capable of preventing enzymatic browning are reductones and dehydroreductones, as confirmed by liquid chromatographic-mass spectrometric analyses. Copyright © 2010 Society of Chemical Industry.
Robert-Peillard, Fabien; Boudenne, Jean-Luc; Coulomb, Bruno
2014-05-01
This paper presents a simple, accurate and multi-sample method for the determination of proline in wines thanks to a 96-well microplate technique. Proline is the most abundant amino acid in wine and is an important parameter related to wine characteristics or maturation processes of grape. In the current study, an improved application of the general method based on sodium hypochlorite oxidation and o-phthaldialdehyde (OPA)-thiol spectrofluorometric detection is described. The main interfering compounds for specific proline detection in wines are strongly reduced by selective reaction with OPA in a preliminary step under well-defined pH conditions. Application of the protocol after a 500-fold dilution of wine samples provides a working range between 0.02 and 2.90gL(-1), with a limit of detection of 7.50mgL(-1). Comparison and validation on real wine samples by ion-exchange chromatography prove that this procedure yields accurate results. Simplicity of the protocol used, with no need for centrifugation or filtration, organic solvents or high temperature enables its full implementation in plastic microplates and efficient application for routine analysis of proline in wines. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bohin, Maxime C; Vincken, Jean-Paul; Westphal, Adrie H; Tripp, Annelise M; Dekker, Peter; van der Hijden, Harry T W M; Gruppen, Harry
2014-09-01
Interactions of Type A and B flavan-3-ol dimers (procyanidins) and several monomeric flavan-3-ols, with α-casein and β-casein, were investigated. Binding affinities measured were related to the ligands structure, including several properties (e.g. intrinsic flexibility (number of rotatable bonds) and hydrophobicity), and to the amino-acid composition of the caseins. A monomeric flavan-3-ol esterified with gallic acid (EGCG) had a five to ten times higher affinity to caseins compared to the non-galloylated dimeric flavan-3-ols. In this case, the larger number of rotatable bonds in EGCG might be accountable for this difference. Comparing flavan-3-ol dimers, intrinsic flexibility did not consistently promote interactions, as procyanidin A1 displayed a higher affinity to α-casein than the supposedly more flexible B-type dimers investigated. Despite its higher content of proline, compared to α-casein, β-casein did not always have a higher affinity for the ligands investigated (e.g. no interaction with procyanidin A1 detected). These results suggest that more factors than proline content and the number of proline repeats govern phenolic-casein interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Vogt, Henning; Vanderheiden, Sylvia; Bräse, Stefan
2003-10-07
Proline-catalysed amination of alpha,alpha-disubstituted racemic aldehydes with azodicarboxylates proceeds smoothly to give configurationally stable scalemic aldehydes and oxazolidinones in up to 86% ee.
Betaine is a positive regulator of mitochondrial respiration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Icksoo, E-mail: icksoolee@dankook.ac.kr
2015-01-09
Highlights: • Betaine enhances cytochrome c oxidase activity and mitochondrial respiration. • Betaine increases mitochondrial membrane potential and cellular energy levels. • Betaine’s anti-tumorigenic effect might be due to a reversal of the Warburg effect. - Abstract: Betaine protects cells from environmental stress and serves as a methyl donor in several biochemical pathways. It reduces cardiovascular disease risk and protects liver cells from alcoholic liver damage and nonalcoholic steatohepatitis. Its pretreatment can rescue cells exposed to toxins such as rotenone, chloroform, and LiCl. Furthermore, it has been suggested that betaine can suppress cancer cell growth in vivo and in vitro.more » Mitochondrial electron transport chain (ETC) complexes generate the mitochondrial membrane potential, which is essential to produce cellular energy, ATP. Reduced mitochondrial respiration and energy status have been found in many human pathological conditions including aging, cancer, and neurodegenerative disease. In this study we investigated whether betaine directly targets mitochondria. We show that betaine treatment leads to an upregulation of mitochondrial respiration and cytochrome c oxidase activity in H2.35 cells, the proposed rate limiting enzyme of ETC in vivo. Following treatment, the mitochondrial membrane potential was increased and cellular energy levels were elevated. We propose that the anti-proliferative effects of betaine on cancer cells might be due to enhanced mitochondrial function contributing to a reversal of the Warburg effect.« less
Somasuntharam, Inthirai; Boopathy, Archana V; Khan, Raffay S; Martinez, Mario D; Brown, Milton E; Murthy, Niren; Davis, Michael E
2013-10-01
Myocardial infarction (MI) is the most common cause of heart failure (HF), the leading cause of death in the developed world. Oxidative stress due to excessive production of reactive oxygen species (ROS) plays a key role in the pathogenesis of cardiac remodeling leading to HF. NADPH oxidase with Nox2 as the catalytic subunit is a major source for cardiac ROS production. Nox2-NADPH expression is significantly increased in the infarcted myocardium, primarily in neutrophils, macrophages and myocytes. Moreover, mice lacking the Nox2 gene are protected from ischemic injury, implicating Nox2 as a potential therapeutic target. RNAi-mediated gene silencing holds great promise as a therapeutic owing to its high specificity and potency. However, in vivo delivery hurdles have limited its effective clinical use. Here, we demonstrate acid-degradable polyketal particles as delivery vehicles for Nox2-siRNA to the post-MI heart. In vitro, Nox2-siRNA particles are effectively taken up by macrophages and significantly knockdown Nox2 expression and activity. Following in vivo intramyocardial injection in experimental mice models of MI, Nox2-siRNA particles prevent upregulation of Nox2 and significantly recovered cardiac function. This study highlights the potential of polyketals as siRNA delivery vehicles to the MI heart and represents a viable therapeutic approach for targeting oxidative stress. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hamisch, Domenica; Randewig, Dörte; Schliesky, Simon; Bräutigam, Andrea; Weber, Andreas P M; Geffers, Robert; Herschbach, Cornelia; Rennenberg, Heinz; Mendel, Ralf R; Hänsch, Robert
2012-12-01
High concentrations of sulfur dioxide (SO(2) ) as an air pollutant, and its derivative sulfite, cause abiotic stress that can lead to cell death. It is currently unknown to what extent plant fumigation triggers specific transcriptional responses. To address this question, and to test the hypothesis that sulfite oxidase (SO) is acting in SO(2) detoxification, we compared Arabidopsis wildtype (WT) and SO knockout lines (SO-KO) facing the impact of 600 nl l(-1) SO(2) , using RNAseq to quantify absolute transcript abundances. These transcriptome data were correlated to sulfur metabolism-related enzyme activities and metabolites obtained from identical samples in a previous study. SO-KO plants exhibited remarkable and broad regulative responses at the mRNA level, especially in transcripts related to sulfur metabolism enzymes, but also in those related to stress response and senescence. Focusing on SO regulation, no alterations were detectable in the WT, whereas in SO-KO plants we found up-regulation of two splice variants of the SO gene, although this gene is not functional in this line. Our data provide evidence for the highly specific coregulation between SO and sulfur-related enzymes like APS reductase, and suggest two novel candidates for involvement in SO(2) detoxification: an apoplastic peroxidase, and defensins as putative cysteine mass storages. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Lopes, Célia; Malhão, Fernanda; Guimarães, Cláudia; Pinheiro, Ivone; Gonçalves, José F; Castro, L Filipe C; Rocha, Eduardo; Madureira, Tânia V
2017-12-01
Disruption of androgenic signaling has been linked to possible cross-modulation with other hormone-mediated pathways. Therefore, our objective was to explore effects caused by testosterone - T (1, 10 and 50μM) in peroxisomal signaling of brown trout hepatocytes. To study the underlying paths involved, several co-exposure conditions were tested, with flutamide - F (anti-androgen) and ICI 182,780 - ICI (anti-estrogen). Molecular and morphological approaches were both evaluated. Peroxisome proliferator-activated receptor alpha (PPARα), catalase and urate oxidase were the selected targets for gene expression analysis. The vitellogenin A gene was also included as a biomarker of estrogenicity. Peroxisome relative volumes were estimated by immunofluorescence, and transmission electron microscopy was used for qualitative morphological control. The single exposures of T caused a significant down-regulation of urate oxidase (10 and 50μM) and a general up-regulation of vitellogenin. A significant reduction of peroxisome relative volumes and smaller peroxisome profiles were observed at 50μM. Co-administration of T and ICI reversed the morphological modifications and vitellogenin levels. The simultaneous exposure of T and F caused a significant and concentration-dependent diminishing in vitellogenin expression. Together, the findings suggest that in the tested model, T acted via both androgen and estrogen receptors to shape the peroxisomal related targets. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Jack J; Ly, Anh-Vuong
2006-05-15
The pharmacology, pharmacokinetics, clinical efficacy, and safety of rasagiline are reviewed. Rasagiline is a novel, investigational propargylamine that irreversibly and selectively inhibits monoamine oxidase type B (MAO-B). Rasagiline demonstrates complete and selective inhibition of MAO-B and is at least five times more potent than selegiline. Unlike selegiline, which is metabolized to amphetamine derivatives, rasagiline is biotransformed to the nonamphetamine compound aminoindan. Clinical studies have revealed that rasagiline is associated with improved outcomes in patients with early Parkinson's disease (PD) and also reduces "off" time in patients with moderate to advanced PD with motor fluctuations. Rasagiline is rapidly absorbed by the gastrointestinal tract and readily crosses the blood-brain barrier. The optimal therapeutic dosage is 0.5-1 mg administered orally once daily. Rasagiline appears to be well tolerated, although elderly patients may be more prone to treatment-emergent adverse cardiovascular and psychiatric effects. At the recommended therapeutic dosage of up to 1 mg once daily, tyramine restriction is unnecessary. In addition to MAO-B inhibition, rasagiline has demonstrated neuroprotective properties in experimental laboratory models. The mechanisms whereby rasagiline exerts neuroprotective effects are multifactorial and include upregulation of cellular antioxidant activity and antiapoptotic factors. Rasagiline is an investigational selective and irreversible inhibitor of MAO-B that has demonstrated efficacy and safety for the treatment of PD. Whether rasagiline is associated with clinically significant neuroprotection is the subject of ongoing clinical trials.
Lim, Dong Wook; Han, Taewon; Jung, Jonghoon; Song, Yuri; Um, Min Young; Yoon, Minseok; Kim, Yun Tai; Cho, Seungmok; Kim, In-Ho; Han, Daeseok; Lee, Changho; Lee, Jaekwang
2018-06-12
Oxidative stress has been implicated in mental disorders, including depression. Chlorogenic acid (CGA), a phenolic compound abundant in herbs and fruits, has been reported to have antioxidant and free-radical scavenging properties. In this study, we investigated the antidepressant-like effects and active mechanisms of CGA from the extract of Crataegus pinnatifida (CP) fruit. Depression-like phenotypes were induced in mice by daily injection of stress hormone for 1-2 weeks. The brains of these animals exhibited reduced brain-derived neurotrophic factor (BDNF) expression and increased astrocytic hypertrophy, which are typical markers of depression in animal models. Stress hormone injection 1) upregulated monoamine oxidase B (MAOB) expression and 2) reduced spine numbers along neuronal dendrites, which indicates synaptic depression. The oral administration of CGA (30 mg/kg) or CP (300 mg/kg) prevented MAOB activation following reactive oxygen species (ROS) production and had an ameliorative effect on depressive behavioral tests (e.g., tail suspension and forced swim tests). In vitro assays performed on cultured C8-D1A cells revealed that CGA and CP inhibited MAOB activity and ROS production. Our study indicates that CGA and CP extracts prevented depressive behavior and thereby have potential as natural antidepressants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ederli, Luisa; Morettini, Roberta; Borgogni, Andrea; Wasternack, Claus; Miersch, Otto; Reale, Lara; Ferranti, Francesco; Tosti, Nicola; Pasqualini, Stefania
2006-01-01
The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain, an alternative pathway that terminates with a single homodimeric protein, the alternative oxidase (AOX). We recorded temporary inhibition of cytochrome capacity respiration and activation of AOX pathway capacity in tobacco plants (Nicotiana tabacum L. cv BelW3) fumigated with ozone (O3). The AOX1a gene was used as a molecular probe to investigate its regulation by signal molecules such as hydrogen peroxide, nitric oxide (NO), ethylene (ET), salicylic acid, and jasmonic acid (JA), all of them reported to be involved in the O3 response. Fumigation leads to accumulation of hydrogen peroxide in mitochondria and early accumulation of NO in leaf tissues. Although ET accumulation was high in leaf tissues 5 h after the start of O3 fumigation, it declined during the recovery period. There were no differences in the JA and 12-oxo-phytodienoic acid levels of treated and untreated plants. NO, JA, and ET induced AOX1a mRNA accumulation. Using pharmacological inhibition of ET and NO, we demonstrate that both NO- and ET-dependent pathways are required for O3-induced up-regulation of AOX1a. However, only NO is indispensable for the activation of AOX1a gene expression. PMID:16935990
Amino acids of Diclidophora merlangi (Monogenea).
Arme, C; Whyte, A
1975-02-01
The level of free amino acids in Diclidophora merlangi is high, comprising over 500 mu moles/g ethanol extracted dry weight. A single amino acid, proline, constitutes some 70% of the total pool. Analysis of parasite protein and host blood and mucus revealed low proline levels, suggesting that the high free pool content was not related to a requirement for protein systhesis or to its abundance in the diet of the worm. Experiments revealed that proline was not involved specifically in osmoregulation, and the reasons for the large amounts present in Diclidophora remain unknown.
Riether, Doris; Zindell, Renee; Wu, Lifen; Betageri, Raj; Jenkins, James E; Khor, Someina; Berry, Angela K; Hickey, Eugene R; Ermann, Monika; Albrecht, Claudia; Ceci, Angelo; Gemkow, Mark J; Nagaraja, Nelamangala V; Romig, Helmut; Sauer, Achim; Thomson, David S
2015-02-01
Through a ligand-based pharmacophore model (S)-proline based compounds were identified as potent cannabinoid receptor 2 (CB2) agonists with high selectivity over the cannabinoid receptor 1 (CB1). Structure-activity relationship investigations for this compound class lead to oxo-proline compounds 21 and 22 which combine an impressive CB1 selectivity profile with good pharmacokinetic properties. In a streptozotocin induced diabetic neuropathy model, 22 demonstrated a dose-dependent reversal of mechanical hyperalgesia. Copyright © 2014 Elsevier Ltd. All rights reserved.
Villarreal-Calderon, Rodolfo; Reed, William; Palacios-Moreno, Juan; Keefe, Sheyla; Herritt, Lou; Brooks, Diane; Torres-Jardón, Ricardo; Calderón-Garcidueñas, Lilian
2012-05-01
Air pollution is a serious environmental problem. Elderly subjects show increased cardiac morbidity and mortality associated with air pollution exposure. Mexico City (MC) residents are chronically exposed to high concentrations of fine particulate matter (PM(2.5)) and PM-associated lipopolysaccharides (PM-LPS). To test the hypothesis that chronic exposure to urban pollution produces myocardial inflammation, female Balb-c mice age 4 weeks were exposed for 16 months to two distinctly different polluted areas within MC: southwest (SW) and northwest (NW). SW mice were given either no treatment or chocolate 2g/9.5 mg polyphenols/3 times per week. Results were compared to mice kept in clean air. Key inflammatory mediator genes: cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), and the LPS receptor CD14 (cluster of differentiation antigen 14) were measured by real-time polymerase chain reaction. Also explored were target NFκB (nuclear factor κB), oxidative stress and antioxidant defense genes. TNF-α, IL-6, and COX-2 were significantly increased in both NW and SWMC mice (p=0.0001). CD14 was up-regulated in SW mice in keeping with the high exposures to particulate matter associated endotoxin. Chocolate administration resulted in a significant down-regulation of TNF-α (p<0.0001), IL-6 (p=0.01), and IL-1β (p=0.02). The up-regulation of antioxidant enzymes and the down-regulation of potent oxidases, toll-like receptors, and pro-apoptotic signaling genes completed the protective profile. Exposure to air pollution produces up-regulation of inflammatory myocardial genes and endotoxin plays a key role in the inflammatory response. Regular consumption of dark chocolate may reduce myocardial inflammation and have cardioprotective properties in the setting of air pollution exposures. Copyright © 2010 Elsevier GmbH. All rights reserved.
Zhao, Ting-Ting; Yang, Tian-Lun; Gong, Li; Wu, Pei
2018-05-03
To unveil the possible protective role of isorhamnetin, an immediate 3'-O-methylated metabolite of quercetin, in cardiomyocyte under hypoxia/reoxygenation (H/R) condition and the underlying mechanisms involved, H9c2 cardiomyocytes were exposed to the vehicle or H/R for 6 h (2 h of hypoxia following by 4 h of reoxygenation) with isorhamnetin (0, 3, 6, 12, 25, 50 μM for 4 h prior to H/R exposure). Apoptosis was evaluated by TUNEL staining, flow cytometry analysis and western blot assay for cleaved caspase-3. Myocardial injure in vivo was determined by infarct size using TTC staining, histological damage using H&E staining and myocardial apoptosis. Here, we found that isorhamnetin dose-dependently protected H9c2 cardiomyocytes against H/R-induced injure, as evidenced by the reduction in lactate dehydrogenase (LDH) levels, increases in cell viability, superoxide dismutase (SOD) and catalase (CAT) activity, with the maximal effects at 25 μΜ. In addition, isorhamnetin treatment significantly inhibited apoptosis in H/R-induced H9c2 cardiomyocytes and ameliorated H/R-induced myocardial injure in vivo, concomitant with the upregulation of sirtuin 1 (SIRT1) expression. Mechanism studies demonstrated that isorhamnetin pretreatment remarkably abolished H/R-induced downregulation of Nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) expressions and upregulation of NADPH oxidase-2/4 (NOX-2/4) expressions in cardiomyocytes. However, SIRT1 inhibition (Sirtinol) not only inhibited isorhamnetin-induced Nrf2/HO-1 upregulation and NOX-2/4 downregulation, but also alleviated its anti-apoptotic effects. Taken together, these data indicate that isorhamnetin can exhibit positive effect on H/R-induced injure by attenuating apoptosis and oxidative stress in H9c2 cardiomyocytes, which is partly attributable to the upregulation of SIRT1 and Nrf2/HO-1-mediated antioxidant signaling pathway. Copyright © 2017. Published by Elsevier B.V.
Villarreal-Calderon, Rodolfo; Reed, William; Palacios-Moreno, Juan; Keefe, Sheyla; Herritt, Lou; Brooks, Diane; Torres-Jardón, Ricardo; Calderón-Garcidueñas, Lilian
2010-01-01
Air pollution is a serious environmental problem. Elderly subjects show increased cardiac morbidity and mortality associated with air pollution exposure. Mexico City (MC) residents are chronically exposed to high concentrations of fine particulate matter (PM2.5) and PM-associated lipopolysaccharides (PM-LPS). To test the hypothesis that chronic exposure to urban pollution produces myocardial inflammation, female Balb-c mice age 4 weeks were exposed for 16 months to two distinctly different polluted areas within MC: Southwest (SW) and Northwest (NW). SW mice were given either no treatment or chocolate 2g/9.5 mg polyphenols/3 times per week. Results were compared to mice kept in clean air. Key inflammatory mediator genes: cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), and the LPS receptor CD14 (cluster of differentiation antigen 14) were measured by real time polymerase chain reaction. Also explored were target NFκB (Nuclear Factor κ B), oxidative stress and antioxidant defense genes. TNF-α, IL-6, and COX-2 were significantly increased in both NW and SWMC mice (p=0.0001). CD14 was up-regulated in SW mice in keeping with the high exposures to particulate matter associated endotoxin. Chocolate administration resulted in a significant down-regulation of TNF-α (p<0.0001), IL-6 (p=0.01), and IL-1β (p=0.02). The up-regulation of antioxidant enzymes and the down-regulation of potent oxidases, toll-like receptors, and pro-apoptotic signaling genes completed the protective profile. Exposure to air pollution produces up-regulation of inflammatory myocardial genes and endotoxin plays a key role in the inflammatory response. Regular consumption of dark chocolate may reduce myocardial inflammation and have cardioprotective properties in the setting of air pollution exposures. PMID:20932730
Kikuchi, Hidetomo; Yuan, Bo; Yuhara, Eisuke; Imai, Masahiko; Furutani, Ryota; Fukushima, Shin; Hazama, Shingo; Hirobe, Chieko; Ohyama, Kunio; Takagi, Norio; Toyoda, Hiroo
2014-08-01
We have demonstrated that an extract from the ripe fruit of Vitex angus-castus (Vitex), might be a promising anticancer candidate. In order to further provide a molecular rationale for clinical development in anticancer therapy, a detailed mechanism underlying the efficacy of Vitex against HL-60 cells was investigated. Vitex induced a dose- and time-dependent decrease in cell viability associated with induction of apoptosis and G(2)/M cell cycle arrest, both of which were suppressed by the addition of SB203580, an inhibitor for p38 MAPK. Furthermore, SB203580 significantly suppressed Vitex-induced phosphorylation of histone H3, a downstream molecule of p38 MAPK known to be involved in apoptosis induction in tumor cells. Notably, Vitex induced upregulation of intracellular ATP, known to bind its binding pocket inside activated p38 MAPK and to be required for the activation of p38 MAPK pathway. These results, thus, suggest that upregulation of intracellular ATP and phosphorylation of histone H3 are closely associated with the activation of p38 MAPK pathway, consequently contributing to Vitex-mediated cytotoxicity. Intriguingly, a significant decrease of intracellular ROS levels and downregulation of expression level of gp91(phox), an important component of NADPH oxidase, were observed in Vitex-treated cells. A greater decline in ROS levels along with enhanced apoptosis was observed after treatment with Vitex in combination with SnPP, an inhibitor specific for HO-1. Since NADPH oxidase and HO-1 are closely correlated to redox status associated with intracellular ROS levels, the two enzymes are suggested to be implicated in Vitex-mediated cytotoxicity in HL-60 cells by regulating ROS generation. We also suggest that activation of the p38 MAPK pathway may be dependent on the alterations of intracellular ATP levels, rather than that of intracellular ROS levels. These results may have important implications for appropriate clinical uses of Vitex and provide novel insights into the interaction between Vitex and other conventional drugs capable of affecting intracellular redox status.
Johar, Kaid; Priya, Anusha; Wong-Riley, Margaret T T
2012-11-23
NRF-1 regulates mediators of neuronal activity and energy generation. NRF-1 transcriptionally regulates Na(+)/K(+)-ATPase subunits α1 and β1. NRF-1 functionally regulates mediators of energy consumption in neurons. NRF-1 mediates the tight coupling of neuronal activity, energy generation, and energy consumption at the molecular level. Energy generation and energy consumption are tightly coupled to neuronal activity at the cellular level. Na(+)/K(+)-ATPase, a major energy-consuming enzyme, is well expressed in neurons rich in cytochrome c oxidase, an important enzyme of the energy-generating machinery, and glutamatergic receptors that are mediators of neuronal activity. The present study sought to test our hypothesis that the coupling extends to the molecular level, whereby Na(+)/K(+)-ATPase subunits are regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), found recently by our laboratory to regulate all cytochrome c oxidase subunit genes and some NMDA and AMPA receptor subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutational analysis, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Atp1a1 and Atp1b1 genes but not of the Atp1a3 gene in neurons. The transcripts of Atp1a1 and Atp1b1 subunit genes were up-regulated by KCl and down-regulated by tetrodotoxin. Atp1b1 is positively regulated by NRF-1, and silencing of NRF-1 with small interference RNA blocked the up-regulation of Atp1b1 induced by KCl, whereas overexpression of NRF-1 rescued these transcripts from being suppressed by tetrodotoxin. On the other hand, Atp1a1 is negatively regulated by NRF-1. The binding sites of NRF-1 on Atp1a1 and Atp1b1 are conserved among mice, rats, and humans. Thus, NRF-1 regulates key Na(+)/K(+)-ATPase subunits and plays an important role in mediating the tight coupling between energy consumption, energy generation, and neuronal activity at the molecular level.
Buku, A.; Faulstich, H.; Wieland, T.; Dabrowski, J.
1980-01-01
Among the four possible stereoisomers of 3,4-dihydroxy-L-proline,2,3-trans-3,4-trans-3,4-dihydroxy-L-proline (IV) had not been found in nature previously. It has now been detected as a component of virotoxins, toxic peptides of Amanita virosa mushrooms. Because periodate failed to effect an oxidative glycol splitting reaction, the two hydroxyl groups in positions 3 and 4 were expected to be in a trans configuration. Furthermore, the formation of a 4-lactone on treatment with acids pointed to the carboxyl group and the hydroxyl group at position 4 being in a cis configuration. These results are in agreement with structure IV only. Final proof for structure IV was given by NMR spectroscopy and direct comparison with the 2,3-cis-3,4-trans-3,4-dihydroxy-L-proline isomer. PMID:16592813
Sasaki, Hideaki; Sato, Daichi; Oshima, Akinobu
2017-01-01
The effect of the amount of the proline transporter PutP expression on the mechanism of adaptation of E. coli cells to high salinity was analyzed. The PutP gene derived from the E. coli expression plasmid was introduced into the E. coli cell, and a high PutP expression strain was developed. At 1.2 M NaCl culture condition, the growth of normal E. coli cells was inhibited, whereas high ProP expression cells showed growth under 2.5 M NaCl conditions. The uptake of proline by E. coli as a compatible solute and substrate for metabolization was in good accordance with those seen in cell growth. These data suggested that the amount of the proline transporter PutP expression played an important role in the adaptation of E. coli cells to high saline conditions.
Suri, Jeff T; Mitsumori, Susumu; Albertshofer, Klaus; Tanaka, Fujie; Barbas, Carlos F
2006-05-12
Dihydroxyacetone variants have been explored as donors in organocatalytic aldol reactions with various aldehyde and ketone acceptors. The protected form of dihydroxyacetone that was chosen for in-depth study was 2,2-dimethyl-1,3-dioxan-5-one, 1. Among the catalysts surveyed here, proline proved to be superior in terms of yield and stereoselectivities in the construction of various carbohydrate scaffolds. In a fashion analogous to aldolase enzymes, the de novo preparation of L-ribulose, L-lyxose, D-ribose, D-tagatose, 1-amino-1-deoxy-D-lyxitol, and other carbohydrates was accomplished via the use of 1 and proline. In reactions using 2,2-dimethyl-1,3-dioxan-5-one 1 as a donor, (S)-proline can be used as a functional mimic of tagatose aldolase, whereas (R)-proline can be regarded as an organocatalytic mimic of fuculose aldolase.
Zhou, Guo-Chun; Weng, Zhibing; Shao, Xiaoxia; Liu, Fang; Nie, Xin; Liu, Jinsong; Wang, Decai; Wang, Chunguang; Guo, Kai
2013-12-15
A series of methionine-proline dipeptide derivatives and their analogues were designed, synthesized and assayed against the serotype 2 dengue virus NS2B-NS3 protease, and methionine-proline anilides 1 and 2 were found to be the most active DENV 2 NS2B-NS3 competitive inhibitors with Ki values of 4.9 and 10.5 μM. The structure and activity relationship and the molecular docking revealed that L-proline, L-methionine and p-nitroaniline in 1 and 2 are the important characters in blocking the active site of NS2B-NS3 protease. Our current results suggest that the title dipeptidic scaffold represents a promising structural core to discover a new class of active NS2B-NS3 competitive inhibitors. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Mason, Charles J.; Scully, Erin D.; Geib, Scott M.; Hoover, Kelli
2016-09-01
Wood-feeding insects encounter challenging diets containing low protein quantities, recalcitrant carbohydrate sources, and plant defensive compounds. The Asian longhorned beetle (Anoplophora glabripennis) is a wood-feeding insect that attacks and kills a diversity of hardwood tree species. We compared gene expression of midguts collected from larvae feeding in a preferred tree, sugar maple, to those consuming a nutrient-rich artificial diet, to identify genes putatively involved in host plant utilization. Anoplophora glabripennis larvae exhibited differential expression of ~3600 genes in response to different diets. Genes with predicted capacity for plant and microbial carbohydrate usage, detoxification, nutrient recycling, and immune-related genes relevant for facilitating interactions with microbial symbionts were upregulated in wood-feeding larvae compared to larvae feeding in artificial diet. Upregulation of genes involved in protein degradation and synthesis was also observed, suggesting that proteins incur more rapid turnover in insects consuming wood. Additionally, wood-feeding individuals exhibited elevated expression of several mitochondrial cytochrome C oxidase genes, suggesting increased aerobic respiration compared to diet-fed larvae. These results indicate that A. glabripennis modulates digestive and basal gene expression when larvae are feeding in a nutrient-poor, yet suitable host plant compared to a tractable and nutrient-rich diet that is free of plant defensive compounds.
Chua, Li-Min; Lim, Mei-Li; Wong, Boon-Seng
2013-08-09
Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) and this can be contributed by aberrant metabolic enzyme function. But, the mechanism causing this enzymatic impairment is unclear. Amyloid precursor protein (APP) is known to be alternatively spliced to produce three major isoforms in the brain (APP695, APP751, APP770). Both APP770 and APP751 contain the Kunitz Protease Inhibitory (KPI) domain, but the former also contain an extra OX-2 domain. APP695 on the other hand, lacks both domains. In AD, up-regulation of the KPI-containing APP isoforms has been reported. But the functional contribution of this elevation is unclear. In the present study, we have expressed and compared the effect of the non-KPI containing APP695 and the KPI-containing APP751 on mitochondrial function. We found that the KPI-containing APP751 significantly decreased the expression of three major mitochondrial metabolic enzymes; citrate synthase, succinate dehydrogenase and cytochrome c oxidase (COX IV). This reduction lowers the NAD(+)/NADH ratio, COX IV activity and mitochondrial membrane potential. Overall, this study demonstrated that up-regulation of the KPI-containing APP isoforms is likely to contribute to the impairment of metabolic enzymes and mitochondrial function in AD. Copyright © 2013 Elsevier Inc. All rights reserved.
Effect of Pulsed Electric Field on Membrane Lipids and Oxidative Injury of Salmonella typhimurium
Yun, Ou; Zeng, Xin-An; Brennan, Charles S.; Han, Zhong
2016-01-01
Salmonella typhimurium cells were subjected to pulsed electric field (PEF) treatment at 25 kV/cm for 0–4 ms to investigate the effect of PEF on the cytoplasmic membrane lipids and oxidative injury of cells. Results indicated that PEF treatment induced a decrease of membrane fluidity of Salmonella typhimurium (S. typhimuriumi), possibly due to the alterations of fatty acid biosynthesis-associated gene expressions (down-regulation of cfa and fabA gene expressions and the up-regulation of fabD gene expression), which, in turn, modified the composition of membrane lipid (decrease in the content ratio of unsaturated fatty acids to saturated fatty acids). In addition, oxidative injury induced by PEF treatment was associated with an increase in the content of malondialdehyde. The up-regulation of cytochrome bo oxidase gene expressions (cyoA, cyoB, and cyoC) indicated that membrane damage was induced by PEF treatment, which was related to the repairing mechanism of alleviating the oxidative injury caused by PEF treatment. Based on these results, we achieved better understanding of microbial injury induced by PEF, suggesting that micro-organisms tend to decrease membrane fluidity in response to PEF treatment and, thus, a greater membrane fluidity might improve the efficiency of PEF treatment to inactivate micro-organisms. PMID:27556460
Zhu, Pingjun; Hu, Shunying; Jin, Qinhua; Li, Dandan; Tian, Feng; Toan, Sam; Li, Yang; Zhou, Hao; Chen, Yundai
2018-06-01
Receptor-interacting protein 3 (Ripk3)-mediated necroptosis contributes to cardiac ischaemia-reperfusion (IR) injury through poorly defined mechanisms. Our results demonstrated that Ripk3 was strongly upregulated in murine hearts subjected to IR injury and cardiomyocytes treated with LPS and H 2 O 2 . The higher level of Ripk3 was positively correlated to the infarction area expansion, cardiac dysfunction and augmented cardiomyocytes necroptosis. Function study further illustrated that upregulated Ripk3 evoked the endoplasmic reticulum (ER) stress, which was accompanied with an increase in intracellular Ca 2+ level ([Ca 2+ ]c) and xanthine oxidase (XO) expression. Activated XO raised cellular reactive oxygen species (ROS) that mediated the mitochondrial permeability transition pore (mPTP) opening and cardiomyocytes necroptosis. By comparison, genetic ablation of Ripk3 abrogated the ER stress and thus blocked the [Ca 2+ ]c overload-XO-ROS-mPTP pathways, favouring a pro-survival state that ultimately resulted in the inhibition of cardiomyocytes necroptosis in the setting of cardiac IR injury. In summary, the present study helps to elucidate how necroptosis is mediated by ER stress, via the calcium overload /XO/ROS/mPTP opening axis. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
INCREASING PROTEIN STABILITY BY IMPROVING BETA-TURNS
Fu, Hailong; Grimsley, Gerald R.; Razvi, Abbas; Scholtz, J. Martin; Pace, C. Nick
2009-01-01
Our goal was to gain a better understanding of how protein stability can be increased by improving β-turns. We studied 22 β-turns in nine proteins with 66 to 370 residues by replacing other residues with proline and glycine and measuring the stability. These two residues are statistically preferred in some β-turn positions. We studied: Cold shock protein B (CspB), Histidine-containing phosphocarrier protein (HPr), Ubiquitin, Ribonucleases Sa2, Sa3, T1, and HI, Tryptophan synthetase α-subunit (TSα), and Maltose binding protein (MBP). Of the fifteen single proline mutations, 11increased stability (Average = 0.8 ± 0.3; Range = 0.3 – 1.5 kcal/mol), and the stabilizing effect of double proline mutants was additive. Based on this and our previous work, we conclude that proteins can generally be stabilized by replacing non-proline residues with proline residues at the i + 1 position of Type I and II β-turns and at the i position in Type II β-turns. Other turn positions can sometimes be used if the φ angle is near −60° for the residue replaced. It is important that the side chain of the residue replaced is less than 50% buried. Identical substitutions in β-turns in related proteins give similar results. Proline substitutions increase stability mainly by decreasing the entropy of the denatured state. In contrast, the large, diverse group of proteins considered here had almost no residues in β-turns that could be replaced by Gly to increase protein stability. Improving β-turns by substituting Pro residues is a generally useful way of increasing protein stability. PMID:19626709
A Statistical Analysis of the PPII Propensity of Amino Acid Guests in Proline-Rich Peptides
Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher
2011-01-01
There has been considerable debate about the intrinsic PPII propensity of amino-acid residues in denatured polypeptides. Experimentally, the propensity scale is based on the behavior of guest amino-acid residues placed in the middle of polyproline hosts. We have used classical molecular dynamics simulations, with state-of-the-art force fields to carry out a comprehensive analysis of the conformational equilibria of the proline-based host oligopeptides with single guests. The tracked structural characteristics include the PPII content, the cis/trans isomerization of the prolyl bonds, the puckering of the pyrrolidine rings of the proline residues, and the secondary structural motifs. We find no evidence for an intrinsic PPII propensity in any of the guest amino acids other than proline. Instead, the PPII content as derived from experiments may be explained in terms of: 1), a local correlation between the dihedral angles of the guest amino acid and the proline residue immediately preceding it; and 2), a nonlocal correlation between the cis/trans states of the peptide bonds. In terms of the latter, we find that the presence of a guest (other than proline, tyrosine, or tryptophan) increases the trans content of most of the prolyl bonds, which results in an effective increase of the peptide PPII content. With respect to the local dihedral correlations, we find that these are well described in terms of the so-called odds-ratio statistic. Expressed in terms of free energy language, the PPII content based on the odds-ratio of the relevant residues correlate well with the experimentally measured PPII content. PMID:21320454
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Naidu, Bodapati P.; Aspinall, Donald; Paleg, Leslie G.
1992-01-01
This work was undertaken in an effort to reconcile the conflicting proline-accumulating responses of the barley (Hordeum vulgare L.) cultivars, Excelsior and Proctor, reported by Singh et al. (1972) and Hanson et al. (1976). It deals with the effects of different vapor pressure deficits (VPD) during growth and subsequent drought stress on several barley cultivars. A higher VPD (1.2 kilopascals) during Clipper seedling growth resulted in higher solute-accumulating ability, seemingly independently of leaf water potential, than a lower VPD (0.12 kilopascals). The higher VPD during stress also resulted in higher solute contents, and this response may be more closely related to leaf water potential. When the responses of Excelsior and Proctor were examined in detail, it was found that the relative proline-accumulating ability of the two cultivars was dependent upon the VPD under which they were grown. At low VPD, Proctor accumulated significantly more proline than did Excelsior; whereas at higher VPD, Excelsior accumulated more proline than did Proctor. The crossover occurred at a VPD of about 0.72 kilopascals. This reversal of cultivar response was enhanced by multiplying seed under the two VPD extremes. Glycinebetaine accumulation did not demonstrate the crossover effect, although the concentration of this compound in all cultivars also depended on the VPD prevailing during growth and/or stress. Solute levels, in general, were more closely related to the decrease in relative water content than to a decrease in leaf water potential. It is concluded that the conflicting proline-accumulating responses of Excelsior and Proctor could be explained by these findings. PMID:16668700
Reorientation Motion and Preferential Interactions of a Peptide in Denaturants and Osmolyte.
Jas, Gouri S; Rentchler, Eric C; Słowicka, Agnieszka M; Hermansen, John R; Johnson, Carey K; Middaugh, C Russell; Kuczera, Krzysztof
2016-03-31
Fluorescence anisotropy decay measurements and all atom molecular dynamics simulations are used to characterize the orientational motion and preferential interaction of a peptide, N-acetyl-tryptophan-amide (NATA) containing two peptide bonds, in aqueous, urea, guanidinium chloride (GdmCl), and proline solution. Anisotropy decay measurements as a function of temperature and concentration showed moderate slowing of reorientations in urea and GdmCl and very strong slowing in proline solution, relative to water. These effects deviate significantly from simple proportionality of peptide tumbling time to solvent viscosity, leading to the investigation of microscopic preferential interaction behavior through molecular dynamics simulations. Examination of the interactions of denaturants and osmolyte with the peptide backbone uncovers the presence of strongest interaction with urea, intermediate with proline, and weakest with GdmCl. In contrast, the strongest preferential solvation of the peptide side chain is by the nonpolar part of the proline zwitterion, followed by urea, and GdmCl. Interestingly, the local density of urea around the side chain is higher, but the GdmCl distribution is more organized. Thus, the computed preferential solvation of the side chain by the denaturants and osmolyte can account for the trend in reorientation rates. Analysis of water structure and its dynamics uncovered underlying differences between urea, GdmCl, and proline. Urea exerted the smallest perturbation of water behavior. GdmCl had a larger effect on water, slowing kinetics and stabilizing interactions. Proline had the largest overall interactions, exhibiting a strong stabilizing effect on both water-water and water-peptide hydrogen bonds. The results for this elementary peptide system demonstrate significant differences in microscopic behavior of the examined solvent environments. For the commonly used denaturants, urea tends to form disorganized local aggregates around the peptide groups and has little influence on water, while GdmCl only forms specific interactions with the side chain and tends to destabilize water structure. The protective osmolyte proline has the strongest and most specific interactions with the tryptophan side chain, and also stabilizes both water-water and water-peptide hydrogen bonds. Our results strongly suggest protein or peptide denaturation triggered by urea occurs by direct interaction, whereas GdmCl interacts favorably with side chains and destabilizes peptide-water hydrogen bonds. The stabilization of biopolymers by an osmolyte such as proline is governed by favorable preferential interaction with the side chains and stabilization of water.
Martínez-Revelles, Sonia; García-Redondo, Ana B; Avendaño, María S; Varona, Saray; Palao, Teresa; Orriols, Mar; Roque, Fernanda R; Fortuño, Ana; Touyz, Rhian M; Martínez-González, Jose; Salaices, Mercedes; Rodríguez, Cristina; Briones, Ana M
2017-09-01
Vascular stiffness, structural elastin abnormalities, and increased oxidative stress are hallmarks of hypertension. Lysyl oxidase (LOX) is an elastin crosslinking enzyme that produces H 2 O 2 as a by-product. We addressed the interplay between LOX, oxidative stress, vessel stiffness, and elastin. Angiotensin II (Ang II)-infused hypertensive mice and spontaneously hypertensive rats (SHR) showed increased vascular LOX expression and stiffness and an abnormal elastin structure. Mice over-expressing LOX in vascular smooth muscle cells (TgLOX) exhibited similar mechanical and elastin alterations to those of hypertensive models. LOX inhibition with β-aminopropionitrile (BAPN) attenuated mechanical and elastin alterations in TgLOX mice, Ang II-infused mice, and SHR. Arteries from TgLOX mice, Ang II-infused mice, and/or SHR exhibited increased vascular H 2 O 2 and O 2 .- levels, NADPH oxidase activity, and/or mitochondrial dysfunction. BAPN prevented the higher oxidative stress in hypertensive models. Treatment of TgLOX and Ang II-infused mice and SHR with the mitochondrial-targeted superoxide dismutase mimetic mito-TEMPO, the antioxidant apocynin, or the H 2 O 2 scavenger polyethylene glycol-conjugated catalase (PEG-catalase) reduced oxidative stress, vascular stiffness, and elastin alterations. Vascular p38 mitogen-activated protein kinase (p38MAPK) activation was increased in Ang II-infused and TgLOX mice and this effect was prevented by BAPN, mito-TEMPO, or PEG-catalase. SB203580, the p38MAPK inhibitor, normalized vessel stiffness and elastin structure in TgLOX mice. We identify LOX as a novel source of vascular reactive oxygen species and a new pathway involved in vascular stiffness and elastin remodeling in hypertension. LOX up-regulation is associated with enhanced oxidative stress that promotes p38MAPK activation, elastin structural alterations, and vascular stiffness. This pathway contributes to vascular abnormalities in hypertension. Antioxid. Redox Signal. 27, 379-397.
Martínez-Revelles, Sonia; García-Redondo, Ana B.; Avendaño, María S.; Varona, Saray; Palao, Teresa; Orriols, Mar; Roque, Fernanda R.; Fortuño, Ana; Touyz, Rhian M.; Martínez-González, Jose; Salaices, Mercedes
2017-01-01
Abstract Aims: Vascular stiffness, structural elastin abnormalities, and increased oxidative stress are hallmarks of hypertension. Lysyl oxidase (LOX) is an elastin crosslinking enzyme that produces H2O2 as a by-product. We addressed the interplay between LOX, oxidative stress, vessel stiffness, and elastin. Results: Angiotensin II (Ang II)-infused hypertensive mice and spontaneously hypertensive rats (SHR) showed increased vascular LOX expression and stiffness and an abnormal elastin structure. Mice over-expressing LOX in vascular smooth muscle cells (TgLOX) exhibited similar mechanical and elastin alterations to those of hypertensive models. LOX inhibition with β-aminopropionitrile (BAPN) attenuated mechanical and elastin alterations in TgLOX mice, Ang II-infused mice, and SHR. Arteries from TgLOX mice, Ang II-infused mice, and/or SHR exhibited increased vascular H2O2 and O2.− levels, NADPH oxidase activity, and/or mitochondrial dysfunction. BAPN prevented the higher oxidative stress in hypertensive models. Treatment of TgLOX and Ang II-infused mice and SHR with the mitochondrial-targeted superoxide dismutase mimetic mito-TEMPO, the antioxidant apocynin, or the H2O2 scavenger polyethylene glycol-conjugated catalase (PEG-catalase) reduced oxidative stress, vascular stiffness, and elastin alterations. Vascular p38 mitogen-activated protein kinase (p38MAPK) activation was increased in Ang II-infused and TgLOX mice and this effect was prevented by BAPN, mito-TEMPO, or PEG-catalase. SB203580, the p38MAPK inhibitor, normalized vessel stiffness and elastin structure in TgLOX mice. Innovation: We identify LOX as a novel source of vascular reactive oxygen species and a new pathway involved in vascular stiffness and elastin remodeling in hypertension. Conclusion: LOX up-regulation is associated with enhanced oxidative stress that promotes p38MAPK activation, elastin structural alterations, and vascular stiffness. This pathway contributes to vascular abnormalities in hypertension. Antioxid. Redox Signal. 27, 379–397. PMID:28010122
Aldosterone stimulates superoxide production in macula densa cells.
Zhu, Xiaolong; Manning, R Davis; Lu, Deyin; Gomez-Sanchez, Celso E; Fu, Yiling; Juncos, Luis A; Liu, Ruisheng
2011-09-01
Two major factors which regulate tubuloglomerular feedback (TGF)-mediated constriction of the afferent arteriole are release of superoxide (O(2)(-)) and nitric oxide (NO) by macula densa (MD) cells. MD O(2)(-) inactivates NO; however, among the factors that increase MD O(2)(-) release, the role of aldosterone is unclear. We hypothesize that aldosterone activates the mineralocorticoid receptor (MR) on MD cells, resulting in increased O(2)(-) production due to upregulation of cyclooxygenase-1 (COX-2) and NOX-2, and NOX-4, isoforms of NAD(P)H oxidase. Studies were performed on MMDD1 cells, a renal epithelial cell line with properties of MD cells. RT-PCR and Western blotting confirmed the expression of MR. Aldosterone (10(-8) mol/l for 30 min) doubled MMDD1 cell O(2)(-) production, and this was completely blocked by MR inhibition with 10(-5) mol/l eplerenone. RT-PCR, real-time PCR, and Western blotting demonstrated aldosterone-induced increases in COX-2, NOX-2, and NOX-4 expression. Inhibition of COX-2 (NS398), NADPH oxidase (apocynin), or a combination blocked aldosterone-induced O(2)(-) production to the same degree. These data suggest that aldosterone-stimulated MD O(2)(-) production is mediated by COX-2 and NADPH oxidase. Next, COX-2 small-interfering RNA (siRNA) specifically decreased COX-2 mRNA without affecting NOX-2 or NOX-4 mRNAs. In the presence of the COX-2 siRNA, the aldosterone-induced increases in COX-2, NOX-2, and NOX-4 mRNAs and O(2)(-) production were completely blocked, suggesting that COX-2 causes increased expression of NOX-2 and NOX-4. In conclusion 1) MD cells express MR; 2) aldosterone increases O(2)(-) production by activating MR; and 3) aldosterone stimulates COX-2, which further activates NOX-2 and NOX-4 and generates O(2)(-). The resulting balance between O(2)(-) and NO in the MD is important in modulating TGF.
CYP714B1 and CYP714B2 encode gibberellin 13-oxidases that reduce gibberellin activity in rice.
Magome, Hiroshi; Nomura, Takahito; Hanada, Atsushi; Takeda-Kamiya, Noriko; Ohnishi, Toshiyuki; Shinma, Yuko; Katsumata, Takumi; Kawaide, Hiroshi; Kamiya, Yuji; Yamaguchi, Shinjiro
2013-01-29
Bioactive gibberellins (GAs) control many aspects of growth and development in plants. GA(1) has been the most frequently found bioactive GA in various tissues of flowering plants, but the enzymes responsible for GA(1) biosynthesis have not been fully elucidated due to the enzymes catalyzing the 13-hydroxylation step not being identified. Because of the lack of mutants defective in this enzyme, biological significance of GA 13-hydroxylation has been unknown. Here, we report that two cytochrome P450 genes, CYP714B1 and CYP714B2, encode GA 13-oxidase in rice. Transgenic Arabidopsis plants that overexpress CYP714B1 or CYP714B2 show semidwarfism. There was a trend that the levels of 13-OH GAs including GA(1) were increased in these transgenic plants. Functional analysis using yeast or insect cells shows that recombinant CYP714B1 and CYP714B2 proteins can convert GA(12) into GA(53) (13-OH GA(12)) in vitro. Moreover, the levels of 13-OH GAs including GA(1) were decreased, whereas those of 13-H GAs including GA(4) (which is more active than GA(1)) were increased, in the rice cyp714b1 cyp714b2 double mutant. These results indicate that CYP714B1 and CYP714B2 play a predominant role in GA 13-hydroxylation in rice. The double mutant plants appear phenotypically normal until heading, but show elongated uppermost internode at the heading stage. Moreover, CYP714B1 and CYP714B2 expression was up-regulated by exogenous application of bioactive GAs. Our results suggest that GA 13-oxidases play a role in fine-tuning plant growth by decreasing GA bioactivity in rice and that they also participate in GA homeostasis.
Liu, Hong-tao; Wang, Jun; Mao, Yong; Liu, Min; Niu, Su-fang; Qiao, Ying; Su, Yong-quan; Wang, Chun-zhong; Zheng, Zhi-peng
2015-12-01
Antimicrobial peptides (AMPs) are important components of the innate immune system and function as the first line of defense against invading pathogens. In current study we identified, cloned and characterized a novel stylicin AMP from Kuruma shrimp Marsupenaeus japonicus (Mj-sty). The full-length cDNA of Mj-sty was 428 bp with an open reading frame of 315 bp that encoded 104 amino acids. The theoretical molecular mass of mature Mj-sty was 8.693 kDa with an isoelectric point (pI) of 4.79. A proline-rich N-terminal region and a C-terminal region contained 13 cysteine residues were identified. Genomic sequence analysis with respect to its cDNA showed that Mj-sty was organized into two exons interrupted by one intron. Tissue-specific expression revealed that Mj-sty was mainly transcribed in gills and hemocytes. Expression of Mj-sty in early developmental stages demonstrated that Mj-sty mRNA were present from fertilized eggs to post-larvae of 17 days (PL17), and the expression levels showed a significant variation in different developmental stages. After challenge of white spot syndrome virus (WSSV), the time-dependent expression pattern of Mj-sty in both gills and hepatopancrease showed down-regulation at the early hours of infection, subsequently up-regulation and down-regulation, and then up-regulation at the end hours to almost the half of the controls. The results indicate that Mj-sty is potentially involved in the ontogenesis and immune responses against WSSV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Rong, Liping; Li, Qianzhong; Li, Shushun; Tang, Ling; Wen, Jing
2016-04-01
Maple (Acer palmatum) is an important species for landscape planting worldwide. Salt stress affects the normal growth of the Maple leaf directly, leading to loss of esthetic value. However, the limited availability of Maple genomic information has hindered research on the mechanisms underlying this tolerance. In this study, we performed comprehensive analyses of the salt tolerance in two genotypes of Maple using RNA-seq. Approximately 146.4 million paired-end reads, representing 181,769 unigenes, were obtained. The N50 length of the unigenes was 738 bp, and their total length over 102.66 Mb. 14,090 simple sequence repeats and over 500,000 single nucleotide polymorphisms were identified, which represent useful resources for marker development. Importantly, 181,769 genes were detected in at least one library, and 303 differentially expressed genes (DEGs) were identified between salt-sensitive and salt-tolerant genotypes. Among these DEGs, 125 were upregulated and 178 were downregulated genes. Two MYB-related proteins and one LEA protein were detected among the first 10 most downregulated genes. Moreover, a methyltransferase-related gene was detected among the first 10 most upregulated genes. The three most significantly enriched pathways were plant hormone signal transduction, arginine and proline metabolism, and photosynthesis. The transcriptome analysis provided a rich genetic resource for gene discovery related to salt tolerance in Maple, and in closely related species. The data will serve as an important public information platform to further our understanding of the molecular mechanisms involved in salt tolerance in Maple.
Effect of proline kinks on the mechanical unfolding of α-helices
NASA Astrophysics Data System (ADS)
Arteca, Gustavo A.; Li, Zhiying
2004-12-01
Proteins unfold by applying an external force, although the microscopic mechanism is still not well understood. In this work, we use steered molecular dynamics to probe fundamental aspects of the stretching transition of α-helices, in particular how proline kinks and side chain dynamics would influence their ability to resist the applied force. We find that proline residues effectively 'cut' a helix in half when introduced on stable homopolymers, whereas their effect is smaller when present in helices that are more easily deformed. Our findings provide insight into the factors that may regulate the mechanical stretching of realistic protein domains.
Randomized Subspace Learning for Proline Cis-Trans Isomerization Prediction.
Al-Jarrah, Omar Y; Yoo, Paul D; Taha, Kamal; Muhaidat, Sami; Shami, Abdallah; Zaki, Nazar
2015-01-01
Proline residues are common source of kinetic complications during folding. The X-Pro peptide bond is the only peptide bond for which the stability of the cis and trans conformations is comparable. The cis-trans isomerization (CTI) of X-Pro peptide bonds is a widely recognized rate-limiting factor, which can not only induces additional slow phases in protein folding but also modifies the millisecond and sub-millisecond dynamics of the protein. An accurate computational prediction of proline CTI is of great importance for the understanding of protein folding, splicing, cell signaling, and transmembrane active transport in both the human body and animals. In our earlier work, we successfully developed a biophysically motivated proline CTI predictor utilizing a novel tree-based consensus model with a powerful metalearning technique and achieved 86.58 percent Q2 accuracy and 0.74 Mcc, which is a better result than the results (70-73 percent Q2 accuracies) reported in the literature on the well-referenced benchmark dataset. In this paper, we describe experiments with novel randomized subspace learning and bootstrap seeding techniques as an extension to our earlier work, the consensus models as well as entropy-based learning methods, to obtain better accuracy through a precise and robust learning scheme for proline CTI prediction.
Mathieu, Christoph; González Salgado, Amaia; Wirdnam, Corina; Meier, Stefan; Grotemeyer, Marianne Suter; Inbar, Ehud; Mäser, Pascal; Zilberstein, Dan; Sigel, Erwin; Bütikofer, Peter; Rentsch, Doris
2014-10-01
Amino acid transporters are crucial for parasite survival since the cellular metabolism of parasitic protozoa depends on the up-take of exogenous amino acids. Amino acid transporters are also of high pharmacological relevance because they may mediate uptake of toxic amino acid analogues. In the present study we show that the eflornithine transporter AAT6 from Trypanosoma brucei (TbAAT6) mediates growth on neutral amino acids when expressed in Saccharomyces cerevisiae mutants. The transport was electrogenic and further analysed in Xenopus laevis oocytes. Neutral amino acids, proline analogues, eflornithine and acivicin induced inward currents. For proline, glycine and tryptophan the apparent affinities and maximal transport rates increased with more negative membrane potentials. Proline-induced currents were dependent on pH, but not on sodium. Although proline represents the primary energy source of T. brucei in the tsetse fly, down-regulation of TbAAT6-expression by RNAi showed that in culture TbAAT6 is not essential for growth of procyclic form trypanosomes in the presence of glucose or proline as energy source. TbAAT6-RNAi lines of both bloodstream and procyclic form trypanosomes showed reduced susceptibility to eflornithine, whereas the sensitivity to acivicin remained unchanged, indicating that acivicin enters the cell by more than one transporter.
Lambhod, Chanderkala; Pathak, Ankita; Munjal, Ashok K.
2017-01-01
ABSTRACT Plastic responses to multiple environmental stressors in wet or dry seasonal populations of tropical Drosophila species have received less attention. We tested plastic effects of heat hardening, acclimation to drought or starvation, and changes in trehalose, proline and body lipids in Drosophila ananassae flies reared under wet or dry season-specific conditions. Wet season flies revealed significant increase in heat knockdown, starvation resistance and body lipids after heat hardening. However, accumulation of proline was observed only after desiccation acclimation of dry season flies while wet season flies elicited no proline but trehalose only. Therefore, drought-induced proline can be a marker metabolite for dry-season flies. Further, partial utilization of proline and trehalose under heat hardening reflects their possible thermoprotective effects. Heat hardening elicited cross-protection to starvation stress. Stressor-specific accumulation or utilization as well as rates of metabolic change for each energy metabolite were significantly higher in wet-season flies than dry-season flies. Energy metabolite changes due to inter-related stressors (heat versus desiccation or starvation) resulted in possible maintenance of energetic homeostasis in wet- or dry-season flies. Thus, low or high humidity-induced plastic changes in energy metabolites can provide cross-protection to seasonally varying climatic stressors. PMID:29141954
NASA Astrophysics Data System (ADS)
Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.
2017-11-01
Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken together, our findings provide a secure basis for the RPL gene family expression as a potential resource for exploring abiotic stress tolerant properties in rice.
Proinflammatory Activity of a Cecropin-Like Antibacterial Peptide from Helicobacter pylori
Bylund, Johan; Christophe, Thierry; Boulay, Francois; Nyström, Thomas; Karlsson, Anna; Dahlgren, Claes
2001-01-01
Helicobacter pylori, the bacterial pathogen associated with gastritis and peptic ulcers, is highly successful in establishing infection in the human gastric mucosa, a process typically associated with massive infiltration of inflammatory cells. Colonization of the mucosa is suggested to be facilitated by H. pylori-produced cecropin-like peptides with antibacterial properties, giving the microbe a competitive advantage over other bacteria. We show that a cecropin-like antibacterial peptide from H. pylori, Hp(2-20), not only has a potent bactericidal effect but also induces proinflammatory activities in human neutrophils, e.g., upregulation of integrins (Mac-1), induction of chemotaxis, and activation of the oxygen radical producing NADPH-oxidase. Furthermore, we show that these effects are mediated through binding of Hp(2-20) to the promiscuous, G-protein-linked lipoxin A4 receptor–formyl peptide-like receptor 1. PMID:11353614
Isolation of cis-3-Amino-l-Proline from Cultured Mycelia of Morchella esculenta Fr
Moriguchi, Mitsuaki; Sada, Shin-Ichi; Hatanaka, Shin-Ichi
1979-01-01
cis-3-Amino-l-proline, identified once as a nonprotein amino acid from the fruiting bodies of Morchella esculenta Fr., was isolated also from the growth medium and cultured mycelia of the same fungus. PMID:16345456
Synthesis of aryl azides and vinyl azides via proline-promoted CuI-catalyzed coupling reactions.
Zhu, Wei; Ma, Dawei
2004-04-07
The coupling reaction of aryl halides or vinyl iodide with sodium azide under catalysis of CuI/L-proline works at relatively low temperature to provide aryl azides or vinyl azides in good to excellent yields.
Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam
2014-01-01
The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040
Sun, Min; Gao, ZhiQiang; Zhao, WeiFeng; Deng, LianFeng; Deng, Yan; Zhao, HongMei; Ren, AiXia; Li, Gang; Yang, ZhenPing
2013-01-01
To provide a new way to increase water storage and retention of dryland wheat, a field study was conducted at Wenxi experimental site of Shanxi Agricultural University. The effect of subsoiling in fallow period on soil water storage, accumulation of proline, and formation of grain protein after anthesis were determined. Our results showed that subsoiling in fallow period could increase water storage in the 0-300 cm soil at pre-sowing stage and at anthesis stage with low or medium N application, especially for the 60-160 cm soil. However, the proline content, glutamine synthetase (GS) activity, glutamate dehydrogenase (GDH) activity in flag leaves and grains were all decreased by subsoiling in fallow period. In addition, the content of albumin, gliadin, and total protein in grains were also decreased while globulin content, Glu/Gli, protein yield, and glutelin content were increased. With N application increasing, water storage of soil layers from 20 to 200 cm was decreased at anthesis stage. High N application resulted in the increment of proline content and GS activity in grains. Besides, correlation analysis showed that soil storage in 40-160 cm soil was negatively correlated with proline content in grains; proline content in grains was positively correlated with GS and GDH activity in flag leaves. Contents of albumin, globulin and total protein in grains were positively correlated with proline content in grains and GDH activity in flag leaves. In conclusion, subsoiling in fallow period, together with N application at 150 kg·hm(-2), was beneficial to increase the protein yield and Glu/Gli in grains which improve the quality of wheat.
Ali, Qasim; Anwar, Farooq; Ashraf, Muhammad; Saari, Nazamid; Perveen, Rashida
2013-01-01
This study was carried out to appraise whether or not the exogenous application of a potential osmoprotectant, proline, could ameliorate the adverse effects of drought stress on maize seed and seed oil composition, as well as oil antioxidant activity. Water stress reduced the kernel sugar, oil, protein and moisture contents and most of the seed macro- and micro-elements analyzed in both maize cultivars but it increased the contents of seed fiber and ash. Water stress increased the oil oleic acid content with a subsequent decrease in the amount of linoleic acid, resulting in an increased oil oleic/linoleic ratio for both maize cultivars. However, no variation was observed in oil stearic and palmitic acids content due to water stress. A considerable drought induced an increase in seed oil α-, γ-, δ- and total tocopherols and flavonoids were observed in both maize cultivars. However, oil phenolic and carotenoid content as well as 1,1-diphenyl-2-picryl-hydrazyl (DPPH) free radical scavenging activity decreased. Foliar-applied proline significantly increased the content of seed sugar, oil, protein, moisture, fiber and ash in both maize cultivars under well irrigated and water deficit conditions. Furthermore, exogenous application of proline increased the oil oleic and linoleic acid contents. The concentrations of antioxidant compounds namely phenolics, carotenoids, flavonoids and tocopherols estimated in the seed oil increased due to foliar-applied proline under water deficit conditions that was positively correlated with the enhanced oil DPPH free radical scavenging activity. Moreover, the increase in the contents of these antioxidant compounds and oil antioxidant activity due to the foliar application of proline was noted to be more pronounced under water deficit conditions. PMID:23344043
Biosynthesis of the nargenicin A1 pyrrole moiety from Nocardia sp. CS682.
Maharjan, Sushila; Aryal, Niraj; Bhattarai, Saurabh; Koju, Dinesh; Lamichhane, Janardan; Sohng, Jae Kyung
2012-01-01
A number of structurally diverse natural products harboring pyrrole moieties possess a wide range of biological activities. Studies on biosynthesis of pyrrole ring have shown that pyrrole moieties are derived from L-proline. Nargenicin A(1), a saturated alicyclic polyketide from Nocardia sp. CS682, is a pyrrole-2-carboxylate ester of nodusmicin. We cloned and identified a set of four genes from Nocardia sp. CS682 that show sequence similarity to the respective genes involved in the biosynthesis of the pyrrole moieties of pyoluteorin in Pseudomonas fluorescens, clorobiocin in Streptomyces roseochromogenes subsp. Oscitans, coumermycin A(1) in Streptomyces rishiriensis, one of the pyrrole rings of undecylprodigiosin in Streptomyces coelicolor, and leupyrrins in Sorangium cellulosum. These genes were designated as ngnN4, ngnN5, ngnN3, and ngnN2. In this study, we presented the evidences that the pyrrole moiety of nargenicin A(1) was also derived from L-proline by the coordinated action of three proteins, NgnN4 (proline adenyltransferase), NgnN5 (proline carrier protein), and NgnN3 (flavine-dependent acyl-coenzyme A dehydrogenases). Biosynthesis of pyrrole moiety in nargenicin A(1) is initiated by NgnN4 that catalyzes ATP-dependent activation of L-proline into L-prolyl-AMP, and the latter is transferred to NgnN5 to create prolyl-S-peptidyl carrier protein (PCP). Later, NgnN3 catalyzes the two-step oxidation of prolyl-S-PCP into pyrrole-2-carboxylate. Thus, this study presents another example of a pyrrole moiety biosynthetic pathway that uses a set of three genes to convert L-proline into pyrrole-2-carboxylic acid moiety.
Gupta, Pratibha; Sharma, Satyawati; Saxena, Sanjay
2015-06-01
Enhanced production of steviol glycosides (SGs) was observed in callus and suspension culture of Stevia rebaudiana treated with proline and polyethylene glycol (PEG). To study their effect, yellow-green and compact calli obtained from in vitro raised Stevia leaves were sub-cultured on MS medium supplemented with 2.0 mg l(-1) NAA and different concentrations of proline (2.5-10 mM) and PEG (2.5-10 %) for 2 weeks, and incubated at 24 ± 1 °C and 22.4 μmol m(-2) s(-1) light intensity provided by white fluorescent tubes for 16 h. Callus and suspension culture biomass (i.e. both fresh and dry weight content) was increased with 5 mM proline and 5 % PEG, while at further higher concentrations, they got reduced. Further, quantification of SGs content in callus (collected at 15th day) and suspension culture (collected at 10th and 15th day) treated with and without elicitors was analysed by HPLC. It was observed that chemical stress enhanced the production of SGs significantly. In callus, the content of SGs increased from 0.27 (control) to 1.09 and 1.83 % with 7.5 mM proline and 5 % PEG, respectively, which was about 4.0 and 7.0 times higher than control. However, in the case of suspension culture, the same concentrations of proline and polyethylene glycol enhanced the SG content from 1.36 (control) to 5.03 and 6.38 %, respectively, on 10th day which were 3.7 times and 4.7 times higher than control.
A statistical analysis of the PPII propensity of amino acid guests in proline-rich peptides.
Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher
2011-02-16
There has been considerable debate about the intrinsic PPII propensity of amino-acid residues in denatured polypeptides. Experimentally, the propensity scale is based on the behavior of guest amino-acid residues placed in the middle of polyproline hosts. We have used classical molecular dynamics simulations, with state-of-the-art force fields to carry out a comprehensive analysis of the conformational equilibria of the proline-based host oligopeptides with single guests. The tracked structural characteristics include the PPII content, the cis/trans isomerization of the prolyl bonds, the puckering of the pyrrolidine rings of the proline residues, and the secondary structural motifs. We find no evidence for an intrinsic PPII propensity in any of the guest amino acids other than proline. Instead, the PPII content as derived from experiments may be explained in terms of: 1), a local correlation between the dihedral angles of the guest amino acid and the proline residue immediately preceding it; and 2), a nonlocal correlation between the cis/trans states of the peptide bonds. In terms of the latter, we find that the presence of a guest (other than proline, tyrosine, or tryptophan) increases the trans content of most of the prolyl bonds, which results in an effective increase of the peptide PPII content. With respect to the local dihedral correlations, we find that these are well described in terms of the so-called odds-ratio statistic. Expressed in terms of free energy language, the PPII content based on the odds-ratio of the relevant residues correlate well with the experimentally measured PPII content. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Glaves, Rachel; Baer, Marcel; Schreiner, Eduard; Stoll, Raphael; Marx, Dominik
2008-12-22
Previous molecular dynamics studies of the elastin-like peptide (ELP) GVG(VPGVG) predict that this ELP undergoes a conformational transition from an open to a more compact closed state upon an increase in temperature. These structural changes occurring in this minimal elastin model at the so-called inverse temperature transition (ITT), which takes place when elastin is heated to temperatures of about 20-40 (omicron)C, are investigated further in this work by means of a combined theoretical and experimental approach. To do this, additional extensive classical molecular dynamics (MD) simulations of the capped octapeptide are carried out, analyzed, and compared to data obtained from homonuclear magnetic resonance (NMR) spectroscopy of the same octapeptide. Moreover, in the previous simulations, the proline residue in the ELP is found to act as a hinge, thereby allowing for the large-amplitude opening and closing conformational motion of the ITT. To explore the role of proline in such elastin repeating units, a point mutant (P5I), which replaces the proline residue with an isoleucine residue, is also investigated using the aforementioned theoretical and experimental techniques. The results show that the site-directed mutation completely alters the properties of this ELP, thus confirming the importance of the highly conserved proline residue in the ITT. Furthermore, a correlation between the two different methods employed is seen. Both methods predict the mutant ELP to be present in an unstructured form and the wild type ELP to have a beta-turn-like structure. Finally, the role of the peptidyl cis to trans isomerization of the proline hinge is assessed in detail.
Min, Jun Zhe; Toyo'oka, Toshimasa; Kato, Masaru; Fukushima, Takeshi
2005-01-01
DBD-d(and l)-beta-proline, new fluorescent chiral derivatization reagents, were synthesized from the reaction of 4-(N,N-dimethylaminosulfonyl)-7- fl uoro-2,1,3-benzoxadiazole (DBD-F) with beta-proline. The racemic mixture synthesized was separated by a chiral stationary phase (CSP) column, Chiralpak AD-H, with n-hexane-EtOH-TFA-diethylamine (70:30:0.1:0.1) as the mobile phase. The dl-forms were decided according to the results obtained from a circular dichroism (CD) detector after separation by the CSP column. The fractionated enantiomers reacted with chiral amine to produce a couple of diastereomers. The labeling proceeded in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and pyridine as the activation reagents. The reaction conditions were mild and no racemization occurred during the diastereomer formation. The resulting diastereomers fluoresced at around 570 nm (excitation at around 460 nm). Good linearity of the calibration curves was obtained in the range 1-75 pmol and the detection limits on chromatogram were less than 1 pmol. The separability of the diastereomers was compared with the diastereomers derived from DBD-d(or l)-proline. The resolution values (Rs) obtained from the diastereomers of three chiral amines with DBD-d(or l)-beta-proline were higher than those derived from DBD-d(or l)-proline, e.g. dl-phenylalanine methylester (dl-PAME), 2.23 vs 1.37; (R)(S)-1-phenylethylamine [(R)(S)-PEA], 2.09 vs 1.13; and (R)(S)-1-(1-naphthyl)ethylamines [(R)(S)-NEA], 5.19 vs 1.23. The results suggest that the position of COOH group on pyrrolidine moiety in the structures is one of the important factors for the efficient separation of a couple of the diastereomers.
Koštál, Vladimír; Korbelová, Jaroslava; Poupardin, Rodolphe; Moos, Martin; Šimek, Petr
2016-08-01
The fruit fly Drosophila melanogaster is an insect of tropical origin. Its larval stage is evolutionarily adapted for rapid growth and development under warm conditions and shows high sensitivity to cold. In this study, we further developed an optimal acclimation and freezing protocol that significantly improves larval freeze tolerance (an ability to survive at -5°C when most of the freezable fraction of water is converted to ice). Using the optimal protocol, freeze survival to adult stage increased from 0.7% to 12.6% in the larvae fed standard diet (agar, sugar, yeast, cornmeal). Next, we fed the larvae diets augmented with 31 different amino compounds, administered in different concentrations, and observed their effects on larval metabolomic composition, viability, rate of development and freeze tolerance. While some diet additives were toxic, others showed positive effects on freeze tolerance. Statistical correlation revealed tight association between high freeze tolerance and high levels of amino compounds involved in arginine and proline metabolism. Proline- and arginine-augmented diets showed the highest potential, improving freeze survival to 42.1% and 50.6%, respectively. Two plausible mechanisms by which high concentrations of proline and arginine might stimulate high freeze tolerance are discussed: (i) proline, probably in combination with trehalose, could reduce partial unfolding of proteins and prevent membrane fusions in the larvae exposed to thermal stress (prior to freezing) or during freeze dehydration; (ii) both arginine and proline are exceptional among amino compounds in their ability to form supramolecular aggregates which probably bind partially unfolded proteins and inhibit their aggregation under increasing freeze dehydration. © 2016. Published by The Company of Biologists Ltd.
Sun, Min; Gao, ZhiQiang; Zhao, WeiFeng; Deng, LianFeng; Deng, Yan; Zhao, HongMei; Ren, AiXia; Li, Gang; Yang, ZhenPing
2013-01-01
To provide a new way to increase water storage and retention of dryland wheat, a field study was conducted at Wenxi experimental site of Shanxi Agricultural University. The effect of subsoiling in fallow period on soil water storage, accumulation of proline, and formation of grain protein after anthesis were determined. Our results showed that subsoiling in fallow period could increase water storage in the 0–300 cm soil at pre-sowing stage and at anthesis stage with low or medium N application, especially for the 60–160 cm soil. However, the proline content, glutamine synthetase (GS) activity, glutamate dehydrogenase (GDH) activity in flag leaves and grains were all decreased by subsoiling in fallow period. In addition, the content of albumin, gliadin, and total protein in grains were also decreased while globulin content, Glu/Gli, protein yield, and glutelin content were increased. With N application increasing, water storage of soil layers from 20 to 200 cm was decreased at anthesis stage. High N application resulted in the increment of proline content and GS activity in grains. Besides, correlation analysis showed that soil storage in 40–160 cm soil was negatively correlated with proline content in grains; proline content in grains was positively correlated with GS and GDH activity in flag leaves. Contents of albumin, globulin and total protein in grains were positively correlated with proline content in grains and GDH activity in flag leaves. In conclusion, subsoiling in fallow period, together with N application at 150 kg·hm−2, was beneficial to increase the protein yield and Glu/Gli in grains which improve the quality of wheat. PMID:24098371
Mechanisms of induced susceptibility to Diplodia tip blight in drought-stressed Austrian pine.
Sherwood, Patrick; Villari, Caterina; Capretti, Paolo; Bonello, Pierluigi
2015-05-01
Plants experiencing drought stress are frequently more susceptible to pathogens, likely via alterations in physiology that create favorable conditions for pathogens. Common plant responses to drought include the production of reactive oxygen species (ROS) and the accumulation of free amino acids (AAs), particularly proline. These same phenomena also frequently occur during pathogenic attack. Therefore, drought-induced perturbations in AA and ROS metabolism could potentially contribute to the observed enhanced susceptibility. Furthermore, nitrogen (N) availability can influence AA accumulation and affect plant resistance, but its contributions to drought-induced susceptibility are largely unexplored. Here we show that drought induces accumulation of hydrogen peroxide (H2O2) in Austrian pine (Pinus nigra Arnold) shoots, but that shoot infection by the blight and canker pathogen Diplodia sapinea (Fr.) Fuckel leads to large reductions in H2O2 levels in droughted plants. In in vitro assays, H2O2 was toxic to D. sapinea, and the fungus responded to this oxidative stress by increasing catalase and peroxidase activities, resulting in substantial H2O2 degradation. Proline increased in response to drought and infection when examined independently, but unlike all other AAs, proline further increased in infected shoots of droughted trees. In the same tissues, the proline precursor, glutamate, decreased significantly. Proline was found to protect D. sapinea from H2O2 damage, while also serving as a preferred N source in vitro. Fertilization increased constitutive and drought-induced levels of some AAs, but did not affect plant resistance. A new model integrating interactions of proline and H2O2 metabolism with drought and fungal infection of plants is proposed. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The adsorption and reactions of the amino acid proline on rutile TiO 2(1 1 0) surfaces
NASA Astrophysics Data System (ADS)
Fleming, G. J.; Adib, K.; Rodriguez, J. A.; Barteau, M. A.; White, J. M.; Idriss, H.
2008-06-01
The reaction of the amino acid DL-proline is studied over stoichiometric and Ar-ions sputtered (reduced) TiO 2(1 1 0) single crystal surfaces by synchrotron High Resolution X-ray Photoelectron Spectroscopy (HRXPS). On the stoichiometric surface proline gives two different species at 300 K: dissociated and zwitterionic. Upon heating the zwitterionic structure is removed first from the surface followed by the dissociated form. The C1s signal for the COO function is found close to 288.5 eV for both forms while the N 1s for the dissociated form is found at 400.0 eV and that of the zwitterionic from close to 401.8 eV. From the attenuation of the Ti 2p signal the surface coverage was estimated less than ½ (about 0.35). This smaller coverage than dissociatively adsorbed carboxylic acids on this surface (usually close to ½), is attributed to lateral repulsion caused by the ring of adjacent proline molecules adsorbed on five-fold coordinated Ti cations along the [0 0 1] direction. On the reduced surface the amount of zwitterion structure is found two times higher than that on the stoichiometric surface, at 300 K, most likely due to the considerable decrease of the amount of surface oxygen available. The stability of the zwitterionic structure on this surface is however found similar to that found on the stoichiometric surface. In addition, evidence of oxidation of reduced Ti cations upon adsorption at 300 K is noticed and explained as breaking of the carbon-oxygen bond of a fraction of adsorbed proline. Variable temperature HRXPS has been collected and results indicated that proline is more stable on the reduced surface compared to the stoichiometric surface.
Silini, A; Silini-Chérif, H; Ghoul, M
2012-02-01
The effect of plant growth-promoting Rhizobacteria (PGPR) and exogenous application of compatible solutes on seed germination and root concentrations of sodium and potassium of two wheat varieties (Triticum durum L.) were evaluated under saline stress. In this experiment, Azotobacter vinelandii strain DSM85, glycine betaine and proline were used. Inoculated seeds for each variety were placed on Whatman paper in 9 cm Petri dishes containing 15 mL of distilled water or NaCl solutions at various concentrations (control, 100, 200, 300 mM) supplemented with or without glycine betaine (GB) or proline at 5 mM. The results indicated that addition of proline (5 mM) stimulated the production of indol acetic acid and the growth of A. vinelandii at 200 and 300 mM NaCl, respectively. The germination rate index and the germination final percentage decreased significantly (p < 0.05) with increasing salinity level. The germination was significantly diminished at 300 mM with significant variation among varieties and Waha variety had higher germination percentage than Bousselam variety. Inoculation of seeds by A. vinelandii and exogenous application of proline had significantly positive effect on the germination at this concentration of NaCl. The rate of accumulation of Na+ in roots was important at 100 mM and increased at 200 mM. The concentration of K+ decreased when salinity increased. The effect of inoculation or inoculation with proline decreased the accumulation of Na' and reduced the loss of K+ under salt stress. From the present study we can conclude that the use of A. vinelandii strain DSM85 and external application of low concentrations of proline on seeds might be considered as a strategy for the protection of plants under saline stress.
Iijima, Hiroko; Nakaya, Yuka; Kuwahara, Ayuko; Hirai, Masami Yokota; Osanai, Takashi
2015-01-01
Water use assessment is important for bioproduction using cyanobacteria. For eco-friendly reasons, seawater should preferably be used for cyanobacteria cultivation instead of freshwater. In this study, we demonstrated that the freshwater unicellular cyanobacterium Synechocystis sp. PCC 6803 could be grown in a medium based on seawater. The Synechocystis wild-type strain grew well in an artificial seawater (ASW) medium supplemented with nitrogen and phosphorus sources. The addition of HEPES buffer improved cell growth overall, although the growth in ASW medium was inferior to that in the synthetic BG-11 medium. The levels of proteins involved in sugar metabolism changed depending on the culture conditions. The biosynthesis of several amino acids including aspartate, glutamine, glycine, proline, ornithine, and lysine, was highly up-regulated by cultivation in ASW. Two types of natural seawater (NSW) were also made available for the cultivation of Synechocystis cells, with supplementation of both nitrogen and phosphorus sources. These results revealed the potential use of seawater for the cultivation of freshwater cyanobacteria, which would help to reduce freshwater consumption during biorefinery using cyanobacteria. PMID:25954257
NASA Astrophysics Data System (ADS)
Ji, Chenglong; Wu, Huifeng; Liu, Xiaoli; Zhao, Jianmin; Yu, Junbao; Yin, Xiuli
2013-03-01
Ruditapes philippinarum, a clam that thrives in intertidal zones of various salinities, is a useful biomonitor to marine contaminants. We investigated the influence of dilution to 75% and 50% of normal seawater salinity (31.1) on the responses of the digestive gland of R. philippinarum to arsenic exposure (20 μg/L), using nuclear magnetic resonance (NMR)-based metabolomics. After acute arsenic exposure for 48 h, salinity-dependent differential metabolic responses were detected. In normal seawater, arsenic exposure increased the concentrations of branched-chain amino acids, and of threonine, proline, phosphocholine and adenosine, and it decreased the levels of alanine, hypotaurine, glucose, glycogen and ATP in the digestive glands. Differential changes in metabolic biomarkers observed at lower salinity (˜23.3) included elevation of succinate, taurine and ATP, and depletion of branched-chain amino acids, threonine and glutamine. Unique effects of arsenic at the lowest salinity (˜15.6) included down-regulation of glutamate, succinate and ADP, and up-regulation of phosphocholine. We conclude that salinity influences the metabolic responses of this clam to arsenic.
Singh-Mallah, Gagandeep; McMahon, Christopher D; Guan, Jian; Singh, Kuljeet
2017-12-01
In rodents, post-lactational involution of mammary glands is characterized by the loss of mammary epithelial cells via apoptosis, which is associated with a decline in the expression of insulin-like growth factor-1 (IGF-1). Overexpression of IGF-1 delays involution by inhibiting apoptosis of epithelial cells and preserving the remaining secretory alveoli. Cyclic-glycine-proline (cGP), a metabolite of IGF-1, normalizes IGF-1 function under pathological conditions by regulating the bioavailability of IGF-1. The present study investigated the effect of cGP on the physiological decline in IGF-1 function during post-lactational mammary involution. Rat dams were gavaged with either cGP (3 mg/kg) or saline once per day from post-natal d8-22. Before collecting tissue on post-natal d23, a pair of mammary glands were sealed on d20 (72 hr-engorgement, thus representative of late-involution) and d22 (24 hr-engorgement, thus representative of mid-involution), while the remaining glands were allowed to involute naturally (early-involution). During early-involution, cGP accelerated the loss of mammary cells through apoptosis, resulting in an earlier clearance of intact secretory alveoli compared with the control group. This coincided with an earlier up-regulation of the cell survival factors, Bcl-xl and IGF-1R, in the early-involution cGP glands compared with the control glands. During late-involution, cGP reduced the bioactivity of IGF-1, which was evident through decreased phosphorylation of IGF-1R in the regressed alveoli. Maternal administration of cGP did not alter milk production and composition during early-, peak-, or late-stage of lactation. These data show that cGP accelerates post-lactational involution by promoting apoptosis and the physiological decline in IGF-1 function. © 2017 Wiley Periodicals, Inc.
Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S
2007-11-07
Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.
Novel Prunus rootstock somaclonal variants with divergent ability to tolerate waterlogging.
Pistelli, Laura; Iacona, Calogero; Miano, Dario; Cirilli, Marco; Colao, Maria Chiara; Mensuali-Sodi, Anna; Muleo, Rosario
2012-03-01
Plants require access to free water for nutrient uptake, but excess water surrounding the roots can be injurious or even lethal because it blocks the transfer of free oxygen between the soil and the atmosphere. Genetic improvement efforts in this study were focused on the increased tolerance in roots to waterlogging. Among a pool of clones generated in vitro from leaf explants of rootstock Mr.S.2/5 of Prunus cerasifera L., the S.4 clone was flood tolerant whereas the S.1 clone was sensitive. The S.4 clone formed adventitious roots on exposure to flooding. Moreover, the chlorophyll content and mitochondrial activity in the leaf and root, soluble sugar content, alcohol dehydrogenase activity and ethylene content were different between the clones. The sorbitol transporter gene (SOT1) was up-regulated during hypoxia, the alcohol dehydrogenase genes (ADH1 and ADH3) were up-regulated in the leaves and down-regulated in the roots of the S.4 clone during hypoxia, and the 1-aminocyclopropane-1-oxidase gene (ACO1) was up-regulated in the leaves and roots of the S.4 clone during hypoxia and down-regulated in the wild-type roots. In addition, in the S.4 root, hypoxia induced significant down-regulation of a glycosyltransferase-like gene (GTL), which has a yet-undefined role. Although the relevant variation in the S.4 genome has yet to be determined, genetic alteration clearly conferred a flooding-tolerant phenotype. The isolation of novel somaclonals with the same genomic background but with divergent tolerance to flooding may offer new insights in the elucidation of the genetic machinery of resistance to flooding and aid in the selection of new Prunus rootstocks to be used in various adverse environments.
Rinne, Päivi L.H.; Paul, Laju K.; Vahala, Jorma; Kangasjärvi, Jaakko; van der Schoot, Christiaan
2016-01-01
Axillary buds (AXBs) of hybrid aspen (Populus tremula×P. tremuloides) contain a developing dwarfed shoot that becomes para-dormant at the bud maturation point. Para-dormant AXBs can grow out after stem decapitation, while dormant AXBs pre-require long-term chilling to release them from dormancy. The latter is mediated by gibberellin (GA)-regulated 1,3-β-glucanases, but it is unknown if GA is also important in the development, activation, and outgrowth of para-dormant AXBs. The present data show that para-dormant AXBs up-regulate GA receptor genes during their maturation, but curtail GA biosynthesis by down-regulating the rate-limiting GIBBERELLIN 3-OXIDASE2 (GA3ox2), which is characteristically expressed in the growing apex. However, decapitation significantly up-regulated GA3ox2 and GA4-responsive 1,3-β-glucanases (GH17-family; α-clade). In contrast, decapitation down-regulated γ-clade 1,3-β-glucanases, which were strongly up-regulated in maturing AXBs concomitant with lipid body accumulation. Overexpression of selected GH17 members in hybrid aspen resulted in characteristic branching patterns. The α-clade member induced an acropetal branching pattern, whereas the γ-clade member activated AXBs in recurrent flushes during transient cessation of apex proliferation. The results support a model in which curtailing the final step in GA biosynthesis dwarfs the embryonic shoot, while high levels of GA precursors and GA receptors keep AXBs poised for growth. GA signaling, induced by decapitation, reinvigorates symplasmic supply routes through GA-inducible 1,3-β-glucanases that hydrolyze callose at sieve plates and plasmodesmata. PMID:27697786
Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong
2017-01-01
To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.
XIE, WEI-DONG; WANG, HUA; ZHANG, JIN-FANG; LI, JIAN-NA; CAN, YI; QING, LV; KUNG, HSIANG-FU; ZHANG, YA-OU
2011-01-01
This study aimed to investigate the potential mechanisms of natural resistance to high-fat diet-induced obesity. Four-week-old C57BL/6 mice were fed a high-fat diet for 6 weeks and were then designated as high-fat diet-fed obesity-prone (HOP) and obesity-resistant (HOR) animals. Their blood biochemistry was evaluated, and visceral adipose tissue samples were subjected to proteomic, Western blot and quantitative real-time PCR (q-PCR) analyses. The HOR mice showed reduced visceral fat weight and size, as well as lowered serum lipid and leptin levels. Proteomic analysis showed that enoyl coenzyme A hydratase 1, peroxisomal (Ech1) expression was significantly increased in their visceral adipose tissues. Moreover, other proteins, such as α-tropomyosin, myosin light chain, urine-nucleoside phosphorylase and transgelin, were also significantly increased. Furthermore, q-PCR analysis showed that the expression of acyl-CoA oxidase 1 palmitoyl, enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase and 3-oxoacyl-CoA thiolase responsible for peroxisomal β-oxidation was also up-regulated in the visceral adipose tissues of the HOR mice. The expression of peroxisome proliferator-activated receptor α (PPARα) was increased in the HOR mice as shown by Western blot analysis. Obesity-resistant animals show enhanced peroxisomal β-oxidation metabolism and reduced fat accumulation in visceral adipose tissues by up-regulating the expression of Ech1, peroxisomal or other related peroxisomal β-oxidation marker genes, which may be driven or enhanced by the up-regulation of the expression of PPARα. However, further validation in future studies is required. PMID:22977503
Chiou, Shih-Hwa; Ku, Hung-Hai; Tsai, Tung-Hu; Lin, Heng-Liang; Chen, Li-Hsin; Chien, Chan-Shiu; Ho, Larry L -T; Lee, Chen-Hsen; Chang, Yuh-Lih
2006-01-01
Moclobemide (MB) is an antidepressant drug that selectively and reversibly inhibits monoamine oxidase-A. Recent studies have revealed that antidepressant drugs possess the characters of potent growth-promoting factors for the development of neurogenesis and improve the survival rate of serotonin (5-hydroxytrytamine; 5-HT) neurons. However, whether MB comprises neuroprotection effects or modulates the proliferation of neural stem cells (NSCs) needs to be elucidated. In this study, firstly, we used the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay to demonstrate that 50 μM MB can increase the cell viability of NSCs. The result of real-time reverse transcription–polymerase chain reaction (RT–PCR) showed that the induction of MB can upregulate the gene expressions of Bcl-2 and Bcl-xL. By using caspases 8 and 3, ELISA and terminal dUTP nick-end labeling (TUNEL) assay, our data further confirmed that 50 μM MB-treated NSCs can prevent FasL-induced apoptosis. The morphological findings also supported the evidence that MB can facilitate the dendritic development and increase the neurite expansion of NSCs. Moreover, we found that MB treatment increased the expression of Bcl-2 in NSCs through activating the extracellular-regulated kinase (ERK) phosphorylation. By using the triple-staining immunofluorescent study, the percentages of serotonin- and MAP-2-positive cells in the day 7 culture of MB-treated NSCs were significantly increased (P<0.01). Furthermore, our data supported that MB treatment increased functional production of serotonin in NSCs via the modulation of ERK1/2. In sum, the study results support that MB can upregulate Bcl-2 expression and induce the differentiation of NSCs into serotoninergic neuron via ERK pathway. PMID:16702990
Chiou, Shih-Hwa; Ku, Hung-Hai; Tsai, Tung-Hu; Lin, Heng-Liang; Chen, Li-Hsin; Chien, Chan-Shiu; Ho, Larry L-T; Lee, Chen-Hsen; Chang, Yuh-Lih
2006-07-01
1. Moclobemide (MB) is an antidepressant drug that selectively and reversibly inhibits monoamine oxidase-A. Recent studies have revealed that antidepressant drugs possess the characters of potent growth-promoting factors for the development of neurogenesis and improve the survival rate of serotonin (5-hydroxytrytamine; 5-HT) neurons. However, whether MB comprises neuroprotection effects or modulates the proliferation of neural stem cells (NSCs) needs to be elucidated. 2. In this study, firstly, we used the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay to demonstrate that 50 microM MB can increase the cell viability of NSCs. The result of real-time reverse transcription-polymerase chain reaction (RT-PCR) showed that the induction of MB can upregulate the gene expressions of Bcl-2 and Bcl-xL. By using caspases 8 and 3, ELISA and terminal dUTP nick-end labeling (TUNEL) assay, our data further confirmed that 50 microM MB-treated NSCs can prevent FasL-induced apoptosis. 3. The morphological findings also supported the evidence that MB can facilitate the dendritic development and increase the neurite expansion of NSCs. Moreover, we found that MB treatment increased the expression of Bcl-2 in NSCs through activating the extracellular-regulated kinase (ERK) phosphorylation. 4. By using the triple-staining immunofluorescent study, the percentages of serotonin- and MAP-2-positive cells in the day 7 culture of MB-treated NSCs were significantly increased (P<0.01). Furthermore, our data supported that MB treatment increased functional production of serotonin in NSCs via the modulation of ERK1/2. In sum, the study results support that MB can upregulate Bcl-2 expression and induce the differentiation of NSCs into serotoninergic neuron via ERK pathway.
Lin, Huapeng; Zhang, Qian; Li, Xiaocheng; Wu, Yushen; Liu, Ye; Hu, Yingchun
2018-01-01
Abstract Hepatitis B virus-associated acute liver failure (HBV-ALF) is a rare but life-threatening syndrome that carried a high morbidity and mortality. Our study aimed to explore the possible molecular mechanisms of HBV-ALF by means of bioinformatics analysis. In this study, genes expression microarray datasets of HBV-ALF from Gene Expression Omnibus were collected, and then we identified differentially expressed genes (DEGs) by the limma package in R. After functional enrichment analysis, we constructed the protein–protein interaction (PPI) network by the Search Tool for the Retrieval of Interacting Genes online database and weighted genes coexpression network by the WGCNA package in R. Subsequently, we picked out the hub genes among the DEGs. A total of 423 DEGs with 198 upregulated genes and 225 downregulated genes were identified between HBV-ALF and normal samples. The upregulated genes were mainly enriched in immune response, and the downregulated genes were mainly enriched in complement and coagulation cascades. Orosomucoid 1 (ORM1), orosomucoid 2 (ORM2), plasminogen (PLG), and aldehyde oxidase 1 (AOX1) were picked out as the hub genes that with a high degree in both PPI network and weighted genes coexpression network. The weighted genes coexpression network analysis found out 3 of the 5 modules that upregulated genes enriched in were closely related to immune system. The downregulated genes enriched in only one module, and the genes in this module majorly enriched in the complement and coagulation cascades pathway. In conclusion, 4 genes (ORM1, ORM2, PLG, and AOX1) with immune response and the complement and coagulation cascades pathway may take part in the pathogenesis of HBV-ALF, and these candidate genes and pathways could be therapeutic targets for HBV-ALF. PMID:29384847
Proline analogue of nitrosourea as a new cytotoxic prodrug.
Stankiewicz-Kranc, Anna; Bielawska, Anna; Bielawski, Krzysztof; Skrzydlewska, Elzbieta
2009-11-01
Carmustine is frequently used as anticancer drug. High toxicity and low selectivity reduces the application of this drug. Though, there is a necessity to find new compounds characterized by similar therapeutic effects but a higher selectivity and safety. As a result, the proline analogue of nitrosourea, N-[N'-(2-bromophenyl)-N'-nitrosocarbamoyl]proline (AC), has been synthesized. The aim of this study was to compare the influence of carmustine and the proline analogue of nitrosourea on the antioxidant abilities of fibroblasts and leukemia cells, MOLT4. It was shown that carmustine as well as AC cause an increase in hydrogen peroxide concentration in normal and neoplastic cells. Incubation with both compounds led to a diminution of the activity of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, and reductase. Changes in activity / level of antioxidant parameters were accompanied by augmentation of lipid and oxidative protein modifications. In conclusion, carmustine and AC cause changes in the antioxidative system of normal and MOLT4 cells and are a reason of oxidative stress formation.
Polyamines induce adaptive responses in water deficit stressed cucumber roots.
Kubiś, Jan; Floryszak-Wieczorek, Jolanta; Arasimowicz-Jelonek, Magdalena
2014-01-01
The aim of this study was to investigate the effect of exogenous polyamines (PAs) on the membrane status and proline level in roots of water stressed cucumber (Cucumis sativus cv. Dar) seedlings. It was found that water shortage resulted in an increase of membrane injury, lipoxygenase (LOX) activity, lipid peroxidation and proline concentration in cucumber roots during progressive dehydration. PA pretreatment resulted in a distinct reduction of the injury index, and this effect was reflected by a lower stress-evoked LOX activity increase and lipid peroxide levels at the end of the stress period. In contrast, PA-supplied stressed roots displayed a higher proline accumulation. The presented results suggest that exogenous PAs are able to alleviate water deficit-induced membrane permeability and diminish LOX activity. Observed changes were accompanied by an accumulation of proline, suggesting that the accumulation of this osmolyte might be another possible mode of action for PAs to attain higher membrane stability, and in this way mitigate water deficit effects in roots of cucumber seedlings.
Chambers, S T; Kunin, C M
1987-01-01
Human urine is osmoprotective for enteric bacteria, permitting E. coli to grow with high concentrations of NaCl and other salts and even higher concentrations of sucrose and mannitol but not urea. The active material in urine is soluble in methanol and is precipitated by ammonium reineckate at acid pH. Using gel filtration and high-pressure liquid chromatography, we have identified two major osmoprotective compounds in urine. One is glycine betaine; the other is proline betaine as demonstrated by nuclear magnetic resonance, mass spectrum scanning, and chemical synthesis. Proline betaine has not been described previously to our knowledge in vertebrate tissues. It is known to be a cell volume-regulating agent for marine red algae and the euryhaline mollusk Elysia chloritica. We suggest that the presence of glycine and proline betaines in human urine may reflect an osmoprotective role for the kidney and that they protect bacteria in the urine only fortuitously. PMID:3546377
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seddon, A.P.; Meister, A.
1986-05-01
5-oxo-L-proline + ATP + 2 H/sub 2/O ..-->.. L-Glutamate + ADP + P/sub i/ Pseudomonas putida 5-oxoprolinase consists of 2 protein components (A and B). A catalyzes 5-OP-dependent ATPase. B, which does not appear to interact with ATP or 5-OP, is required for catalysis of the complete reaction. Application of the isotope trapping method showed that 5-OP is converted stoichiometrically to an enzyme-bound form in a process requiring ATP and its cleavage. The overall reaction is not inhibited by high concentrations of borohydride. When the reaction catalyzed by A alone is carried out in the presence of 0.1-0.6 M KBH/submore » 4/ there is catalytic formation of proline. Studies with KB/sup 3/H/sub 4/ showed incorporation of /sup 3/H into proline. Proline formation is prevented by addition of B.« less
Conformational Preferences of α-Substituted Proline Analogues
Flores-Ortega, Alejandra; Jiménez, Ana I.; Cativiela, Carlos; Nussinov, Ruth; Alemán, Carlos; Casanovas, Jordi
2009-01-01
DFT calculations at the B3LYP/6-31+G(d,p) level have been used to investigate how the replacement of the α hydrogen by a more sterically demanding group affects the conformational preferences of proline. Specifically, the N-acetyl-N’-methylamide derivatives of L-proline, L-α-methylproline and L-α-phenylproline have been calculated, with both the cis/trans isomerism of the peptide bonds and the puckering of the pyrrolidine ring being considered. The effects of solvation have been evaluated using a Self Consistent Reaction Field model. As expected, tetrasubstitution at the α carbon destabilizes the conformers with one or more peptide bonds arranged in cis. The lowest energy minimum has been found to be identical for the three compounds investigated, but important differences are observed regarding other energetically accessible backbone conformations. The results obtained provide evidence that the distinct steric requirements of the substituent at Cα may play a significant role in modulating the conformational preferences of proline. PMID:18351745
NASA Astrophysics Data System (ADS)
Duan, S. H.; Kai, T.; Chowdhury, F. A.; Taniguchi, I.; Kazama, S.
2018-01-01
Poly(amidoamine) (PAMAM) dendrimers were incorporated into cross-linked poly(ethylene glycol) (PEGDMA) matrix to improve carbon dioxide (CO2) separation performance at elevated pressures. In our previous studies, PAMAM/PEGDMA hybrid membranes showed high CO2 separation properties from CO2/H2 mixed gases. In this study, proline, choline and ionic liquid [Choline][Pro] compounds were selected as rate promoters that were used to prepare PAMAM/PEGDMA hybrid membranes. The effect of addition of proline, choline, IL [Choline][Pro] on separation performance of PAMAM/PEGDMA) hybrid membranes for CO2/H2 separation was investigated. Amino acid proline, choline, and IL [Choline][Pro] were used to promote CO2 and amine reaction. With the addition of [Choline][Pro] into PAMAM/PEG membrane, CO2 permeance of PAMAM/PEG hybrid membranes are increased up to 46% without any change of selectivity of membrane for CO2.
Radhakrishnan, Aditya; Vitalis, Andreas; Mao, Albert H.; Steffen, Adam T.; Pappu, Rohit V.
2012-01-01
Poly-L-proline (PLP) polymers are useful mimics of biologically relevant proline-rich sequences. Biophysical and computational studies of PLP polymers in aqueous solutions are challenging because of the diversity of length scales and the slow time scales for conformational conversions. We describe an atomistic simulation approach that combines an improved ABSINTH implicit solvation model, with conformational sampling based on standard and novel Metropolis Monte Carlo moves. Refinements to forcefield parameters were guided by published experimental data for proline-rich systems. We assessed the validity of our simulation results through quantitative comparisons to experimental data that were not used in refining the forcefield parameters. Our analysis shows that PLP polymers form heterogeneous ensembles of conformations characterized by semi-rigid, rod-like segments interrupted by kinks, which result from a combination of internal cis peptide bonds, flexible backbone ψ-angles, and the coupling between ring puckering and backbone degrees of freedom. PMID:22329658
NASA Astrophysics Data System (ADS)
Fleming, G. J.; Adib, K.; Rodriguez, J. A.; Barteau, M. A.; Idriss, H.
2007-12-01
The surface chemistry and binding of DL-proline were investigated on the oxidised (stoichiometric) and reduced (sub-stoichiometric) TiO 2(1 1 0) single crystal surfaces. TiO 2 was chosen as the substrate as it best represents the surface of a biomedical implant, which bio-molecules interact with during the healing of bone/teeth fractures (molecular recognition). High resolution X-ray photoelectron spectroscopy (HR-XPS) studies of the C1s and N1s regions revealed that DL-proline is present in two forms (dissociated and zwitterionic) on the oxidised TiO 2 surface. On TiO 2(1 1 0) surfaces reduced by Ar + sputtering, a significant increase in the amount of zwitterionic proline at the surface was detected when compared with the oxidised surface. Study of the temperature effect showed that in both cases the zwitterionic structure was the less stable structure. The reason for its relative instability appears to be thermodynamic.
Ayers, Benjamin J; Glawar, Andreas F G; Martínez, R Fernando; Ngo, Nigel; Liu, Zilei; Fleet, George W J; Butters, Terry D; Nash, Robert J; Yu, Chu-Yi; Wormald, Mark R; Nakagawa, Shinpei; Adachi, Isao; Kato, Atsushi; Jenkinson, Sarah F
2014-04-18
All 16 stereoisomeric N-methyl 5-(hydroxymethyl)-3,4-dihydroxyproline amides have been synthesized from lactones accessible from the enantiomers of glucuronolactone. Nine stereoisomers, including all eight with a (3R)-hydroxyl configuration, are low to submicromolar inhibitors of β-N-acetylhexosaminidases. A structural correlation between the proline amides is found with the ADMDP-acetamide analogues bearing an acetamidomethylpyrrolidine motif. The proline amides are generally more potent than their ADMDP-acetamide equivalents. β-N-Acetylhexosaminidase inhibition by an azetidine ADMDP-acetamide analogue is compared to an azetidine carboxylic acid amide. None of the amides are good α-N-acetylgalactosaminidase inhibitors.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...
Song, Jiangning; Burrage, Kevin; Yuan, Zheng; Huber, Thomas
2006-03-09
The majority of peptide bonds in proteins are found to occur in the trans conformation. However, for proline residues, a considerable fraction of Prolyl peptide bonds adopt the cis form. Proline cis/trans isomerization is known to play a critical role in protein folding, splicing, cell signaling and transmembrane active transport. Accurate prediction of proline cis/trans isomerization in proteins would have many important applications towards the understanding of protein structure and function. In this paper, we propose a new approach to predict the proline cis/trans isomerization in proteins using support vector machine (SVM). The preliminary results indicated that using Radial Basis Function (RBF) kernels could lead to better prediction performance than that of polynomial and linear kernel functions. We used single sequence information of different local window sizes, amino acid compositions of different local sequences, multiple sequence alignment obtained from PSI-BLAST and the secondary structure information predicted by PSIPRED. We explored these different sequence encoding schemes in order to investigate their effects on the prediction performance. The training and testing of this approach was performed on a newly enlarged dataset of 2424 non-homologous proteins determined by X-Ray diffraction method using 5-fold cross-validation. Selecting the window size 11 provided the best performance for determining the proline cis/trans isomerization based on the single amino acid sequence. It was found that using multiple sequence alignments in the form of PSI-BLAST profiles could significantly improve the prediction performance, the prediction accuracy increased from 62.8% with single sequence to 69.8% and Matthews Correlation Coefficient (MCC) improved from 0.26 with single local sequence to 0.40. Furthermore, if coupled with the predicted secondary structure information by PSIPRED, our method yielded a prediction accuracy of 71.5% and MCC of 0.43, 9% and 0.17 higher than the accuracy achieved based on the singe sequence information, respectively. A new method has been developed to predict the proline cis/trans isomerization in proteins based on support vector machine, which used the single amino acid sequence with different local window sizes, the amino acid compositions of local sequence flanking centered proline residues, the position-specific scoring matrices (PSSMs) extracted by PSI-BLAST and the predicted secondary structures generated by PSIPRED. The successful application of SVM approach in this study reinforced that SVM is a powerful tool in predicting proline cis/trans isomerization in proteins and biological sequence analysis.
Pitzschke, Andrea; Xue, Hui; Persak, Helene; Datta, Sneha; Seifert, Georg J.
2016-01-01
Arabidopsis EARLI-type hybrid proline-rich proteins (HyPRPs) consist of a putative N-terminal secretion signal, a proline-rich domain (PRD), and a characteristic eight-cysteine-motif (8-CM). They have been implicated in biotic and abiotic stress responses. AZI1 is required for systemic acquired resistance and it has recently been identified as a target of the stress-induced mitogen-activated protein kinase MPK3. AZI1 gel migration properties strongly indicate AZI1 to undergo major post-translational modifications. These occur in a stress-independent manner and are unrelated to phosphorylation by MAPKs. As revealed by transient expression of AZI1 in Nicotiana benthamiana and Tropaeolum majus, the Arabidopsis protein is similarly modified in heterologous plant species. Proline-rich regions, resembling arabinogalactan proteins point to a possible proline hydroxylation and subsequent O-glycosylation of AZI1. Consistently, inhibition of prolyl hydroxylase reduces its apparent protein size. AZI1 secretion was examined using Arabidopsis protoplasts and seedling exudates. Employing Agrobacterium-mediated leaf infiltration of N. benthamiana, we attempted to assess long-distance movement of AZI1. In summary, the data point to AZI1 being a partially secreted protein and a likely new member of the group of hydroxyproline-rich glycoproteins. Its dual location suggests AZI1 to exert both intra- and extracellular functions. PMID:26771603
Proline-poor hydrophobic domains modulate the assembly and material properties of polymeric elastin.
Muiznieks, Lisa D; Reichheld, Sean E; Sitarz, Eva E; Miao, Ming; Keeley, Fred W
2015-10-01
Elastin is a self-assembling extracellular matrix protein that provides elasticity to tissues. For entropic elastomers such as elastin, conformational disorder of the monomer building block, even in the polymeric form, is essential for elastomeric recoil. The highly hydrophobic monomer employs a range of strategies for maintaining disorder and flexibility within hydrophobic domains, particularly involving a minimum compositional threshold of proline and glycine residues. However, the native sequence of hydrophobic elastin domain 30 is uncharacteristically proline-poor and, as an isolated polypeptide, is susceptible to formation of amyloid-like structures comprised of stacked β-sheet. Here we investigated the biophysical and mechanical properties of multiple sets of elastin-like polypeptides designed with different numbers of proline-poor domain 30 from human or rat tropoelastins. We compared the contributions of these proline-poor hydrophobic sequences to self-assembly through characterization of phase separation, and to the tensile properties of cross-linked, polymeric materials. We demonstrate that length of hydrophobic domains and propensity to form β-structure, both affecting polypeptide chain flexibility and cross-link density, play key roles in modulating elastin mechanical properties. This study advances the understanding of elastin sequence-structure-function relationships, and provides new insights that will directly support rational approaches to the design of biomaterials with defined suites of mechanical properties. © 2015 Wiley Periodicals, Inc.
Thompson, John F.; Stewart, Cecil R.; Morris, Clayton J.
1966-01-01
Excised leaves were incubated at various water contents to determine the effect of water status on amino acid composition. Considerable proteolysis took place during incubation with a resultant increase in each amino acid in the non-protein fraction. However, serine, proline, γ-aminobutyric acid and methyleysteine sulfoxide were the only amino acids in which there was an accumulation (i.e., net synthesis). Serine showed a small but consistent accumulation lasting for 6 days. Proline showed a greater accumulation but this ceased after 2 days. To learn more about the control of the proline accumulation during wilting, turgid and wilted leaves were incubated under aerobic and anaerobic conditions. The amino acid analyses showed that turgid leaves did not accumulate proline and that proline and methylcysteine sulfoxide accumulation was abolished by anaerobiosis. With other amino acids, relative concentration changes between wilted and non-wilted leaves were less striking than the difference between aerobic and anaerobic conditions. Under anaerobic conditions there was an increase in alanine and a large increase in γ-aminobutyric acid which were not evident in air. Serine, aspartic acid, glutamic acid, and glutamine disappeared more rapidly and glycine disappeared less rapidly under anaerobic than under aerobic conditions. On the basis of these results, several pathways of amino acid degradation were suggested. PMID:16656443
Low-energy electron collisions with proline and pyrrolidine: A comparative study
NASA Astrophysics Data System (ADS)
Barbosa, Alessandra Souza; Freitas, Thiago Corrêa; Bettega, M. H. F.
2018-02-01
We present a comparative study on the calculated cross sections obtained for the elastic collisions of low-energy electrons with the amino acid proline (C5H9NO2) and its building block pyrrolidine (C4H9N). We employed the Schwinger multichannel method implemented with pseudopotentials to compute integral, differential, and momentum transfer cross sections in the static-exchange plus polarization approximation, for energies up to 15 eV. We report three shape resonances for proline at around 1.7 eV, 6.8 eV, and 10 eV and two shape resonances for pyrrolidine centered at 7 eV and 10.2 eV. The present resonance energies are compared with available experimental data on vertical attachment energies and dissociative electron attachment, where a good agreement is found. From the comparison of the present results with available calculated cross sections for the simplest carboxylic acid, formic acid (HCOOH), and from electronic structure calculations, we found that the first resonance of proline, at 1.7 eV, is due the presence of the carboxylic group, whereas the other two structures, at 6.8 eV and 10 eV, clearly arise from the pyrrolidine ring. A comparison between the differential cross sections for proline and pyrrolidine at some selected energies of the incident electron is also reported in this paper.
Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming
2015-03-01
Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.
Pitzschke, Andrea; Xue, Hui; Persak, Helene; Datta, Sneha; Seifert, Georg J
2016-01-12
Arabidopsis EARLI-type hybrid proline-rich proteins (HyPRPs) consist of a putative N-terminal secretion signal, a proline-rich domain (PRD), and a characteristic eight-cysteine-motif (8-CM). They have been implicated in biotic and abiotic stress responses. AZI1 is required for systemic acquired resistance and it has recently been identified as a target of the stress-induced mitogen-activated protein kinase MPK3. AZI1 gel migration properties strongly indicate AZI1 to undergo major post-translational modifications. These occur in a stress-independent manner and are unrelated to phosphorylation by MAPKs. As revealed by transient expression of AZI1 in Nicotiana benthamiana and Tropaeolum majus, the Arabidopsis protein is similarly modified in heterologous plant species. Proline-rich regions, resembling arabinogalactan proteins point to a possible proline hydroxylation and subsequent O-glycosylation of AZI1. Consistently, inhibition of prolyl hydroxylase reduces its apparent protein size. AZI1 secretion was examined using Arabidopsis protoplasts and seedling exudates. Employing Agrobacterium-mediated leaf infiltration of N. benthamiana, we attempted to assess long-distance movement of AZI1. In summary, the data point to AZI1 being a partially secreted protein and a likely new member of the group of hydroxyproline-rich glycoproteins. Its dual location suggests AZI1 to exert both intra- and extracellular functions.
Salmon, Jean-Michel; Barre, Pierre
1998-01-01
Metabolism of nitrogen compounds by yeasts affects the efficiency of wine fermentation. Ammonium ions, normally present in grape musts, reduce catabolic enzyme levels and transport activities for nonpreferred nitrogen sources. This nitrogen catabolite repression severely impairs the utilization of proline and arginine, both common nitrogen sources in grape juice that require the proline utilization pathway for their assimilation. We attempted to improve fermentation performance by genetic alteration of the regulation of nitrogen-assimilatory pathways in Saccharomyces cerevisiae. One mutant carrying a recessive allele of ure2 was isolated from an industrial S. cerevisiae strain. This mutation strongly deregulated the proline utilization pathway. Fermentation kinetics of this mutant were studied under enological conditions on simulated standard grape juices with various nitrogen levels. Mutant strains produced more biomass and exhibited a higher maximum CO2 production rate than the wild type. These differences were primarily due to the derepression of amino acid utilization pathways. When low amounts of dissolved oxygen were added, the mutants could assimilate proline. Biomass yield and fermentation rate were consequently increased, and the duration of the fermentation was substantially shortened. S. cerevisiae strains lacking URE2 function could improve alcoholic fermentation of natural media where proline and other poorly assimilated amino acids are the major potential nitrogen source, as is the case for most fruit juices and grape musts. PMID:9758807
Malešević, Miroslav; Schumann, Michael; Jahreis, Günther; Fischer, Gunter; Lücke, Christian
2012-09-24
Turns are secondary-structure elements that are omnipresent in natively folded polypeptide chains. A large variety of four-residue β-turns exist, which differ mainly in the backbone dihedral angle values of the two central residues i+1 and i+2. The βVI-type turns are of particular biological interest because the i+2 residue is always a proline in the cis conformation and might thus serve as target of peptidyl prolyl cis/trans isomerases (PPIases). We have designed cyclic hexapeptides containing two proline residues that predominantly adopt the cis conformation in aqueous solution. NMR data and MD calculations indicated that the cyclic peptide sequences c-(-DXaa-Ser-Pro-DXaa-Lys-Pro-) result in highly symmetric backbone structures when both prolines are in the cis conformation and the D-amino acids are either alanine or phenylalanine residues. Replacement of the serine residue either by phosphoserine or by tyrosine compromises this symmetry, but further increases the cis conformation content of both prolines. As a result, we obtained a cyclic hexapeptide that exists almost exclusively as the cis-Pro/cis-Pro conformer but shows no cis/trans interconversion even in the presence of the PPIase Pin1, apparently due to an energetically quite favorable but highly restricted conformational space. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hamelberg, Donald; Shen, Tongye; McCammon, J Andrew
2005-02-16
The presence of serine/threonine-proline motifs in proteins provides a conformational switching mechanism of the backbone through the cis/trans isomerization of the peptidyl-prolyl (omega) bond. The reversible phosphorylation of the serine/threonine modulates this switching in regulatory proteins to alter signaling and transcription. However, the mechanism is not well understood. This is partly because cis/trans isomerization is a very slow process and, hence, difficult to study. We have used our accelerated molecular dynamics method to study the cis/trans proline isomerization, preferred backbone conformation of a serine-proline motif, and the effects of phosphorylation of the serine residue. We demonstrate that, unlike normal molecular dynamics, the accelerated molecular dynamics allows for the system to escape very easily from the trans isomer to cis isomer, and vice versa. Moreover, for both the unphosphorylated and phosphorylated peptides, the statistical thermodynamic properties are recaptured, and the results are consistent with experimental values. Isomerization of the proline omega bond is shown to be asymmetric and strongly dependent on the psi backbone angle before and after phosphorylation. The rates of escape decrease after phosphorylation. Also, the alpha-helical backbone conformation is more favored after phosphorylation. This accelerated molecular dynamics approach provides a general approach for enhancing the conformational transitions of molecular systems without having prior knowledge of the location of the minima and barriers on the potential-energy landscape.
Enkhmandakh, Badam; Makeyev, Alexandr V.; Bayarsaihan, Dashzeveg
2006-01-01
Lim1, Ssdp1, and Ldb1 proteins are components of the Ldb1-associated transcriptional complex, which is important in the head-organizing activity during early mouse development. Depletion of each individual protein alone causes a headless phenotype. To explore in more detail the modular architecture of the complex, we have generated two different gene-trapped mouse lines that express truncated forms of Ssdp1. Embryos derived from the gene-trapped line that encodes a truncated Ssdp1 lacking the proline-rich sequence exhibit a lethal abnormal head-development phenotype, resembling mouse embryos deficient for Lim1, Ssdp1, or Otx2 genes. Embryos derived from the second gene-trapped line, in which most of the proline-rich domain of Ssdp1 is retained, did not show abnormalities in head development. Our data demonstrate that components of the Ldb1-dependent module can be subdivided further into discrete functional domains and that the proline-rich stretch of Ssdp1 is critical for embryonic head development. Furthermore, phylogenetic comparisons revealed that in Caenorhabditis elegans, a similar proline-rich sequence is absent in Ssdp but present in Ldb1. We conclude that although the overall architecture of the Ldb1-dependent module has been preserved, the genetic specification of its individual components has diversified during evolution, without compromising the function of the module. PMID:16864769
Enkhmandakh, Badam; Makeyev, Alexandr V; Bayarsaihan, Dashzeveg
2006-08-01
Lim1, Ssdp1, and Ldb1 proteins are components of the Ldb1-associated transcriptional complex, which is important in the head-organizing activity during early mouse development. Depletion of each individual protein alone causes a headless phenotype. To explore in more detail the modular architecture of the complex, we have generated two different gene-trapped mouse lines that express truncated forms of Ssdp1. Embryos derived from the gene-trapped line that encodes a truncated Ssdp1 lacking the proline-rich sequence exhibit a lethal abnormal head-development phenotype, resembling mouse embryos deficient for Lim1, Ssdp1, or Otx2 genes. Embryos derived from the second gene-trapped line, in which most of the proline-rich domain of Ssdp1 is retained, did not show abnormalities in head development. Our data demonstrate that components of the Ldb1-dependent module can be subdivided further into discrete functional domains and that the proline-rich stretch of Ssdp1 is critical for embryonic head development. Furthermore, phylogenetic comparisons revealed that in Caenorhabditis elegans, a similar proline-rich sequence is absent in Ssdp but present in Ldb1. We conclude that although the overall architecture of the Ldb1-dependent module has been preserved, the genetic specification of its individual components has diversified during evolution, without compromising the function of the module.
Zhu, Haiyan; Kwak, Hyun-Jeong; Liu, Peng; Bajrami, Besnik; Xu, Yuanfu; Park, Shin-Young; Nombela-Arrieta, Cesar; Mondal, Subhanjan; Kambara, Hiroto; Yu, Hongbo; Chai, Li; Silberstein, Leslie E; Cheng, Tao; Luo, Hongbo R
2017-04-01
Both microbial infection and sterile inflammation augment bone marrow (BM) neutrophil production, but whether the induced accelerated granulopoiesis is mediated by a common pathway and the nature of such a pathway are poorly defined. We recently established that BM myeloid cell-derived reactive oxygen species (ROS) externally regulate myeloid progenitor proliferation and differentiation in bacteria-elicited emergency granulopoiesis. In this article, we show that BM ROS levels are also elevated during sterile inflammation. Similar to in microbial infection, ROS were mainly generated by the phagocytic NADPH oxidase in Gr1 + myeloid cells. The myeloid cells and their ROS were uniformly distributed in the BM when visualized by multiphoton intravital microscopy, and ROS production was both required and sufficient for sterile inflammation-elicited reactive granulopoiesis. Elevated granulopoiesis was mediated by ROS-induced phosphatase and tensin homolog oxidation and deactivation, leading to upregulated PtdIns(3,4,5)P3 signaling and increased progenitor cell proliferation. Collectively, these results demonstrate that, although infection-induced emergency granulopoiesis and sterile inflammation-elicited reactive granulopoiesis are triggered by different stimuli and are mediated by distinct upstream signals, the pathways converge to NADPH oxidase-dependent ROS production by BM myeloid cells. Thus, BM Gr1 + myeloid cells represent a key hematopoietic niche that supports accelerated granulopoiesis in infective and sterile inflammation. This niche may be an excellent target in various immune-mediated pathologies or immune reconstitution after BM transplantation. Copyright © 2017 by The American Association of Immunologists, Inc.
Zhu, Haiyan; Kwak, Hyun-Jeong; Liu, Peng; Bajrami, Besnik; Xu, Yuanfu; Park, Shin-Young; Nombela-Arrieta, Cesar; Mondal, Subhanjan; Kambara, Hiroto; Yu, Hongbo; Chai, Li; Silberstein, Leslie E.; Cheng, Tao; Luo, Hongbo R.
2017-01-01
Summary Both microbial infection and sterile inflammation augment bone marrow (BM) neutrophil production, but whether the induced accelerated granulopoiesis is mediated by a common pathway and the nature of such a pathway are poorly defined. We recently established that BM myeloid cell-derived reactive oxygen species (ROS) externally regulate myeloid progenitor proliferation and differentiation in bacteria-elicited emergency granulopoiesis. Here we show that BM ROS levels are also elevated during sterile inflammation. Similar to in microbial infection, ROS were mainly generated by the phagocytic NADPH oxidase in Gr1+ myeloid cells. The myeloid cells and their ROS were uniformly distributed in the BM when visualized by multi-photon intravital microscopy, and ROS production was both required and sufficient for sterile inflammation-elicited reactive granulopoiesis. Elevated granulopoiesis was mediated by ROS-induced PTEN oxidation and deactivation leading to upregulated PtdIns(3,4,5)P3 signaling and increased progenitor cell proliferation. Collectively, these results demonstrate that although infection-induced emergency granulopoiesis and sterile inflammation-elicited reactive granulopoiesis are triggered by different stimuli and are mediated by distinct upstream signals, the pathways converge to NADPH oxidase-dependent ROS production by BM myeloid cells. Thus, BM Gr1+ myeloid cells represent a key hematopoietic niche that supports accelerated granulopoiesis in both infective and sterile inflammation. This niche may be an excellent target in various immune-mediated pathologies or immune reconstitution after BM transplantation. PMID:28235862
Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi
2015-01-01
Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453
Yang, Qian; Wu, Wei; Li, Qian; Chen, Chan; Zhou, Ronghua; Qiu, Yanhua; Luo, Ming; Tan, Zhaoxia; Li, Shen; Chen, Gang; Zhou, Wentao; Liu, Jiaxin; Yang, Chengmin; Liu, Jin; Li, Tao
2015-01-01
Objective. Ischemia/reperfusion (I/R) injury is an unavoidable event for patients in cardiac surgery under cardiopulmonary bypass (CPB). This study was designed to investigate whether glutaraldehyde-polymerized human placenta hemoglobin (PolyPHb), a hemoglobin-based oxygen carrier (HBOC), can protect heart against CPB-induced I/R injury or not and to elucidate the underlying mechanism. Methods and Results. A standard dog CPB model with 2-hour cardiac arrest and 2-hour reperfusion was established. The results demonstrated that a low-dose PolyPHb (0.1%, w/v) provided a significant protection on the I/R heart, whereas the high-dose PolyPHb (3%, w/v) did not exhibit cardioprotective effect, as evidenced by the impaired cardiac function, decreased myocardial oxygen utilization, and elevated enzymes release and pathological changes. Further study indicated that exposure of isolated coronary arteries or human umbilical vein endothelial cells (HUVECs) to a high-dose PolyPHb caused impaired endothelium-dependent relaxation, which was companied with increased reactive oxygen species (ROS) production, reduced superoxide dismutase (SOD) activity, and elevated malonaldehyde (MDA) formation. Consistent with the increased oxidative stress, the NAD(P)H oxidase activity and subunits expression, including gp91(phox), p47(phox), p67(phox), and Nox1, were greatly upregulated. Conclusion. The high-dose PolyPHb fails to protect heart from CPB-induced I/R injury, which was due to overproduction of NAD(P)H oxidase-induced ROS and resultant endothelial dysfunction.
Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H
2014-01-01
Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.
Okamura, Yo; Inada, Mari; Elshopakey, Gehad Elsaid; Itami, Toshiaki
2018-05-16
Reactive oxygen species (ROS) play key roles in many physiological processes. In particular, the sterilization mechanism of bacteria using ROS in macrophages is a very important function for biological defense. Xanthine dehydrogenase (XDH) and aldehyde oxidase (AOX), members of the molybdo-flavoenzyme subfamily, are known to generate ROS. Although these enzymes occur in many vertebrates, some insects, and plants, little research has been conducted on XDHs and AOXs in crustaceans. Here, we cloned the entire cDNA sequences of XDH (MjXDH: 4328 bp) and AOX (MjAOX: 4425 bp) from Marsupenaeus japonicus (kuruma shrimp) using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). Quantitative real-time RT-PCR transcriptional analysis revealed that MjXDH mRNA is highly expressed in heart and stomach tissues, whereas MjAOX mRNA is highly expressed in the lymphoid organ and intestinal tissues. Furthermore, expression of MjAOX was determined to be up-regulated in the lymphoid organ in response to Vibrio penaeicida at 48 and 72 h after injection; in contrast, hydrogen peroxide (H 2 O 2 ) concentrations increased significantly at 6, 12, 48, and 72 h after injection with white spot syndrome virus (WSSV) and at 72 h after injection with V. penaeicida. To the best of our knowledge, this study is the first to have identified and cloned XDH and AOX from a crustacean species.
Si, Tong; Wang, Xiao; Wu, Lin; Zhao, Chunzhao; Zhang, Lini; Huang, Mei; Cai, Jian; Zhou, Qin; Dai, Tingbo; Zhu, Jian-Kang; Jiang, Dong
2017-01-01
Mechanical wounding is a common stress caused by herbivores or manual and natural manipulations, whereas its roles in acclimation response to a wide spectrum of abiotic stresses remain unclear. The present work showed that local mechanical wounding enhanced freezing tolerance in untreated systemic leaves of wheat plants (Triticum aestivum L.), and meanwhile the signal molecules hydrogen peroxide (H2O2) and nitric oxide (NO) were accumulated systemically. Pharmacological study showed that wounding-induced NO synthesis was substantially arrested by pretreatment with scavengers of reactive oxygen species and an inhibitor of NADPH oxidase (respiratory burst oxidase homolog, RBOH). On the contrary, wounding-induced H2O2 accumulation was not sensitive to NO synthetic inhibitors or scavenger, indicating that H2O2 acts upstream of NO in wounding signal transduction pathways. Cytochemical and vascular tissues localizations approved that RBOH-dependent H2O2 acts as long-distance signal in wounding response. Transcriptome analysis revealed that 279 genes were up-regulated in plants treated with wounding and freezing, but not in plants treated with freezing alone. Importantly, freezing- and wounding-induced genes were significantly enriched in the categories of “photosynthesis” and “signaling.” These results strongly supported that primary mechanical wounding can induce freezing tolerance in wheat through the systemic accumulation of NO and H2O2, and further modifications in photosystem and antioxidant system. PMID:28769973
Nakatsu, Yusuke; Seno, Yasuyuki; Kushiyama, Akifumi; Sakoda, Hideyuki; Fujishiro, Midori; Katasako, Aya; Mori, Keiichi; Matsunaga, Yasuka; Fukushima, Toshiaki; Kanaoka, Ryuhei; Yamamotoya, Takeshi; Kamata, Hideaki; Asano, Tomoichiro
2015-07-01
Xanthine oxidase (XO) is an enzyme involved in the production of uric acid (UA) from purine nucleotides. Numerous recent studies have revealed the likelihood of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) or steatohepatitis (NASH) to be related to hyperuricemia. However, it remains unclear whether elevated serum UA during the development of NAFLD or NASH is a cause or a consequence of these diseases. In this study, the XO inhibitor febuxostat was administered to two types of NASH model mice. Febuxostat exerted a strong protective effect against NASH development induced by a high-fat diet containing trans fatty acid (HFDT). In contrast, methionine choline-deficient-diet-induced NASH development not accompanied by hyperuricemia showed no UA normalization, suggesting that the ameliorating effect of febuxostat occurs via the normalization of hyperuricemia itself and/or accompanying molecular mechanism(s) such as oxidative stress. In the HFDT-fed mice, hyperuricemia, elevated alanine aminotransferase, and increased Tunnel-positive cells in the liver were normalized by febuxostat administration. In addition, upregulation of fatty acid oxidation-related genes, fibrotic change, and increases in collagen deposition, inflammatory cytokine expressions, and lipid peroxidation in the HFDT-fed mice were also normalized by febuxostat administration. Taken together, these observations indicate that administration of febuxostat has a protective effect against HFDT-induced NASH development, suggesting the importance of XO in its pathogenesis. Thus XO inhibitors are potentially potent therapies for patients with NASH, particularly that associated with hyperuricemia. Copyright © 2015 the American Physiological Society.
Yusseppone, Maria S; Rocchetta, Iara; Sabatini, Sebastian E; Luquet, Carlos M; Ríos de Molina, Maria Del Carmen; Held, Christoph; Abele, Doris
2018-01-01
Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O 2 /L), hypoxia (2 mg O 2 /L), and normoxia (9 mg O 2 /L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis . Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks.
Song, Si-Xin; Gao, Jun-Ling; Wang, Kai-Jie; Li, Ran; Tian, Yan-Xia; Wei, Jian-Qiang; Cui, Jian-Zhong
2013-01-01
Diffuse brain injury (DBI) is a leading cause of mortality and disability among young individuals and adults worldwide. In specific cases, DBI is associated with permanent spatial learning dysfunction and motor deficits due to primary and secondary brain damage. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) is a major complex that produces reactive oxygen species (ROS) during the ischemic period. The complex aggravates brain damage and cell death following ischemia/reperfusion injury; however, its role in DBI remains unclear. The present study aimed to investigate the hypothesis that levels of NOX2 (a catalytic subunit of NOX) protein expression and the activation of NOX are enhanced following DBI induction in rats and are involved in aggravating secondary brain damage. A rat model of DBI was created using a modified weight-drop device. Our results demonstrated that NOX2 protein expression and NOX activity were enhanced in the CA1 subfield of the hippocampus at 48 and 72 h following DBI induction. Treatment with apocynin (50 mg/kg body weight), a specific inhibitor of NOX, injected intraperitoneally 30 min prior to DBI significantly attenuated NOX2 protein expression and NOX activation. Moreover, treatment with apocynin reduced brain edema and improved spatial learning function assessed using the Morris water maze. These results reveal that treatment with apocynin may provide a new neuroprotective therapeutic strategy against DBI by diminishing the upregulation of NOX2 protein and NOX activity.
Cardioprotective properties of Crataegus oxycantha extract against ischemia-reperfusion injury.
Swaminathan, J K; Khan, M; Mohan, I K; Selvendiran, K; Niranjali Devaraj, S; Rivera, B K; Kuppusamy, P
2010-08-01
The aim of the study was to investigate the cardioprotective effect and mechanism of Crataegus oxycantha (COC) extract, a well-known natural antioxidant-based cardiotonic, against ischemia/reperfusion (I/R) injury. Electron paramagnetic resonance studies showed that COC extract was capable of scavenging superoxide, hydroxyl, and peroxyl radicals, in vitro. The cardioprotective efficacy of the extract was studied in a crystalloid perfused heart model of I/R injury. Hearts were subjected to 30min of global ischemia followed by 45min of reperfusion. During reperfusion, COC extract was infused at a dose rate of 1mg/ml/min for 10min. Hearts treated with COC extract showed a significant recovery in cardiac contractile function, reduction in infarct size, and decrease in creatine kinase and lactate dehydrogenase activities. The expressions of xanthine oxidase and NADPH oxidase were significantly reduced in the treated group. A significant upregulation of the anti-apoptotic proteins Bcl-2 and Hsp70 with simultaneous downregulation of the pro-apoptotic proteins cytochrome c and cleaved caspase-3 was observed. The molecular signaling cascade including phospho-Akt (ser-473) and HIF-1alpha that lead to the activation or suppression of apoptotic pathway also showed a significant protective role in the treatment group. No significant change in phospho-p38 levels was observed. The results suggested that the COC extract may reduce the oxidative stress in the reperfused myocardium, and play a significant role in the inhibition of apoptotic pathways leading to cardioprotection. 2010 Elsevier GmbH. All rights reserved.
Cardioprotective properties of Crataegus oxycantha extract against ischemia-reperfusion injury
Swaminathan, Jayachandran Kesavan; Khan, Mahmood; Mohan, Iyappu K; Selvendiran, Karuppaiyah; Devaraj, S. Niranjali; Rivera, Brian K.; Kuppusamy, Periannan
2010-01-01
The aim of the study was to investigate the cardioprotective effect and mechanism of Crataegus oxycantha (COC) extract, a well-known natural antioxidant-based cardiotonic, against ischemia/reperfusion (I/R) injury. Electron paramagnetic resonance studies showed that COC extract was capable of scavenging superoxide, hydroxyl, and peroxyl radicals, in vitro. The cardioprotective efficacy of the extract was studied in a crystalloid perfused heart model of I/R injury. Hearts were subjected to 30 min of global ischemia followed by 45 min of reperfusion. During reperfusion, COC extract was infused at a dose rate of 1 mg/ml/min for 10 min. Hearts treated with COC extract showed a significant recovery in cardiac contractile function, reduction in infarct size, and decrease in creatine kinase and lactate dehydrogenase activities. The expressions of xanthine oxidase and NADPH oxidase were significantly reduced in the treated group. A significant upregulation of the anti-apoptotic proteins Bcl-2 and Hsp70 with simultaneous downregulation of the pro-apoptotic proteins cytochrome c and cleaved caspase-3 was observed. The molecular signaling cascade including phospho-Akt (ser-473) and HIF-1α that lead to the activation or suppression of apoptotic pathway also showed a significant protective role in the treatment group. No significant change in phospho-p38 levels was observed. The results suggested that the COC extract may reduce the oxidative stress in the reperfused myocardium, and play a significant role in the inhibition of apoptotic pathways leading to cardioprotection. PMID:20171068
Li, Xuguang; Yang, Guangtian; Edin, Matthew L.; Zeldin, Darryl C.; Wang, Dao Wen
2014-01-01
Background Our previous studies demonstrated that C-reactive protein (CRP) acts as an inflammatory factor to induce endothelial dysfunction and hypertension in rats. The anti-inflammatory effects of statins suggest that they may attenuate CRP-induced endothelial dysfunction and hypertension in Sprague Dawley (SD) rats. Methods Male SD rats were injected with an adeno-associated virus (AAV) to induce overexpression of human CRP (AAV-hCRP) or GFP control (AAV-GFP). Two months after injection, rats were administered rosuvastatin by daily oral gavage (10 mg/kg) for two additional months. Blood pressure was monitored, serum hCRP concentrations were assessed by ELISA, and vascular levels of endothelial nitric oxide synthase (eNOS), PI3K/Akt, Rho kinase, angiotensin type 1 (AT1) receptor, MAPK, SOD-1, and NADPH oxidase was determined by immunoblotting. Results Rosuvastatin administration attenuated the increased blood pressure and loss of vascular eNOS expression in AAV-hCRP-treated rats. Rosuvastatin also activated PI3K/Akt, inhibited Rho kinase activity, and downregulated the AT1 receptor expression in aorta. Rosuvastatin reduced production of ROS through downregulation of NADPH oxidase subunit p22 phox and gp91 phox, and upregulation of SOD-1 expression. Conclusions Rosuvastatin attenuated the increase in blood pressure in AAV-hCRP-treated rats through endothelial protection and antioxidant effects. Our data reveals a novel mechanism through which statins may lower blood pressure and suggests the potential use of statins in the treatment of hypertension. PMID:21562509
Yusseppone, Maria S.; Rocchetta, Iara; Sabatini, Sebastian E.; Luquet, Carlos M.; Ríos de Molina, Maria del Carmen; Held, Christoph; Abele, Doris
2018-01-01
Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L), hypoxia (2 mg O2/L), and normoxia (9 mg O2/L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks. PMID:29527172
Coronary hemodynamic regulation by nitric oxide in experimental animals: recent advances.
Toda, Noboru; Toda, Hiroshi
2011-09-30
Nitric oxide (NO) formed via endothelial NO synthase (eNOS) plays crucial roles in the regulation of coronary blood flow through vasodilatation and decreased vascular resistance and in the inhibition of platelet aggregation and adhesion, leading to the prevention of coronary circulatory failure, thrombosis, and atherosclerosis. NO restrains myocardial oxygen consumption, when coronary perfusion is restricted. Endothelial function is impaired by pathogenic factors including smoking, excess salt intake, obesity, aging, hypercholesterolemia, hyperglycemia, and hypertension. The mechanisms involved in endothelial dysfunction are reduced NOS expression and activity, decreased NO bioavailability, and increased production of oxygen radicals and endogenous NOS inhibitors. NADPH oxidase, xanthine oxidase, and NOS uncoupling are involved in increased superoxide generation. Plasma levels of asymmetric dimethylarginine, the endogenous NOS inhibitor, are increased by an impairment of enzymatic degradation by dimethylarginine dimethylaminohydrolase and alanine-glyoxylate aminotransferase 2. Impairment of coronary arteriolar dilatation induced by perivascular nitrergic nerve activation is involved in decreased coronary blood flow. NO derived from nNOS singly or in combination with eNOS protects against serious myocardial injury through ischemic insults. Ischemia-induced iNOS upregulation contributes to myocardial contractile dysfunction. Preventive and therapeutic measures, such as improvement of life-style and treatment with therapeutic agents, to eliminate pathogenic factors for endothelial dysfunction or nNOS-derived NO deprivation would be quite important for the prophylaxis and minimizing the development of coronary artery disease. Copyright © 2011 Elsevier B.V. All rights reserved.
Wong, Agnes M F; Burkhalter, Andreas; Tychsen, Lawrence
2005-02-01
Suppression is a major sensorial abnormality in humans and monkeys with infantile strabismus. We previously reported evidence of metabolic suppression in the visual cortex of strabismic macaques, using the mitochondrial enzyme cytochrome oxidase as an anatomic label. The purpose of this study was to further elucidate alterations in cortical metabolic activity, with or without amblyopia. Six macaque monkeys were used in the experiments (four strabismic and two control). Three of the strabismic monkeys had naturally occurring, infantile strabismus (two esotropic, one exotropic). The fourth strabismic monkey had infantile microesotropia induced by alternating monocular occlusion in the first months of life. Ocular motor behaviors and visual acuity were tested after infancy in each animal, and development of stereopsis was recorded during infancy in one strabismic and one control monkey. Ocular dominance columns (ODCs) of the striate visual cortex (area V1) were labeled using cytochrome oxidase (CO) histochemistry alone, or CO in conjunction with an anterograde tracer ([H 3 ]proline or WGA-HRP) injected into one eye. Each of the strabismic monkeys showed inequalities of metabolic activity in ODCs of opposite ocularity, visible as rows of lighter CO staining, corresponding to ODCs of lower metabolic activity, alternating with rows of darker CO staining, corresponding to ODCs of higher metabolic activity. In monkeys who had infantile strabismus and unilateral amblyopia, lower metabolic activity was found in (suppressed) ODCs driven by the nondominant eye in each hemisphere. In monkeys who had infantile esotropia and alternating fixation (no amblyopia), metabolic activity was lower in ODCs driven by the ipsilateral eye in each hemisphere. The suppression included a monocular core zone at the center of ODCs and binocular border zones at the boundaries of ODCs. This suppression was not evident in the monocular lamina of the LGN, indicating an intracortical rather than subcortical mechanism. Suppression of metabolic activity in ODCs of V1 differs depending upon whether infantile strabismus is alternating or occurs in conjunction with unilateral amblyopia. Our findings reinforce the principle that unrepaired strabismus promotes abnormal competition in V1, observable as interocular suppression of ODCs.
Proline/pipecolinic acid-promoted copper-catalyzed P-arylation.
Huang, Cheng; Tang, Xu; Fu, Hua; Jiang, Yuyang; Zhao, Yufen
2006-06-23
We have developed a convenient and efficient approach for P-arylation of organophosphorus compounds containing P-H. Using commercially available and inexpensive proline and pipecolinic acid as the ligands greatly improved the efficiency of the coupling reactions, so the method can provide an entry to arylphosphonates, arylphosphinates and arylphosphine oxides.
Wren, J. J.; Wiggall, P. H.
1965-01-01
1. The conditions required for sensitive and specific colorimetric determination of proline with acidified ninhydrin were investigated. 2. A method applicable to protein samples was developed. 3. The only compound found to interfere appreciably was a hydroxyproline. PMID:14342233