Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

PubMed Central

Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

2015-01-01

Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

NASA Astrophysics Data System (ADS)

Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

2016-04-01

The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

PubMed

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

PubMed

Javed, Muhammad Babar; Shotyk, William

2018-05-10

Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

PubMed

Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

1990-03-25

The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

Apparatus for purifying exhaust gases of internal combustion engines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakinuma, O.; Oya, H.

1980-06-03

Apparatus for purifying the exhaust gases of internal combustion engines is disclosed is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a shell having an inlet chamber, catalyst chamber, and an outlet chamber. The axial lines of the inlet ports are arranged to cross each other in the inlet chamber at a position near, but upstream of, the upstream facing end of said monolithic catalyst element, so that gas flow can diffuse to the entire plane of the element.

FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.

PubMed

Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F

2015-12-01

The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

PubMed Central

Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

1995-01-01

The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

Prediction of Geomagnetic Activity and Key Parameters in High-Latitude Ionosphere-Basic Elements

NASA Technical Reports Server (NTRS)

Lyatsky, W.; Khazanov, G. V.

2007-01-01

Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere is an important task of the Space Weather program. Prediction reliability is dependent on the prediction method and elements included in the prediction scheme. Two main elements are a suitable geomagnetic activity index and coupling function -- the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity. The appropriate choice of these two elements is imperative for any reliable prediction model. The purpose of this work was to elaborate on these two elements -- the appropriate geomagnetic activity index and the coupling function -- and investigate the opportunity to improve the reliability of the prediction of geomagnetic activity and other events in the Earth's magnetosphere. The new polar magnetic index of geomagnetic activity and the new version of the coupling function lead to a significant increase in the reliability of predicting the geomagnetic activity and some key parameters, such as cross-polar cap voltage and total Joule heating in high-latitude ionosphere, which play a very important role in the development of geomagnetic and other activity in the Earth s magnetosphere, and are widely used as key input parameters in modeling magnetospheric, ionospheric, and thermospheric processes.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

PubMed Central

Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

1997-01-01

GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

Functional Intersection Area -- Oregon Department of Transportation

DOT National Transportation Integrated Search

1996-01-01

This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India

NASA Astrophysics Data System (ADS)

Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti

2017-09-01

Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

PubMed

Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

2002-04-24

The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

PubMed Central

Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

2015-01-01

Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Efficient activation of transcription in yeast by the BPV1 E2 protein.

PubMed Central

Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

1989-01-01

The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

PubMed

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

Contactor/filter improvements

DOEpatents

Stelman, David

1989-01-01

A contactor/filter arrangement for removing particulate contaminants from a gaseous stream includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. The housing further includes a gas inlet means, a gas outlet means, and means for moving a body of granular material through the zone. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. Disposed on the upstream face of the filter element is a cover screen which isolates the filter element from contact with the moving granular bed and collects a portion of the particulates so as to form a dust cake having openings small enough to exclude the granular material, yet large enough to receive the dust particles. In one embodiment, the granular material is comprised of prous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses.

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

2006-07-07

In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene

PubMed Central

Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.

2008-01-01

Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

PubMed Central

Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

2010-01-01

POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Vertical distribution of trace-element concentrations and occurrence of metallurgical slag particles in accumulated bed sediments of Lake Roosevelt, Washington, September 2002

USGS Publications Warehouse

Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.

2005-01-01

Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization

PubMed Central

Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela

2004-01-01

Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906

Contactor/filter improvements

DOEpatents

Stelman, D.

1988-06-30

A contactor/filter arrangement for removing particulate contaminants from a gaseous stream is described. The filter includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. A cover screen isolates the filter element from contact with the moving granular bed. In one embodiment, the granular material is comprised of porous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses. 6 figs.

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).

PubMed

Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng

2017-06-01

ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

A novel mode of enhancer evolution: The Tal1 stem cell enhancer recruited a MIR element to specifically boost its activity

PubMed Central

Smith, Aileen M.; Sanchez, Maria-Jose; Follows, George A.; Kinston, Sarah; Donaldson, Ian J.; Green, Anthony R.; Göttgens, Berthold

2008-01-01

Altered cis-regulation is thought to underpin much of metazoan evolution, yet the underlying mechanisms remain largely obscure. The stem cell leukemia TAL1 (also known as SCL) transcription factor is essential for the normal development of blood stem cells and we have previously shown that the Tal1 +19 enhancer directs expression to hematopoietic stem cells, hematopoietic progenitors, and to endothelium. Here we demonstrate that an adjacent region 1 kb upstream (+18 element) is in an open chromatin configuration and carries active histone marks but does not function as an enhancer in transgenic mice. Instead, it boosts activity of the +19 enhancer both in stable transfection assays and during differentiation of embryonic stem (ES) cells carrying single-copy reporter constructs targeted to the Hprt locus. The +18 element contains a mammalian interspersed repeat (MIR) which is essential for the +18 function and which was transposed to the Tal1 locus ∼160 million years ago at the time of the mammalian/marsupial branchpoint. Our data demonstrate a previously unrecognized mechanism whereby enhancer activity is modulated by a transposon exerting a “booster” function which would go undetected by conventional transgenic approaches. PMID:18687876

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

1989-02-01

We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

PubMed

Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

2008-08-01

Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

Apparatus for purifying exhaust gases of internal combustion engines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakinuma, A.; Oya, H.

1980-06-03

Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Observations on the Growth of Roughness Elements Into Icing Feathers

NASA Technical Reports Server (NTRS)

Vargas, Mario; Tsao, Jen, Ching

2007-01-01

This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

PubMed Central

Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

2005-01-01

Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Application of finite element approach to transonic flow problems

NASA Technical Reports Server (NTRS)

Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.

1976-01-01

A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.

The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

PubMed Central

Lu, X; Welsh, T M; Peterlin, B M

1993-01-01

The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

Optimal frequency-response sensitivity of compressible flow over roughness elements

NASA Astrophysics Data System (ADS)

Fosas de Pando, Miguel; Schmid, Peter J.

2017-04-01

Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

PubMed

Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

2015-12-01

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

Near-field flow structures about subcritical surface roughness

NASA Astrophysics Data System (ADS)

Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.

2014-12-01

Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.

Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

PubMed

Wang, F; Samudio, I; Safe, S

2001-01-01

The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

Shielded regeneration heating element for a particulate filter

DOEpatents

Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI

2011-01-04

An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Involvement of activator protein 1 complexes in the epithelium-specific activation of the laminin gamma2-chain gene promoter by hepatocyte growth factor (scatter factor).

PubMed Central

Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P

2000-01-01

Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670

TPA can overcome the requirement for EIa and together act synergistically in stimulating expression of the adenovirus EIII promoter.

PubMed Central

Buckbinder, L; Miralles, V J; Reinberg, D

1989-01-01

We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

PubMed

Yamasu, K; Wilt, F H

1999-02-01

The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

Hydrochemical study of an arsenic-contaminated plain in Guandu, north Taiwan

NASA Astrophysics Data System (ADS)

Hsiao, Yu-Hsiang

2015-04-01

Arsenic pollution in Guandu Plain, north Taiwan is a critical issue due to highly developed anthropogenic activities. It was considered that arsenic was carried in by surface water system. Two major rivers, Huanggang Creek and South Huang Greek, flow through Guandu Plain. Both creeks originate from Tatung Volcano Group, which is extensively active in post-volcanic activities. In this study, the hydrochemistry along the two major rivers was studied for tracing the source of arsenic pollution in Guandu Plain. The pH values in the upstream water are in the range from 6 to 8 but dramatically decrease down to 2-4.5 in the downstream area. It can be concluded that the creeks are recharged with very low pH geothermal water. In addition, arsenic shows a different spatial distribution. In Huanggang Creek, arsenic concentration is much higher, about 200 ppb to 500 ppb, in the downstream than in the upstream while arsenic concentration is extremely low, below 1 ppb, in the downstream of South Huang Greek. The geochemical results show that rare earth elements (REEs) are depleted in the upstream both in Huanggang creek and South Huang creek, and the NASC-normalized ratios of heavy to light REE (Lu/La) in the upstream are very close to 1. This demonstrates that the upstream water is geochemically dominated by the interaction between water and sedimentary rock. In the downstream, the NASC-normalized REE pattern shows a quit different type which is depleted in light REEs (much higher Lu/La ratio). It is well known that igneous rock is depleted in light REEs; therefore, arsenic is possibly volcanic origin. In this study, PHREEQC, a thermodynamic modeling program, was also utilized to calculate the saturation index (SI) of hydrous ferric oxide (HFO), which can effectively scavenge arsenic in water. The results demonstrate that SI of HFO is mainly controlled by pH in this study. When pH is greater than 3.5, HFO start to precipitate and remove arsenic from water. Therefore, it is believed that the arsenic pollution in Guandu Plain could result from HFO co-precipitation due to the increase of pH when Huanggang creek and South Huang creek flow through the land.

Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae

PubMed Central

Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi

2016-01-01

Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3′ untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3′-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall–related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide. PMID:27845367

Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae.

PubMed

Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi

2016-11-15

Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3' untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3'-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall-related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

PubMed

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Serial killers: ordering caspase activation events in apoptosis.

PubMed

Slee, E A; Adrain, C; Martin, S J

1999-11-01

Caspases participate in the molecular control of apoptosis in several guises; as triggers of the death machinery, as regulatory elements within it, and ultimately as a subset of the effector elements of the machinery itself. The mammalian caspase family is steadily growing and currently contains 14 members. At present, it is unclear whether all of these proteases participate in apoptosis. Thus, current research in this area is focused upon establishing the repertoire and order of caspase activation events that occur during the signalling and demolition phases of cell death. Evidence is accumulating to suggest that proximal caspase activation events are typically initiated by molecules that promote caspase aggregation. As expected, distal caspase activation events are likely to be controlled by caspases activated earlier in the cascade. However, recent data has cast doubt upon the functional demarcation of caspases into signalling (upstream) and effector (downstream) roles based upon their prodomain lengths. In particular, caspase-3 may perform an important role in propagating the caspase cascade, in addition to its role as an effector caspase within the death programme. Here, we discuss the apoptosis-associated caspase cascade and the hierarchy of caspase activation events within it.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

The KRAS Promoter Responds to Myc-associated Zinc Finger and Poly(ADP-ribose) Polymerase 1 Proteins, Which Recognize a Critical Quadruplex-forming GA-element*

PubMed Central

Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.

2010-01-01

The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603

Transcriptional activation of Mina by Sp1/3 factors.

PubMed

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Transcriptional Activation of Mina by Sp1/3 Factors

PubMed Central

Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

PubMed Central

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

2012-01-01

The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

PubMed

Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

2010-02-01

GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

Particle Velocity Measuring System

NASA Technical Reports Server (NTRS)

Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)

1998-01-01

Method and apparatus are provided for determining the velocity of individual food particles within a liquid/solid food mixture that is cooked by an aseptic cooking method whereby the food mixture is heated as it flows through a flowline. At least one upstream and at least one downstream microwave transducer are provided to determine the minimum possible travel time of the fastest food particle through the flowline. In one embodiment, the upstream detector is not required. In another embodiment, a plurality of small dipole antenna markers are secured to a plurality of food particles to provide a plurality of signals as the markers pass the upstream and downstream transducers. The dipole antenna markers may also include a non-linear element to reradiate a harmonic frequency of a transmitter frequency. Upstream and downstream transducers include dipole antennas that are matched to the impedance of the food slurry and a signal transmission cable by various impedance matching means including unbalanced feed to the antennas.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

The human apolipoprotein AV gene is regulated by peroxisome proliferator-activated receptor-alpha and contains a novel farnesoid X-activated receptor response element.

PubMed

Prieur, Xavier; Coste, Herve; Rodriguez, Joan C

2003-07-11

The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.

PubMed

Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R

1989-01-01

Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin promoter in vitro.

Expression of AtWRKY33 encoding a pathogen- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements.

PubMed

Lippok, Bernadette; Birkenbihl, Rainer P; Rivory, Gaelle; Brümmer, Janna; Schmelzer, Elmon; Logemann, Elke; Somssich, Imre E

2007-04-01

WRKY transcription factors regulate distinct parts of the plant defense transcriptome. Expression of many WRKY genes themselves is induced by pathogens or pathogen-mimicking molecules. Here, we demonstrate that Arabidopsis WRKY33 responds to various stimuli associated with plant defense as well as to different kinds of phytopathogens. Although rapid pathogen-induced AtWRKY33 expression does not require salicylic acid (SA) signaling, it is dependent on PAD4, a key regulator upstream of SA. Activation of AtWRKY33 is independent of de novo protein synthesis, suggesting that it is at least partly under negative regulatory control. We show that a set of three WRKY-specific cis-acting DNA elements (W boxes) within the AtWRKY33 promoter is required for efficient pathogen- or PAMP-triggered gene activation. This strongly indicates that WRKY transcription factors are major components of the regulatory machinery modulating immediate to early expression of this gene in response to pathogen attack.

Molecular epidemiology of nga and NAD glycohydrolase/ADP-ribosyltransferase activity among Streptococcus pyogenes causing streptococcal toxic shock syndrome.

PubMed

Stevens, D L; Salmi, D B; McIndoo, E R; Bryant, A E

2000-10-01

Severe invasive group A streptococcal (GAS) infections emerged in the late 1980s, yet no single virulence factor has been common to all isolates from infected patients. A strong association was recently found between isolates of such cases (regardless of M type) and the production of NAD glycohydrolase (NADase). Of interest, all M-1 strains isolated after 1988 were positive for NADase, whereas virtually all M-1 GAS were previously negative for NADase. Genetic analysis demonstrated that GAS isolates were >96% identical in nga and >99% identical in their upstream regulatory sequences. Furthermore, because NADase-negative strains did not produce immunoreactive NADase, we concluded that additional regulatory element(s) control NADase production. NADase purified from GAS altered neutrophil-directed migration and chemiluminescence responses and had potent ADP-ribosyltransferase activity. In summary, the temporal relationship of NADase expression, alone or with other streptococcal virulence factors, may contribute to the pathogenesis of invasive GAS infections.

Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

USGS Publications Warehouse

Boughton, G.K.

2001-01-01

Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

Computation of Feedback Aeroacoustic System by the CE/SE Method

NASA Technical Reports Server (NTRS)

Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

2000-01-01

It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

PubMed Central

Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

2015-01-01

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

PubMed

Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

2014-08-01

Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Expression of the alaE gene is positively regulated by the global regulator Lrp in response to intracellular accumulation of l-alanine in Escherichia coli.

PubMed

Ihara, Kohei; Sato, Kazuki; Hori, Hatsuhiro; Makino, Yumiko; Shigenobu, Shuji; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi

2017-04-01

The alaE gene in Escherichia coli encodes an l-alanine exporter that catalyzes the active export of l-alanine using proton electrochemical potential. In our previous study, alaE expression was shown to increase in the presence of l-alanyl-l-alanine (Ala-Ala). In this study, the global regulator leucine-responsive regulatory protein (Lrp) was identified as an activator of the alaE gene. A promoter less β-galactosidase gene was fused to an alaE upstream region (240 nucleotides). Cells that were lacZ-deficient and harbored this reporter plasmid showed significant induction of β-galactosidase activity (approximately 17-fold) in the presence of 6 mM l-alanine, l-leucine, and Ala-Ala. However, a reporter plasmid possessing a smaller alaE upstream region (180 nucleotides) yielded transformants with strikingly low enzyme activity under the same conditions. In contrast, lrp-deficient cells showed almost no β-galactosidase induction, indicating that Lrp positively regulates alaE expression. We next performed an electrophoretic mobility shift assay (EMSA) and a DNase I footprinting assay using purified hexahistidine-tagged Lrp (Lrp-His). Consequently, we found that Lrp-His binds to the alaE upstream region spanning nucleotide -161 to -83 with a physiologically relevant affinity (apparent K D , 288.7 ± 83.8 nM). Furthermore, the binding affinity of Lrp-His toward its cis-element was increased by l-alanine and l-leucine, but not by Ala-Ala and d-alanine. Based on these results, we concluded that the gene expression of the alaE is regulated by Lrp in response to intracellular levels of l-alanine, which eventually leads to intracellular homeostasis of l-alanine concentrations. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Spatial characterization, risk assessment, and statistical source identification of the dissolved trace elements in the Ganjiang River-feeding tributary of the Poyang Lake, China.

PubMed

Zhang, Hua; Jiang, Yinghui; Wang, Min; Wang, Peng; Shi, Guangxun; Ding, Mingjun

2017-01-01

Surface water samples were collected from 20 sampling sites throughout the Ganjiang River during pre-monsoon, monsoon, and post-monsoon seasons, and the concentrations of dissolved trace elements were determined by inductively coupled plasma-mass spectrometry (ICP-MS) for the spatial and seasonal variations, risk assessment, source identification, and categorization for risk area. The result demonstrated that concentrations of the elements exhibited significant seasonality. The high total element concentrations were detected at sites close to the intensive mining and urban activities. The concentrations of the elements were under the permissible limits as prescribed by related standards with a few exceptions. The most of heavy metal pollution index (HPI) values were lower than the critical index limit, indicating the basically clean water used as habitat for aquatic life. As was identified as the priority pollutant of non-carcinogenic and carcinogenic concerns, and the inhabitants ingesting the surface water at particular site might be subjected to the integrated health risks for exposure to the mixed trace elements. Multivariate statistical analyses confirmed that Zn, As, Cd, and Tl were derived from mining and urban activities; V, Cd, and Pb exhibited mixed origin; and Co, Ni, and Cu mainly resulted from natural processes. Three categorized risk areas corresponded to high, moderate, and low risks, respectively. As a whole, the upstream of the Ganjiang River was identified as the high-risk area relatively.

Src is a major signaling component for CTGF induction by TGF-β1 in osteoblasts

PubMed Central

X, Zhang; JA, Arnott; S, Rehman; WG, DeLong; A, Sanjay; FF, Safadi; SN, Popoff

2010-01-01

Connective tissue growth factor (CTGF/CCN2) is induced by transforming growth factor beta 1(TGF-β1) where it acts as a downstream mediator of TGF-β1 induced matrix production in osteoblasts. We have shown the requirement of Src, Erk and Smad signaling for CTGF induction by TGF-β1 in osteoblasts, however the potential interaction among these signaling pathways remains undetermined. In this study we demonstrate that TGF-β1 activates Src kinase in ROS17/2.8 cells and that treatment with the Src family kinase inhibitor PP2 prevents Src activation and CTGF induction by TGF-β1. Additionally, inhibiting Src activation prevented Erk activation, Smad 2 & 3 activation and nuclear translocation by TGF-β1, demonstrating that Src is an essential upstream signaling partner of both Erk and Smads in osteoblasts. MAPKs such as Erk can modulate the Smad pathway through directly mediating the phosphorylation of Smads or indirectly through activation/inactivation of required nuclear co-activators that mediate Smad DNA binding. When we treated cells with the Erk inhibitor, PD98059 it inhibited TGF-β1-induced CTGF protein expression but had no effect on Src activation, Smad activation or Smad nuclear translocation. However PD98059 impaired transcriptional complex formation on the Smad binding element (SBE) on the CTGF promoter, demonstrating that Erk activation was required for SBE transactivation. This data demonstrates that Src is an essential upstream signaling transducer of Erk and Smad signaling with respect to TGF-β1 in osteoblasts and that Smads and Erk function independently but are both essential for forming a transcriptionally active complex on the CTGF promoter in osteoblasts. PMID:20432467

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Nuclear reactor control

DOEpatents

Cawley, William E.; Warnick, Robert F.

1982-01-01

1. In a nuclear reactor incorporating a plurality of columns of tubular fuel elements disposed in horizontal tubes in a mass of graphite wherein water flows through the tubes to cool the fuel elements, the improvement comprising at least one control column disposed in a horizontal tube including fewer fuel elements than in a normal column of fuel elements and tubular control elements disposed at both ends of said control column, and means for varying the horizontal displacement of the control column comprising a winch at the upstream end of the control column and a cable extending through the fuel and control elements and attached to the element at the downstream end of the column.

Valuating Indonesian upstream oil management scenario through system dynamics modelling

NASA Astrophysics Data System (ADS)

Ketut Gunarta, I.; Putri, F. A.

2018-04-01

Under the existing regulation in Constitution Number 22 Year 2001 (UU No 22 Tahun 2001), Production Sharing Contract (PSC) continues to be the scenario in conducting oil and gas upstream mining activities as the previous regulation (UU No. 8 Tahun 1971). Because of the high costs and risks in upstream mining activities, the contractors are dominated by foreign companies, meanwhile National Oil Company (NOC) doesn’t act much. The domination of foreign contractor companies also warned Indonesia in several issues addressing to energy independence and energy security. Therefore, to achieve the goals of energy which is independence and security, there need to be a revision in upstream oil activities regulating scenario. The scenarios will be comparing the current scenario, which is PSC, with the “full concession” scenario for National Oil Company (NOC) in managing oil upstream mining activities. Both scenario will be modelled using System Dynamics methodology and assessed furthermore using financial valuation method of income approach. Under the 2 scenarios, the author will compare which scenario is better for upstream oil management in reaching the goals mentioned before and more profitable in financial aspect. From the simulation, it is gathered that concession scenario offers better option than PSC in reaching energy independence and energy security.

Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

PubMed Central

Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

2007-01-01

Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

PubMed

Lee, M O; Liu, Y; Zhang, X K

1995-08-01

The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.

Computational methods in sequence and structure prediction

NASA Astrophysics Data System (ADS)

Lang, Caiyi

This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

NASA Astrophysics Data System (ADS)

Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

2004-12-01

Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed Central

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-01-01

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene. Images PMID:2602141

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-12-11

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene.

Naturally occurring phenolic acids modulate TPA-induced activation of EGFR, AP-1, and STATs in mouse epidermis.

PubMed

Cichocki, Michał; Dałek, Miłosz; Szamałek, Mateusz; Baer-Dubowska, Wanda

2014-01-01

Epidermal growth factor receptor (EGFR) plays an important role in epithelial carcinogenesis and appears to be involved in STATs activation. In this study we investigated the possible interference of naturally occurring phenolic acids with EGFR, activator protein-1 (AP-1), and signal transducers and activators of transcription (STATs) pathways activated by topical application of tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in Balb/c mice epidermis. Pretreatment with tannic or chlorogenic acid resulted in a significant decrease in the phosphorylation of EGFR Y-1068 and Y-1173 tyrosine residues, which was accompanied by reduced activation of AP-1. Tannic acid decreased also the c-Jun AP-1 subunit level and binding to TPA response element (TRE) (3- and 2-fold in comparison with TPA-treated group respectively). Simultaneous reduction of JNK activity might be responsible for reduced activation of AP-1. In contrast to these more complex phenolics, protocatechuic acid increased the activity of JNK and was also the most efficient inhibitor of STATs activation. These results indicate that naturally occurring phenolic acids, by decreasing EGFR, AP-1, and STATs activation, may modulate other elements both upstream and downstream in these pathways and thus inhibit the tumor development. Although more complex phenolics affect mainly the EGFR/AP-1 pathway, STATs seem to be the most important targets for simple compounds, such as protocatechuic acid.

Immortalization-susceptible elements and their binding factors mediate rejuvenation of regulation of the type I collagenase gene in simian virus 40 large T antigen-transformed immortal human fibroblasts.

PubMed Central

Imai, S; Fujino, T; Nishibayashi, S; Manabe, T; Takano, T

1994-01-01

Dramatic changes occur in expression of the type I collagenase gene during the process of immortalization in simian virus 40 large T antigen-transformed human fibroblasts (S. Imai and T. Takano, Biochem. Biophys. Res. Commun. 189:148-153, 1992). From transient transfection assays, it was determined that these changes involved the functions of two immortalization-susceptible cis-acting elements, ISE1 and ISE2, located in a 100-bp region about 1.7 kb upstream. The profiles of binding of an activator, Proserpine, to the enhancer ISE1 were similar in the extracts of young, senescent preimmortalized and immortalized cells. ISE2 contained both negative and positive regulatory elements located adjacent to each other. The positive regulatory element consisted of a tandem array of putative Ets family- and AP-1-binding sites. An activator, Pluto, interacted with this positive regulatory element and had an AP-1-related component as a complex. The binding activity of Pluto was predominantly detected only in the extract from senescent preimmortalized cells. In contrast, a repressor, Orpheus, which bound to the ATG-rich negative regulatory element of ISE2, was prominently detected in extracts from both young preimmortalized and immortalized cells and appeared to suppress transcription in an orientation-dependent manner. Thus, the interplay of Pluto and Orpheus was suggested to be crucial for regulation of the collagenase gene accompanying in vitro aging and immortalization. Proserpine seemed to interact with Pluto to mediate strong expression of the collagenase gene in cellular senescence. On the basis of these results, we propose a model for regulation of the collagenase gene during in vitro aging and immortalization. Images PMID:7935433

Differential Effects of Ethanol on c-Jun N-Terminal Kinase, 14-3-3 Proteins, and Bax in Postnatal Day 4 and Postnatal Day 7 Rat Cerebellum

PubMed Central

Heaton, Marieta Barrow; Paiva, Michael; Kubovic, Stacey; Kotler, Alexandra; Rogozinski, Jonathan; Swanson, Eric; Madorsky, Vladimir; Posados, Michelle

2011-01-01

These studies investigated ethanol effects on upstream cellular elements and interactions which contribute to Bax-related apoptosis in neonatal rat cerebellum at ages of peak ethanol sensitivity (postnatal day 4 [P4]), compared to later ages of relative resistance (P7). Analyses were made of basal levels of the pro-apoptotic c-jun N-termimal kinase (JNK), Bax, and the 14-3-3 anchoring proteins, as well as the responsiveness of these substances to ethanol at P4 versus P7. Dimerization of Bax with 14-3-3 was also investigated at the two ages following ethanol treatment, a process which sequesters Bax in the cytosol, thus inhibiting its mitochondrial translocation and disruption of the mitochondrial membrane potential. Cultured cerebellar granule cells were used to examine the protective potential of JNK inhibition on ethanol-mediated cell death. Basal levels of JNK were significantly higher at P4 than P7, but no differences in the other proteins were found. Activated JNK, and cytosolic and mitochondrially-translocated Bax were increased in P4 but not P7 animals following ethanol exposure, while protective 14-3-3 proteins were increased only at P7. Ethanol treatment resulted in decreases in Bax:14-3-3 heterodimers at P4, but not at P7. Inhibition of JNK activity in vitro provided partial protection against ethanol neurotoxicity. Thus, differential temporal vulnerability to ethanol in this CNS region correlates with differences in both levels of apoptosis-related substances (e.g., JNK), and differential cellular responsiveness, favoring apoptosis at the most sensitive age and survival at the resistant age. The upstream elements contributing to this vulnerability can be targets for future therapeutic strategies. PMID:22169498

Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

PubMed

Sweet, D H; Jang, Y K; Sancar, G B

1997-11-01

In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Nutrient, suspended sediment, and trace element loads in the Blackstone River Basin in Massachusetts and Rhode Island, 2007 to 2009

USGS Publications Warehouse

Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.

2015-01-01

Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.

Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

PubMed

Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

2011-04-29

Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

DTIC Science & Technology

1976-11-01

periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

PubMed Central

Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

1988-01-01

To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

PubMed

Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

2014-02-01

Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

Degrees of connectivity: Systems model for upstream risk assessment and mitigation.

PubMed

Gambatese, John; AlOmari, Kasim

2016-08-01

There is growing recognition that in order to further improve safety performance, attention needs to be given beyond the immediate working conditions and worker actions. A systems approach to construction safety enables considering: multiple project elements simultaneously; connections between different elements; and all system elements affected by safety risk. This paper describes recent and current research to conceptualize a typical building project in terms of connections between workers, activities, and design elements, and to verify and analyze impacts of the design and worker interactions on worker safety. Prior research provides the basis for a network tying the design elements, construction activities, and work crews on a typical building project together along with the extent of interaction between each of the system elements in terms of safety. In conjunction with this systems approach, the researchers propose a concept for viewing and managing construction safety through four different types of connections, or "degrees of connectivity," between the different workers, activities, and design elements in the system. The degrees of connectivity are defined as: interacting with the design element during its construction (DoC #1); interacting with the design element in its final form to attach another component to it (DoC #2) or by working in the vicinity of it (DoC #3); and indirectly interacting with the design element through another worker (DoC #4). To support and verify the presence of the concept in practice, the researchers conducted a survey of construction personnel. The survey results confirm that the four different degrees of connectivity are present and felt during construction operations, and indicate that attention should be given to all design elements, activities, and workers to which a worker is "connected". According to the survey respondents, DoC's #1 and #2 are recognized as the most widely present on construction sites. Eighty percent of the respondents believe that the design element has a moderate or greater impact on worker safety while it is being constructed. These initial research steps provide the starting point for continuing study that aims to develop and demonstrate the degrees of connectivity concept linking workers and design elements, with the goal of understanding how to design a project and work operations in order to improve safety during construction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1.

PubMed

Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian

2012-05-06

Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.

Long-term memory deficits in Pavlovian fear conditioning in Ca2+/calmodulin kinase kinase alpha-deficient mice.

PubMed

Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A

2006-12-01

Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

PubMed Central

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Effects of metals on a montane aquatic system evaluated using an integrated assessment approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beltman, D.; Lipton, J.; Cacela, D.

Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less

Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

PubMed

Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

2018-03-01

Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression.

PubMed

McCullen, M V; Li, H; Cam, M; Sen, S K; McVicar, D W; Anderson, S K

2016-09-01

The variegated expression of murine Ly49 loci has been associated with the probabilistic behavior of an upstream promoter active in immature cells, the Pro1 element. However, recent data suggest that Pro1 may be active in mature natural killer (NK) cells and function as an enhancer element. To assess directly if Pro1 transcripts are present in mature Ly49-expressing NK cells, RNA-sequencing of the total transcript pool was performed on freshly isolated splenic NK cells sorted for expression of either Ly49G or Ly49I. No Pro1 transcripts were detected from the Ly49a, Ly49c or Ly49i genes in mature Ly49(+) NK cells that contained high levels of Pro2 transcripts. Low levels of Ly49g Pro1 transcripts were found in both Ly49G(+) and Ly49G(-) populations, consistent with the presence of a small population of mature NK cells undergoing Ly49g gene activation, as previously demonstrated by culture of splenic NK cells in interleukin-2. Ly49 gene reporter constructs containing Pro1 failed to show any enhancer activity of Pro1 on Pro2 in a mature Ly49-expressing cell line. Taken together, the results are consistent with Pro1 transcription having a role in gene activation in developing NK, and argue against a role for Pro1 in Ly49 gene transcription by mature NK cells.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

PubMed

Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

2015-07-13

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Transcriptional regulation of Saccharomyces cerevisiaeCYS3 encoding cystathionine γ-lyase

PubMed Central

Hiraishi, Hiroyuki; Miyake, Tsuyoshi

2008-01-01

In studying the regulation of GSH11, the structural gene of the high-affinity glutathione transporter (GSH-P1) in Saccharomyces cerevisiae, a cis-acting cysteine responsive element, CCGCCACAC (CCG motif), was detected. Like GSH-P1, the cystathionine γ-lyase encoded by CYS3 is induced by sulfur starvation and repressed by addition of cysteine to the growth medium. We detected a CCG motif (−311 to −303) and a CGC motif (CGCCACAC; −193 to −186), which is one base shorter than the CCG motif, in the 5′-upstream region of CYS3. One copy of the centromere determining element 1, CDE1 (TCACGTGA; −217 to −210), being responsible for regulation of the sulfate assimilation pathway genes, was also detected. We tested the roles of these three elements in the regulation of CYS3. Using a lacZ-reporter assay system, we found that the CCG/CGC motif is required for activation of CYS3, as well as for its repression by cysteine. In contrast, the CDE1 motif was responsible for only activation of CYS3. We also found that two transcription factors, Met4 and VDE, are responsible for activation of CYS3 through the CCG/CGC and CDE1 motifs. These observations suggest a dual regulation of CYS3 by factors that interact with the CDE1 motif and the CCG/CGC motifs. PMID:18317767

Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

PubMed

Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

2017-09-19

A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Asian clam Corbicula fluminea as a biomonitor of trace element contamination: Accounting for different sources of variation using an hierarchical linear model

USGS Publications Warehouse

Shoults-Wilson, W. A.; Peterson, J.T.; Unrine, J.M.; Rickard, J.; Black, M.C.

2009-01-01

In the present study, specimens of the invasive clam, Corbicula fluminea, were collected above and below possible sources of potentially toxic trace elements (As, Cd, Cr, Cu, Hg, Pb, and Zn) in the Altamaha River system (Georgia, USA). Bioaccumulation of these elements was quantified, along with environmental (water and sediment) concentrations. Hierarchical linear models were used to account for variability in tissue concentrations related to environmental (site water chemistry and sediment characteristics) and individual (growth metrics) variables while identifying the strongest relations between these variables and trace element accumulation. The present study found significantly elevated concentrations of Cd, Cu, and Hg downstream of the outfall of kaolin-processing facilities, Zn downstream of a tire cording facility, and Cr downstream of both a nuclear power plant and a paper pulp mill. Models of the present study indicated that variation in trace element accumulation was linked to distance upstream from the estuary, dissolved oxygen, percentage of silt and clay in the sediment, elemental concentrations in sediment, shell length, and bivalve condition index. By explicitly modeling environmental variability, the Hierarchical linear modeling procedure allowed the identification of sites showing increased accumulation of trace elements that may have been caused by human activity. Hierarchical linear modeling is a useful tool for accounting for environmental and individual sources of variation in bioaccumulation studies. ?? 2009 SETAC.

Stimulatory and inhibitory mechanisms of slow muscle-specific myosin heavy chain gene expression in fish: Transient and transgenic analysis of torafugu MYH{sub M86-2} promoter in zebrafish embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asaduzzaman, Md.; Kinoshita, Shigeharu, E-mail: akino@mail.ecc.u-tokyo.ac.jp; Bhuiyan, Sharmin Siddique

The myosin heavy chain gene, MYH{sub M86-2}, exhibited restricted expression in slow muscle fibers of torafugu embryos and larvae, suggesting its functional roles for embryonic and larval muscle development. However, the transcriptional mechanisms involved in its expression are still ambiguous. The present study is the first extensive analysis of slow muscle-specific MYH{sub M86-2} promoter in fish for identifying the cis-elements that are crucial for its expression. Combining both transient transfection and transgenic approaches, we demonstrated that the 2614 bp 5′-flanking sequences of MYH{sub M86-2} contain a sufficient promoter activity to drive gene expression specific to superficial slow muscle fibers. Bymore » cyclopamine treatment, we also demonstrated that the differentiation of such superficial slow muscle fibers depends on hedgehog signaling activity. The deletion analyses defined an upstream fragment necessary for repressing ectopic MYH{sub M86-2} expression in the fast muscle fibers. The transcriptional mechanism that prevents MYH{sub M86-2} expression in the fast muscle fibers is mediated through Sox6 binding elements. We also demonstrated that Sox6 may function as a transcriptional repressor of MYH{sub M86-2} expression. We further discovered that nuclear factor of activated T cells (NFAT) binding elements plays a key role and myocyte enhancer factor-2 (MEF2) binding elements participate in the transcriptional regulation of MYH{sub M86-2} expression. - Highlights: ► MYH{sub M86-2} is highly expressed in slow muscle fibers of torafugu embryos and larvae. ► MYH{sub M86-2} promoter activity depends on the hedgehog signaling. ► Sox6 binding elements inhibits MYH{sub M86-2} expression in fast muscle fibers. ► Sox6 elements function as transcriptional repressor of MYH{sub M86-2} promoter activity. ► NFAT and MEF2 binding elements play a key role for directing MYH{sub M86-2} expression.« less

Culvert roughness elements for native Utah fish passage : phase II.

DOT National Transportation Integrated Search

2012-04-01

Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...

Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements.

PubMed

Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

2015-04-21

Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.

OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.).

PubMed

Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng

2014-01-01

Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

PubMed

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Control site location and transcriptional regulation in Escherichia coli.

PubMed Central

Collado-Vides, J; Magasanik, B; Gralla, J D

1991-01-01

The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

Exposure of insects and insectivorous birds to metals and other elements from abandoned mine tailings in three Summit County drainages, Colorado

USGS Publications Warehouse

Custer, Christine M.; Yang, C.; Crock, J.G.; Shearn-Bochsler, V.; Smith, K.S.; Hageman, P.L.

2009-01-01

Concentrations of 31 metals, metalloids, and other elements were measured in insects and insectivorous bird tissues from three drainages with different geochemistry and mining histories in Summit Co., Colorado, in 2003, 2004, and 2005. In insect samples, all 25 elements that were analyzed in all years increased in both Snake and Deer Creeks in the mining impacted areas compared to areas above and below the mining impacted areas. This distribution of elements was predicted from known or expected sediment contamination resulting from abandoned mine tailings in those drainages. Element concentrations in avian liver tissues were in concordance with levels in insects, that is with concentrations higher in mid-drainage areas where mine tailings were present compared to both upstream and downstream locations; these differences were not always statistically different, however. The lack of statistically significant differences in liver tissues, except for a few elements, was due to relatively small sample sizes and because many of these elements are essential and therefore well regulated by the bird's homeostatic processes. Most elements were at background concentrations in avian liver tissue except for Pb which was elevated at mid-drainage sites to levels where ??-aminolevulinic acid dehydratase activity was inhibited at other mining sites in Colorado. Lead exposure, however, was not at toxic levels. Fecal samples were not a good indication of what elements birds ingested and were potentially exposed to. ?? Springer Science+Business Media B.V. 2008.

The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

PubMed Central

Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

1997-01-01

The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Functional characterization of the 5'-flanking and the promoter region of the human UCP3 (hUCP3) gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U

2000-09-22

Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.

Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

PubMed

Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

2015-02-01

DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

PubMed Central

Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret

2015-01-01

ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636

Prototyping phase of the high heat flux scraper element of Wendelstein 7-X

DOE PAGES

Boscary, Jean; Greuner, Henri; Ehrke, G.; ...

2016-03-24

The water-cooled high heat flux scraper element aims to reduce excessive heat loads on the target element ends of the actively cooled divertor of Wendelstein 7-X. Its purpose is to intercept some of the plasma fluxes both upstream and downstream before they reach the divertor surface. The scraper element has 24 identical plasma facing components (PFCs) divided into 6 modules. One module has 4 PFCs hydraulically connected in series by 2 water boxes. A PFC, 247 mm long and 28 mm wide, has 13 monoblocks made of CFC NB31 bonded by hot isostatic pressing onto a CuCrZr cooling tube equippedmore » with a copper twisted tape. 4 full-scale prototypes of PFCs have been successfully tested in the GLADIS facility up to 20 MW/m 2. The difference observed between measured and calculated surface temperatures is probably due to the inhomogeneity of CFC properties. The design of the water box prototypes has been detailed to allow the junction between the cooling pipe of the PFCs and the water boxes by internal orbital welding. In conclusion, the prototypes are presently under fabrication.« less

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

PubMed Central

Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

1996-01-01

The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

Connections between meteorological and hydrological droughts in a semi-arid basin of the middle Yellow River

NASA Astrophysics Data System (ADS)

Li, Binquan; Zhu, Changchang; Liang, Zhongmin; Wang, Guoqing; Zhang, Yu

2018-06-01

Differences between meteorological and hydrological droughts could reflect the regional water consumption by both natural elements and human water-use. The connections between these two drought types were analyzed using the Standardized Precipitation Evapotranspiration Index (SPEI) and Standardized Streamflow Index (SSI), respectively. In a typical semi-arid basin of the middle Yellow River (Qingjianhe River basin), annual precipitation and air temperature showed significantly downward and upward trends, respectively, with the rates of -2.37 mm yr-1 and 0.03 °C yr-1 (1961-2007). Under their synthetic effects, water balance variable (represented by SPEI) showed obviously downward (drying) trend at both upstream and whole basin areas. For the spatial variability of precipitation, air temperature and the calculated SPEI, both upstream and downstream areas experienced very similar change characteristics. Results also suggested that the Qingjianhe River basin experienced near normal condition during the study period. As a whole, this semi-arid basin mainly had the meteorological drought episodes in the mid-1960s, late-1990s and the 2000s depicted by 12-month SPEI. The drying trend could also be depicted by the hydrological drought index (12-month SSI) at both upstream and downstream stations (Zichang and Yanchuan), but the decreasing trends were not significant. A correlation analysis showed that hydrological system responds rapidly to the change of meteorological conditions in this semi-arid region. This finding could be an useful implication to drought research for those semi-arid basins with intensive human activities.

Culvert roughness elements for native Utah fish passage : phase I.

DOT National Transportation Integrated Search

2011-01-01

Laboratory flume testing of native Utah non-salmonid fish was performed to observe how : they use altered flow around obstacles to swim upstream. Three experimental setups included : a bare Plexiglas flume, vertical cylinders, and natural substrate p...

Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.

PubMed

Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi

2016-05-01

STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.

Mycobacterium tuberculosis Exploits a Molecular Off Switch of the Immune System for Intracellular Survival.

PubMed

von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael

2018-01-12

Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity[S

PubMed Central

Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.

2015-01-01

Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563

Low exhaust temperature electrically heated particulate matter filter system

DOEpatents

Gonze, Eugene V [Pinckney, MI; Paratore, Jr., Michael J.; Bhatia, Garima [Bangalore, IN

2012-02-14

A system includes a particulate matter (PM) filter, a sensor, a heating element, and a control module. The PM filter includes with an upstream end that receives exhaust gas, a downstream end and multiple zones. The sensor detects a temperature of the exhaust gas. The control module controls current to the heating element to convection heat one of the zones and initiate a regeneration process. The control module selectively increases current to the heating element relative to a reference regeneration current level when the temperature is less than a predetermined temperature.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

Autocrine motility factor (neuroleukin, phosphohexose isomerase) induces cell movement through 12-lipoxygenase-dependent tyrosine phosphorylation and serine dephosphorylation events.

PubMed

Timár, J; Tóth, S; Tóvári, J; Paku, S; Raz, A

1999-01-01

Autocrine motility factor (AMF) is one of the motility cytokines regulating tumor cell migration, therefore identification of the signaling pathway coupled with it has critical importance. Previous studies revealed several elements of this pathway predominated by lipoxygenase-PKC activations but the role for tyrosine kinases remained questionable. Motility cytokines frequently have mitogenic effect as well, producing activation of overlapping signaling pathways therefore we have used B16a melanoma cells as models where AMF has exclusive motility effect. Our studies revealed that in B16a cells AMF initiated rapid (1-5 min) activation of the protein tyrosine kinase (PTK) cascade inducing phosphorylation of 179, 125, 95 and 40/37 kD proteins which was mediated by upstream cyclo- and lipoxygenases. The phosphorylated proteins were localized to the cortical actin-stress fiber attachment zones in situ by confocal microscopy. On the other hand, AMF receptor activation induced significant decrease in overall serine-phosphorylation level of cellular proteins accompanied by serine phosphorylation of 200, 90, 78 and 65 kd proteins. The decrease in serine phosphorylation was independent of PTKs, PKC as well as cyclo- and lipoxygenases. However, AMF induced robust translocation of PKCalpha to the stress fibers and cortical actin suggesting a critical role for this kinase in the generation of the motility signal. Based on the significant decrease in serine phosphorylation after AMF stimulus in B16a cells we postulated the involvement of putative serine/threonine phosphatase(s) upstream lipoxygenase and activation of the protein tyrosine kinase cascade downstream cyclo- and lipoxygenase(s) in the previously identified autocrine motility signal.

Multiple circadian transcriptional elements cooperatively regulate cell-autonomous transcriptional oscillation of Period3, a mammalian clock gene.

PubMed

Matsumura, Ritsuko; Akashi, Makoto

2017-09-29

Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

PubMed

Schwank, S; Hoffmann, B; Sch-uller, H J

1997-06-01

Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

Upstream oversight assessment for agrifood nanotechnology: a case studies approach.

PubMed

Kuzma, Jennifer; Romanchek, James; Kokotovich, Adam

2008-08-01

Although nanotechnology is broadly receiving attention in public and academic circles, oversight issues associated with applications for agriculture and food remain largely unexplored. Agrifood nanotechnology is at a critical stage in which informed analysis can help shape funding priorities, risk assessment, and oversight activities. This analysis is designed to help society and policymakers anticipate and prepare for challenges posed by complicated, convergent applications of agrifood nanotechnology. The goal is to identify data, risk assessment, regulatory policy, and engagement needs for overseeing these products so they can be addressed prior to market entry. Our approach, termed upstream oversight assessment (UOA), has potential as a key element of anticipatory governance. It relies on distinct case studies of proposed applications of agrifood nanotechnology to highlight areas that need study and attention. As a tool for preparation, UOA anticipates the types and features of emerging applications; their endpoints of use in society; the extent to which users, workers, ecosystems, or consumers will be exposed; the nature of the material and its safety; whether and where the technologies might fit into current regulatory system(s); the strengths and weaknesses of the system(s) in light of these novel applications; and the possible social concerns related to oversight for them.

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.

PubMed

Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram

2008-08-01

Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.

Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

PubMed Central

Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

2008-01-01

SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

PubMed

Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

2008-04-11

The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

Focusing of active particles in a converging flow

DOE PAGES

Potomkin, Mykhailo; Kaiser, Andreas; Berlyand, Leonid; ...

2017-10-20

We consider active particles swimming in a convergent fluid flow in a trapezoid nozzle with no-slip walls. We use mathematical modeling to analyze trajectories of these particles inside the nozzle. By extensive Monte Carlo simulations, we show that trajectories are strongly affected by the background fluid flow and geometry of the nozzle leading to wall accumulation and upstream motion (rheotaxis). In particular, we describe the non-trivial focusing of active rods depending on physical and geometrical parameters. It is also established that the convergent component of the background flow leads to stability of both downstream and upstream swimming at the centerline.more » The stability of downstream swimming enhances focusing, and the stability of upstream swimming enables rheotaxis in the bulk.« less

GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

EPA Science Inventory

Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

The flow field around a pair of cubic roughness elements with different spacings immersed in turbulent boundary layer

NASA Astrophysics Data System (ADS)

Agarwal, Karuna; Gao, Jian; Katz, Joseph

2017-11-01

The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling

PubMed Central

Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf

2010-01-01

Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396

Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase by Ikaros, Histone Deacetylase 1 (HDAC1), and Casein Kinase 2 (CK2) in B-cell Acute Lymphoblastic Leukemia*

PubMed Central

Wang, Haijun; Song, Chunhua; Ding, Yali; Pan, Xiaokang; Ge, Zheng; Tan, Bi-Hua; Gowda, Chandrika; Sachdev, Mansi; Muthusami, Sunil; Ouyang, Hongsheng; Lai, Liangxue; Francis, Olivia L.; Morris, Christopher L.; Abdel-Azim, Hisham; Dorsam, Glenn; Xiang, Meixian; Payne, Kimberly J.; Dovat, Sinisa

2016-01-01

Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements of its target genes and regulates their transcription via chromatin remodeling. Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 trimethylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the upstream regulatory element of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed, and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic casein kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of trimethylated histone H3 lysine 27 and decreased histone H3 Lys-9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of JARID1B transcription. The presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL. PMID:26655717

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

Structure of a bacterial RNA polymerase holoenzyme open promoter complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka

2015-09-08

Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

Structure of a bacterial RNA polymerase holoenzyme open promoter complex

DOE PAGES

Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...

2015-09-08

Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less

Transcriptional regulation of hepatic lipogenesis.

PubMed

Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

2015-11-01

Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

DOE PAGES

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

2016-03-26

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Cooperative action of multiple cis-acting elements is required for N-myc expression in branchial arches: specific contribution of GATA3.

PubMed

Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean

2010-11-01

The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.

Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2003-01-01

Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

Selfish DNA: a pharmaceutical perspective.

PubMed

Winckler, T

2013-07-01

Almost 25 years ago, Theo Dingermann published the discovery of a new mobile genetic element in the unicellular microbe Dictyostelium discoideum in the journal Science. An interesting property of this new molecular parasite, the Dictyostelium Repetitive Element (DRE), was that all integrations were found approximately 50 base pairs (bp) upstream of transfer RNA (tRNA) genes in the D. discoideum genome, thus implying an active targeting mechanism to avoid the disruption of host cell genes by the retrotransposition process. Since then, the facultative multicellular "social amoeba" D. discoideum has become a popular model for analyzing complex cellular functions such as cell movement, chemotaxis, phagocytosis, and cell differentiation, important areas of biomedical research that are often hard to investigate in cells from "higher organisms" including humans. Therefore, progress in the development of methods to study Dictyostelium biology has also provoked research on transposable elements in this organism. Early work on the DRE element suggested that studying its molecular mechanism of site-specific integration might promote human gene therapy technology through the design of integrating gene transfer vectors with low intrinsic genotoxic potential. In this review article, I will briefly review the original research performed on the DRE transposable element in the Dingermann lab and report on how the emergence of genomics technologies and the development of tools to analyze de novo retrotransposition events in D. discoideum cells will expand our knowledge of DRE biology in the future.

Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

PubMed Central

Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

2000-01-01

Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

PubMed

Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

2012-09-01

Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

Insulin signalling mechanisms for triacylglycerol storage.

PubMed

Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M

2013-05-01

Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.

3-D Hybrid Kinetic Modeling of the Interaction Between the Solar Wind and Lunar-like Exospheric Pickup Ions in Case of Oblique/ Quasi-Parallel/Parallel Upstream Magnetic Field

NASA Technical Reports Server (NTRS)

Lipatov, A. S.; Farrell, W. M.; Cooper, J. F.; Sittler, E. C., Jr.; Hartle, R. E.

2015-01-01

The interactions between the solar wind and Moon-sized objects are determined by a set of the solar wind parameters and plasma environment of the space objects. The orientation of upstream magnetic field is one of the key factors which determines the formation and structure of bow shock wave/Mach cone or Alfven wing near the obstacle. The study of effects of the direction of the upstream magnetic field on lunar-like plasma environment is the main subject of our investigation in this paper. Photoionization, electron-impact ionization and charge exchange are included in our hybrid model. The computational model includes the self-consistent dynamics of the light (hydrogen (+), helium (+)) and heavy (sodium (+)) pickup ions. The lunar interior is considered as a weakly conducting body. Our previous 2013 lunar work, as reported in this journal, found formation of a triple structure of the Mach cone near the Moon in the case of perpendicular upstream magnetic field. Further advances in modeling now reveal the presence of strong wave activity in the upstream solar wind and plasma wake in the cases of quasiparallel and parallel upstream magnetic fields. However, little wave activity is found for the opposite case with a perpendicular upstream magnetic field. The modeling does not show a formation of the Mach cone in the case of theta(Sub B,U) approximately equal to 0 degrees.

HSF and Msn2/4p can exclusively or cooperatively activate the yeast HSP104 gene.

PubMed

Grably, Melanie R; Stanhill, Ariel; Tell, Osnat; Engelberg, David

2002-04-01

In an effort to understand how an accurate level of stress-specific expression is obtained, we studied the promoter of the yeast HSP104 gene. Through 5' deletions, we defined a 334 bp fragment upstream of the first coding AUG as sufficient and essential for maximal basal activity and a 260 bp fragment as sufficient and essential for heat shock responsiveness. These sequences contain heat shock elements (HSEs) and stress response elements (STREs) that cooperate to achieve maximal inducible expression. However, in the absence of one set of factors (e.g. in msn2Deltamsn4Delta cells) proper induction is obtained exclusively through HSEs. We also show that HSP104 is constitutively derepressed in ras2Delta cells. This derepression is achieved exclusively through activation of STREs, with no role for HSEs. Strikingly, in ras2Deltamsn2Deltamsn4Delta cells the HSP104 promoter is also derepressed, but in this strain derepression is mediated through HSEs, showing the flexibility and adaptation of the promoter. Thus, appropriate transcription of HSP104 is usually obtained through cooperation between the Msn2/4/STRE and the HSF/ HSE systems, but each factor could activate the promoter alone, backing up the other. Transcription control of HSP104 is adaptive and robust, ensuring proper expression under extreme conditions and in various mutants.

Upstream paths for Hippo signaling in Drosophila organ development.

PubMed

Choi, Kwang-Wook

2018-03-01

Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].

Sediment-quality assessment of Franklin D. Roosevelt Lake and the upstream reach of the Columbia River, Washington, 1992

USGS Publications Warehouse

Bortleson, Gilbert Carl; Cox, S.E.; Munn, M.D.; Schumaker, R.J.; Block, E.K.

2001-01-01

Elevated concentrations of trace elements were found in bed sediment of Lake Roosevelt and the Columbia River, its principal source of inflow. Trace-element concentrations in whole water samples did not exceed criteria for freshwater organisms. Bed sediments of Lake Roosevelt were analyzed for organic compounds associated with wood-pulp waste. Dioxins and furans were found in suspended sediment and water of the Columbia River. Abundance and diversity of benthic invertebrate communities were analyzed.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Exaptation of Bornavirus-Like Nucleoprotein Elements in Afrotherians

PubMed Central

Kobayashi, Yuki; Horie, Masayuki; Nakano, Ayumi; Murata, Koichi; Itou, Takuya; Suzuki, Yoshiyuki

2016-01-01

Endogenous bornavirus-like nucleoprotein elements (EBLNs), the nucleotide sequence elements derived from the nucleoprotein gene of ancient bornavirus-like viruses, have been identified in many animal genomes. Here we show evidence that EBLNs encode functional proteins in their host. Some afrotherian EBLNs were observed to have been maintained for more than 83.3 million years under negative selection. Splice variants were expressed from the genomic loci of EBLNs in elephant, and some were translated into proteins. The EBLN proteins appeared to be localized to the rough endoplasmic reticulum in African elephant cells, in contrast to the nuclear localization of bornavirus N. These observations suggest that afrotherian EBLNs have acquired a novel function in their host. Interestingly, genomic sequences of the first exon and its flanking regions in these EBLN loci were homologous to those of transmembrane protein 106B (TMEM106B). The upstream region of the first exon in the EBLN loci exhibited a promoter activity, suggesting that the ability of these EBLNs to be transcribed in the host cell was gained through capturing a partial duplicate of TMEM106B. In conclusion, our results strongly support for exaptation of EBLNs to encode host proteins in afrotherians. PMID:27518265

Characterization of a Maize Wip1 Promoter in Transgenic Plants

PubMed Central

Zhang, Shengxue; Lian, Yun; Liu, Yan; Wang, Xiaoqing; Liu, Yunjun; Wang, Guoying

2013-01-01

The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI) protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1) several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2) the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3) the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4) the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5) there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6) the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5′-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5′-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs) in the 5′-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity. PMID:24322445

Cadmium partition in river sediments from an area affected by mining activities.

PubMed

Vasile, Georgiana D; Vlădescu, Luminiţa

2010-08-01

In this paper, the cadmium distribution in Certej River sediments in an area seriously affected by intense mining activities has been studied. The main objective of this study was the evaluation of partition of this metal into different operational defined fractions by sequential extractions. Community Bureau of Reference (BCR) sequential extraction was used to isolate different fractions. The sediment quality was assessed both upstream and downstream the pollution input points, along the Certej River, in order to reveal a possible accumulation of cadmium in sediments and the seasonal changes in cadmium concentrations in BCR sediment phases. Our results reveal that most of the cadmium content is divided between both the soluble and iron and manganese hydrated oxide fractions. Based on total cadmium concentrations in sediments, the enrichment factors were estimated using aluminum as normalizing element and the regression curve Cd/Al corresponding to the geochemical background of the studied area.

Wnt and GSK3 Signaling Pathways in Bipolar Disorder: Clinical and Therapeutic Implications

PubMed Central

Muneer, Ather

2017-01-01

The neurobiology of bipolar disorder, a chronic and systemic ailment is not completely understood. The bipolar phenotype manifests in myriad ways, and psychopharmacological agents like lithium have long term beneficial effects. The enzyme glycogen synthase kinase 3 (GSK3) has come into focus, as lithium and several other mood stabilizing medications inhibit its activity. This kinase and its key upstream modulator, Wnt are dysregulated in mood disorders and there is a growing impetus to delineate the chief substrates involved in the development of these illnesses. In May 2016, a comprehensive literature search was undertaken which revealed that there is over activity of GSK3 in bipolar disorder with deleterious downstream effects like proinflammatory status, increased oxidative stress, and circadian dysregulation leading to declining neurotrophic support and enhanced apoptosis of neural elements. By developing specific GSK3 inhibitors the progressive worsening in bipolar disorder can be forestalled with improved prospects for the sufferers. PMID:28449557

Insulators form gene loops by interacting with promoters in Drosophila.

PubMed

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Contribution of an ancient evaporitic-type reservoir to lake vostok chemistry

NASA Astrophysics Data System (ADS)

de Angelis, M.; Thiemens, M. H.; Savarino, J.; Petit, J. R.

2003-04-01

Accretion ice 1 (3538 to 3608 m) contents visible sediment inclusions likely incorporated into ice in a shallow bay upstream Vostok where glacier moves against a relief rise. Ion chromatography measurements indicate that elemental concentrations are linked to inclusions abundances. More than 80% of SO_42- is present as CaSO_4 or MgSO_4. While SO_42- concentrations and the relative proportion of CaSO_4 and MgSO_4 varies in a wide range in accreted ice, concentration profiles of Na and Cl, present as NaCl, are much more regular even along individual crystals. Question rises about the presence of such salts in lake water: The 17O anomaly of sulphate in one samples taken at 3570 m suggests that less than 10% of total sulphate comes from DMS oxidation, ruling out any significant contribution of glacer melt water. Fe concentrations are low (10 ppb) excluding sulphate production from the pyrite oxidation by biogenic in-situ activity. This conclusion is supported by the isotopic signature of 34S. Taken all together, these observations strongly suggest the contribution of an evaporitic-type basin to the lake salinity. Assuming that sediments accumulated in an isolated reservoir prior the lake formation, seismotectonic activated hydrothermal circulation may pulse NaCl rich water with sulphate salts through faults up to their vents in a shallow bay upstream Vostok, where they could be incorporated in the accreted ice and also contribute to lake salinity.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

On the role of acoustic feedback in boundary-layer instability.

PubMed

Wu, Xuesong

2014-07-28

In this paper, the classical triple-deck formalism is employed to investigate two instability problems in which an acoustic feedback loop plays an essential role. The first concerns a subsonic boundary layer over a flat plate on which two well-separated roughness elements are present. A spatially amplifying Tollmien-Schlichting (T-S) wave between the roughness elements is scattered by the downstream roughness to emit a sound wave that propagates upstream and impinges on the upstream roughness to regenerate the T-S wave, thereby forming a closed feedback loop in the streamwise direction. Numerical calculations suggest that, at high Reynolds numbers and for moderate roughness heights, the long-range acoustic coupling may lead to absolute instability, which is characterized by self-sustained oscillations at discrete frequencies. The dominant peak frequency may jump from one value to another as the Reynolds number, or the distance between the roughness elements, is varied gradually. The second problem concerns the supersonic 'twin boundary layers' that develop along two well-separated parallel flat plates. The two boundary layers are in mutual interaction through the impinging and reflected acoustic waves. It is found that the interaction leads to a new instability that is absent in the unconfined boundary layer. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

PubMed Central

Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

2012-01-01

The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potomkin, Mykhailo; Kaiser, Andreas; Berlyand, Leonid

We consider active particles swimming in a convergent fluid flow in a trapezoid nozzle with no-slip walls. We use mathematical modeling to analyze trajectories of these particles inside the nozzle. By extensive Monte Carlo simulations, we show that trajectories are strongly affected by the background fluid flow and geometry of the nozzle leading to wall accumulation and upstream motion (rheotaxis). In particular, we describe the non-trivial focusing of active rods depending on physical and geometrical parameters. It is also established that the convergent component of the background flow leads to stability of both downstream and upstream swimming at the centerline.more » The stability of downstream swimming enhances focusing, and the stability of upstream swimming enables rheotaxis in the bulk.« less

Binary agonist surface patterns prime platelets for downstream adhesion in flowing whole blood.

PubMed

Eichinger, Colin D; Hlady, Vladimir

2017-04-28

As platelets encounter damaged vessels or biomaterials, they interact with a complex milieu of surface-bound agonists, from exposed subendothelium to adsorbed plasma proteins. It has been shown that an upstream, surface-immobilized agonist is capable of priming platelets for enhanced adhesion downstream. In this study, binary agonists were integrated into the upstream position of flow cells and the platelet priming response was measured by downstream adhesion in flowing whole blood. A nonadditive response was observed in which platelets transiently exposed to two agonists exhibited greater activation and downstream adhesion than that from the sum of either agonist alone. Antibody blocking of one of the two upstream agonists eliminated nonadditive activation and downstream adhesion. Crosstalk between platelet activation pathways likely led to a synergistic effect which created an enhanced activation response in the platelet population. The existence of synergy between platelet priming pathways is a concept that has broad implications for the field of biomaterials hemocompatibility and platelet activity testing.

Bacterial evolution through the selective loss of beneficial Genes. Trade-offs in expression involving two loci.

PubMed Central

Zinser, Erik R; Schneider, Dominique; Blot, Michel; Kolter, Roberto

2003-01-01

The loss of preexisting genes or gene activities during evolution is a major mechanism of ecological specialization. Evolutionary processes that can account for gene loss or inactivation have so far been restricted to one of two mechanisms: direct selection for the loss of gene activities that are disadvantageous under the conditions of selection (i.e., antagonistic pleiotropy) and selection-independent genetic drift of neutral (or nearly neutral) mutations (i.e., mutation accumulation). In this study we demonstrate with an evolved strain of Escherichia coli that a third, distinct mechanism exists by which gene activities can be lost. This selection-dependent mechanism involves the expropriation of one gene's upstream regulatory element by a second gene via a homologous recombination event. Resulting from this genetic exchange is the activation of the second gene and a concomitant inactivation of the first gene. This gene-for-gene expression tradeoff provides a net fitness gain, even if the forfeited activity of the first gene can play a positive role in fitness under the conditions of selection. PMID:12930738

Small molecule drug A-769662 and AMP synergistically activate naive AMPK independent of upstream kinase signaling.

PubMed

Scott, John W; Ling, Naomi; Issa, Samah M A; Dite, Toby A; O'Brien, Matthew T; Chen, Zhi-Ping; Galic, Sandra; Langendorf, Christopher G; Steinberg, Gregory R; Kemp, Bruce E; Oakhill, Jonathan S

2014-05-22

The AMP-activated protein kinase (AMPK) is a metabolic stress-sensing αβγ heterotrimer responsible for energy homeostasis, making it a therapeutic target for metabolic diseases such as type 2 diabetes and obesity. AMPK signaling is triggered by phosphorylation on the AMPK α subunit activation loop Thr172 by upstream kinases. Dephosphorylated, naive AMPK is thought to be catalytically inactive and insensitive to allosteric regulation by AMP and direct AMPK-activating drugs such as A-769662. Here we show that A-769662 activates AMPK independently of α-Thr172 phosphorylation, provided β-Ser108 is phosphorylated. Although neither A-769662 nor AMP individually stimulate the activity of dephosphorylated AMPK, together they stimulate >1,000-fold, bypassing the requirement for β-Ser108 phosphorylation. Consequently A-769662 and AMP together activate naive AMPK entirely allosterically and independently of upstream kinase signaling. These findings have important implications for development of AMPK-targeting therapeutics and point to possible combinatorial therapeutic strategies based on AMP and AMPK drugs. Copyright © 2014 Elsevier Ltd. All rights reserved.

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

PubMed

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

Structural and functional analysis of myostatin-2 promoter alleles from the marine fish Sparus aurata: evidence for strong muscle-specific promoter activity and post-transcriptional regulation.

PubMed

Nadjar-Boger, Elisabeth; Hinits, Yaniv; Funkenstein, Bruria

2012-09-25

Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. In this study, we analyzed the structural-functional features of the four variants of Sparus aurata MSTN-2 5'-flanking region: saMSTN-2a, saMSTN-2as, saMSTN-2b and saMSTN-2c. In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed surprisingly high transcriptional activity in muscle cells, suggesting the presence of regulatory elements unique to differentiated myotubes. These observations were confirmed by in situ intramuscular injections of promoter DNA followed by reporter gene assays. Moreover, high promoter activity was found in differentiated neural cell, in agreement with MSTN-2 expression in brain. Progressive 5'-deletion analysis, using reporter gene assays, showed that the core promoter is located within the first -127 bp upstream of the ATG, and suggested the presence of regulatory elements that either repress or induce transcriptional activity. Transient transgenic zebrafish provided evidence for saMSTN-2 promoter ability to direct GFP expression to myofibers. Finally, our data shows that although no mature saMSTN-2 mRNA is observed in muscle; unspliced forms accumulate, confirming high level of transcription. In conclusion, our study shows for the first time that MSTN-2 promoter is a very robust promoter, especially in muscle cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-03-01

MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

Recurrent emergence of structural variants of LTR retrotransposon CsRn1 evolving novel expression strategy and their selective expansion in a carcinogenic liver fluke, Clonorchis sinensis.

PubMed

Kim, Seon-Hee; Kong, Yoon; Bae, Young-An

2017-06-01

Autonomous retrotransposons, in which replication and transcription are coupled, encode the essential gag and pol genes as a fusion or separate overlapping form(s) that are expressed in single transcripts regulated by a common upstream promoter. The element-specific expression strategies have driven development of relevant translational recoding mechanisms including ribosomal frameshifting to satisfy the protein stoichiometry critical for the assembly of infectious virus-like particles. Retrotransposons with different recoding strategies exhibit a mosaic distribution pattern across the diverse families of reverse transcribing elements, even though their respective distributions are substantially skewed towards certain family groups. However, only a few investigations to date have focused on the emergence of retrotransposons evolving novel expression strategy and causal genetic drivers of the structural variants. In this study, the bulk of genomic and transcribed sequences of a Ty3/gypsy-like CsRn1 retrotransposon in Clonorchis sinensis were analyzed for the comprehensive examination of its expression strategy. Our results demonstrated that structural variants with single open reading frame (ORF) have recurrently emerged from precedential CsRn1 copies encoding overlapping gag-pol ORFs by a single-nucleotide insertion in an upstream region of gag stop codon. In the parasite genome, some of the newly evolved variants appeared to undergo proliferative burst as active master lineages together with their ancestral copies. The genetic event was similarly observed in Opisthorchis viverrini, the closest neighbor of C. sinensis, whereas the resulting structural variants might have failed to overcome purifying selection and comprised minor remnant copies in the Opisthorchis genome. Copyright © 2017 Elsevier B.V. All rights reserved.

Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

PubMed

Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

2017-06-29

Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart

PubMed Central

Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare EG; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

2009-01-01

Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1+/− mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

Transcriptional regulation by retinoic acid of interleukin-2 alpha receptors in human B cells.

PubMed Central

Bhatti, L; Sidell, N

1994-01-01

In this study, we demonstrated that retinoic acid (RA) up-regulated interleukin-2 receptor-alpha (IL-2R alpha) expression on two human B-cell lines, IE8.6 and SKW6.4. Deleted forms of the human IL-2R alpha promoter linked to the bacterial chloramphenicol acetyltransferase reporter gene were transfected into IE8.6 cells in order to define RA-responsive regulatory domains. Experiments using the -1.6 kb construct, which contains all known regulatory regions in the IL-2R alpha promoter, indicated that RA could induce IL-2R alpha promoter activity. The basal activity of the -471 construct was initially low, but was markedly enhanced by the addition of RA. Deletion of promoter sequences between -471 and -317 resulted in a significant augmentation of basal promoter activity and abolished promoter induction by RA. This finding revealed a requirement for sequences 5' of base -317 for RA-induced promoter activation, raising the possibility of the presence of both a RA response element and a negative regulatory element (NRE) upstream of base -317. Transfection studies with internal deletion mutants with the putative NRE removed resulted in increases in basal promoter activity and unresponsiveness to RA similar to the -317 construct. In contrast, an internal deletion mutant with the NRE intact had low basal activity and was inducible by RA similar to the -471 construct. Taken together, our results suggested that RA-induced activation of the IL-2R alpha promoter was through changes in the function of a NRE present between bases -400 and -368. This 31-base pair element may interact with an adjacent RA-responsive regulatory site as well as being responsible for down-regulation of basal IL-2R alpha expression under certain conditions. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8157276

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

BEHAVIOR OF ARSENIC AND OTHER REDOX-SENSITIVE ELEMENTS IN CROWLEY LAKE, CA: A RESERVOIR IN THE LOS ANGELES AQUEDUCT SYSTEM. (R826202)

EPA Science Inventory

Elevated arsenic concentrations in Crowley Lake derive from upstream geothermal inputs. We examined the water column of Crowley Lake under stratified and unstratified conditions, seeking evidence for algal uptake and transformation of arsenic and its deposition to and release fro...

The prostaglandin receptor EP2 activates multiple signaling pathways and β-arrestin1 complex formation during mouse skin papilloma development

PubMed Central

Chun, Kyung-Soo; Lao, Huei-Chen; Trempus, Carol S.; Okada, Manabu; Langenbach, Robert

2009-01-01

Prostaglandin E2 (PGE2) is elevated in many tumor types, but PGE2's contributions to tumor growth are largely unknown. To investigate PGE2's roles, the contributions of one of its receptors, EP2, were studied using the mouse skin initiation/promotion model. Initial studies indicated that protein kinase A (PKA), epidermal growth factor receptor (EGFR) and several effectors—cyclic adenosine 3′,5′-monophosphate response element-binding protein (CREB), H-Ras, Src, protein kinase B (AKT) and extracellular signal-regulated kinase (ERK)1/2—were activated in 12-O-tetradecanoylphorbol-13-acetate (TPA)-promoted papillomas and that PKA and EGFR inhibition (H89 and AG1478, respectively) decreased papilloma formation. EP2's contributions to the activation of these pathways and papilloma development were determined by inhibiting endogenous TPA-induced PGE2 production with indomethacin (Indo) and concomitantly treating with the EP2 agonist, CAY10399 (CAY). CAY treatment restored papilloma formation in TPA/Indo-treated mice and increased cyclic adenosine 3′,5′-monophosphate and PKA activation as measured by p-CREB formation. CAY treatment also increased EGFR and Src activation and their inhibition by AG1478 and PP2 indicated that Src was upstream of EGFR. CAY also increased H-Ras, ERK1/2 and AKT activation, and AG1478 decreased their activation indicating EGFR being upstream. Supporting EP2's contribution, EP2−/− mice exhibited 65% fewer papillomas and reduced Src, EGFR, H-Ras, AKT and ERK1/2 activation. G protein-coupled receptor (GPCR) activation of EGFR has been reported to involve Src's activation via a GPCR–β-arrestin–Src complex. Indeed, immunoprecipitation of β-arrestin1 or p-Src indicated the presence of an EP2–β-arrestin1–p-Src complex in papillomas. The data indicated that EP2 contributed to tumor formation via activation of PKA and EGFR and that EP2 formed a complex with β-arrestin1 and Src that contributed to signaling and/or EP2 desensitization. PMID:19587094

Atmospheric-pressure plasma jets: Effect of gas flow, active species, and snake-like bullet propagation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, S.; Wang, Z.; Huang, Q.

2013-02-15

Cold atmospheric-pressure plasma jets have recently attracted enormous interest owing to numerous applications in plasma biology, health care, medicine, and nanotechnology. A dedicated study of the interaction between the upstream and downstream plasma plumes revealed that the active species (electrons, ions, excited OH, metastable Ar, and nitrogen-related species) generated by the upstream plasma plume enhance the propagation of the downstream plasma plume. At gas flows exceeding 2 l/min, the downstream plasma plume is longer than the upstream plasma plume. Detailed plasma diagnostics and discharge species analysis suggest that this effect is due to the electrons and ions that are generatedmore » by the upstream plasma and flow into the downstream plume. This in turn leads to the relatively higher electron density in the downstream plasma. Moreover, high-speed photography reveals a highly unusual behavior of the plasma bullets, which propagate in snake-like motions, very differently from the previous reports. This behavior is related to the hydrodynamic instability of the gas flow, which results in non-uniform distributions of long-lifetime active species in the discharge tube and of surface charges on the inner surface of the tube.« less

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Fate and transport of heavy metals and radioelements in groundwater aquifers of Al-Qunfudhah and Wadi Haliy quadrangles, southwest of Saudi Arabia

NASA Astrophysics Data System (ADS)

Bajabaa, S. A.; Abd El-Naby, H.; Dawood, Y.

2009-12-01

The fate and transport of heavy metals and radioelements in groundwater aquifers in five wadis located in the Al Qunfudhah and Wadi Haliy quadrangles were investigated. These wadis are an important source of water to the Red Sea coastal plain. Copper, zinc and other base-metals mineralization occur at eastern parts of these quadrangles that dominates the water catchments area of these wadis. Water, rock and soil samples were collected from all wadis and they were analyzed for major, trace elements, heavy metals and stable isotopes. The chemical and isotopic results showed active water/rock interaction. The preliminary investigation of the data analyses showed some samples with high heavy metals and uranium contents. Generally, the uranium and heavy metal contents are higher in samples collected from the upstream area of each wadi where the crystalline rocks are exposed and direct contact with the runoff. The uranium contents were as high as 120 ppb in some water samples. These elevated values are mainly due to two factors water rock interaction and concentration through evaporation. It was also observed to have elevated heavy metal contents near mining activates, which suggests that these mining activates are playing an important role in mobilizing the heavy elements and in turn affecting the water quality in these wadis.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Bone Morphogenetic Protein 15 (BMP15) Acts as a BMP and Wnt Inhibitor during Early Embryogenesis*

PubMed Central

Di Pasquale, Elisa; Brivanlou, Ali H.

2009-01-01

Bone morphogenetic protein 15 (BMP15) belongs to an unusual subgroup of the transforming growth factor β (TGFβ) superfamily of signaling ligands as it lacks a key cysteine residue in the mature region required for proper intermolecular dimerization. Naturally occurring BMP15 mutation leads to early ovarian failure in humans, and BMP15 has been shown to activate the Smad1/5/8 pathway in that context. Despite its important role in germ cell specification, the embryological function of BMP15 remains unknown. Surprisingly, we find that during early Xenopus embryogenesis BMP15 acts solely as an inhibitor of the Smad1/5/8 pathway and the Wnt pathway. BMP15 gain-of-function leads to embryos with secondary ectopic heads and to direct neural induction in intact explants. BMP15 inhibits BMP4-mediated epidermal induction in dissociated explants. BMP15 strongly inhibits BRE response induced by BMP4 and blocks phosphorylation and activation of Smad1/5/8 MH2-domain. Mechanistically, BMP15 protein specifically interacts with BMP4 protein, suggesting inhibition upstream of receptor binding. Loss-of-function experiments using morpholinos or a naturally occurring human BMP15 dominant-negative mutant (BMP15-Y235C) leads to embryos lacking head. BMP15-Y235C also eliminates the inhibitory activity of BMP15 on BRE (BMP-responsive element). Finally, we show that BMP15 inhibits the canonical branch of the Wnt pathway, upstream of β-catenin. We, thus, demonstrate that BMP15 is necessary and sufficient for the specification of dorso-anterior structures and highlight novel mechanisms of BMP15 function that strongly suggest a reinterpretation of its function in ovaries specially for ovarian failure. PMID:19553676

Diurnal cycles control the fate of contaminants at an Andean river confluence impacted by legacy mining

NASA Astrophysics Data System (ADS)

Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.

2014-12-01

The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

PubMed

Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

2017-02-21

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

Assessing potential release tendency of As, Mo and W in the tributary sediments of the Three Gorges Reservoir, China.

PubMed

Gao, Li; Gao, Bo; Peng, Wenqi; Xu, Dongyu; Yin, Shuhua

2018-01-01

As the largest man-made reservoir in China, the Three Gorges Reservoir (TGR) has significant influence on national drinking water safety. The geochemical behavior of trace elements at the sediment-water interface (SWI) is still unknown. The mobilization characteristics of trace elements (As, Mo and W)-determined by diffusive gradients in thin films (DGT)-were studied to quantitatively calculate the release trends in the SWI in three typical tributaries and the mainstream of the TGR in the summer. The results showed that concentrations of DGT-labile As, Mo and W in the overlying water and sediment cores showed significant variations in the ranges of 0.05-50.90, 0.30-1.63 and 0.01-0.42μgL -1 , respectively. The apparent net diffusive fluxes were significantly positive in most sampling sites (77.8% for As, 88.8% for Mo and 66.6% for W), suggesting that the sediment was the source of these three elements. It was noteworthy that the maximum net diffusive fluxes of As and W were found in the upstream of Meixi tributary, which may be attributed to anthropogenic activities. In addition, As, Mo and W may be incorporated in Fe and Mn oxyhydroxides and these three elements simultaneously remobilized with Fe and Mn. Copyright © 2017 Elsevier Inc. All rights reserved.

Specific trans-acting proteins interact with auxiliary RNA polyadenylation elements in the COX-2 3′-UTR

PubMed Central

Hall-Pogar, Tyra; Liang, Songchun; Hague, Lisa K.; Lutz, Carol S.

2007-01-01

Two cyclooxygenase (COX) enzymes, COX-1 and COX-2, are present in human cells. While COX-1 is constitutively expressed, COX-2 is inducible and up-regulated in response to many signals. Since increased transcriptional activity accounts for only part of COX-2 up-regulation, we chose to explore other RNA processing mechanisms in the regulation of this gene. Previously, we showed that COX-2 is regulated by alternative polyadenylation, and that the COX-2 proximal polyadenylation signal contains auxiliary upstream sequence elements (USEs) that are very important in efficient polyadenylation. To explore trans-acting protein factors interacting with these cis-acting RNA elements, we performed pull-down assays with HeLa nuclear extract and biotinylated RNA oligonucleotides representing COX-2 USEs. We identified PSF, p54nrb, PTB, and U1A as proteins specifically bound to the COX-2 USEs. We further explored their participation in polyadenylation using MS2 phage coat protein-MS2 RNA binding site tethering assays, and found that tethering any of these four proteins to the COX-2 USE mutant RNA can compensate for these cis-acting elements. Finally, we suggest that these proteins (p54nrb, PTB, PSF, and U1A) may interact as a complex since immunoprecipitations of the transfected MS2 fusion proteins coprecipitate the other proteins. PMID:17507659

Mechanism of estrogen activation of c-myc oncogene expression.

PubMed

Dubik, D; Shiu, R P

1992-08-01

The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

Method and apparatus for in-cell vacuuming of radiologically contaminated materials

DOEpatents

Spadaro, Peter R.; Smith, Jay E.; Speer, Elmer L.; Cecconi, Arnold L.

1987-01-01

A vacuum air flow operated cyclone separator arrangement for collecting, handling and packaging loose contaminated material in accordance with acceptable radiological and criticality control requirements. The vacuum air flow system includes a specially designed fail-safe prefilter installed upstream of the vacuum air flow power supply. The fail-safe prefilter provides in-cell vacuum system flow visualization and automatically reduces or shuts off the vacuum air flow in the event of an upstream prefilter failure. The system is effective for collecting and handling highly contaminated radiological waste in the form of dust, dirt, fuel element fines, metal chips and similar loose material in accordance with radiological and criticality control requirements for disposal by means of shipment and burial.

TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements.

PubMed

Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D

2009-02-01

TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.

Computational fluid dynamics modeling of intracranial aneurysms: effects of parent artery segmentation on intra-aneurysmal hemodynamics.

PubMed

Castro, M A; Putman, C M; Cebral, J R

2006-09-01

The purpose of this study is to show the influence of the upstream parent artery geometry on intraaneurysmal hemodynamics of cerebral aneurysms. Patient-specific models of 4 cerebral aneurysms (1 posterior communicating artery [PcomA], 2 middle cerebral artery [MCA], and 1 anterior communicating artery [AcomA]) were constructed from 3D rotational angiography images. Two geometric models were constructed for each aneurysm. One model had the native parent vessel geometry; the second model was truncated approximately 1 cm upstream from the aneurysm, and the parent artery replaced with a straight cylinder. Corresponding finite element grids were generated and computational fluid dynamics simulations were carried out under pulsatile flow conditions. The intra-aneurysmal flow patterns and wall shear stress (WSS) distributions were visualized and compared. Models using the truncated parent vessel underestimated the WSS in the aneurysms in all cases and shifted the impaction zone to the neck compared with the native geometry. These effects were more pronounced in the PcomA and AcomA aneurysms where upstream curvature was substantial. The MCA aneurysm with a long M1 segment was the least effected. The more laminar flow pattern within the parent vessel in truncated models resulted in a less complex intra-aneurysmal flow patterns with fewer vortices and less velocity at the dome. Failure to properly model the inflow stream contributed by the upstream parent artery can significantly influence the results of intra-aneurysmal hemodynamic models. The upstream portion of the parent vessel of cerebral aneurysms should be included to accurately represent the intra-aneurysmal hemodynamics.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

LTR12 promoter activation in a broad range of human tumor cells by HDAC inhibition

PubMed Central

Krönung, Sonja K.; Beyer, Ulrike; Chiaramonte, Maria Luisa; Dolfini, Diletta; Mantovani, Roberto; Dobbelstein, Matthias

2016-01-01

A considerable proportion of the human genome consists of transposable elements, including the long terminal repeats (LTRs) of endogenous retroviruses. During evolution, such LTRs were occasionally inserted upstream of protein-coding genes, contributing to their regulation. We previously identified the LTR12 from endogenous retrovirus 9 (ERV9) as a regulator of proapoptotic genes such as TP63 or TNFRSF10B. The promoter activity of LTR12 is largely confined to the testes, silenced in testicular carcinoma, but reactivated in testicular cancer cells by broad-range histone deacetylase (HDAC) inhibitors. Here we show that inhibition of HDAC1-3 is sufficient for LTR12 activation. Importantly, HDAC inhibitors induce LTR12 activity not only in testicular cancer cells, but also in cells derived from many additional tumor species. Finally, we characterize the transcription factor NF-Y as a mediator of LTR12 promoter activity and HDAC inhibitor-induced apoptosis, in the context of widespread genomic binding of NF-Y to specific LTR12 sequences. Thus, HDAC inhibitor-driven LTR12 activation represents a generally applicable means to induce proapoptotic genes in human cancer cells. PMID:27172897

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Long-term Records of Trace Metal Elements in Core Sediments: Anthropogenic Impacts in The Eure River Watershed

NASA Astrophysics Data System (ADS)

Gardes, T.; Debret, M.; Copard, Y.; Patault, E.; Deloffre, J.; Marcotte, S.; Develle, A. L.; Sabatier, P.; Chaumillon, E.; Coulombier, T.; Revillon, S.; Nizou, J.; Laberdesque, Y.; Koltalo, F.

2017-12-01

The Martot Dam is located in the Eure River Watershed (Normandy, France), few hundred meters upstream the Eure-Seine Rivers confluence. In the context of the European Water Framework Directive (2000/60/EC), the French Authorities planned to remove this dam in 2017. Nevertheless, impacts of the removal remain poorly studied. Classically, dam blocked sedimentary transfers downstream, but here, sediments are not blocked behind the dam but stored three hundred meters upstream in a hydraulic annex, called the Martot Pond. Furthermore, this pond is submitted to the tidal flow from the Seine Estuary despite the Martot Dam. The aim of the study is to evaluate the dam removal impacts on sedimentary transfers and re-suspension of contaminated sediments stored in the Martot Pond and the Eure River's channel. Concerning past transfers and sediments accumulation in the Eure River Watershed, sedimentary archives have been cored, before dam removal, at the Martot Pond and the Les Damps Pond (located 10km upstream the latter). Dating of sedimentary cores for both ponds indicates a sedimentation rate around 1 cm y-1. Trace metal elements quantification showed a wide metallic contamination with highest concentrations evidenced during the 1950-1960's (As: 13-22 mg kg-1; Cd: 40-55 mg kg-1; Cr: 170-210 mg kg-1; Cu: 400-490 mg kg-1; Hg: 2.3 mg kg-1; Mn: 1,280-2,200 mg kg-1; Ni: 64-75 mg kg-1; Zn: 905-990 mg kg-1) and the 1990-2000's (Cr: 95-215 mg kg-1; Ni: 100 mg kg-1; Pb: 670-855 mg kg-1). These variations of concentrations along cores can be associated with industrial past of the Eure River Watershed and sources of contamination can be identified. Thereby, Zn, Ni or Hg contamination could be associated with wastes of battery factory released in the Eure River during the economic recovery, while Pb contamination is linked to the activities of a cathode-ray tubes factory. Metals quantification in core materials highlighted anthropogenic impacts in the Eure River Watershed. These contaminated sediments could be re-suspended and transferred to the Seine River in case of remobilization in Martot Pond and the Eure River's channel after dam removal.

A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

PubMed

He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

2017-08-23

The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

Comparing Experiment and Computation of Hypersonic Laminar Boundary Layers with Isolated Roughness

NASA Technical Reports Server (NTRS)

Bathel, Brett F.; Iyer, Prahladh S.; Mahesh, Krishnan; Danehy, Paul M.; Inman, Jennifer A.; Jones, Stephen B.; Johansen, Craig T.

2014-01-01

Streamwise velocity profile behavior in a hypersonic laminar boundary layer in the presence of an isolated roughness element is presented for an edge Mach number of 8.2. Two different roughness element types are considered: a 2-mm tall, 4-mm diameter cylinder, and a 2-mm radius hemisphere. Measurements of the streamwise velocity behavior using nitric oxide (NO) planar laser-induced fluorescence (PLIF) molecular tagging velocimetry (MTV) have been performed on a 20-degree wedge model. The top surface of this model acts as a flat-plate and is oriented at 5 degrees with respect to the freestream flow. Computations using direct numerical simulation (DNS) of these flows have been performed and are compared to the measured velocity profiles. Particular attention is given to the characteristics of velocity profiles immediately upstream and downstream of the roughness elements. In these regions, the streamwise flow can experience strong deceleration or acceleration. An analysis in which experimentally measured MTV profile displacements are compared with DNS particle displacements is performed to determine if the assumption of constant velocity over the duration of the MTV measurement is valid. This assumption is typically made when reporting MTV-measured velocity profiles, and may result in significant errors when comparing MTV measurements to computations in regions with strong deceleration or acceleration. The DNS computations with the cylindrical roughness element presented in this paper were performed with and without air injection from a rectangular slot upstream of the cylinder. This was done to determine the extent to which gas seeding in the MTV measurements perturbs the boundary layer flowfield.

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

PubMed Central

Gao, Feng; Simon, Anne E.

2016-01-01

Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Massive programmed translational jumping in mitochondria

PubMed Central

Lang, B. Franz; Jakubkova, Michaela; Hegedusova, Eva; Daoud, Rachid; Forget, Lise; Brejova, Brona; Vinar, Tomas; Kosa, Peter; Fricova, Dominika; Nebohacova, Martina; Griac, Peter; Tomaska, Lubomir; Burger, Gertraud; Nosek, Jozef

2014-01-01

Programmed translational bypassing is a process whereby ribosomes “ignore” a substantial interval of mRNA sequence. Although discovered 25 y ago, the only experimentally confirmed example of this puzzling phenomenon is expression of the bacteriophage T4 gene 60. Bypassing requires translational blockage at a “takeoff codon” immediately upstream of a stop codon followed by a hairpin, which causes peptidyl-tRNA dissociation and reassociation with a matching “landing triplet” 50 nt downstream, where translation resumes. Here, we report 81 translational bypassing elements (byps) in mitochondria of the yeast Magnusiomyces capitatus and demonstrate in three cases, by transcript analysis and proteomics, that byps are retained in mitochondrial mRNAs but not translated. Although mitochondrial byps resemble the bypass sequence in the T4 gene 60, they utilize unused codons instead of stops for translational blockage and have relaxed matching rules for takeoff/landing sites. We detected byp-like sequences also in mtDNAs of several Saccharomycetales, indicating that byps are mobile genetic elements. These byp-like sequences lack bypassing activity and are tolerated when inserted in-frame in variable protein regions. We hypothesize that byp-like elements have the potential to contribute to evolutionary diversification of proteins by adding new domains that allow exploration of new structures and functions. PMID:24711422

Morphine biosynthesis in opium poppy involves two cell types: sieve elements and laticifers.

PubMed

Onoyovwe, Akpevwe; Hagel, Jillian M; Chen, Xue; Khan, Morgan F; Schriemer, David C; Facchini, Peter J

2013-10-01

Immunofluorescence labeling and shotgun proteomics were used to establish the cell type-specific localization of morphine biosynthesis in opium poppy (Papaver somniferum). Polyclonal antibodies for each of six enzymes involved in converting (R)-reticuline to morphine detected corresponding antigens in sieve elements of the phloem, as described previously for all upstream enzymes transforming (S)-norcoclaurine to (S)-reticuline. Validated shotgun proteomics performed on whole-stem and latex total protein extracts generated 2031 and 830 distinct protein families, respectively. Proteins corresponding to nine morphine biosynthetic enzymes were represented in the whole stem, whereas only four of the final five pathway enzymes were detected in the latex. Salutaridine synthase was detected in the whole stem, but not in the latex subproteome. The final three enzymes converting thebaine to morphine were among the most abundant active latex proteins despite a limited occurrence in laticifers suggested by immunofluorescence labeling. Multiple charge isoforms of two key O-demethylases in the latex were revealed by two-dimensional immunoblot analysis. Salutaridine biosynthesis appears to occur only in sieve elements, whereas conversion of thebaine to morphine is predominant in adjacent laticifers, which contain morphine-rich latex. Complementary use of immunofluorescence labeling and shotgun proteomics has substantially resolved the cellular localization of morphine biosynthesis in opium poppy.

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

The human phospholamban gene: structure and expression.

PubMed

McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M

1999-03-01

Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.

Concentrations of mercury and other trace elements in walleye, smallmouth bass, and rainbow trout in Franklin D. Roosevelt Lake and the upper Columbia River, Washington, 1994

USGS Publications Warehouse

Munn, M.D.; Cox, S.E.; Dean, C.J.

1995-01-01

Three species of sportfish--walleye, smallmouth bass, and rainbow trout--were collected from Franklin D. Roosevelt Lake and the upstream reach of the Columbia River within the state of Washington, to determine the concentrations of mercury and other selected trace elements in fish tissue. Concentrations of total mercury in walleye fillets ranged from 0.11 to 0.44 milligram per kilogram, with the higher concentrations in the larger fish. Fillets of smallmouth bass and rainbow trout also contained mercury, but generally at lower concentrations. Other selected trace elements were found in fillet samples, but the concentrations were generally low depending on species and the specific trace element. The trace elements cadmium, copper, lead, and zinc were found in liver tissue of these same species with zinc consistently present in the highest concentration.

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Isolation of a citrus promoter specific for reproductive organs and its functional analysis in isolated juice sacs and tomato.

PubMed

Sorkina, Alina; Bardosh, Gabriel; Liu, Yong-Zhong; Fridman, Ifat; Schlizerman, Ludmila; Zur, Naftali; Or, Etti; Goldschmidt, Eliezer E; Blumwald, Eduardo; Sadka, Avi

2011-09-01

While searching for genes expressed in acid lemon but not in acidless lime pulp, we isolated clone Cl111 which showed the following expression phenotypes: (1) while it was expressed in the ovaries in both varieties, its mRNA was detected only in the pulp of the acid fruit, (2) no or very low expression of the gene was detected in vegetative organs. These expression patterns suggested that Cl111 is an ovary- and pulp-specific gene. The ability of ~2-kb fragments upstream of the transcription start site of the lemon and lime genes to confer reporter-gene activity was investigated by transient expression in isolated juice vesicles of both varieties. Whereas Cl111 promoter from lemon showed faint activity in lemon and lime juice vesicles, no activity was evident with the lime promoter. The activities of the 2-kb fragments and their delimited fragments were further investigated in tomato. The results indicated that the promoters were active in a manner similar to that in acid lemon and acidless lime: the lemon promoter generated activity in the fruit endocarp, analogous to citrus fruit pulp. The delimitation analyses identified an expression-conferring region which, in the lemon promoter, contained a sequence homologous to a fruit-specific element of the melon cucumisin gene. Another region, which reduced promoter activity, contained an I-Box-like sequence, identified as a fruit-specific negative element. Taken together, Cl111 promoter was confirmed to be pulp- and flower-specific. Differences in the expression of Cl111 between the two varieties could be attributable to changes in the gene promoter region.

Upstream energetic ions under radial IMF - A critical test of the Fermi model

NASA Technical Reports Server (NTRS)

Sarris, E. T.; Krimigis, S. M.

1988-01-01

Eight years of interplanetary magnetic field (IMF) and energetic particle observations obtained by the IMP-8 spacecraft upstream from the bow shock have been surveyed, and 63 cases when the upstream IMF remained radial for extended periods of time (greater than 1 hour) have been accumulated. Of these, two cases have been selected during which measurable fluxes of ambient solar or corotating energetic particle events were absent. These conditions provide an excellent test to the theories of the origin of upstream energetic ions. It is shown that there are extended periods with radial IMF when no upstream energetic ions were detected. It is further shown that energetic ions in the range E of between 50 keV and 1 MeV, inclusive, are not continuously present but appear in bursts of intensities varying by more than an order of magnitude under persistently radial IMF. These measurements contradict a fundamental prediction of the Fermi mechanism for the origin of the upstream energetic ions, namely that such ions should always be present on radial IMF lines. The observations are consistent with the hypothesis that energetic (greater than about 50 keV) ions leak out from, and appear in the upstream medium sporadically, following the onset of magnetic activity within the magnetosphere.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

USGS Publications Warehouse

Justus, B.G.; Stanton, Gregory P.

2005-01-01

The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

RHIC Prefire Protection Masks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drees, A.; Biscardi, C.; Curcio, T.

2015-01-07

The protection of the RHIC experimental detectors from damage due to beam hitting close upstream elements in cases of abort kicker prefires requires some dedicated precautionary measures with two general options: to bring the beam close to a limiting aperture (i.e. the beam pipe wall), as far upstream of the detector components as possible or, alternatively, to bring a limiting aperture close to the circulating beam. During the FY 2014 RHIC Heavy Ion run the first option was chosen because of the limited time available for preparation before the start of the run. For future runs the second option, inmore » this case the installation of dual-sided movable masks, is preferred. The installation of the masks, one per ring, is planned before the start of the FY 2015 run.« less

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

Identification of a two-component Class IIb bacteriocin in Streptococcus pyogenes by recombinase-based in vivo expression technology.

PubMed

Armstrong, Brent D; Herfst, Christine A; Tonial, Nicholas C; Wakabayashi, Adrienne T; Zeppa, Joseph J; McCormick, John K

2016-11-03

Streptococcus pyogenes is a globally prominent bacterial pathogen that exhibits strict tropism for the human host, yet bacterial factors responsible for the ability of S. pyogenes to compete within this limited biological niche are not well understood. Using an engineered recombinase-based in vivo expression technology (RIVET) system, we identified an in vivo-induced promoter region upstream of a predicted Class IIb bacteriocin system in the M18 serotype S. pyogenes strain MGAS8232. This promoter element was not active under in vitro laboratory conditions, but was highly induced within the mouse nasopharynx. Recombinant expression of the predicted mature S. pyogenes bacteriocin peptides (designated SpbM and SpbN) revealed that both peptides were required for antimicrobial activity. Using a gain of function experiment in Lactococcus lactis, we further demonstrated S. pyogenes immunity function is encoded downstream of spbN. These data highlight the importance of bacterial gene regulation within appropriate environments to help understand mechanisms of niche adaptation by bacterial pathogens.

Identification of a two-component Class IIb bacteriocin in Streptococcus pyogenes by recombinase-based in vivo expression technology

PubMed Central

Armstrong, Brent D.; Herfst, Christine A.; Tonial, Nicholas C.; Wakabayashi, Adrienne T.; Zeppa, Joseph J.; McCormick, John K.

2016-01-01

Streptococcus pyogenes is a globally prominent bacterial pathogen that exhibits strict tropism for the human host, yet bacterial factors responsible for the ability of S. pyogenes to compete within this limited biological niche are not well understood. Using an engineered recombinase-based in vivo expression technology (RIVET) system, we identified an in vivo-induced promoter region upstream of a predicted Class IIb bacteriocin system in the M18 serotype S. pyogenes strain MGAS8232. This promoter element was not active under in vitro laboratory conditions, but was highly induced within the mouse nasopharynx. Recombinant expression of the predicted mature S. pyogenes bacteriocin peptides (designated SpbM and SpbN) revealed that both peptides were required for antimicrobial activity. Using a gain of function experiment in Lactococcus lactis, we further demonstrated S. pyogenes immunity function is encoded downstream of spbN. These data highlight the importance of bacterial gene regulation within appropriate environments to help understand mechanisms of niche adaptation by bacterial pathogens. PMID:27808235

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

PubMed

Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

1999-10-28

We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.

PubMed

Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M

2001-01-26

Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.

The hetC Gene Is a Direct Target of the NtcA Transcriptional Regulator in Cyanobacterial Heterocyst Development

PubMed Central

Muro-Pastor, Alicia M.; Valladares, Ana; Flores, Enrique; Herrero, Antonia

1999-01-01

The heterocyst is the site of nitrogen fixation in aerobically grown cultures of some filamentous cyanobacteria. Heterocyst development in Anabaena sp. strain PCC 7120 is dependent on the global nitrogen regulator NtcA and requires, among others, the products of the hetR and hetC genes. Expression of hetC, tested by RNA- DNA hybridization, was impaired in an ntcA mutant. A nitrogen-regulated, NtcA-dependent putative transcription start point was localized at nucleotide −571 with respect to the hetC translational start. Sequences upstream from this transcription start point exhibit the structure of the canonical cyanobacterial promoter activated by NtcA, and purified NtcA protein specifically bound to a DNA fragment containing this promoter. Activation of expression of hetC during heterocyst development appears thus to be directly operated by NtcA. NtcA-mediated activation of hetR expression was not impaired in a hetC mutant, indicating that HetC is not an NtcA-dependent element required for hetR induction. PMID:10542167

Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element

PubMed Central

Hao, Hailing; Li, Ying; Tzatzalos, Evangeline; Gilbert, Jordana; Zala, Dhara; Bhaumik, Mantu; Cai, Li

2014-01-01

Precise control of lineage-specific gene expression in the neural stem/progenitor cells is crucial for generation of the diversity of neuronal and glial cell types in the central nervous system (CNS). The mechanism underlying such gene regulation, however, is not fully elucidated. Here, we report that a 377 bp evolutionarily conserved DNA fragment (CR5), located approximately 32 kbp upstream of Olig2 transcription start site, acts as a cis-regulator for gene expression in the development of the neonatal forebrain. CR5 is active in a time-specific and brain region-restricted manner. CR5 activity is not detected in the embryonic stage, but it is exclusively in a subset of Sox5+ cells in the neonatal ventral forebrain. Furthermore, we show that Sox5 binding motif in CR5 is important for this cell-specific gene regulatory activity; mutation of Sox5 binding motif in CR5 alters reporter gene expression with different cellular composition. Together, our study provides new insights into the regulation of cell-specific gene expression during CNS development. PMID:24954155

Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

PubMed

Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

2000-06-01

The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis

PubMed Central

Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

2016-01-01

The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671

Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

PubMed Central

Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

2011-01-01

Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

The GhTT2_A07 gene is linked to the brown colour and natural flame retardancy phenotypes of Lc1 cotton (Gossypium hirsutum L.) fibres

PubMed Central

Hinchliffe, Doug J.; Condon, Brian D.; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A.; Reynolds, Michael; Delhom, Christopher D.; Fang, David D.; Li, Ping; McCarty, Jack

2016-01-01

Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. PMID:27567364

Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

PubMed

Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

2014-05-01

Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

BCL11B enhances TCR/CD28-triggered NF-kappaB activation through up-regulation of Cot kinase gene expression in T-lymphocytes.

PubMed

Cismasiu, Valeriu B; Duque, Javier; Paskaleva, Elena; Califano, Danielle; Ghanta, Sailaja; Young, Howard A; Avram, Dorina

2009-01-15

BCL11B is a transcriptional regulator with an important role in T-cell development and leukaemogenesis. We demonstrated recently that BCL11B controls expression from the IL (interleukin)-2 promoter through direct binding to the US1 (upstream site 1). In the present study, we provide evidence that BCL11B also participates in the activation of IL-2 gene expression by enhancing NF-kappaB (nuclear factor kappaB) activity in the context of TCR (T-cell receptor)/CD28-triggered T-cell activation. Enhanced NF-kappaB activation is not a consequence of BCL11B binding to the NF-kappaB response elements or association with the NF-kappaB-DNA complexes, but rather the result of higher translocation of NF-kappaB to the nucleus caused by enhanced degradation of IkappaB (inhibitor of NF-kappaB). The enhanced IkappaB degradation in cells with increased levels of BCL11B was specific for T-cells activated through the TCR, but not for cells activated through TNFalpha (tumour necrosis factor alpha) or UV light, and was caused by increased activity of IkappaB kinase, as indicated by its increase in phosphorylation. As BCL11B is a transcription factor, we investigated whether the expression of genes upstream of IkappaB kinase in the TCR/CD28 signalling pathway was affected by increased BCL11B expression, and found that Cot (cancer Osaka thyroid oncogene) kinase mRNA levels were elevated. Cot kinase is known to promote enhanced IkappaB kinase activity, which results in the phosphorylation and degradation of IkappaB and activation of NF-kappaB. The implied involvement of Cot kinase in BCL11B-mediated NF-kappaB activation in response to TCR activation is supported by the fact that a Cot kinase dominant-negative mutant or Cot kinase siRNA (small interfering RNA) knockdown blocked BCL11B-mediated NF-kappaB activation. In support of our observations, in the present study we report that BCL11B enhances the expression of several other NF-kappaB target genes, in addition to IL-2. In addition, we provide evidence that BCL11B associates with intron 2 of the Cot kinase gene to regulate its expression.

Discovery of functional non-coding conserved regions in the α-synuclein gene locus

PubMed Central

Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

2014-01-01

Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

Trace element fluxes in sediments of an environmentally impacted river from a coastal zone of Brazil.

PubMed

da Silva, Yuri Jacques Agra Bezerra; Cantalice, José Ramon Barros; Singh, Vijay P; do Nascimento, Clístenes Williams Araújo; Piscoya, Victor Casimiro; Guerra, Sérgio M S

2015-10-01

Data regarding trace element concentrations and fluxes in suspended sediments and bedload are scarce. To fill this gap and meet the international need to include polluted rivers in future world estimation of trace element fluxes, this study aimed to determine the trace element fluxes in suspended sediment and bedload of an environmentally impacted river in Brazil. Water, suspended sediment, and bedload from both the upstream and the downstream cross sections were collected. To collect both the suspended sediment and water samples, we used the US DH-48. Bedload measurements were carried out using the US BLH 84 sampler. Concentrations of Cd, Cr, Cu, Fe, Mn, Ni, Pb, and Zn were determined by inductively coupled plasma (ICP-OES). As and Hg were determined by an atomic absorption spectrophotometer (AA-FIAS). The suspended sediments contributed more than 99 % of the trace element flux. By far Pb and to a less extent Zn at the downstream site represents major concerns. The yields of Pb and Zn in suspended sediments were 4.20 and 2.93 kg km(2) year(-1), respectively. These yields were higher than the values reported for Pb and Zn for Tuul River (highly impacted by mining activities), 1.60 and 1.30 kg km(2) year(-1), respectively, as well as the Pb yield (suspended + dissolved) to the sea of some Mediterranean rivers equal to 3.4 kg km(2) year(-1). Therefore, the highest flux and yield of Pb and Zn in Ipojuca River highlighted the importance to include medium and small rivers-often overlooked in global and regional studies-in the future estimation of world trace element fluxes in order to protect estuaries and coastal zones.

Whole body-element composition of Atlantic salmon Salmo salar influenced by migration direction and life stage in three distinct populations.

PubMed

Ebel, J D; Leroux, S J; Robertson, M J; Dempson, J B

2016-11-01

Body-element content was measured for three life stages of wild Atlantic salmon Salmo salar from three distinct Newfoundland populations as individuals crossed between freshwater and marine ecosystems. Life stage explained most of the variation in observed body-element concentration whereas river of capture explained very little variation. Element composition of downstream migrating post-spawn adults (i.e. kelts) and juvenile smolts were similar and the composition of these two life stages strongly differed from adults migrating upstream to spawn. Low variation within life stages and across populations suggests that S. salar may exert rheostatic control of their body-element composition. Additionally, observed differences in trace element concentration between adults and other life stages were probably driven by the high carbon concentration in adults because abundant elements, such as carbon, can strongly influence the observed concentrations of less abundant elements. Thus, understanding variation among individuals in trace elements composition requires the measurement of more abundant elements. Changes in element concentration with ontogeny have important consequences the role of fishes in ecosystem nutrient cycling and should receive further attention. © 2016 The Fisheries Society of the British Isles.

The BMP pathway acts to directly regulate Tbx20 in the developing heart

PubMed Central

Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.

2010-01-01

TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

PubMed Central

Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

2017-01-01

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

Molecular identification and transcriptional regulation of porcine IFIT2 gene.

PubMed

Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

2018-04-06

IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra

Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

DOE PAGES

Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra; ...

2016-06-13

Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Regulation of the human ascorbate transporter SVCT2 exon 1b gene by zinc-finger transcription factors

PubMed Central

Qiao, Huan; May, James M.

2011-01-01

The sodium-dependent vitamin C transporter (SVCT) 2 is crucial for ascorbate uptake in metabolically active and specialized tissues. The present study focused on the gene regulation of the SVCT2 exon 1b, which is ubiquitously expressed in human and mouse tissues. Although the human SVCT2 exon 1b promoter doesn’t contain a classical TATA-box, we found that it does contain a functional initiator (Inr) that binds YY1 and interacts with upstream Sp1/Sp3 elements in the proximal promoter region. These elements in turn play a critical role in regulating YY1-mediated transcription of the exon 1b gene. Formation of YY1/Sp complexes on the promoter is required for its optional function. YY1 with Sp1 or Sp3 synergistically enhanced exon 1b promoter activity as well as the endogenous SVCT2 protein expression. Further, in addition to Sp1/Sp3 both EGR-1 and -2 were detected in the protein complexes that bound the three GC boxes bearing overlapping binding sites for EGR/WT1 and Sp1/3. The EGR family factors, WT1 and MAZ were found to differentially regulate exon 1b promoter activity. These results show that differential occupancy of transcription factors on the GC-rich consensus sequences in SVCT2 exon 1b promoter contributes to the regulation of cell and tissue expression of SVCT2. PMID:21335086

Efficiency of plasma actuator ionization in shock wave modification in a rarefied supersonic flow over a flat plate

NASA Astrophysics Data System (ADS)

Joussot, Romain; Lago, Viviana; Parisse, Jean-Denis

2014-12-01

This paper describes experimental and numerical investigations focused on the shock wave modification, induced by a dc glow discharge, of a Mach 2 flow under rarefied regime. The model under investigation is a flat plate equipped with a plasma actuator composed of two electrodes. The glow discharge is generated by applying a negative potential to the upstream electrode, enabling the creation of a weakly ionized plasma. The natural flow (i.e. without the plasma) exhibits a thick laminar boundary layer and a shock wave with a hyperbolic shape. Images of the flow obtained with an ICCD camera revealed that the plasma discharge induces an increase in the shock wave angle. Thermal effects (volumetric, and at the surface) and plasma effects (ionization, and thermal non-equilibrium) are the most relevant processes explaining the observed modifications. The effect induced by the heating of the flat plate surface is studied experimentally by replacing the upstream electrode by a heating element, and numerically by modifying the thermal boundary condition of the model surface. The results show that for a similar temperature distribution over the plate surface, modifications induced by the heating element are lower than those produced by the plasma. This difference shows that other effects than purely thermal effects are involved with the plasma actuator. Measurements of the electron density with a Langmuir probe highlight the fact that the ionization degree plays an important role into the modification of the flow. The gas properties, especially the isentropic exponent, are indeed modified by the plasma above the actuator and upstream the flat plate. This leads to a local modification of the flow conditions, inducing an increase in the shock wave angle.

A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

PubMed

Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

2017-07-01

Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

UCR1C is a novel activator of phosphodiesterase 4 (PDE4) long isoforms and attenuates cardiomyocyte hypertrophy.

PubMed

Wang, Li; Burmeister, Brian T; Johnson, Keven R; Baillie, George S; Karginov, Andrei V; Skidgel, Randal A; O'Bryan, John P; Carnegie, Graeme K

2015-05-01

Hypertrophy increases the risk of heart failure and arrhythmia. Prevention or reversal of the maladaptive hypertrophic phenotype has thus been proposed to treat heart failure. Chronic β-adrenergic receptor (β-AR) stimulation induces cardiomyocyte hypertrophy by elevating 3',5'-cyclic adenosine monophosphate (cAMP) levels and activating downstream effectors such protein kinase A (PKA). Conversely, hydrolysis of cAMP by phosphodiesterases (PDEs) spatiotemporally restricts cAMP signaling. Here, we demonstrate that PDE4, but not PDE3, is critical in regulating cardiomyocyte hypertrophy, and may represent a potential target for preventing maladaptive hypertrophy. We identify a sequence within the upstream conserved region 1 of PDE4D, termed UCR1C, as a novel activator of PDE4 long isoforms. UCR1C activates PDE4 in complex with A-kinase anchoring protein (AKAP)-Lbc resulting in decreased PKA signaling facilitated by AKAP-Lbc. Expression of UCR1C in cardiomyocytes inhibits hypertrophy in response to chronic β-AR stimulation. This effect is partially due to inhibition of nuclear PKA activity, which decreases phosphorylation of the transcription factor cAMP response element-binding protein (CREB). In conclusion, PDE4 activation by UCR1C attenuates cardiomyocyte hypertrophy by specifically inhibiting nuclear PKA activity. Published by Elsevier Inc.

Cloning and characterization of microbial activated Aedes aegypti MEK4 (AaMEK4): influences of noncatalytic domains on enzymatic activity.

PubMed

Wu, R C-C; Cho, W-L

2014-10-01

Protein kinases are known to be involved in a number of signal transduction cascades. Both the stress-activated Jun N-terminal kinase (JNK) and mitogen-activated protein kinase (MAPK) p38 pathways have been shown to correlate with the insect immune response to microbial infection. MAP kinase kinase 4 (MEK4) is an upstream kinase of JNK and p38 kinase. The cDNA of AaMEK4 was cloned and characterized. AaMEK4 was activated by microbial lysates of Gram-positive, Gram-negative bacteria and yeast. The conserved lysine (K112 ) and the putative phosphorylation sites (S238 and T242 ) were shown to be important for kinase activity by site-directed mutagenesis. A common MAPK docking site (MAPK_dsA) was found and in addition, a new nearby docking site, MAPK_dsB, was identified in the N-terminal noncatalytic domain of AaMEK4. MAPK_dsB was shown to be a unique element in the MEK4 family. In this study, both MAPK_dsA and _dsB were demonstrated to be important to AaMEK4 enzymatic activity for the downstream protein kinase, Aap38. © 2014 The Royal Entomological Society.

Adsorbents for capturing mercury in coal-fired boiler flue gas.

PubMed

Yang, Hongqun; Xu, Zhenghe; Fan, Maohong; Bland, Alan E; Judkins, Roddie R

2007-07-19

This paper reviews recent advances in the research and development of sorbents used to capture mercury from coal-fired utility boiler flue gas. Mercury emissions are the source of serious health concerns. Worldwide mercury emissions from human activities are estimated to be 1000 to 6000 t/annum. Mercury emissions from coal-fired power plants are believed to be the largest source of anthropogenic mercury emissions. Mercury emissions from coal-fired utility boilers vary in total amount and speciation, depending on coal types, boiler operating conditions, and configurations of air pollution control devices (APCDs). The APCDs, such as fabric filter (FF) bag house, electrostatic precipitator (ESP), and wet flue gas desulfurization (FGD), can remove some particulate-bound and oxidized forms of mercury. Elemental mercury often escapes from these devices. Activated carbon injection upstream of a particulate control device has been shown to have the best potential to remove both elemental and oxidized mercury from the flue gas. For this paper, NORIT FGD activated carbon was extensively studied for its mercury adsorption behavior. Results from bench-, pilot- and field-scale studies, mercury adsorption by coal chars, and a case of lignite-burned mercury control were reviewed. Studies of brominated carbon, sulfur-impregnated carbon and chloride-impregnated carbon were also reviewed. Carbon substitutes, such as calcium sorbents, petroleum coke, zeolites and fly ash were analyzed for their mercury-adsorption performance. At this time, brominated activated carbon appears to be the best-performing mercury sorbent. A non-injection regenerable sorbent technology is briefly introduced herein, and the issue of mercury leachability is briefly covered. Future research directions are suggested.

Functional imaging: monitoring heme oxygenase-1 gene expression in vivo

NASA Astrophysics Data System (ADS)

Zhang, Weisheng; Reilly-Contag, Pamela; Stevenson, David K.; Contag, Christopher H.

1999-07-01

The regulation of genetic elements can be monitored in living animals using photoproteins as reporters. Heme oxygenase (HO) is the key catabolic enzyme in the heme degradation pathway. Here, HO expression serves as a model for in vivo functional imaging of transcriptional regulation of a clinically relevant gene. HO enzymatic activity is inhibited by heme analogs, metalloporphyrins, but many members of this family of compounds also activate transcription of the HO-1 promoter. The degree of transcriptional activation by twelve metalloporphyrins, differing at the central metal and porphyrin ring substituents, was evaluated in both NIH 3T3 stable lines and transgenic animals containing HO-1 promoter-luciferase gene fusions. In the correlative cell culture assays, the metalloporphyrins increased transcription form the full length HO promoter fusion to varying degrees, but none increased transcription from a truncated HO-1 promoter. These results suggested that one or both of the two distal enhancer elements located at -4 and -10 Kb upstream from transcriptional start are required for HO-1 induction by heme and its analogs. The full-length HO-1-luc fusion was then evaluated as a transgene in mice. It was possible to monitor the effects of the metalloporphyrins, SnMP and ZnPP, in living animals over time. This spatiotemporal analyses of gene expression in vivo implied that alterations in porphyrin ring substituents and the central metal may affect the extent of gene activation. These data further indicate that using photoprotein reporters, subtle differences in gene expression can be monitored in living animals.

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Novel mechanism of JNK pathway activation by adenoviral E1A

PubMed Central

Morrison, Helen; Pospelova, Tatiana V.; Pospelov, Valery A.; Herrlich, Peter

2014-01-01

The adenoviral oncoprotein E1A influences cellular regulation by interacting with a number of cellular proteins. In collaboration with complementary oncogenes, E1A fully transforms primary cells. As part of this action, E1A inhibits transcription of c-Jun:Fos target genes while promoting that of c-Jun:ATF2-dependent genes including jun. Both c-Jun and ATF2 are hyperphosphorylated in response to E1A. In the current study, E1A was fused with the ligand binding domain of the estrogen receptor (E1A-ER) to monitor the immediate effect of E1A activation. With this approach we now show that E1A activates c-Jun N-terminal kinase (JNK), the upstream kinases MKK4 and MKK7, as well as the small GTPase Rac1. Activation of the JNK pathway requires the N-terminal domain of E1A, and, importantly, is independent of transcription. In addition, it requires the presence of ERM proteins. Downregulation of signaling components upstream of JNK inhibits E1A-dependent JNK/c-Jun activation. Taking these findings together, we show that E1A activates the JNK/c-Jun signaling pathway upstream of Rac1 in a transcription-independent manner, demonstrating a novel mechanism of E1A action. PMID:24742962

Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

USGS Publications Warehouse

Cary, L.E.; Parrett, Charles

1996-01-01

Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Accumulation of trace elements, pesticides, and polychlorinated biphenyls in sediments and the clam Corbicula manilensis of the Apalachicola River, Florida

USGS Publications Warehouse

Elder, J.F.; Mattraw, H.C.

1984-01-01

A survey of trace element and synthetic organic compound concentrations in botton materials was conducted on the Apalachichola River in northwest Florida in 1979-80 as part of the Apalachicola River Quality Assessment. Substances analyzed included trace elements (predominantly heavy metals), organochlorine insecticides, organophosphorus insecticides, chlorinated phenoxy-acid herbicides, and polychlorinated biphenyls (PCBs). Three kinds of materials were surveyed: fine-grained sediments, whole-body tissue of the Asiatic clam Corbicula manilensis, and bottom-load organic detritus. No hazardous levels of any of the substances were found. Concentrations in the fine-grained sediments and clams were generally at least ten times lower than maximum limits considered safe for biota of aquatic systems. A comparison of trace-substance data from the Apalachicola River with data from Lake Seminole (upstream) and Apalachicola Bay (downstream) showed lower concentrations in riverine clams. Sediment concentrations in all parts of the system were comparable. Most trace substances in the Apalachicola River enter the river from the upstream part of the basin (the Chattahoochee and Flint Rivers in Georgia and Alabama) and from nonpoint sources throughout the basin. There are no major point discharges along the Apalachicola. Trend analysis was limited by the scope of the study, but did not reveal any spatial or temporal trends in concentrations of any of the substances analyzed. Concentrations of organic compounds and most metals in Corbicula manilensis did not correlate with those in sediments.

Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.

PubMed

Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han

2002-04-05

We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.

Oil and Gas 101: An Overview of Oil and Gas Upstream Activities and Using EPA's Nonpoint Oil and Gas Emission Estimation Tool for the 2014 NEI (2015 EIC)

EPA Pesticide Factsheets

provide a general overview of the upstream oil and gas exploration and production processes and emissions covered by the tool; a discussion of EPA’s plans for the 2014 NEI pertaining to oil and gas; use of the tool to compile emissions estimates

Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.

PubMed

Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas

2018-06-25

An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

The HIP1 initiator element plays a role in determining the in vitro requirement of the dihydrofolate reductase gene promoter for the C-terminal domain of RNA polymerase II.

PubMed

Buermeyer, A B; Thompson, N E; Strasheim, L A; Burgess, R R; Farnham, P J

1992-05-01

We examined the ability of purified RNA polymerase (RNAP) II lacking the carboxy-terminal heptapeptide repeat domain (CTD), called RNAP IIB, to transcribe a variety of promoters in HeLa extracts in which endogenous RNAP II activity was inhibited with anti-CTD monoclonal antibodies. Not all promoters were efficiently transcribed by RNAP IIB, and transcription did not correlate with the in vitro strength of the promoter or with the presence of a consensus TATA box. This was best illustrated by the GC-rich, non-TATA box promoters of the bidirectional dihydrofolate reductase (DHFR)-REP-encoding locus. Whereas the REP promoter was transcribed by RNAP IIB, the DHFR promoter remained inactive after addition of RNAP IIB to the antibody-inhibited reactions. However, both promoters were efficiently transcribed when purified RNAP with an intact CTD was added. We analyzed a series of promoter deletions to identify which cis elements determine the requirement for the CTD of RNAP II. All of the promoter deletions of both DHFR and REP retained the characteristics of their respective full-length promoters, suggesting that the information necessary to specify the requirement for the CTD is contained within approximately 65 bp near the initiation site. Furthermore, a synthetic minimal promoter of DHFR, consisting of a single binding site for Sp1 and a binding site for the HIP1 initiator cloned into a bacterial vector sequence, required RNAP II with an intact CTD for activity in vitro. Since the synthetic minimal promoter of DHFR and the smallest REP promoter deletion are both activated by Sp1, the differential response in this assay does not result from upstream activators. However, the sequences around the start sites of DHFR and REP are not similar and our data suggest that they bind different proteins. Therefore, we propose that specific initiator elements are important for determination of the requirement of some promoters for the CTD.

ION ACCELERATION AT THE QUASI-PARALLEL BOW SHOCK: DECODING THE SIGNATURE OF INJECTION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sundberg, Torbjörn; Haynes, Christopher T.; Burgess, D.

Collisionless shocks are efficient particle accelerators. At Earth, ions with energies exceeding 100 keV are seen upstream of the bow shock when the magnetic geometry is quasi-parallel, and large-scale supernova remnant shocks can accelerate ions into cosmic-ray energies. This energization is attributed to diffusive shock acceleration; however, for this process to become active, the ions must first be sufficiently energized. How and where this initial acceleration takes place has been one of the key unresolved issues in shock acceleration theory. Using Cluster spacecraft observations, we study the signatures of ion reflection events in the turbulent transition layer upstream of the terrestrial bowmore » shock, and with the support of a hybrid simulation of the shock, we show that these reflection signatures are characteristic of the first step in the ion injection process. These reflection events develop in particular in the region where the trailing edge of large-amplitude upstream waves intercept the local shock ramp and the upstream magnetic field changes from quasi-perpendicular to quasi-parallel. The dispersed ion velocity signature observed can be attributed to a rapid succession of ion reflections at this wave boundary. After the ions’ initial interaction with the shock, they flow upstream along the quasi-parallel magnetic field. Each subsequent wavefront in the upstream region will sweep the ions back toward the shock, where they gain energy with each transition between the upstream and the shock wave frames. Within three to five gyroperiods, some ions have gained enough parallel velocity to escape upstream, thus completing the injection process.« less

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

Treesearch

Tomas Johansson; Per Olof Nyman; Daniel Cullen

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

Identification of hot spot area of sediment contamination in a lake system using texture characteristics.

PubMed

Sheela, A M; Letha, J; Joseph, Sabu; Thomas, Jobin

2013-04-01

Texture plays an important role in the identification of polluted stretch in a lake system. The organic matter as well as toxic elements get accumulated in the finer sediments. The aim of the work is to show the spatio-temporal distribution of texture of the lake sediment (Akkulam-Veli lake, Kerala) and to identify the hot spot areas of contamination. Hot spot areas vary with seasons. During PRM, (premonsoon), the upstream portion of the Akkulam lake is the hot spot. During MON (monsoon), the downstream portion of the Akkulam lake and the upstream portion of the Veli lake are the hot spots. During POM (postmonsoon), hot spot area is the downstream portion of the Akkulam lake. This methodology can be used for the quick identification of hot spots in water bodies.

Protecting LHC components against radiation resulting from an unsynchronized beam abort

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nikolai V. Mokhov et al.

2001-06-26

The effect of possible accidental beam loss in the LHC on the IP5 and IP6 insertion elements is studied via realistic Monte Carlo simulations. The scenario studied is beam loss due to unsynchronized abort at an accidental prefire of one of the abort kicker modules. Simulations show that this beam loss would result in severe heating of the IP5 and IP6 superconducting (SC) quadrupoles. Contrary to the previous considerations with a stationary set of collimators in IP5, collimators in IP6 close to the cause are proposed: a movable collimator upstream of the Q4 quadrupole and a stationary one upstream ofmore » the extraction septumMSD. The calculated temperature rise in the optimal set of collimators is quite acceptable. All SC magnets are protected by these collimators against damage.« less

Tissue-specific expression of squirrel monkey chorionic gonadotropin

PubMed Central

Vasauskas, Audrey A.; Hubler, Tina R.; Boston, Lori; Scammell, Jonathan G.

2010-01-01

Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (−1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. PMID:21130091

Global transcriptional landscape and promoter mapping of the gut commensal Bifidobacterium breve UCC2003.

PubMed

Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe

2017-12-28

Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.

Polycyclic aromatic hydrocarbons, aliphatic hydrocarbons, trace elements and monooxygenase activity in birds nesting on the North Platte River, Casper, Wyoming, USA

USGS Publications Warehouse

Custer, T.W.; Custer, Christine M.; Dickerson, K.; Allen, K.; Melancon, M.J.; Schmidt, L.J.

2001-01-01

Tree swallow (Tachycineta bicolor) and house wren (Troglodytes aedon) eggs and chicks were collected near a refinery site on the North Platte River, Casper, Wyoming, USA and at a reference site 10 km upstream. Total polycylic aromatic hydrocarbon (PAH) concentrations in swallow and wren chicks were higher at the refinery site than at the reference site. Polycylic aromatic hydrocarbon concentrations in sediment and chick dietary samples were consistent with these findings. The general lack of methylated PAHs in sediment, diet, and bird carcasses suggested that the PAHs were derived from combustion and not from petroleum. The predominance of odd numbered aliphatic hydrocarbons and the low ratios (≤ 0.25) of pristane: n-C17 and phytane: n-C18 in chick and diet samples also suggested that swallow and wren chicks were not being chronically exposed to petroleum. Mean ethoxyresorufin-O-dealkylase and benzyloxyresorufin-O-dealkylase activities in tree swallow livers averaged nine times higher at the refinery site than at the reference site and were probably induced by exposure to PAHs. Trace element concentrations in eggs and livers of swallows and wrens were similar or greater at the reference site than at the refinery site. Selenium, strontium, and boron concentrations were elevated in eggs and livers of swallows and wrens at both the refinery and reference sites.

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

NASA Technical Reports Server (NTRS)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

PubMed Central

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

PubMed

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

PubMed

Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

2013-12-06

Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

PubMed Central

Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

2013-01-01

Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

cAMP Response Element-binding Protein (CREB) and Nuclear Factor κB Mediate the Tamoxifen-induced Up-regulation of Glutamate Transporter 1 (GLT-1) in Rat Astrocytes*

PubMed Central

Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook

2013-01-01

Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341

A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

PubMed Central

2014-01-01

Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

Involvement of cyclin D1/CDK4 and pRb mediated by PI3K/AKT pathway activation in Pb{sup 2+}-induced neuronal death in cultured hippocampal neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Chenchen; Xing Tairan; Tang Mingliang

2008-06-15

Lead (Pb) is widely recognized as a neurotoxicant. One of the suggested mechanisms of lead neurotoxicity is apoptotic cell death. And the mechanism by which Pb{sup 2+} causes neuronal death is not well understood. The present study sought to examine the obligate nature of cyclin D1/cyclin-dependent kinase 4 (CDK4), phosphorylation of its substrate retinoblastoma protein (pRb) and its select upstream signal phosphoinositide 3-kinase (PI3K)/AKT pathway in the death of primary cultured rat hippocampal neurons evoked by Pb{sup 2+}. Our data showed that lead treatment of primary hippocampal cultures results in dose-dependent cell death. Inhibition of CDK4 prevented Pb{sup 2+}-induced neuronalmore » death significantly but was incomplete. In addition, we demonstrated that the levels of cyclin D1 and pRb/p107 were increased during Pb{sup 2+} treatment. These elevated expression persisted up to 48 h, returning to control levels after 72 h. We also presented pharmacological and morphological evidences that cyclin D1/CDK4 and pRb/p107 were required for such kind of neuronal death. Addition of the PI3K inhibitor LY294002 (30 {mu}M) or wortmannin (100 nM) significantly rescued the cultured hippocampal neurons from death caused by Pb{sup 2+}. And that Pb{sup 2+}-elicited phospho-AKT (Ser473) participated in the induction of cyclin D1 and partial pRb/p107 expression. These results provide evidences that cell cycle elements play a required role in the death of neurons evoked by Pb{sup 2+} and suggest that certain signaling elements upstream of cyclin D1/CDK4 are modified and/or required for this form of neuronal death.« less

Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

PubMed Central

Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

2016-01-01

Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

Pheromone-Regulated Expression of Sex Pheromone Plasmid pAD1-Encoded Aggregation Substance Depends on at Least Six Upstream Genes and a cis-Acting, Orientation-Dependent Factor

PubMed Central

Muscholl-Silberhorn, Albrecht B.

2000-01-01

Conjugative transfer of Enterococcus faecalis-specific sex pheromone plasmids relies on an adhesin, called aggregation substance, to confer a tight cell-to-cell contact between the mating partners. To analyze the dependence of pAD1-encoded aggregation substance, Asa1, on pheromone induction, a variety of upstream fragments were fused to an α-amylase reporter gene, amyL, by use of a novel promoter probe vector, pAMY-em1. For pheromone-regulated α-amylase activity, a total of at least six genes, traB, traC, traA, traE1, orfY, and orf1, are required: TraB efficiently represses asa1 (by a mechanism unrelated to its presumptive function in pheromone shutdown, since a complete shutdown is observed exclusively in the presence of traC); only traC can relieve traB-mediated repression in a pheromone-dependent manner. In addition to traB, traA is required but not sufficient for negative control. Mutational inactivation of traE1, orfY, or orf1, respectively, results in a total loss of α-amylase activity for constructs normally mediating constitutive expression. Inversion of a fragment covering traA, P0, and traE1 without disrupting any gene or control element switches off amyL or asa1 expression, indicating the involvement of a cis-acting, orientation-dependent factor (as had been shown for plasmid pCF10). Unexpectedly, pAD1 represses all pAMY-em1 derivatives in trans, while its own pheromone-dependent functions are unaffected. The discrepancy between the new data and those of former studies defining TraE1 as a trans-acting positive regulator is discussed. PMID:10850999

Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

PubMed

Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

2010-07-01

Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

The Membrane-Bound NAC Transcription Factor ANAC013 Functions in Mitochondrial Retrograde Regulation of the Oxidative Stress Response in Arabidopsis[C][W

PubMed Central

De Clercq, Inge; Vermeirssen, Vanessa; Van Aken, Olivier; Vandepoele, Klaas; Murcha, Monika W.; Law, Simon R.; Inzé, Annelies; Ng, Sophia; Ivanova, Aneta; Rombaut, Debbie; van de Cotte, Brigitte; Jaspers, Pinja; Van de Peer, Yves; Kangasjärvi, Jaakko; Whelan, James; Van Breusegem, Frank

2013-01-01

Upon disturbance of their function by stress, mitochondria can signal to the nucleus to steer the expression of responsive genes. This mitochondria-to-nucleus communication is often referred to as mitochondrial retrograde regulation (MRR). Although reactive oxygen species and calcium are likely candidate signaling molecules for MRR, the protein signaling components in plants remain largely unknown. Through meta-analysis of transcriptome data, we detected a set of genes that are common and robust targets of MRR and used them as a bait to identify its transcriptional regulators. In the upstream regions of these mitochondrial dysfunction stimulon (MDS) genes, we found a cis-regulatory element, the mitochondrial dysfunction motif (MDM), which is necessary and sufficient for gene expression under various mitochondrial perturbation conditions. Yeast one-hybrid analysis and electrophoretic mobility shift assays revealed that the transmembrane domain–containing NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON transcription factors (ANAC013, ANAC016, ANAC017, ANAC053, and ANAC078) bound to the MDM cis-regulatory element. We demonstrate that ANAC013 mediates MRR-induced expression of the MDS genes by direct interaction with the MDM cis-regulatory element and triggers increased oxidative stress tolerance. In conclusion, we characterized ANAC013 as a regulator of MRR upon stress in Arabidopsis thaliana. PMID:24045019

Viral DNA Replication Orientation and hnRNPs Regulate Transcription of the Human Papillomavirus 18 Late Promoter.

PubMed

Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming

2017-05-30

The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P 811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis -acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. IMPORTANCE It has been known for decades that the activity of viral late promoters is associated with viral DNA replication among almost all DNA viruses. However, the mechanism of how DNA replication activates the viral late promoter and what components of the replication machinery are involved remain largely unknown. In this study, we characterized the P 811 promoter region of HPV18 and demonstrated that its activation depends on the orientation of DNA replication. Using single-stranded oligonucleotides targeting the replication fork on either leading or lagging strands, we showed that viral lagging-strand replication activates the promoter. We also identified a transcriptional repressor element located upstream of the promoter transcription start site which interacts with cellular proteins hnRNP D0B and hnRNP A/B and modulates the late promoter activity. This is the first report on how DNA replication activates a viral late promoter. Copyright © 2017 Wang et al.

The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

PubMed Central

Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

2008-01-01

A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

Fast acting multiple element valve

DOEpatents

Yang, Jefferson Y. S.; Wada, James M.

1991-01-01

A plurality of slide valve elements having plural axial-spaced annular parts and an internal slide are inserted into a bulkhead in a fluid conduit from a downstream side of the bulkhead, locked in place by a bayonet coupling and set screw, and project through the bulkhead into the upstream conduit. Pneumatic lines connecting the slide valve element actuator to pilot valves are brought out the throat of the valve element to the downstream side. Pilot valves are radially spaced around the exterior of the valve to permit the pneumatic lines to be made identical, thereby to minimize adverse timing tolerances in operation due to pressure variations. Ring manifolds surround the valve adjacent respective pilot valve arrangements to further reduce adverse timing tolerances due to pressure variations, the manifolds being directly connected to the respective pilot valves. Position sensors are provided the valve element slides to signal the precise time at which a slide reaches or passes through a particular point in its stroke to initiate a calibrated timing function.

Grant management procedure for energy saving TDM-PONs

NASA Astrophysics Data System (ADS)

Alaelddin, Fuad Yousif Mohammed; Newaz, S. H. Shah; AL-Hazemi, Fawaz; Choi, Jun Kyun

2018-01-01

In order to minimize energy consumption in Time Division Multiplexing-Passive Optical Network (TDM-PON), IEEE and ITU-T have mandated sleep mode mechanism for Optical Network Units (ONUs) in the latest TDM-PON standards (e.g. IEEE P1904.1 SIEPON, ITU-T G.sup45). The sleep mode mechanism is a promising mean for maximizing energy saving in an ONU. An ONU in sleep mode flips between sleep and active state depending on the presence or absent of upstream and downstream frames. To ensure Quality of Service (QoS) of upstream frames, the recent TDM-PON standards introduced an early wake-up mechanism, in which an ONU is forced to leave the sleep state on upstream frame arrival. When the Optical Line Terminal (OLT) of a TDM-PON allows early wake-up of its connected ONUs, it allocates gratuitous grants for the sleeping ONUs along with allocating upstream grants for the ONUs in active state. Note that, the gratuitous grants control message sent periodically by the OLT on Inter-Gratuitous grant Interval (IGI) time. After leaving sleep state due to the arrival of upstream frame, the ONU uses its allocated gratuitous grant to send a control message mentioning the amount of upstream bandwidth (upstream grant) required in order to forward the remaining frames in its buffer. However, the existing early wake-up process of ONU can lead to increase the energy consumption of an ONU. It is because of the ONU wakes-up immediately from the sleep state on arrival of the upstream frame, but even so, it needs to wait for forwarding the frame until its allocated gratuitous grant period, resulting in spending energy unnecessarily. In addition, current energy saving solution for TDM-PONs do not provide a clear solution on how to manage different types of grants (e.g. listening grant, upstream transmission grant) within a Dynamic Bandwidth Allocation (DBA) polling cycle. To address this problem, we propose a state-of-art Grant Management Procedure (GMP) in order to maximize energy saving in a TDM-PON with sleep mode enabled ONUs. GMP contributes in defining the location of the different types of grants during a DBA polling cycle. Furthermore, GMP devises a mechanism so as to allow an ONU to predict its assigned gratuitous grant control message arrival time, thereby allowing an ONU to remain its transceiver unit powered off until the arrival period of the next gratuitous grant control message, increasing the energy saving of the ONU. Results show that, with the increment of IGI, the energy saving performance of an ONU with GMP increases noticeably in compare to a conventional ONU (an ONU that does not use GMP) without imposing any additional upstream frame delay.

Similar Intracellular Location and Stimulus Reactivity, but Differential Mobility of Tailless (Vicia faba) and Tailed Forisomes (Phaseolus vulgaris) in Intact Sieve Tubes.

PubMed

Furch, Alexandra C U; Buxa, Stefanie V; van Bel, Aart J E

2015-01-01

Sieve elements of legumes contain forisomes-fusiform protein bodies that are responsible for sieve-tube occlusion in response to damage or wound signals. Earlier work described the existence of tailless and tailed forisomes. This study intended to quantify and compare location and position of tailless (in Vicia faba) and tailed (in Phaseolus vulgaris) forisomes inside sieve elements and to assess their reactivity and potential mobility in response to a remote stimulus. Location (distribution within sieve elements) and position (forisome tip contacts) of more than altogether 2000 forisomes were screened in 500 intact plants by laser scanning confocal microscopy in the transmission mode. Furthermore, we studied the dispersion of forisomes at different locations in different positions and their positional behaviour in response to distant heat shocks. Forisome distribution turned out to be species-specific, whereas forisome positions at various locations were largely similar in bushbean (Phaseolus) and broadbean (Vicia). In general, the tailless forisomes had higher dispersion rates in response to heat shocks than the tailed forisomes and forisomes at the downstream (basal) end dispersed more frequently than those at the upstream end (apical). In contrast to the tailless forisomes that only oscillate in response to heat shocks, downstream-located tailed forisomes can cover considerable distances within sieve elements. This displacement was prevented by gentle rubbing of the leaf (priming) before the heat shock. Movement of these forisomes was also prohibited by Latrunculin A, an inhibitor of actin polymerization. The apparently active mobility of tailed forisomes gives credence to the idea that at least the latter forisomes are not free-floating, but connected to other sieve-element structures.

Similar Intracellular Location and Stimulus Reactivity, but Differential Mobility of Tailless (Vicia faba) and Tailed Forisomes (Phaseolus vulgaris) in Intact Sieve Tubes

PubMed Central

van Bel, Aart J. E.

2015-01-01

Sieve elements of legumes contain forisomes—fusiform protein bodies that are responsible for sieve-tube occlusion in response to damage or wound signals. Earlier work described the existence of tailless and tailed forisomes. This study intended to quantify and compare location and position of tailless (in Vicia faba) and tailed (in Phaseolus vulgaris) forisomes inside sieve elements and to assess their reactivity and potential mobility in response to a remote stimulus. Location (distribution within sieve elements) and position (forisome tip contacts) of more than altogether 2000 forisomes were screened in 500 intact plants by laser scanning confocal microscopy in the transmission mode. Furthermore, we studied the dispersion of forisomes at different locations in different positions and their positional behaviour in response to distant heat shocks. Forisome distribution turned out to be species-specific, whereas forisome positions at various locations were largely similar in bushbean (Phaseolus) and broadbean (Vicia). In general, the tailless forisomes had higher dispersion rates in response to heat shocks than the tailed forisomes and forisomes at the downstream (basal) end dispersed more frequently than those at the upstream end (apical). In contrast to the tailless forisomes that only oscillate in response to heat shocks, downstream-located tailed forisomes can cover considerable distances within sieve elements. This displacement was prevented by gentle rubbing of the leaf (priming) before the heat shock. Movement of these forisomes was also prohibited by Latrunculin A, an inhibitor of actin polymerization. The apparently active mobility of tailed forisomes gives credence to the idea that at least the latter forisomes are not free-floating, but connected to other sieve-element structures. PMID:26624625

Two transcriptional activators of N-acetylserotonin O-methyltransferase 2 and melatonin biosynthesis in cassava.

PubMed

Wei, Yunxie; Liu, Guoyin; Bai, Yujing; Xia, Feiyu; He, Chaozu; Shi, Haitao; Foyer, Christine

2017-10-13

Similar to the situation in animals, melatonin biosynthesis is regulated by four sequential enzymatic steps in plants. Although the melatonin synthesis genes have been identified in various plants, the upstream transcription factors of them remain unknown. In this study on cassava (Manihot esculenta), we found that MeWRKY79 and heat-shock transcription factor 20 (MeHsf20) targeted the W-box and the heat-stress elements (HSEs) in the promoter of N-acetylserotonin O-methyltransferase 2 (MeASMT2), respectively. The interaction between MeWRKY79, MeHsf20, and the MeASMT2 promoter was evidenced by the activation of promoter activity and chromatin immunoprecipitation (ChIP) in cassava protoplasts, and by an in vitro electrophoretic mobility shift assay (EMSA). The transcripts of MeWRKY79, MeHsf20, and MeASMT2 were all regulated by a 22-amino acid flagellin peptide (flg22) and by Xanthomonas axonopodis pv manihotis (Xam). In common with the phenotype of MeASMT2, transient expression of MeWRKY79 and MeHsf20 in Nicotiana benthamiana leaves conferred improved disease resistance. Through virus-induced gene silencing (VIGS) in cassava, we found that MeWRKY79- and MeHsf20-silenced plants showed lower transcripts of MeASMT2 and less accumulation of melatonin, which resulted in disease sensitivity that could be reversed by exogenous melatonin. Taken together, these results indicate that MeASMT2 is a target of MeWRKY79 and MeHsf20 in plant disease resistance. This study identifies novel upstream transcription factors of melatonin synthesis genes in cassava, thus extending our knowledge of the complex modulation of melatonin synthesis in plant defense. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

Cognitive processing in the primary visual cortex: from perception to memory.

PubMed

Supèr, Hans

2002-01-01

The primary visual cortex is the first cortical area of the visual system that receives information from the external visual world. Based on the receptive field characteristics of the neurons in this area, it has been assumed that the primary visual cortex is a pure sensory area extracting basic elements of the visual scene. This information is then subsequently further processed upstream in the higher-order visual areas and provides us with perception and storage of the visual environment. However, recent findings show that such neural implementations are observed in the primary visual cortex. These neural correlates are expressed by the modulated activity of the late response of a neuron to a stimulus, and most likely depend on recurrent interactions between several areas of the visual system. This favors the concept of a distributed nature of visual processing in perceptual organization.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

PubMed

Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

2013-03-01

Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

PubMed

Borodulina, O R; Kramerov, D A

2001-10-01

Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

Roles of calpain-calpastatin system (CCS) in human T cell activation.

PubMed

Mikosik, Anna; Jasiulewicz, Aleksandra; Daca, Agnieszka; Henc, Izabella; Frąckowiak, Joanna E; Ruckemann-Dziurdzińska, Katarzyna; Foerster, Jerzy; Le Page, Aurelie; Bryl, Ewa; Fulop, Tamas; Witkowski, Jacek M

2016-11-22

The immune response is determined by the speed of the T cell reaction to antigens assured by a state of readiness for proliferation and cytokine secretion. Proliferation, apoptosis and motion of many cell types are controlled by cytoplasmic proteases - µ- and m-calpain - and their inhibitor calpastatin, together forming the "calpain-calpastatin system" (CCS), assumed to modify their targets only upon activation-dependent cytoplasmic Ca2+ increase. Contrastingly to this notion, using quantitative real time PCR and semiquantitative flow cytometry respectively, we show here that the CCS genes are constitutively expressed, and that both calpains are constitutively active in resting, circulating human CD4+ and CD8+ lymphocytes. Furthermore, we demonstrate that calpain inhibition in the resting T cells prevents them from proliferation in vitro and greatly reduces secretion of multiple cytokines. The mechanistic reason for these effects of calpain inhibition on T cell functions might be the demonstrated significant reduction of the expression of active (phosphorylated) upstream signalling molecules, including the phospholipase C gamma, p56Lck and NFκB, in the inhibitor-treated cells. Thus, we propose that the constitutive, self-regulatory calpain-calpastatin system activity in resting human T cells is a necessary, controlling element of their readiness for complex and effective response to antigenic challenge.

Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.

PubMed

Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D

2017-07-01

The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.

Non-homeodomain regions of Hox proteins mediate activation versus repression of Six2 via a single enhancer site in vivo

PubMed Central

Yallowitz, Alisha R.; Gong, Ke-Qin; Swinehart, Ilea T.; Nelson, Lisa T.; Wellik, Deneen M.

2009-01-01

Summary Hox genes control many developmental events along the AP axis, but few target genes have been identified. Whether target genes are activated or repressed, what enhancer elements are required for regulation, and how different domains of the Hox proteins contribute to regulatory specificity is poorly understood. Six2 is genetically downstream of both the Hox11 paralogous genes in the developing mammalian kidney and Hoxa2 in branchial arch and facial mesenchyme. Loss-of-function of Hox11 leads to loss of Six2 expression and loss-of-function of Hoxa2 leads to expanded Six2 expression. Herein we demonstrate that a single enhancer site upstream of the Six2 coding sequence is responsible for both activation by Hox11 proteins in the kidney and repression by Hoxa2 in the branchial arch and facial mesenchyme in vivo. DNA binding activity is required for both activation and repression, but differential activity is not controlled by differences in the homeodomains. Rather, protein domains N- and C-terminal to the homeodomain confer activation versus repression activity. These data support a model in which the DNA binding specificity of Hox proteins in vivo may be similar, consistent with accumulated in vitro data, and that unique functions result mainly from differential interactions mediated by non-homeodomain regions of Hox proteins. PMID:19716816

Transcriptional regulation of human papillomavirus type 18 P105 promoter by the co-activator CBP.

PubMed

Valencia-Hernández, Armando; Cuevas-Bennett, Christian; Garrido, Efraín

2007-01-01

Human papillomaviruses (HPVs) are the etiological agents of cervical cancer, with HPV-16 and 18 being the representative types of the higher risk group. The expression of the viral genes with transforming activity (E6 and E7) is controlled by the upstream regulatory region (URR), a segment of the viral genome that contains elements recognized by several transcription factors. We have analyzed the participation of the cellular co-activator CBP on the transcriptional regulation of the HPV-18 URR. We generated mutants and 5' end deletion constructs derived from the HPV-18 URR and evaluated their transcriptional activity performing transient co-transfection assays on C-33A cells with a plasmid that over-expresses the co-activator CBP. We also performed quantitative chromatin immunoprecipitation assays to analyze the participation of the co-activator CBP on the HPV-18 P105 promoter. Our results demonstrate that in C-33A cells CBP acts as a strong activator of the HPV-18 P105 promoter by a mechanism that depends on the integrity of the SP1-binding site, directly correlating with the acetylation of the histone H3 that is involved in nucleosomal stability. We propose a mechanism of regulation of the HPV-18 P105 promoter by the cellular co-activator CBP, recruited by the transcription factor SP1. (c) 2008 S. Karger AG, Basel

Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang Tao; Rector, Kyle; Barnett, Corey D.

2008-02-22

Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less

Distribution of spawning activity by anadromous fishes in an atlantic slope drainage after removal of a low-head dam

USGS Publications Warehouse

Burdick, S.M.; Hightower, J.E.

2006-01-01

In 1998, the Quaker Neck Dam was removed from the Neuse River near Goldsboro, North Carolina, restoring access to more than 120 km of potential main-stem spawning habitat and 1,488 km of potential tributary spawning habitat to anadromous fishes. We used plankton sampling and standardized electrofishing to examine the extent to which anadromous fishes utilized this restored spawning habitat in 2003 and 2004. Evidence of spawning activity was detected upstream of the former dam site for three anadromous species: American shad Alosa sapidissima, hickory shad A. mediocris, and striped bass Morone saxatilis. The percentages of eggs and larvae collected in the restored upstream habitat were greater in 2003, when spring flows were high, than in 2004. River reaches where spawning occurred were estimated from egg stage and water velocity data. Spawning of American shad and striped bass occurred primarily in main-stem river reaches that were further upstream during the year of higher spring flows. Hickory shad generally spawned in downstream reaches and in tributaries above and below the former dam site. These results demonstrate that anadromous fishes will take advantage of upper basin spawning habitat restored through dam removal as long as instream flows are adequate to facilitate upstream migration.

Water-quality trends for selected sampling sites in the upper Clark Fork Basin, Montana, water years 1996-2010

USGS Publications Warehouse

Sando, Steven K.; Vecchia, Aldo V.; Lorenz, David L.; Barnhart, Elliott P.

2014-01-01

A large-scale trend analysis was done on specific conductance, selected trace elements (arsenic, cadmium, copper, iron, lead, manganese, and zinc), and suspended-sediment data for 22 sites in the upper Clark Fork Basin for water years 1996–2010. Trend analysis was conducted by using two parametric methods: a time-series model (TSM) and multiple linear regression on time, streamflow, and season (MLR). Trend results for 1996–2010 indicate moderate to large decreases in flow-adjusted concentrations (FACs) and loads of copper (and other metallic elements) and suspended sediment in Silver Bow Creek upstream from Warm Springs. Deposition of metallic elements and suspended sediment within Warm Springs Ponds substantially reduces the downstream transport of those constituents. However, mobilization of copper and suspended sediment from floodplain tailings and stream banks in the Clark Fork reach from Galen to Deer Lodge is a large source of metallic elements and suspended sediment, which also affects downstream transport of those constituents. Copper and suspended-sediment loads mobilized from within this reach accounted for about 40 and 20 percent, respectively, of the loads for Clark Fork at Turah Bridge (site 20); whereas, streamflow contributed from within this reach only accounted for about 8 percent of the streamflow at Turah Bridge. Minor changes in FACs and loads of copper and suspended sediment are indicated for this reach during 1996–2010. Clark Fork reaches downstream from Deer Lodge are relatively smaller sources of metallic elements than the reach from Galen to Deer Lodge. In general, small decreases in loads and FACs of copper and suspended sediment are indicated for Clark Fork sites downstream from Deer Lodge during 1996–2010. Thus, although large decreases in FACs and loads of copper and suspended sediment are indicated for Silver Bow Creek upstream from Warm Springs, those large decreases are not translated to the more downstream reaches largely because of temporal stationarity in constituent transport relations in the Clark Fork reach from Galen to Deer Lodge. Unlike metallic elements, arsenic (a metalloid element) in streams in the upper Clark Fork Basin typically is mostly in dissolved phase, has less variability in concentrations, and has weaker direct relations with suspended-sediment concentrations and streamflow. Arsenic trend results for 1996–2010 indicate generally moderate decreases in FACs and loads in Silver Bow Creek upstream from Opportunity. In general, small temporal changes in loads and FACs of arsenic are indicated for Silver Bow Creek and Clark Fork reaches downstream from Opportunity during 1996–2010. Contribution of arsenic (from Warm Springs Ponds, the Mill-Willow bypass, and groundwater sources) in the Silver Bow Creek reach from Opportunity to Warm Springs is a relatively large source of arsenic. Arsenic loads originating from within this reach accounted for about 11 percent of the load for Clark Fork at Turah Bridge; whereas, streamflow contributed from within this reach only accounted for about 2 percent of the streamflow at Turah Bridge.

Core signaling pathways in ovarian cancer stem cell revealed by integrative analysis of multi-marker genomics data.

PubMed

Zhang, Tianyu; Xu, Jielin; Deng, Siyuan; Zhou, Fengqi; Li, Jin; Zhang, Liwei; Li, Lang; Wang, Qi-En; Li, Fuhai

2018-01-01

Tumor recurrence occurs in more than 70% of ovarian cancer patients, and the majority eventually becomes refractory to treatments. Ovarian Cancer Stem Cells (OCSCs) are believed to be responsible for the tumor relapse and drug resistance. Therefore, eliminating ovarian CSCs is important to improve the prognosis of ovarian cancer patients. However, there is a lack of effective drugs to eliminate OCSCs because the core signaling pathways regulating OCSCs remain unclear. Also it is often hard for biologists to identify a few testable targets and infer driver signaling pathways regulating CSCs from a large number of differentially expression genes in an unbiased manner. In this study, we propose a straightforward and integrative analysis to identify potential core signaling pathways of OCSCs by integrating transcriptome data of OCSCs isolated based on two distinctive markers, ALDH and side population, with regulatory network (Transcription Factor (TF) and Target Interactome) and signaling pathways. We first identify the common activated TFs in two OCSC populations integrating the gene expression and TF-target Interactome; and then uncover up-stream signaling cascades regulating the activated TFs. In specific, 22 activated TFs are identified. Through literature search validation, 15 of them have been reported in association with cancer stem cells. Additionally, 10 TFs are found in the KEGG signaling pathways, and their up-stream signaling cascades are extracted, which also provide potential treatment targets. Moreover, 40 FDA approved drugs are identified to target on the up-stream signaling cascades, and 15 of them have been reported in literatures in cancer stem cell treatment. In conclusion, the proposed approach can uncover the activated up-stream signaling, activated TFs and up-regulated target genes that constitute the potential core signaling pathways of ovarian CSC. Also drugs and drug combinations targeting on the core signaling pathways might be able to eliminate OCSCs. The proposed approach can also be applied for identifying potential activated signaling pathways of other types of cancers.

Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

PubMed

Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

2010-12-01

The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

Kin28 regulates the transient association of Mediator with core promoters

PubMed Central

Jeronimo, Célia; Robert, François

2014-01-01

Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572.

PubMed

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-04-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO(4) to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology.

Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

PubMed Central

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

Hydrodynamic Influence Dabanhu River Bridge Holes Widening Based on Two-Dimensional Finite Element Numerical Model

NASA Astrophysics Data System (ADS)

Li, Dong Feng; Bai, Fu Qing; Nie, Hui

2018-06-01

In order to analyze the influence of bridge holes widening on hydrodynamic such as water level, a two-dimensional mathematical model was used to calculate the hydrodynamic factors, river network flow velocity vector distribution is given, water level and difference of bridge widening before and after is calculated and charted, water surface gradient in seven different river sections near the upper reaches of bridges is counted and revealed. The results of hydrodynamic calculation indicate that The Maximum and the minimum deducing numerical value of the water level after bridge widening is 0.028m, and 0.018m respective. the seven sections water surface gradient becomes smaller until it becomes negative, the influence of bridge widening on the upstream is basically over, the range of influence is about 450m from the bridge to the upstream. reach

Aldosterone alters the chromatin structure of the murine endothelin-1 gene.

PubMed

Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S

2016-08-15

Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.

Estimated sediment thickness, quality, and toxicity to benthic organisms in selected impoundments in Massachusetts

USGS Publications Warehouse

Breault, Robert F.; Sorenson, Jason R.; Weiskel, Peter K.

2013-01-01

The U.S. Geological Survey and the Massachusetts Department of Fish and Game, Division of Ecological Restoration, collaborated to collect baseline information on the quantity and quality of sediment impounded behind selected dams in Massachusetts, including sediment thickness and the occurrence of contaminants potentially toxic to benthic organisms. The thicknesses of impounded sediments were measured, and cores of sediment were collected from 32 impoundments in 2004 and 2005. Cores were chemically analyzed, and concentrations of 32 inorganic elements and 108 organic compounds were quantified. Sediment thicknesses varied considerably among the 32 impoundments, with an average thickness of 3.7 feet. Estimated volumes also varied greatly, ranging from 100,000 cubic feet to 81 million cubic feet. Concentrations of toxic contaminants as well as the number of contaminants detected above analytical quantification levels (also known as laboratory reporting levels) varied greatly among sampling locations. Based on measured contaminant concentrations and comparison to published screening thresholds, bottom sediments were predicted to be toxic to bottom-dwelling (benthic) organisms in slightly under 30 percent of the impoundments sampled. Statistically significant relations were found between several of the contaminants and individual indicators of urban land use and industrial activity in the upstream drainage areas of the impoundments. However, models developed to estimate contaminant concentrations at unsampled sites from upstream landscape characteristics had low predictive power, consistent with the long and complex land-use history that is typical of many drainage areas in Massachusetts.

Cumulative impacts of mountaintop mining on an Appalachian watershed

PubMed Central

Lindberg, T. Ty; Bernhardt, Emily S.; Bier, Raven; Helton, A. M.; Merola, R. Brittany; Vengosh, Avner; Di Giulio, Richard T.

2011-01-01

Mountaintop mining is the dominant form of coal mining and the largest driver of land cover change in the central Appalachians. The waste rock from these surface mines is disposed of in the adjacent river valleys, leading to a burial of headwater streams and dramatic increases in salinity and trace metal concentrations immediately downstream. In this synoptic study we document the cumulative impact of more than 100 mining discharge outlets and approximately 28 km2 of active and reclaimed surface coal mines on the Upper Mud River of West Virginia. We measured the concentrations of major and trace elements within the tributaries and the mainstem and found that upstream of the mines water quality was equivalent to state reference sites. However, as eight separate mining-impacted tributaries contributed their flow, conductivity and the concentrations of selenium, sulfate, magnesium, and other inorganic solutes increased at a rate directly proportional to the upstream areal extent of mining. We found strong linear correlations between the concentrations of these contaminants in the river and the proportion of the contributing watershed in surface mines. All tributaries draining mountaintop-mining-impacted catchments were characterized by high conductivity and increased sulfate concentration, while concentrations of some solutes such as Se, Sr, and N were lower in the two tributaries draining reclaimed mines. Our results demonstrate the cumulative impact of multiple mines within a single catchment and provide evidence that mines reclaimed nearly two decades ago continue to contribute significantly to water quality degradation within this watershed. PMID:22160676

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

The GhTT2_A07 gene is linked to the brown colour and natural flame retardancy phenotypes of Lc1 cotton (Gossypium hirsutum L.) fibres.

PubMed

Hinchliffe, Doug J; Condon, Brian D; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A; Reynolds, Michael; Delhom, Christopher D; Fang, David D; Li, Ping; McCarty, Jack

2016-10-01

Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

PubMed Central

Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

2010-01-01

The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Radioactivity levels in major French rivers: summary of monitoring chronicles acquired over the past thirty years and current status.

PubMed

Eyrolle, Frédérique; Claval, David; Gontier, Gilles; Antonelli, Christelle

2008-07-01

Since the beginning of the 1990 s, liquid releases of gamma-emitting radionuclides from French nuclear facilities have generally fallen by almost 85%. Almost 65% of gamma-emitting liquid effluents released into freshwater rivers concerned the River Rhône (Southeast France), with around 85% of this originating from the Marcoule spent fuel reprocessing plant. Upstream of French nuclear plants, artificial radionuclides still detected by gamma spectrometry in 2006, include (137)Cs, (131)I as well as (60)Co, (58)Co and (54)Mn in the case of the Rhine (Switzerland nuclear industries). In the wake of the fallout from the Chernobyl accident, (103)Ru, (106)Rh-Ru, (110 m)Ag, (141)Ce and (129)Te were detected in rivers in the east of France. Some of these radionuclides were found in aquatic plants until 1989. In eastern France, (137)Cs activity in river sediments and mosses is still today two to three times greater than that observed in similar environments in western France. No (134)Cs has been detected upstream of nuclear plants in French rivers since 2001. Downstream of nuclear plants, the gamma emitters still detected regularly in rivers in 2006 are (137)Cs, (134)Cs, (60)Co, (58)Co, (110 m)Ag, (54)Mn, (131)I, together with (241)Am downstream of the Marcoule spent fuel reprocessing plant. Alpha and beta emitters such as plutonium isotopes and (90)Sr first entered freshwaters at the early 1950s due to the leaching of soils contaminated by atmospheric fallout from nuclear testing. These elements were also introduced, in the case of the Rhône River, via effluent from the Marcoule reprocessing plant. Until the mid 1990 s, plutonium isotope levels observed in the lower reaches of the Rhône were 10 to 1000 times higher than those observed in other French freshwaters. Data gathered over a period of almost thirty years of radioecological studies reveal that the only radionuclides detected in fish muscles are (137)Cs, (90)Sr, plutonium isotopes and (241)Am. At the scale of the French territory, there is no significant difference since the mid 1990 s between (137)Cs activity observed downstream of nuclear facilities and that observed upstream, whether in sediments, mosses and fish. Finally, this study highlights that the natural radioactivity of surface freshwaters are around 25 times greater than artificial radioactivity from gamma emitters. However, non gamma emitters released by nuclear industries, such as (3)H, may lead to artificial activity levels 2 to 20 times higher than natural levels.

Questa baseline and pre-mining ground-water quality investigation 4. Historical surface-water quality for the Red River Valley, New Mexico, 1965 to 2001

USGS Publications Warehouse

Maest, Ann S.; Nordstrom, D. Kirk; LoVetere, Sara H.

2004-01-01

Historical water-quality samples collected from the Red River over the past 35 years were compiled, reviewed for quality, and evaluated to determine influences on water quality over time. Hydrologic conditions in the Red River were found to have a major effect on water quality. The lowest sulfate concentrations were associated with the highest flow events, especially peak, rising limb, and falling limb conditions. The highest sulfate concentrations were associated with the early part of the rising limb of summer thunderstorm events and early snowmelt runoff, transient events that can be difficult to capture as part of planned sampling programs but were observed in some of the data. The first increase in flows in the spring, or during summer thunderstorm events, causes a flushing of sulfide oxidation products from scars and mine-disturbed areas to the Red River before being diluted by rising river waters. A trend of increasing sulfate concentrations and loads over long time periods also was noted at the Questa Ranger Station gage on the Red River, possibly related to mining activities, because the same trend is not apparent for concentrations upstream. This trend was only apparent when the dynamic events of snowmelt and summer rainstorms were eliminated and only low-flow concentrations were considered. An increase in sulfate concentrations and loads over time was not seen at locations upstream from the Molycorp, Inc., molybdenum mine and downstream from scar areas. Sulfate concentrations and loads and zinc concentrations downstream from the mine were uniformly higher, and alkalinity values were consistently lower, than those upstream from the mine, suggesting that additional sources of sulfate, zinc, and acidity enter the river in the vicinity of the mine. During storm events, alkalinity values decreased both upstream and downstream of the mine, indicating that natural sources, most likely scar areas, can cause short-term changes in the buffering capacity of the Red River. The major-element water chemistry of the Red River is controlled by dissolution of calcite and gypsum and the oxidation of pyrite, and the river is generally not well buffered with respect to pH. During higher-flow periods, Red River water was diluted by calcium-carbonate waters, most likely from unmineralized Red River tributaries and areas upstream from scars. The effect of pyrite oxidation on Red River water chemistry was more pronounced after the early 1980's. Elevated zinc concentrations were most apparent during summer thunderstorm and rising limb times, which also were associated with a decrease in alkalinity and an increase in sulfate concentrations and conductivity. The water-quality results demonstrate that it is critical to consider hydrologic conditions when interpreting water chemistry in naturally mineralized or mined drainages.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites

PubMed Central

Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme

1998-01-01

ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779

Trace elements in streambed sediments of small subtropical streams on O'ahu, Hawai'i: Results from the USGS NAWQA program

USGS Publications Warehouse

De Carlo, E. H.; Tomlinson, M.S.; Anthony, S.S.

2005-01-01

Data are presented for trace element concentrations determined in the <63 ??m fraction of streambed sediment samples collected at 24 sites on the island of O'ahu, Hawai'i. Sampling sites were classified as urban, agricultural, mixed (urban/agricultural), or forested based on their dominant land use, although the mixed land use at selected sampling sites consisted of either urban and agricultural or forested and agricultural land uses. Forest dominated sites were used as reference sites for calculating enrichment factors. Trace element concentrations were compared to concentrations from studies conducted in the conterminous United States using identical methods and to aquatic-life guidelines provided by the Canadian Council of Ministers of the Environment. A variety of elements including Pb, Cr, Cu and Zn exceeded the aquatic-life guidelines in selected samples. All of the Cr and Zn values and 16 of 24 Cu values exceeded their respective guidelines. The potential toxicity of elements exceeding guidelines, however, should be considered in the context of strong enrichments of selected trace elements attributable to source rocks in Hawai'i, as well as in the context of the abundance of fine-grained sediment in the streambed of O'ahu streams. Statistical methods including cluster analysis, Kruskal-Wallis non-parametric test, correlation analysis, and principal component analysis (PCA) were used to evaluate differences and elucidate relationships between trace elements and sites. Overall, trace element distributions and abundances can be correlated to three principal sources of elements. These include basaltic rocks of the volcanic edifice (Fe, Al, Ni, Co, Cr, V and Cu), carbonate/seawater derived elements (Mg, Ca, Na and Sr), and elements enriched owing to anthropogenic activity (P, Sn, Cd, Sn, Ba and Pb). Anthropogenic enrichment gradients were observed for Ba, Cd, Pb, Sn and Zn in the four streams in which sediments were collected upstream and downstream. The findings of this study are generally similar to but differ slightly from previous work on sediments and suspended particulate matter in streams, from two urban watersheds of O'ahu, Hawai'i. Inter-element associations in the latter were often stronger and indicated a mixture of anthropogenic, agricultural and basaltic sources of trace elements. Some elements fell into different statistical categories in the two studies, owing in part to differences in study design and the hydrogeological constraints on the respective study areas.

Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

PubMed

Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

2017-04-01

The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element.

PubMed

Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro

2007-05-15

Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.

Achieving a golden mean: mechanisms by which coronaviruses ensure synthesis of the correct stoichiometric ratios of viral proteins.

PubMed

Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D

2010-05-01

In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

New approaches for moving upstream: how state and local health departments can transform practice to reduce health inequalities.

PubMed

Freudenberg, Nicholas; Franzosa, Emily; Chisholm, Janice; Libman, Kimberly

2015-04-01

Growing evidence shows that unequal distribution of wealth and power across race, class, and gender produces the differences in living conditions that are "upstream" drivers of health inequalities. Health educators and other public health professionals, however, still develop interventions that focus mainly on "downstream" behavioral risks. Three factors explain the difficulty in translating this knowledge into practice. First, in their allegiance to the status quo, powerful elites often resist upstream policies and programs that redistribute wealth and power. Second, public health practice is often grounded in dominant biomedical and behavioral paradigms, and health departments also face legal and political limits on expanding their scope of activities. Finally, the evidence for the impact of upstream interventions is limited, in part because methodologies for evaluating upstream interventions are less developed. To illustrate strategies to overcome these obstacles, we profile recent campaigns in the United States to enact living wages, prevent mortgage foreclosures, and reduce exposure to air pollution. We then examine how health educators working in state and local health departments can transform their practice to contribute to campaigns that reallocate the wealth and power that shape the living conditions that determine health and health inequalities. We also consider health educators' role in producing the evidence that can guide transformative expansion of upstream interventions to reduce health inequalities. © 2015 Society for Public Health Education.

An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

PubMed Central

Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

2014-01-01

Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

Rho2 Palmitoylation Is Required for Plasma Membrane Localization and Proper Signaling to the Fission Yeast Cell Integrity Mitogen-Activated Protein Kinase Pathway

PubMed Central

Sánchez-Mir, Laura; Franco, Alejandro; Martín-García, Rebeca; Madrid, Marisa; Vicente-Soler, Jero; Soto, Teresa; Gacto, Mariano; Pérez, Pilar

2014-01-01

The fission yeast small GTPase Rho2 regulates morphogenesis and is an upstream activator of the cell integrity pathway, whose key element, mitogen-activated protein kinase (MAPK) Pmk1, becomes activated by multiple environmental stimuli and controls several cellular functions. Here we demonstrate that farnesylated Rho2 becomes palmitoylated in vivo at cysteine-196 within its carboxyl end and that this modification allows its specific targeting to the plasma membrane. Unlike that of other palmitoylated and prenylated GTPases, the Rho2 control of morphogenesis and Pmk1 activity is strictly dependent upon plasma membrane localization and is not found in other cellular membranes. Indeed, artificial plasma membrane targeting bypassed the Rho2 need for palmitoylation in order to signal. Detailed functional analysis of Rho2 chimeras fused to the carboxyl end from the essential GTPase Rho1 showed that GTPase palmitoylation is partially dependent on the prenylation context and confirmed that Rho2 signaling is independent of Rho GTP dissociation inhibitor (GDI) function. We further demonstrate that Rho2 is an in vivo substrate for DHHC family acyltransferase Erf2 palmitoyltransferase. Remarkably, Rho3, another Erf2 target, negatively regulates Pmk1 activity in a Rho2-independent fashion, thus revealing the existence of cross talk whereby both GTPases antagonistically modulate the activity of this MAPK cascade. PMID:24820419

Emodin induces neurite outgrowth through PI3K/Akt/GSK-3β-mediated signaling pathways in Neuro2a cells.

PubMed

Park, Shin-Ji; Jin, Mei Ling; An, Hyun-Kyu; Kim, Kyoung-Sook; Ko, Min Jung; Kim, Cheol Min; Choi, Young Whan; Lee, Young-Choon

2015-02-19

In this study, a neurite outgrowth-inducing substance was isolated from the ethylacetate extract of the Polygonum multiflorum roots and identified as emodin by gas-liquid chromatography-mass spectrometry and (1)H NMR and (13)C NMR. Emodin displayed remarkable neurite outgrowth-inducing activity in Neuro2a cells, as demonstrated by morphological changes and immunocytochemistry for class III β-tubulin. Emodin exhibited a stronger neutrophic activity than retinoic acid (RA) known as inducer of neurite outgrowth in Neuro2a cells. Emodin treatment resulted in marked increases in phosphorylation of Akt a direct downstream signaling molecule of phosphatidylinositol 3-kinase (PI3K), but upstream of glycogen synthase kinase-3β (GSK-3β) and cAMP response element-binding protein (CREB). These augmentations and neurite-bearing cells induced by emodin were remarkably reduced by the addition of PI3K inhibitor LY294002. These results demonstrate that emodin induces neuronal differentiation of Neuro2a cells via PI3K/Akt/GSK-3β pathway. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Delamination of neural crest cells requires transient and reversible Wnt inhibition mediated by Dact1/2.

PubMed

Rabadán, M Angeles; Herrera, Antonio; Fanlo, Lucia; Usieto, Susana; Carmona-Fontaine, Carlos; Barriga, Elias H; Mayor, Roberto; Pons, Sebastián; Martí, Elisa

2016-06-15

Delamination of neural crest (NC) cells is a bona fide physiological model of epithelial-to-mesenchymal transition (EMT), a process that is influenced by Wnt/β-catenin signalling. Using two in vivo models, we show that Wnt/β-catenin signalling is transiently inhibited at the time of NC delamination. In attempting to define the mechanism underlying this inhibition, we found that the scaffold proteins Dact1 and Dact2, which are expressed in pre-migratory NC cells, are required for NC delamination in Xenopus and chick embryos, whereas they do not affect the motile properties of migratory NC cells. Dact1/2 inhibit Wnt/β-catenin signalling upstream of the transcriptional activity of T cell factor (TCF), which is required for EMT to proceed. Dact1/2 regulate the subcellular distribution of β-catenin, preventing β-catenin from acting as a transcriptional co-activator to TCF, yet without affecting its stability. Together, these data identify a novel yet important regulatory element that inhibits β-catenin signalling, which then affects NC delamination. © 2016. Published by The Company of Biologists Ltd.

Unexpected sequences and structures of mtDNA required for efficient transcription from the first heavy-strand promoter

PubMed Central

Uchida, Akira; Murugesapillai, Divakaran; Kastner, Markus; Wang, Yao; Lodeiro, Maria F; Prabhakar, Shaan; Oliver, Guinevere V; Arnold, Jamie J; Maher, L James; Williams, Mark C; Cameron, Craig E

2017-01-01

Human mtDNA contains three promoters, suggesting a need for differential expression of the mitochondrial genome. Studies of mitochondrial transcription have used a reductionist approach, perhaps masking differential regulation. Here we evaluate transcription from light-strand (LSP) and heavy-strand (HSP1) promoters using templates that mimic their natural context. These studies reveal sequences upstream, hypervariable in the human population (HVR3), and downstream of the HSP1 transcription start site required for maximal yield. The carboxy-terminal tail of TFAM is essential for activation of HSP1 but not LSP. Images of the template obtained by atomic force microscopy show that TFAM creates loops in a discrete region, the formation of which correlates with activation of HSP1; looping is lost in tail-deleted TFAM. Identification of HVR3 as a transcriptional regulatory element may contribute to between-individual variability in mitochondrial gene expression. The unique requirement of HSP1 for the TFAM tail may enable its regulation by post-translational modifications. DOI: http://dx.doi.org/10.7554/eLife.27283.001 PMID:28745586

Lack of robustness of life extension associated with several single-gene P element mutations in Drosophila melanogaster.

PubMed

Mockett, Robin J; Nobles, Amber C

2013-10-01

The hypothesis tested in this study was that single-gene mutations found previously to extend the life span of Drosophila melanogaster could do so consistently in both long-lived y w and standard w (1118) genetic backgrounds. GAL4 drivers were used to express upstream activation sequence (UAS)-responder transgenes globally or in the nervous system. Transgenes associated with oxidative damage prevention (UAS-hSOD1 and UAS-GCLc) or removal (EP-UAS-Atg8a and UAS-dTOR (FRB) ) failed to increase mean life spans in any expression pattern in either genetic background. Flies containing a UAS-EGFP-bMSRA (C) transgene associated with protein repair were found not to exhibit life extension or detectable enhanced green fluorescent protein (EGFP) activity. The presence of UAS-responder transgenes was confirmed by PCR amplification and sequencing at the 5' and 3' end of each insertion. These results cast doubt on the robustness of life extension in flies carrying single-gene mutations and suggest that the effects of all such mutations should be tested independently in multiple genetic backgrounds and laboratory environments.

Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

USGS Publications Warehouse

Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

2016-07-18

The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

Kin28 regulates the transient association of Mediator with core promoters.

PubMed

Jeronimo, Célia; Robert, François

2014-05-01

Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation

PubMed Central

Bilic, Benny; Belkin, Shimshon

2010-01-01

Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

PubMed

Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

2011-03-01

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

Upregulated LINE-1 Activity in the Fanconi Anemia Cancer Susceptibility Syndrome Leads to Spontaneous Pro-inflammatory Cytokine Production.

PubMed

Brégnard, Christelle; Guerra, Jessica; Déjardin, Stéphanie; Passalacqua, Frank; Benkirane, Monsef; Laguette, Nadine

2016-06-01

Fanconi Anemia (FA) is a genetic disorder characterized by elevated cancer susceptibility and pro-inflammatory cytokine production. Using SLX4(FANCP) deficiency as a working model, we questioned the trigger for chronic inflammation in FA. We found that absence of SLX4 caused cytoplasmic DNA accumulation, including sequences deriving from active Long INterspersed Element-1 (LINE-1), triggering the cGAS-STING pathway to elicit interferon (IFN) expression. In agreement, absence of SLX4 leads to upregulated LINE-1 retrotransposition. Importantly, similar results were obtained with the FANCD2 upstream activator of SLX4. Furthermore, treatment of FA cells with the Tenofovir reverse transcriptase inhibitor (RTi), that prevents endogenous retrotransposition, decreased both accumulation of cytoplasmic DNA and pro-inflammatory signaling. Collectively, our data suggest a contribution of endogenous RT activities to the generation of immunogenic cytoplasmic nucleic acids responsible for inflammation in FA. The additional observation that RTi decreased pro-inflammatory cytokine production induced by DNA replication stress-inducing drugs further demonstrates the contribution of endogenous RTs to sustaining chronic inflammation. Altogether, our data open perspectives in the prevention of adverse effects of chronic inflammation in tumorigenesis. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Foxi2 Is an Animally Localized Maternal mRNA in Xenopus, and an Activator of the Zygotic Ectoderm Activator Foxi1e

PubMed Central

Cha, Sang-Wook; McAdams, Meredith; Kormish, Jay; Wylie, Christopher; Kofron, Matthew

2012-01-01

Foxi1e is a zygotic transcription factor that is essential for the expression of early ectodermal genes. It is expressed in a highly specific pattern, only in the deep cell layers of the animal hemisphere, and in a mosaic pattern in which expressing cells are interspersed with non-expressing cells. Previous work has shown that several signals in the blastula control this expression pattern, including nodals, the TGFβ family member Vg1, and Notch. However, these are all inhibitory, which raises the question of what activates Foxi1e. In this work, we show that a related Forkhead family protein, Foxi2, is a maternal activator of Foxi1e. Foxi2 mRNA is maternally encoded, and highly enriched in animal hemisphere cells of the blastula. ChIP assays show that it acts directly on upstream regulatory elements of Foxi1e. Its effect is specific, since animal cells depleted of Foxi2 are able to respond normally to mesoderm inducing signals from vegetal cells. Foxi2 thus acts as a link between the oocyte and the early pathway to ectoderm, in a similar fashion to the vegetally localized VegT acts to initiate endoderm and mesoderm formation. PMID:22848601

A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria

PubMed Central

Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.

2013-01-01

The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats

NASA Technical Reports Server (NTRS)

Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

2000-01-01

In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.

Position-dependent and neuron-specific splicing regulation by the CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans

PubMed Central

Kuroyanagi, Hidehito; Watanabe, Yohei; Suzuki, Yutaka; Hagiwara, Masatoshi

2013-01-01

A large fraction of protein-coding genes in metazoans undergo alternative pre-mRNA splicing in tissue- or cell-type-specific manners. Recent genome-wide approaches have identified many putative-binding sites for some of tissue-specific trans-acting splicing regulators. However, the mechanisms of splicing regulation in vivo remain largely unknown. To elucidate the modes of splicing regulation by the neuron-specific CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans, we performed deep sequencing of poly(A)+ RNAs from the unc-75(+)- and unc-75-mutant worms and identified more than 20 cassette and mutually exclusive exons repressed or activated by UNC-75. Motif searches revealed that (G/U)UGUUGUG stretches are enriched in the upstream and downstream introns of the UNC-75-repressed and -activated exons, respectively. Recombinant UNC-75 protein specifically binds to RNA fragments carrying the (G/U)UGUUGUG stretches in vitro. Bi-chromatic fluorescence alternative splicing reporters revealed that the UNC-75-target exons are regulated in tissue-specific and (G/U)UGUUGUG element-dependent manners in vivo. The unc-75 mutation affected the splicing reporter expression specifically in the nervous system. These results indicate that UNC-75 regulates alternative splicing of its target exons in neuron-specific and position-dependent manners through the (G/U)UGUUGUG elements in C. elegans. This study thus reveals the repertoire of target events for the CELF family in the living organism. PMID:23416545

A geochemical study of overbank sediments in an urban area (Madrid, Spain).

PubMed

Adánez Sanjuán, Paula; Llamas Borrajo, Juan F; Locutura Rupérez, Juan; García Cortés, Angel

2014-12-01

Overbank and stream sediments have been studied in the Community of Madrid. Four vertical profiles have been sampled corresponding to Guadarrama, Jarama, and finally Manzanares River, where two profiles have been studied upstream (El Pardo profile) and downstream (Rivas profile) Madrid city. Sieved samples (<63 µm) were subjected to total (ICP-MS/ICP-OES and INAA) and partial analysis (ICP-MS). AMS radiocarbon dating techniques revealed a young age (170 ± 40 years BP) at 2.40-2.65 m depth for Rivas profile. It has not been possible to detect pristine or pre-industrial overbank sediments, since in the rest of the studied profiles, anthropogenic wastes were found even in the lower levels. Three main sources of sediment have been detected in the area. Granitic and arkosic geology, located in the northern part of Madrid (U, Th, W, K, Na, or rare earth elements); clays located in the southeast of Madrid (Ni, Cr, or V), and finally an anthropogenic source has been identified (Au, Ag, Pb, Zn, or Sb) in Rivas profile. The influence of the anthropogenic activity has been established based on the contents distribution of contaminant elements in the profile. This can be associated to the growth of industrial activities and population in the city of Madrid during the last decades. The comparison of the profiles by a k-means cluster analysis showed some similarities for these samples that could have analogous sources (anthropogenic and geological).

Tissue-specific expression of squirrel monkey chorionic gonadotropin.

PubMed

Vasauskas, Audrey A; Hubler, Tina R; Boston, Lori; Scammell, Jonathan G

2011-02-01

Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human and rhesus macaque CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (-1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. Copyright © 2010 Elsevier Inc. All rights reserved.

Accumulation and release of 241Am by a macrophyte of the Yenisei River (Elodea canadensis).

PubMed

Bolsunovsky, A; Zotina, T; Bondareva, L

2005-01-01

The source of radioactive contamination of the Yenisei River floodplain, including contamination with transuranic elements, is the Mining-and-Chemical Combine of the Russian Ministry of Atomic Energy, which has for many years been producing weapons-grade plutonium. Transuranic elements have been detected not only in the soil and sediment of the river but also in the biomass of aquatic plants. This work is an investigation of accumulation and release of 241Am by a submerged macrophyte of the Yenisei River (Elodea canadensis) in laboratory experiments. In 2000-2003, laboratory experiments were carried out with biomass of E. canadensis Mich. and filtered river water. The samples were collected from the Yenisei River upstream of the discharge of the Combine's radioactive effluent. The experiments showed that 241Am is accumulated by Elodea biomass: the activity concentration of 241Am can reach 3280+/-240 Bq/g, with the concentration factor for 241Am 16 600+/-2200l/kg. Results of chemical fractionation have proved that in the course of 241Am accumulation by Elodea biomass, 241Am tightly bound to biomass increases from 11% to 27% of the total 241Am in the biomass. Release of 241Am from the decaying Elodea biomass has been evaluated experimentally. By the end of the experiment (lasting up to 127 days), the Elodea plants had lost up to 65% of their initial 241Am activity and the rate of 241Am release into the water environment reached 23 Bq/day.

AP-1 proteins in the adult brain: facts and fiction about effectors of neuroprotection and neurodegeneration.

PubMed

Herdegen, T; Waetzig, V

2001-04-30

Jun and Fos proteins are induced and activated following most physiological and pathophysiological stimuli in the brain. Only few data allow conclusions about distinct functions of AP-1 proteins in neurodegeneration and neuroregeneration, and these functions mainly refer to c-Jun and its activation by JNKs. Apoptotic functions of activated c-Jun affect hippocampal, nigral and primary cultured neurons following excitotoxic stimulation and destruction of the neuron-target-axis including withdrawal of trophic molecules. The inhibition of JNKs might exert neuroprotection by subsequent omission of c-Jun activation. Besides endogenous neuronal functions, the c-Jun/AP-1 proteins can damage the nervous system by upregulation of harmful programs in non-neuronal cells (e.g. microglia) with release of neurodegenerative molecules. In contrast, the differentiation with neurite extension and maturation of neural cells in vitro indicate physiological and potentially neuroprotective functions of c-Jun and JNKs including sensoring for alterations in the cytoskeleton. This review summarizes the multiple molecular interfunctions which are involved in the shift from the physiological role to degenerative effects of the Jun/JNK-axis such as cell type-specific expression and intracellular localization of scaffold proteins and upstream activators, antagonistic phosphatases, interaction with other kinase systems, or the activation of transcription factors competing for binding to JNK proteins and AP-1 DNA elements.

The proteins encoded by the Drosophila Planar Polarity Effector genes inturned, fuzzy and fritz interact physically and can re-pattern the accumulation of “upstream” Planar Cell Polarity proteins

PubMed Central

Wang, Ying; Yan, Jie; Lee, Haeryun; Lu, Qiuheng; Adler, Paul N.

2014-01-01

The frizzled/starry night pathway regulates planar cell polarity in a wide variety of tissues in many types of animals. It was discovered and has been most intensively studied in the Drosophila wing where it controls the formation of the array of distally pointing hairs that cover the wing. The pathway does this by restricting the activation of the cytoskeleton to the distal edge of wing cells. This results in hairs initiating at the distal edge and growing in the distal direction. All of the proteins encoded by genes in the pathway accumulate asymmetrically in wing cells. The pathway is a hierarchy with the Planar Cell Polarity (PCP) genes (aka the core genes) functioning as a group upstream of the Planar Polarity Effector (PPE) genes which in turn function as a group upstream of multiple wing hairs. Upstream proteins, such as Frizzled accumulate on either the distal and/or proximal edges of wing cells. Downstream PPE proteins accumulate on the proximal edge under the instruction of the upstream proteins. A variety of types of data support this hierarchy, however, we have found that when over expressed the PPE proteins can alter both the subcellular location and level of accumulation of the upstream proteins. Thus, the epistatic relationship is context dependent. We further show that the PPE proteins interact physically and can modulate the accumulation of each other in wing cells. We also find that over expression of Frtz results in a marked delay in hair initiation suggesting that it has a separate role/activity in regulating the cytoskeleton that is not shared by other members of the group. PMID:25072625

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts

PubMed Central

HATAKEYAMA, YOSHINORI; SHIBUYA, NORIHIRO; NISHIYAMA, TAKASHI; NAKASHIMA, NOBUHIKO

2004-01-01

The intergenic region (IGR) located upstream of the capsid protein gene in dicistroviruses contains an internal ribosome entry site (IRES). Translation initiation mediated by the IRES does not require initiator methionine tRNA. Comparison of the IGRs among dicistroviruses suggested that Taura syndrome virus (TSV) and acute bee paralysis virus have an extra side stem loop in the predicted IRES. We examined whether the side stem is responsible for translation activity mediated by the IGR using constructs with compensatory mutations. In vitro translation analysis showed that TSV has an IGR-IRES that is structurally distinct from those previously described. Because IGR-IRES elements determine the translation initiation site by virtue of their own tertiary structure formation, the discovery of this initiation mechanism suggests the possibility that eukaryotic mRNAs might have more extensive coding regions than previously predicted. To test this hypothesis, we searched full-length cDNA databases and whole genome sequences of eukaryotes using the pattern matching program, Scan For Matches, with parameters that can extract sequences containing secondary structure elements resembling those of IGR-IRES. Our search yielded several sequences, but their predicted secondary structures were suggested to be unstable in comparison to those of dicistroviruses. These results suggest that RNAs structurally similar to dicistroviruses are not common. If some eukaryotic mRNAs are translated independently of an initiator methionine tRNA, their structures are likely to be significantly distinct from those of dicistroviruses. PMID:15100433

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

A Mammalian Conserved Element Derived from SINE Displays Enhancer Properties Recapitulating Satb2 Expression in Early-Born Callosal Projection Neurons

PubMed Central

Nakanishi, Akiko; Sasaki, Takeshi; Yan, Kuo; Tarabykin, Victor; Vigier, Lisa; Sumiyama, Kenta; Hirakawa, Mika; Nishihara, Hidenori; Pierani, Alessandra; Okada, Norihiro

2011-01-01

Short interspersed repetitive elements (SINEs) are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered “junk DNA”. However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1−/NPY+) portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum, a eutherian-specific brain structure. PMID:22174821

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

The Evolution of Riparian Landscape Elements Following Upstream Regulation and Depletion on the Rio Grande

NASA Astrophysics Data System (ADS)

Everitt, B. L.

2006-12-01

In 1915 closure of Elephant Butte Dam in central New Mexico profoundly altered the hydrologic regime of the Rio Grande for 560 km downstream, and set in motion a cascade of interwoven geomorphic, biological, and cultural responses. Geomorphic response included shrinking of the width and depth of the channel, and an increase in sinuosity. Cultural responses included artificial channel modification on 320 km of the river within the boundaries of the original irrigation project, beginning in 1933. The pre-dam river and its flood plain consisted of a mosaic of geomorphic elements that formed a functional riverine landscape, and founded a diverse habitat for the plants, animals, and people that lived there. A preliminary comparison of the modern river with pre-dam topographic mapping permits identification of individual landscape elements, including overflow land (flood plain) both cultivated and uncultivated, with oxbows and back-swamps. The pre-dam channel included a low water thread and un-vegetated flood bars. From pre-dam description and photographs we can assume the usual complement of pools and riffles, point bars and undercut banks. Until dredged in the 1970s, the unmodified reach retained the entire suite of landscape elements, although in somewhat different proportions from the pre-dam river, and remained a functional riparian system. Channel sinuosity increased from 1.45 in 1910 to 1.7 in 1970, thus riverbank habitat increased by 1.17%. In 1970 undercut banks still provided protection for fish, and point bars generated by lateral migration still provided seed beds for pioneer species. The smaller shallower channel raised groundwater beneath the flood plain and retarded flood waves, creating a generally more mesic environment, although the river occasionally dries up, as it did prior to 1915. In contrast, an impoverished suite of landscape elements characterizes the channelized reach. Lateral stability precludes point bars and undercut banks. Bounding levees separate the channel from its former flood plain. All areas are impacted by heavy machinery during periodic channel maintenance. I conclude that the environmental degradation caused by artificial channel modification has far outweighed any generated by upstream hydrologic control.

Parasite fauna of Etheostoma nigrum (Percidae: Etheostomatinae) in localities of varying pollution stress in the St. Lawrence River, Quebec, Canada.

PubMed

Krause, Rachel J; McLaughlin, J Daniel; Marcogliese, David J

2010-07-01

Parasite communities were examined in johnny darters (Etheostoma nigrum) collected from five localities in the St. Lawrence River in southwestern Quebec: two reference localities, one polluted locality upstream of the Island of Montreal and downstream of industrial and agricultural activity, and two polluted localities downstream of the Island of Montreal in the plume from the wastewater treatment facility. Twenty-four helminth species were found. Fish from the upstream polluted locality had the highest parasite species richness and total parasite numbers, and fish from the downstream polluted localities the lowest. Nonmetric multivariate analyses were conducted using square-root-transformed Bray-Curtis dissimilarity index. An analysis of similarity, dendrogram of centroids, and a permutational multivariate analysis of variance with contrasts all showed that fish from the reference localities had different parasite community composition than those from the polluted localities, and fish from the upstream polluted locality had different parasite communities than fish from the downstream polluted localities. Differences between reference and polluted localities were mainly due to higher abundances of the brain-encysting trematode, Ornithodiplostomum sp., at the reference localities. Differences between upstream and downstream polluted localities were mainly due to a higher diversity and abundance of trematodes in fish at the upstream locality.

Dissolved Strontium and Barium in Fresh and Saltwater: a 2-year Study in the Calcasieu River to the Gulf of Mexico

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2016-02-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88-km long estuary, the Calcasieu River, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to July 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth. Water samples were analyzed for dissolved Sr, Ba, and Ca concentrations. In-situ measurements of salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance were taken. Our preliminary data showed that the Sr and Ca concentrations and the Sr/Ca ratio all increased significantly with decreasing distance to the Gulf of Mexico, while the Ba/Ca ratio decreased with decreasing distance to the Gulf. The spatial variation in Ba concentration was marginal. The Sr and Ca concentrations and ratios were positively related to salinity, while Ba/Ca was negatively related to salinity. All the elemental concentrations and ratios had considerable seasonal and interannual variations. There were significant differences among sampling months for all the elemental concentrations and ratios (p<0.05), and there were significant differences among sampling years for the Sr and Ca concentrations and the Ba/Ca ratio (p<0.05).

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Irrigation drainage studies of the Angostura Reclamation Unit and the Belle Fourche Reclamation Project, western South Dakota : results of 1994 sampling and comparisons with 1988 data

USGS Publications Warehouse

Sando, Steven K.; Williamson, Joyce E.; Dickerson, Kimberly K.; Wesolowski, Edwin A.

2001-01-01

The U.S. Department of the Interior started the National Irrigation Water Quality Program in 1985 to identify the nature and extent of irrigation-induced water-quality problems that might exist in the western U.S. The Angostura Reclamation Unit (ARU) and Belle Fourche Reclamation Project (BFRP) in western South Dakota were included as part of this program. The ARU and BFRP reconnaissance studies were initiated in 1988, during below-normal streamflow conditions in both study areas. Surface water, bottom sediment, and fish were resampled in 1994 at selected sites in both study areas during generally near-normal streamflow conditions to compare with 1988 study results. Concentrations of major ions in water for both the ARU and BFRP study areas are high relative to national baseline levels. Major-ion concentrations for both areas generally are lower for 1994 than for 1988, when low-flow conditions prevailed, but ionic proportions are similar between years. For ARU, dissolved-solids concentrations probably increase slightly downstream from Angostura Reservoir; however, the available data sets are insufficient to confidently discern effects of ARU operations on dissolved-solids loading. For BFRP, dissolved-solids concentrations are slightly higher at sites that are affected by irrigation drainage; again, however, the data are inconclusive to determine whether BFRP operations increase dissolved-solids loading. Most trace-element concentrations in water samples for both study areas are similar between 1988 and 1994, and do not show strong relations with discharge. ARU operations probably are not contributing discernible additional loads of trace elements to the Cheyenne River. For BFRP, concentrations of some trace elements are slightly higher at sites downstream from irrigation operations than at a site upstream from irrigation operations. BFRP operations might contribute to trace-element concentrations in the Belle Fourche River, but available data are insufficient to quantify increases. For both study areas, concentrations of several trace elements occasionally exceed National Irrigation Water Quality Program guidelines. Selenium routinely occurs in concentrations that could be problematic at sites upstream and downstream from both study areas. Elevated selenium concentrations at sites upstream from irrigation operations indicate that naturally occurring selenium concentrations are relatively high in and near the study areas. While ARU operations probably do not contribute discernible additional loads of selenium to the Cheyenne River, BFRP operations might contribute additional selenium loads to the Belle Fourche River. Concentrations of most trace elements in bottom sediment, except arsenic and selenium, are similar to typical concentrations for western U.S. soils for both study areas. Bottom-sediment arsenic and selenium (1988) concentrations in both study areas can reach levels that might be of concern; however, there is insufficient information to determine whether irrigation operations contribute to these elevated concentrations. Concentrations of most trace elements in fish in both study areas are less than values known to adversely affect fish or birds, although there are occasional exceedances of established criteria. However, selenium concentrations in fish samples routinely are within the National Irrigation Water Quality Program level of concern, and also commonly exceed the dietary guideline for avian consumers for both study areas. Selenium concentrations in fish samples generally are higher at sites downstream from irrigation operations. For BFRP, arsenic and mercury concentrations are elevated in fish samples from site B-18, which is influenced by mine tailings.

Achieving a Golden Mean: Mechanisms by Which Coronaviruses Ensure Synthesis of the Correct Stoichiometric Ratios of Viral Proteins▿

PubMed Central

Plant, Ewan P.; Rakauskaitė, Rasa; Taylor, Deborah R.; Dinman, Jonathan D.

2010-01-01

In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed −1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the −1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a “golden mean” model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins. PMID:20164235

Geochemistry of the suspended sediment in the estuaries of the Mandovi and Zuari rivers, central west coast of India.

PubMed

Kessarkar, Pratima M; Shynu, R; Rao, V Purnachandra; Chong, Feng; Narvekar, Tanuja; Zhang, Jing

2013-05-01

The geochemistry of the suspended particulate matter (SPM) collected during the monsoon was determined to identify the sources of SPM and to understand the physicochemical processes in the Mandovi and Zuari river estuaries. The concentrations of SPM decrease seaward in both estuaries, but are relatively high at bay stations. Kaolinite is the most dominant clay mineral in the upstream of both rivers. Smectite increases seaward in both estuaries and is abundant in the bay. Upstream stations of Mandovi, where ore deposits are stored on the shore, exhibit high Fe, Mn, total rare earth elements (∑REE), and middle REE- and heavy REE-enriched patterns. Channel stations of both estuaries exhibit middle REE- and light REE-enriched patterns, which gradually changed seaward to middle REE- and heavy REE-enriched patterns. Canal stations exhibit the highest concentrations of major and trace metals. High metal/Al ratios occur at stations in the upstream of Zuari and at the confluence of canals in the Mandovi estuary. Enrichment factors of metals indicate that Mn is significantly polluted while other metals are moderately polluted. The δ(13)C and δ(15)N of organic matter indicate that the terrigenous organic matter at the upstream is diluted seaward by marine organic matter. Organic matter at bay stations is largely marine and altered-type. The compositions of SPM are controlled by the particulates from ore dust, the geology of the drainage basins, and the physicochemical processes in the estuaries. Particulates resuspended from the bay are dominated by ore dust, which are advected into the channels of both estuaries during the lull periods of the monsoon.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

DEAR1, a transcriptional repressor of DREB protein that mediates plant defense and freezing stress responses in Arabidopsis.

PubMed

Tsutsui, Tomokazu; Kato, Wataru; Asada, Yutaka; Sako, Kaori; Sato, Takeo; Sonoda, Yutaka; Kidokoro, Satoshi; Yamaguchi-Shinozaki, Kazuko; Tamaoki, Masanori; Arakawa, Keita; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Shinozaki, Kazuo; Matsui, Minami; Ikeda, Akira; Yamaguchi, Junji

2009-11-01

Plants have evolved intricate mechanisms to respond and adapt to a wide variety of biotic and abiotic stresses in their environment. The Arabidopsis DEAR1 (DREB and EAR motif protein 1; At3g50260) gene encodes a protein containing significant homology to the DREB1/CBF (dehydration-responsive element binding protein 1/C-repeat binding factor) domain and the EAR (ethylene response factor-associated amphiphilic repression) motif. We show here that DEAR1 mRNA accumulates in response to both pathogen infection and cold treatment. Transgenic Arabidopsis overexpressing DEAR1 (DEAR1ox) showed a dwarf phenotype and lesion-like cell death, together with constitutive expression of PR genes and accumulation of salicylic acid. DEAR1ox also showed more limited P. syringae pathogen growth compared to wild-type, consistent with an activated defense phenotype. In addition, transient expression experiments revealed that the DEAR1 protein represses DRE/CRT (dehydration-responsive element/C-repeat)-dependent transcription, which is regulated by low temperature. Furthermore, the induction of DREB1/CBF family genes by cold treatment was suppressed in DEAR1ox, leading to a reduction in freezing tolerance. These results suggest that DEAR1 has an upstream regulatory role in mediating crosstalk between signaling pathways for biotic and abiotic stress responses.

Long-range activation of Sox9 in Odd Sex (Ods) mice.

PubMed

Qin, Yangjun; Kong, Ling-kun; Poirier, Christophe; Truong, Cavatina; Overbeek, Paul A; Bishop, Colin E

2004-06-15

The Odd Sex mouse mutation arose in a transgenic line of mice carrying a tyrosinase minigene driven by the dopachrome tautomerase (Dct) promoter region. The minigene integrated 0.98 Mb upstream of Sox9 and was accompanied by a deletion of 134 kb. This mutation causes female to male sex reversal in XX Ods/+ mice, and a characteristic eye phenotype of microphthalmia with cataracts in all mice carrying the transgene. Ods causes sex reversal in the absence of Sry by upregulating Sox9 expression and maintaining a male pattern of Sox9 expression in XX Ods/+ embryonic gonads. This expression, which begins at E11.5, triggers downstream events leading to the formation of a testis. We report here that the 134 kb deletion, in itself, is insufficient to cause sex reversal. We demonstrate that in Ods, the Dct promoter is capable of acting over a distance of 1 Mb to induce inappropriate expression of Sox9 in the retinal pigmented epithelium of the eye, causing the observed microphthalmia. In addition, it induces Sox9 expression in the melanocytes where it causes pigmentation defects. We propose that Ods sex reversal is due to the Dct promoter element interacting with gonad-specific enhancer elements to produce the observed male pattern expression of Sox9 in the embryonic gonads.

Revisiting the X:A signal that specifies Caenorhabditis elegans sexual fate.

PubMed

Gladden, John M; Farboud, Behnom; Meyer, Barbara J

2007-11-01

In Caenorhabditis elegans, sex is determined by the opposing actions of X-signal elements (XSEs) and autosomal signal elements (ASEs), which communicate the ratio of X chromosomes to sets of autosomes (X:A signal). This study delves more deeply into the mechanism by which XSEs transmit X chromosome dose. We determined the relative contributions of individual XSEs to the X:A signal and showed the order of XSE strength to be sex-1 > sex-2 > fox-1 > ceh-39 >/= region 1 XSE. sex-1 exerts a more potent influence on sex determination and dosage compensation than any other XSE by functioning in two separate capacities in the pathway: sex-1 acts upstream as an XSE to repress xol-1 and downstream as an activator of hermaphrodite development and dosage compensation. Furthermore, the process of dosage compensation affects expression of the very XSEs that control it; XSEs become fully dosage compensated once sex is determined. The X:A signal is then equivalent between XO and XX animals, causing sexual differentiation to be controlled by genes downstream of xol-1 in the sex-determination pathway. Prior to the onset of dosage compensation, the difference in XSE expression between XX and XO embryos appears to be greater than twofold, making X chromosome counting a robust process.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benson, Stephen V.; Marhauser, Frank; Douglas, David R.

A method for the suppression of upstream-directed field emission in RF accelerators. The method is not restricted to a certain number of cavity cells, but requires similar operating field levels in all cavities to efficiently annihilate the once accumulated energy. Such a field balance is desirable to minimize dynamic RF losses, but not necessarily achievable in reality depending on individual cavity performance, such as early Q.sub.0-drop or quench field. The method enables a significant energy reduction for upstream-directed electrons within a relatively short distance. As a result of the suppression of upstream-directed field emission, electrons will impact surfaces at rathermore » low energies leading to reduction of dark current and less issues with heating and damage of accelerator components as well as radiation levels including neutron generation and thus radio-activation.« less

Sleep-Active Neurons: Conserved Motors of Sleep

PubMed Central

Bringmann, Henrik

2018-01-01

Sleep is crucial for survival and well-being. This behavioral and physiological state has been studied in all major genetically accessible model animals, including rodents, fish, flies, and worms. Genetic and optogenetic studies have identified several neurons that control sleep, making it now possible to compare circuit mechanisms across species. The “motor” of sleep across animal species is formed by neurons that depolarize at the onset of sleep to actively induce this state by directly inhibiting wakefulness. These sleep-inducing neurons are themselves controlled by inhibitory or activating upstream pathways, which act as the “drivers” of the sleep motor: arousal inhibits “sleep-active” neurons whereas various sleep-promoting “tiredness” pathways converge onto sleep-active neurons to depolarize them. This review provides the first overview of sleep-active neurons across the major model animals. The occurrence of sleep-active neurons and their regulation by upstream pathways in both vertebrate and invertebrate species suggests that these neurons are general and ancient components that evolved early in the history of nervous systems. PMID:29618588

INVESTIGATION OF TRANSFORMATION PRODUCTS FROM THE CHLORINATION OF ESTROGENIC AND ANDROGENIC COMPOUNDS

EPA Science Inventory

Drinking water sources are increasingly impacted by upstream anthropogenic activities, including wastewater discharge, concentrated animal feeding operations (CAFOs) and landfill leachate. Androgenic and estrogenic activities have been detected in surface waters downstream from ...

RNA chaperone activity of human La protein is mediated by variant RNA recognition motif.

PubMed

Naeeni, Amir R; Conte, Maria R; Bayfield, Mark A

2012-02-17

La proteins are conserved factors in eukaryotes that bind and protect the 3' trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3'OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3'OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

Sustainability of Water Resources in the Upstream Watershed- Based Community Engagement and Multistakeholder Cooperation

NASA Astrophysics Data System (ADS)

Brotosusilo, Agus; Utari, Dyah; Agung Satria, Afrizal

2016-02-01

The communities engagement become the backbone of the conservation in the Citanduy upstream watershed. It functioning as a major deal and the first one in keeping his own Watershed. This paper based on Community Engagement Grants (CEGs). Program Society-based empowerment approach is also emphasized in the viewpoint of environmental law that is useful to set governance and sanctions in watershed management. The type of activity to be undertaken are the expansion of awareness programs communities of the existence and condition of the watershed Citanduy, the formation of a cadre of conservationists environment that is primarily directed to children and women, the institutionalization of customary law environment, and afforestation by planting 100,000 prolific trees, tree conservationists, and Sunda endemic tree in the land surrounding the watershed upstream Citanduy. The Program involves several partners and stakeholders who helped in substance and operational support activities in the field.. Result of program shows that Community Engagement Grants need cooperation among stakeholders by positioning the community as main subject of changing, not as subject who does not understand their needs to change.

Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

DOE PAGES

Zhao, Baoyu; Shu, Chang; Gao, Xinsheng; ...

2016-06-02

Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

Control of Endothelin-A Receptor Expression by Progesterone Is Enhanced by Synergy With Gata2

PubMed Central

Zhang, Yanping; Knutsen, Gregory R.; Brown, Matthew D.

2013-01-01

The endothelin-A receptor (Ednra) is involved in several physiological, pathological, and developmental pathways. Known for its function in vasoconstriction after being activated by endothelin-1, Ednra also controls cephalic neural crest cell development and appears to play a role in several pathologies, including cancer and periodontitis. However, the mechanisms regulating Ednra expression have not been identified despite its important functions. In this study, we investigated the role progesterone plays in Ednra gene expression in vivo and in vitro. In mice, pregnancy promotes Ednra expression in the heart, kidney, lung, uterus, and placenta, and the up-regulation is mediated by progesterone. We determined that the conserved region between −5.7 and −4.2 kb upstream of the mouse Ednra gene is necessary for the progesterone response. We also found that progesterone mediates Ednra activation through progesterone receptor B activation by its recruitment to PRE6, one of the 6 progesterone response elements found in that locus. However, gene activation by means of a GATA2 site was also necessary for the progesterone response. The Gata2 transcription factor enhances the progesterone response mediated by the progesterone receptor B. Together these results indicate that progesterone regulates Ednra expression by synergizing with Gata2 activity, a previously unknown mechanism. This mechanism may have an impact on pathologies involving the endothelin signaling. PMID:23592430

Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Baoyu; Shu, Chang; Gao, Xinsheng

Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR.

PubMed

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter

2011-05-01

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.

Bioavailability of Pb and Zn from mine tailings as indicated by erythrocyte aminolevulinic acid dehydratase (ALA-D) activity in suckers (Pisces: catostomidae)

USGS Publications Warehouse

Schmitt, Christopher J.; Dwyer, F. James; Finger, Susan E.

1984-01-01

The activity of the erythrocyte enzyme δ-aminolevulinic acid dehydratase (ALA-D) was measured in 35 catostomids (black redhorse, Moxostoma duquesnei; golden redhorse, M. erythrurum; northern hogsucker, Hypentelium nigricans) collected from three sites on a stream contaminated with Pb-, Cd-, and Zn-rich mine tailings and from an uncontaminated site upstream. Enzyme activity was expressed in terms of hemoglobin (Hb), DNA, and protein concentrations; these variables can be determined in the laboratory on once-frozen blood samples. Concentrations of Pb and Zn in blood and of Pb in edible tissues were significantly higher, and ALA-D activity was significantly lower, at all three contaminated sites than upstream. At the most contaminated site, ALA-D activity was 62–67% lower than upstream. Lead concentrations in the edible tissues and in blood were positively correlated (r = 0.80), whereas ALA-D activity was negatively correlated with Pb in blood (r = −0.70) and in edible tissues (r = −0.59). Five statistically significant relations between Pb and Zn in blood and ALA-D activity were determined. The two models that explained the highest percentage (> 74%) of the total variance also included factors related to Hb concentration. All five significant models included negative coefficients for variables that represented Pb in blood and positive coefficients for Zn in blood. The ALA-D assay with results standardized to Hb concentration represents an expedient alternative to the more traditional hematocrit standardization, and the measurement of ALA-D activity by this method can be used to document exposure of fish to environmental Pb.

Molecular mechanisms underlying protective effects of quercetin against mitochondrial dysfunction and progressive dopaminergic neurodegeneration in cell culture and MitoPark transgenic mouse models of Parkinson's Disease.

PubMed

Ay, Muhammet; Luo, Jie; Langley, Monica; Jin, Huajun; Anantharam, Vellareddy; Kanthasamy, Arthi; Kanthasamy, Anumantha G

2017-06-01

Quercetin, one of the major flavonoids in plants, has been recently reported to have neuroprotective effects against neurodegenerative processes. However, since the molecular signaling mechanisms governing these effects are not well clarified, we evaluated quercetin's effect on the neuroprotective signaling events in dopaminergic neuronal models and further tested its efficacy in the MitoPark transgenic mouse model of Parkinson's disease (PD). Western blot analysis revealed that quercetin significantly induced the activation of two major cell survival kinases, protein kinase D1 (PKD1) and Akt in MN9D dopaminergic neuronal cells. Furthermore, pharmacological inhibition or siRNA knockdown of PKD1 blocked the activation of Akt, suggesting that PKD1 acts as an upstream regulator of Akt in quercetin-mediated neuroprotective signaling. Quercetin also enhanced cAMP response-element binding protein phosphorylation and expression of the cAMP response-element binding protein target gene brain-derived neurotrophic factor. Results from qRT-PCR, Western blot analysis, mtDNA content analysis, and MitoTracker assay experiments revealed that quercetin augmented mitochondrial biogenesis. Quercetin also increased mitochondrial bioenergetics capacity and protected MN9D cells against 6-hydroxydopamine-induced neurotoxicity. To further evaluate the neuroprotective efficacy of quercetin against the mitochondrial dysfunction underlying PD, we used the progressive dopaminergic neurodegenerative MitoPark transgenic mouse model of PD. Oral administration of quercetin significantly reversed behavioral deficits, striatal dopamine depletion, and TH neuronal cell loss in MitoPark mice. Together, our findings demonstrate that quercetin activates the PKD1-Akt cell survival signaling axis and suggest that further exploration of quercetin as a promising neuroprotective agent for treating PD may offer clinical benefits. © 2017 International Society for Neurochemistry.

Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families.

PubMed

Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele

2017-05-04

Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

PubMed

Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

2015-01-01

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

TAR-independent transactivation by Tat in cells derived from the CNS: a novel mechanism of HIV-1 gene regulation.

PubMed Central

Taylor, J P; Pomerantz, R; Bagasra, O; Chowdhury, M; Rappaport, J; Khalili, K; Amini, S

1992-01-01

The Tat protein of human immunodeficiency virus type 1 (HIV-1) is essential for productive infection and is a potential target for antiviral therapy. Tat, a potent activator of HIV-1 gene expression, serves to greatly increase the rate of transcription directed by the viral promoter. This induction, which seems to be an important component in the progression of acquired immune deficiency syndrome (AIDS), may be due to increased transcriptional initiation, increased transcriptional elongation, or a combination of these processes. Much attention has been focused on the interaction of Tat with a specific RNA target termed TAR (transactivation responsive) which is present in the leader sequence of all HIV-1 mRNAs. This interaction is believed to be an important component of the mechanism of transactivation. In this report we demonstrate that in certain CNS-derived cells Tat is capable of activating HIV-1 through a TAR-independent pathway. A Tat-responsive element is found upstream within the viral promoter that in glial-derived cell lines allows transactivation in the absence of TAR. Deletion mapping and hybrid promoter constructs demonstrate that the newly identified Tat-responsive element corresponds to a sequence within the viral long terminal repeat (LTR) previously identified as the HIV-1 enhancer, or NF-kappa B domain. DNA band-shift analysis reveals NF-kappa B binding activity in glial cells that differs from that present in T lymphoid cells. Further, we observe that TAR-deleted mutants of HIV-1 demonstrate normal late gene expression in glial cells as evidenced by syncytia formation and production of viral p24 antigen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1505523

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

PubMed

Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

2016-07-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

JS-III-49, a hydroquinone derivative, exerts anti-inflammatory activity by targeting Akt and p38

PubMed Central

Yi, Young-Su

2017-01-01

Since previous studies have reported that hydroquinone (HQ) exerted immunosuppressive and anti-inflammatory activity, various HQ derivatives have been synthesized and their biological activities investigated. In this study, we explored the anti-inflammatory activity of JS-III-49, a novel HQ derivative, in macrophage-mediated inflammatory responses. JS-III-49 suppressed the production of the inflammatory mediators nitric oxide (NO) and prostaglandin E2 (PGE2) and down-regulated the mRNA expression of the inflammatory enzymes cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) as well as the expression of the pro-inflammatory cytokines interleukin-6 (IL-6) and IL-1b without cytotoxicity in LPS-stimulated RAW264.7 cells. JS-III-49 inhibited nuclear translocation of the NF-kB transcription factors p65 and p50 by directly targeting Akt, an upstream kinase of the NF-kB pathway, in LPS-stimulated RAW264.7 cells. However, JS-III-49 did not directly inhibit the kinase activities of Src and Syk, which are upstream kinases of Akt, in LPS-stimulated RAW264.7 cells. Moreover, JS-III-49 suppressed the nuclear translocation of c-Fos, one of the components of AP-1, by specifically targeting p38, an upstream mitogen-activated protein kinase (MAPK) in the AP-1 pathway in LPS-stimulated RAW264.7 cells. These results suggest that JS-III-49 plays an anti-inflammatory role in LPS-stimulated macrophages by targeting Akt and p38 in the NF-kB and AP-1 pathways, respectively. PMID:28461777

JS-III-49, a hydroquinone derivative, exerts anti-inflammatory activity by targeting Akt and p38.

PubMed

Yi, Young-Su; Kim, Mi-Yeon; Cho, Jae Youl

2017-05-01

Since previous studies have reported that hydroquinone (HQ) exerted immunosuppressive and anti-inflammatory activity, various HQ derivatives have been synthesized and their biological activities investigated. In this study, we explored the anti-inflammatory activity of JS-III-49, a novel HQ derivative, in macrophage-mediated inflammatory responses. JS-III-49 suppressed the production of the inflammatory mediators nitric oxide (NO) and prostaglandin E 2 (PGE 2 ) and down-regulated the mRNA expression of the inflammatory enzymes cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) as well as the expression of the pro-inflammatory cytokines interleukin-6 (IL-6) and IL-1b without cytotoxicity in LPS-stimulated RAW264.7 cells. JS-III-49 inhibited nuclear translocation of the NF-kB transcription factors p65 and p50 by directly targeting Akt, an upstream kinase of the NF-kB pathway, in LPS-stimulated RAW264.7 cells. However, JS-III-49 did not directly inhibit the kinase activities of Src and Syk, which are upstream kinases of Akt, in LPS-stimulated RAW264.7 cells. Moreover, JS-III-49 suppressed the nuclear translocation of c-Fos, one of the components of AP-1, by specifically targeting p38, an upstream mitogen-activated protein kinase (MAPK) in the AP-1 pathway in LPS-stimulated RAW264.7 cells. These results suggest that JS-III-49 plays an anti-inflammatory role in LPS-stimulated macrophages by targeting Akt and p38 in the NF-kB and AP-1 pathways, respectively.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

USGS Publications Warehouse

Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

2016-01-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

USGS Publications Warehouse

Wilson, Jennifer T.

2016-06-23

Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

Southwest Greenland's Alpine Glacier History: Recent Glacier Change in the Context of the Holocene Geologic Record

NASA Astrophysics Data System (ADS)

Larocca, L. J.; Axford, Y.; Lasher, G. E.; Lee, C. W.

2017-12-01

Due to anthropogenic climate change, the Arctic region is currently undergoing major transformation, and is expected to continue warming much faster than the global average. To put recent and future changes into context, a longer-term understanding of this region's past response to natural climate variability is needed. Given their sensitivity to modest climate change, small alpine glaciers and ice caps on Greenland's coastal margin (beyond the Greenland Ice Sheet) represent ideal features to record climate variability through the Holocene. Here we investigate the Holocene history of a small ( 160 square km) ice cap and adjacent alpine glaciers, located in southwest Greenland approximately 50 km south of Nuuk. We employ measurements on sediment cores from a glacier-fed lake in combination with geospatial analysis of satellite images spanning the past several decades. Sedimentary indicators of sediment source and thus glacial activity, including organic matter abundance, inferred chlorophyll-a content, sediment major element abundances, grain size, and magnetic susceptibility are presented from cores collected from a distal glacier-fed lake (informally referred to here as Per's Lake) in the summer of 2015. These parameters reflect changes in the amount and character of inorganic detrital input into the lake, which may be linked to the size of the upstream glaciers and ice cap and allow us to reconstruct their status through the Holocene. Additionally, we present a complementary record of recent changes in Equilibrium Line Altitude (ELA) for the upstream alpine glaciers. Modern ELAs are inferred using the accumulation area ratio (AAR) method in ArcGIS via Landsat and Worldview-2 satellite imagery, along with elevation data obtained from digital elevation models (DEMs). Paleo-ELAs are inferred from the positions of moraines and trim lines marking the glaciers' most recent expanded state, which we attribute to the Little Ice Age (LIA). This approach will allow us to explore the possibility of quantitatively or qualitatively linking changes in ELA (and thus the size of upstream glaciers) to specific sediment parameters. Ultimately, we aim to reconstruct glacier variability through the entire Holocene epoch, and to compare this history with 20th and 21st Century changes.

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

Analysis of an existing experiment on the interaction of acoustic waves with a laminar boundary layer

NASA Technical Reports Server (NTRS)

Schopper, M. R.

1982-01-01

The hot-wire anemometer amplitude data contained in the 1977 report of P. J. Shapiro entitled, ""The Influence of Sound Upon Laminar Boundary'' were reevaluated. Because the low-Reynolds number boundary layer disturbance data were misinterpreted, an effort was made to improve the corresponding disturbance growth rate curves. The data are modeled as the sum of upstream and downstream propagating acoustic waves and a wave representing the Tollmien-Schlichting (TS) wave. The amplitude and phase velocity of the latter wave were then adjusted so that the total signal reasonably matched the amplitude and phase angle hot-wire data along the plate laminar boundary layer. The revised rates show growth occurring further upstream than Shapiro found. It appears that the premature growth is due to the adverse pressure gradient created by the shape of the plate. Basic elements of sound propagation in ducts and the experimental and theoretical acoustic-stability literature are reviewed.

Flow Instabilities in Feather Seals due to Upstream Harmonic Pressure Fluctuations

NASA Technical Reports Server (NTRS)

Deng, D.; Braun, M. J.; Henricks, Robert C.

2008-01-01

Feather seals (also called slot seals) typically found in turbine stators limit leakage from the platform into the core cavities and from the shroud to the case. They are of various geometric shapes, yet all are contoured to fit the aerodynamic shape of the stator and placed as close as thermomechanically reasonable the powerstream flow passage. Oscillations engendered in the compressor or combustor alter the steady leakage characteristics of these sealing elements and in some instances generate flow instabilities downstream of the seal interface. In this study, a generic feather seal geometry was studied numerically by imposing an upstream harmonic pressure disturbance on the simulated stator-blade gap. The flow and thermal characteristics were determined; it was found that for high pressure drops, large fluctuations in flows in the downstream blade-stator gap can occur. These leakages and pulsations in themselves are not all that significant, yet if coupled with cavity parameters, they could set up resonance events. Computationally generated time-dependent flow fields are captured in sequence video streaming.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

PubMed Central

Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

2014-01-01

Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

Green house emissions, inventories and evaluation of marine environment visa vis offshore oil field development activities Bombay high (west coast) upstream petroleum sector, India

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, J.S.; Ahmed, S.; Negi, C.V.S.

1996-12-31

Wide use of petroleum products contributes significant amount of emission to the global environment and hence maintaining emission inventories are of great importance while assessing the global green house emissions. The present paper describes a brief account of green house emission and inventories for CO{sub 2}, CO, NO{sub x}, HC particulate and SO{sub 2} emissions generated due to upstream petroleum sector activities viz. discharges of gaseous emission, combustion of Natural Gas anti HSD from production and drilling facilities of Bombay offshore area located in Exclusive Economic Zone (EEZ) west coast of India. Besides, authors have also given an account onmore » west coast marine base line status including impact of oil field activities on marine ecosystem.« less

Ongoing data reduction, theoretical studies and supporting research in magnetospheric physics

NASA Technical Reports Server (NTRS)

Scarf, F. L.; Greenstadt, E. W.

1984-01-01

Data from ISEE-3, Pioneer Venus Orbiter, and Voyager 1 and 2 were analyzed. The predictability of local shock macrostructure at ISEE-1, at the Earth's bow shock, from solar wind measurements made up-stream by ISEE-3, was conducted using computer graphic format. Morphology of quasi-parallel shock was reviewed. The review attempted to interrelate various measurements and computations involving the q-parallel structure and foreshock elements connected to it. A new classification for q-parallel morphology was suggested.

Monolithically integrated fiber-to-the-home diplexers and triplexers using a bilevel etched 2 x 2 optical coupler.

PubMed

Zhang, Li; Wang, Lei; He, Jian-Jun

2009-09-01

A novel design of monolithically integrated diplexers and triplexers for fiber-to-the-home applications is presented. A bilevel etched asymmetrical 2 x 2 optical coupler is analyzed for efficient couplings of both upstream and downstream signals. The design of the diplexer is extended to a triplexer by adding an etched diffraction grating as an additional downstream demultiplexing element. The total size of the integrated diplexer and triplexer is smaller than 500 microm x 500 microm.

Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2015-09-01

An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR Cascade Inhibitors: How Mutations Can Result in Therapy Resistance and How to Overcome Resistance

PubMed Central

McCubrey, James A.; Steelman, Linda S.; Chappell, William H.; Abrams, Stephen L.; Franklin, Richard A.; Montalto, Giuseppe; Cervello, Melchiorre; Libra, Massimo; Candido, Saverio; Malaponte, Grazia; Mazzarino, Maria C.; Fagone, Paolo; Nicoletti, Ferdinando; Bäsecke, Jörg; Mijatovic, Sanja; Maksimovic-Ivanic, Danijela; Milella, Michele; Tafuri, Agostino; Chiarini, Francesca; Evangelisti, Camilla; Cocco, Lucio; Martelli, Alberto M.

2012-01-01

The Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR cascades are often activated by genetic alterations in upstream signaling molecules such as receptor tyrosine kinases (RTK). Targeting these pathways is often complex and can result in pathway activation depending on the presence of upstream mutations (e.g., Raf inhibitors induce Raf activation in cells with wild type (WT) RAF in the presence of mutant, activated RAS) and rapamycin can induce Akt activation. Targeting with inhibitors directed at two constituents of the same pathway or two different signaling pathways may be a more effective approach. This review will first evaluate potential uses of Raf, MEK, PI3K, Akt and mTOR inhibitors that have been investigated in pre-clinical and clinical investigations and then discuss how cancers can become insensitive to various inhibitors and potential strategies to overcome this resistance. PMID:23085539

Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR cascade inhibitors: how mutations can result in therapy resistance and how to overcome resistance.

PubMed

McCubrey, James A; Steelman, Linda S; Chappell, William H; Abrams, Stephen L; Franklin, Richard A; Montalto, Giuseppe; Cervello, Melchiorre; Libra, Massimo; Candido, Saverio; Malaponte, Grazia; Mazzarino, Maria C; Fagone, Paolo; Nicoletti, Ferdinando; Bäsecke, Jörg; Mijatovic, Sanja; Maksimovic-Ivanic, Danijela; Milella, Michele; Tafuri, Agostino; Chiarini, Francesca; Evangelisti, Camilla; Cocco, Lucio; Martelli, Alberto M

2012-10-01

The Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR cascades are often activated by genetic alterations in upstream signaling molecules such as receptor tyrosine kinases (RTK). Targeting these pathways is often complex and can result in pathway activation depending on the presence of upstream mutations (e.g., Raf inhibitors induce Raf activation in cells with wild type (WT) RAF in the presence of mutant, activated RAS) and rapamycin can induce Akt activation. Targeting with inhibitors directed at two constituents of the same pathway or two different signaling pathways may be a more effective approach. This review will first evaluate potential uses of Raf, MEK, PI3K, Akt and mTOR inhibitors that have been investigated in pre-clinical and clinical investigations and then discuss how cancers can become insensitive to various inhibitors and potential strategies to overcome this resistance.

Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

PubMed

Xue, Gongda; Hemmings, Brian A

2012-02-01

The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

Changes of hydrodynamic parameters on mountain stream bed within the block ramp influence and possibility of their use for integrated river management

NASA Astrophysics Data System (ADS)

Radecki-Pawlik, Artur; Plesiński, Karol

2016-04-01

In modern river management practices and philosophy one can notice coming more into use ecological friendly hydraulic structures. Those, which are especially needed for river training works, as far as expectation of Water Framework Directive is concerned, are block ramps which are hydraulic structures working similar to riffles known very well from fluvial geomorphology studies and are natural features in streams and rivers. What is important well designed block ramps do not stop fish and invertebrates against migrating, provide natural and esthetical view being built within the river channel, still working as hydraulic engineering structures and might be used in river management in different river ecosystems. The main aim of the research was to describe changes of values of hydrodynamics parameters upstream and downstream of the block ramps and to find out their influence on hydrodynamics of the stream. The study was undertaken on the Porębianka River in the Gorce Mountains, Polish Carpathians. Observed hydrodynamic parameters within the reach of the block ramps depend on the location of measuring point and the influence of individual part of the structure. We concluded that: 1. Hydrodynamic parameters close to block ramps depend on the location of the measurement points in relation to particular elements of the structure; 2. The highest value of velocities don't cause the highest force values, which acting on the bed of the watercourse, because they are rather related to the water level of the channel; 3. The values of mean velocities, shear velocities and shear stresses were similar upstream and downstream the block ramps, which means that the structures stabilize the river bed. This study was performed within the scope of the Science Activity money from Ministry of High Education and Young Scientist's Activity Money of Department of Hydraulics Engineering and Geotechnique, University of Agriculture, Cracow, Poland

Two Genetic Determinants Acquired Late in Mus Evolution Regulate the Inclusion of Exon 5, which Alters Mouse APOBEC3 Translation Efficiency

PubMed Central

Li, Jun; Hakata, Yoshiyuki; Takeda, Eri; Liu, Qingping; Iwatani, Yasumasa; Kozak, Christine A.; Miyazawa, Masaaki

2012-01-01

Mouse apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like editing complex 3 (mA3), an intracellular antiviral factor, has 2 allelic variations that are linked with different susceptibilities to beta- and gammaretrovirus infections among various mouse strains. In virus-resistant C57BL/6 (B6) mice, mA3 transcripts are more abundant than those in susceptible BALB/c mice both in the spleen and bone marrow. These strains of mice also express mA3 transcripts with different splicing patterns: B6 mice preferentially express exon 5-deficient (Δ5) mA3 mRNA, while BALB/c mice produce exon 5-containing full-length mA3 mRNA as the major transcript. Although the protein product of the Δ5 mRNA exerts stronger antiretroviral activities than the full-length protein, how exon 5 affects mA3 antiviral activity, as well as the genetic mechanisms regulating exon 5 inclusion into the mA3 transcripts, remains largely uncharacterized. Here we show that mA3 exon 5 is indeed a functional element that influences protein synthesis at a post-transcriptional level. We further employed in vitro splicing assays using genomic DNA clones to identify two critical polymorphisms affecting the inclusion of exon 5 into mA3 transcripts: the number of TCCT repeats upstream of exon 5 and the single nucleotide polymorphism within exon 5 located 12 bases upstream of the exon 5/intron 5 boundary. Distribution of the above polymorphisms among different Mus species indicates that the inclusion of exon 5 into mA3 mRNA is a relatively recent event in the evolution of mice. The widespread geographic distribution of this exon 5-including genetic variant suggests that in some Mus populations the cost of maintaining an effective but mutagenic enzyme may outweigh its antiviral function. PMID:22275865

Proteome and phosphoproteome analysis of commensally induced dendritic cell maturation states.

PubMed

Korkmaz, Ali Giray; Popov, Todor; Peisl, Loulou; Codrea, Marius Cosmin; Nahnsen, Sven; Steimle, Alexander; Velic, Ana; Macek, Boris; von Bergen, Martin; Bernhardt, Joerg; Frick, Julia-Stefanie

2018-05-30

Dendritic cells (DCs) can shape the immune system towards an inflammatory or tolerant state depending on the bacterial antigens and the environment they encounter. In this study we provide a proteomic catalogue of differentially expressed proteins between distinct DC maturation states, brought about by bacteria that differ in their endotoxicity. To achieve this, we have performed proteomics and phosphoproteomics on murine DC cultures. Symbiont and pathobiont bacteria were used to direct dendritic cells into a semi-mature and fully-mature state, respectively. The comparison of semi-mature and fully-mature DCs revealed differential expression in 103 proteins and differential phosphorylation in 118 phosphosites, including major regulatory factors of central immune processes. Our analyses predict that these differences are mediated by upstream elements such as SOCS1, IRF3, ABCA1, TLR4, and PTGER4. Our analyses indicate that the symbiont bacterial strain affects DC proteome in a distinct way, by downregulating inflammatory proteins and activating anti-inflammatory upstream regulators. Biological significance In this study we have investigated the responses of immune cells to distinct bacterial stimuli. We have used the symbiont bacterial strain B. vulgatus and the pathobiont E. coli strain to stimulate cultured primary dendritic cells and performed a shotgun proteome analysis to investigate the protein expression and phosphorylation level differences on a genome level. We have observed expression and phosphorylation level differences in key immune regulators, transcription factors and signal transducers. Moreover, our subsequent bioinformatics analysis indicated regulation at several signaling pathways such as PPAR signaling, LXR/RXR activation and glucocorticoid signaling pathways, which are not studied in detail in an inflammation and DC maturation context. Our phosphoproteome analysis showed differential phosphorylation in 118 phosphosites including those belonging to epigenetic regulators, transcription factors and major cell cycle regulators. We anticipate that our study will facilitate further investigation of immune cell proteomes under different inflammatory and non-inflammatory conditions. Copyright © 2017. Published by Elsevier B.V.

Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee Jihjong; Huang, M.-S.; Yang, I-C.

2008-06-20

In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, andmore » tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity.« less