Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

PubMed

Kel, AlexanderE

2017-02-01

Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

PubMed Central

Qiao, Huan; May, James M.

2012-01-01

Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed Central

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-01-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Insulin-like growth factor binding protein-2: contributions of the C-terminal domain to insulin-like growth factor-1 binding.

PubMed

Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A

2006-03-01

Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

Control of the actin cytoskeleton in root hair development.

PubMed

Pei, Weike; Du, Fei; Zhang, Yi; He, Tian; Ren, Haiyun

2012-05-01

The development of root hair includes four stages: bulge site selection, bulge formation, tip growth, and maturation. The actin cytoskeleton is involved in all of these stages and is organized into distinct arrangements in the different stages. In addition to the actin configuration, actin isoforms also play distinct roles in the different stages. The actin cytoskeleton is regulated by actin-binding proteins, such as formin, Arp2/3 complex, profilin, actin depolymerizing factor, and villin. Some upstream signals, i.e. calcium, phospholipids, and small GTPase regulate the activity of these actin-binding proteins to produce the proper actin configuration. We constructed a working model on how the actin cytoskeleton is controlled by actin-binding proteins and upstream signaling in root hair development based on the current literature: at the tip of hairs, actin polymerization appears to be facilitated by Arp2/3 complex that is activated by small GTPase, and profilin that is regulated by phosphatidylinositol 4,5-bisphosphate. Meanwhile, actin depolymerization and turnover are likely mediated by villin and actin depolymerizing factor, which are stimulated by calcium. At the shank, actin cables are produced by formin and villin. Under the complicated interaction, the actin cytoskeleton is controlled spatially and temporally during root hair development. © 2012 Elsevier Ireland Ltd. All rights reserved.

Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

PubMed

Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

2013-10-01

A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

PubMed

Wang, G; Liao, J; Tang, M; Yu, S

2018-02-01

1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

PubMed Central

Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

2012-01-01

The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

Coliphage HK022 Nun protein inhibits RNA polymerase translocation

PubMed Central

Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

2014-01-01

The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed Central

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-01-01

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-10-11

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease

PubMed Central

Coin, Frédéric; Frit, Philippe; Viollet, Benoit; Salles, Bernard; Egly, Jean-Marc

1998-01-01

DNA damage recognition by basal transcription factors follows different mechanisms. Using transcription-competition, nitrocellulose filter binding, and DNase I footprinting assays, we show that, although the general transcription factor TFIIH is able to target any kind of lesion which can be repaired by the nucleotide excision repair pathway, TATA binding protein (TBP)-TFIID is more selective in damage recognition. Only genotoxic agents which are able to induce kinked DNA structures similar to the one for the TATA box in its TBP complex are recognized. Indeed, DNase I footprinting patterns reveal that TBP protects equally 4 nucleotides upstream and 6 nucleotides downstream from the A-T (at position −29 of the noncoding strand) of the adenovirus major late promoter and from the G-G of a cisplatin-induced 1,2-d(GpG) cross-link. Together, our results may partially explain differences in transcription inhibition rates following DNA damage. PMID:9632775

Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

PubMed

Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

2010-07-01

Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Auxin-dependent compositional change in Mediator in ARF7- and ARF19-mediated transcription.

PubMed

Ito, Jun; Fukaki, Hidehiro; Onoda, Makoto; Li, Lin; Li, Chuanyou; Tasaka, Masao; Furutani, Masahiko

2016-06-07

Mediator is a multiprotein complex that integrates the signals from transcription factors binding to the promoter and transmits them to achieve gene transcription. The subunits of Mediator complex reside in four modules: the head, middle, tail, and dissociable CDK8 kinase module (CKM). The head, middle, and tail modules form the core Mediator complex, and the association of CKM can modify the function of Mediator in transcription. Here, we show genetic and biochemical evidence that CKM-associated Mediator transmits auxin-dependent transcriptional repression in lateral root (LR) formation. The AUXIN/INDOLE 3-ACETIC ACID 14 (Aux/IAA14) transcriptional repressor inhibits the transcriptional activity of its binding partners AUXIN RESPONSE FACTOR 7 (ARF7) and ARF19 by making a complex with the CKM-associated Mediator. In addition, TOPLESS (TPL), a transcriptional corepressor, forms a bridge between IAA14 and the CKM component MED13 through the physical interaction. ChIP assays show that auxin induces the dissociation of MED13 but not the tail module component MED25 from the ARF7 binding region upstream of its target gene. These findings indicate that auxin-induced degradation of IAA14 changes the module composition of Mediator interacting with ARF7 and ARF19 in the upstream region of their target genes involved in LR formation. We suggest that this regulation leads to a quick switch of signal transmission from ARFs to target gene expression in response to auxin.

Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.

PubMed

Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2014-12-05

The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models. Copyright © 2014 Elsevier B.V. All rights reserved.

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

PubMed Central

Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

2010-01-01

The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

PubMed

Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

2005-11-01

The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

PubMed

Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

2011-09-26

HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

PubMed Central

2011-01-01

Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

PubMed

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

An ABA-responsive DRE-binding protein gene from Setaria italica, SiARDP, the target gene of SiAREB, plays a critical role under drought stress.

PubMed

Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan

2014-10-01

The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

INTRINSIC REGULATION OF HEMOGLOBIN EXPRESSION BY VARIABLE SUBUNIT INTERFACE STRENGTHS

PubMed Central

Manning, James M.; Popowicz, Anthony M.; Padovan, Julio C.; Chait, Brian T.; Manning, Lois R.

2012-01-01

SUMMARY The expression of the six types of human hemoglobin subunits over time is currently considered to be regulated mainly by transcription factors that bind to upstream control regions of the gene (the “extrinsic” component of regulation). Here we describe how subunit pairing and further assembly to tetramers in the liganded state is influenced by the affinity of subunits for one another (the “intrinsic” component of regulation). The adult hemoglobin dimers have the strongest subunit interfaces and the embryonic hemoglobins are the weakest with fetal hemoglobins of intermediate strength, corresponding to the temporal order of their expression. These variable subunit binding strengths and the attenuating effects of acetylation contribute to the differences with which these hemoglobin types form functional O2-binding tetramers consistent with gene switching. PMID:22129306

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

PubMed

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

PubMed

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

2014-08-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

PubMed Central

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

2014-01-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

NASA Technical Reports Server (NTRS)

Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

2003-01-01

Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

Transcriptional regulation of hepatic lipogenesis.

PubMed

Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

2015-11-01

Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

The Treacher Collins syndrome (TCOF1) gene product is involved in ribosomal DNA gene transcription by interacting with upstream binding factor.

PubMed

Valdez, Benigno C; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J

2004-07-20

Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof(+/-) mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS.

The Treacher Collins syndrome (TCOF1) gene product is involved in ribosomal DNA gene transcription by interacting with upstream binding factor

PubMed Central

Valdez, Benigno C.; Henning, Dale; So, Rolando B.; Dixon, Jill; Dixon, Michael J.

2004-01-01

Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof+/- mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS. PMID:15249688

Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria

PubMed Central

Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej

2011-01-01

HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585

Purification and characterization of human mitochondrial transcription factor 1.

PubMed Central

Fisher, R P; Clayton, D A

1988-01-01

We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148

PuTmiR: A database for extracting neighboring transcription factors of human microRNAs

PubMed Central

2010-01-01

Background Some of the recent investigations in systems biology have revealed the existence of a complex regulatory network between genes, microRNAs (miRNAs) and transcription factors (TFs). In this paper, we focus on TF to miRNA regulation and provide a novel interface for extracting the list of putative TFs for human miRNAs. A putative TF of an miRNA is considered here as those binding within the close genomic locality of that miRNA with respect to its starting or ending base pair on the chromosome. Recent studies suggest that these putative TFs are possible regulators of those miRNAs. Description The interface is built around two datasets that consist of the exhaustive lists of putative TFs binding respectively in the 10 kb upstream region (USR) and downstream region (DSR) of human miRNAs. A web server, named as PuTmiR, is designed. It provides an option for extracting the putative TFs for human miRNAs, as per the requirement of a user, based on genomic locality, i.e., any upstream or downstream region of interest less than 10 kb. The degree distributions of the number of putative TFs and miRNAs against each other for the 10 kb USR and DSR are analyzed from the data and they explore some interesting results. We also report about the finding of a significant regulatory activity of the YY1 protein over a set of oncomiRNAs related to the colon cancer. Conclusion The interface provided by the PuTmiR web server provides an important resource for analyzing the direct and indirect regulation of human miRNAs. While it is already an established fact that miRNAs are regulated by TFs binding to their USR, this database might possibly help to study whether an miRNA can also be regulated by the TFs binding to their DSR. PMID:20398296

RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

PubMed

KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

2018-06-20

Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

SRY-box-containing Gene 2 Regulation of Nuclear Receptor Tailless (Tlx) Transcription in Adult Neural Stem Cells*

PubMed Central

Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.

2012-01-01

Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs. PMID:22194602

SRY-box-containing gene 2 regulation of nuclear receptor tailless (Tlx) transcription in adult neural stem cells.

PubMed

Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M; Evans, Ronald M; Gage, Fred H

2012-02-17

Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs.

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Low concentrations of copper in drinking water increase AP-1 binding in the brain.

PubMed

Lung, Shyang; Li, Huihui; Bondy, Stephen C; Campbell, Arezoo

2015-12-01

Copper (Cu) in trace amounts is essential for biological organisms. However, dysregulation of the redox-active metal has been implicated in different neurological disorders such as Wilson's, Menkes', Alzheimer's, and Parkinson's diseases. Since many households use Cu tubing in the plumbing system, and corrosion causes the metal to leach into the drinking water, there may be adverse effects on the central nervous system connected with low-level chronic exposure. The present study demonstrates that treatment with a biologically relevant concentration of Cu for 3 months significantly increases activation of the redox-modulated transcription factor AP-1 in mouse brains. This was independent of an upstream kinase indicated in AP-1 activation. Another redox-active transcription factor, NF-κB, was not significantly modified by the Cu exposure. These results indicate that the effect of Cu on AP-1 is unique and may involve direct modulation of DNA binding. © The Author(s) 2012.

Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2015-09-01

An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

PubMed

Daubas, Philippe; Buckingham, Margaret E

2013-04-15

The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

PubMed Central

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

PubMed

Irizarry, Kristopher J L; Bryden, Randall L

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

Role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of Dr+ Escherichia coli receptor protein Decay Accelerating Factor (DAF or CD55) by Nitric oxide

PubMed Central

Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

2012-01-01

We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121

Role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of Dr+ Escherichia coli receptor protein decay accelerating factor (DAF or CD55) by nitric oxide.

PubMed

Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

2013-02-01

We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.

Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.

PubMed

Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim

2013-07-01

Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.

Functional importance of evolutionally conserved Tbx6 binding sites in the presomitic mesoderm-specific enhancer of Mesp2.

PubMed

Yasuhiko, Yukuto; Kitajima, Satoshi; Takahashi, Yu; Oginuma, Masayuki; Kagiwada, Harumi; Kanno, Jun; Saga, Yumiko

2008-11-01

The T-box transcription factor Tbx6 controls the expression of Mesp2, which encodes a basic helix-loop-helix transcription factor that has crucial roles in somitogenesis. In cultured cells, Tbx6 binding to the Mesp2 enhancer region is essential for the activation of Mesp2 by Notch signaling. However, it is not known whether this binding is required in vivo. Here we report that an Mesp2 enhancer knockout mouse bearing mutations in two crucial Tbx6 binding sites does not express Mesp2 in the presomitic mesoderm. This absence leads to impaired skeletal segmentation identical to that reported for Mesp2-null mice, indicating that these Tbx6 binding sites are indispensable for Mesp2 expression. T-box binding to the consensus sequences in the Mesp2 upstream region was confirmed by chromatin immunoprecipitation assays. Further enhancer analyses indicated that the number and spatial organization of the T-box binding sites are critical for initiating Mesp2 transcription via Notch signaling. We also generated a knock-in mouse in which the endogenous Mesp2 enhancer was replaced by the core enhancer of medaka mespb, an ortholog of mouse Mesp2. The homozygous enhancer knock-in mouse was viable and showed normal skeletal segmentation, indicating that the medaka mespb enhancer functionally replaced the mouse Mesp2 enhancer. These results demonstrate that there is significant evolutionary conservation of Mesp regulatory mechanisms between fish and mice.

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE PAGES

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

2015-11-10

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

PubMed

Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

2018-04-01

The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Mechanism of arginine sensing by CASTOR1 upstream of mTORC1

PubMed Central

Saxton, Robert A.; Chantranupong, Lynne; Knockenhauer, Kevin E.; Schwartz, Thomas U.; Sabatini, David M.

2016-01-01

Summary The mechanistic Target of Rapamycin Complex 1 (mTORC1) is a major regulator of eukaryotic growth that coordinates anabolic and catabolic cellular processes with inputs such as growth factors and nutrients, including amino acids1–3. In mammals, arginine is particularly important and promotes diverse physiological effects including immune cell activation, insulin secretion, and muscle growth, largely through activation of mTORC14–7. Arginine activates mTORC1 upstream of the Rag GTPases8, through either the lysosomal amino acid transporter SLC38A9 or the GATOR2-interacting CASTOR1 (Cellular Arginine Sensor for mTORC1)9–12. However, the mechanism by which the mTORC1 pathway detects and transmits the arginine signal has been elusive. Here, we present the 1.8 Å crystal structure of arginine-bound CASTOR1. Homodimeric CASTOR1 binds arginine at the interface of two ACT domains, enabling allosteric control of the adjacent GATOR2-binding site to trigger dissociation from GATOR2 and the downstream activation of mTORC1. Our data reveal that CASTOR1 shares substantial structural homology with the lysine-binding regulatory domain of prokaryotic aspartate kinases, suggesting that the mTORC1 pathway exploited an ancient amino-acid-dependent allosteric mechanism to acquire arginine sensitivity. Together, these results establish a structural basis for arginine sensing by the mTORC1 pathway and provide insights into the evolution of a mammalian nutrient sensor. PMID:27487210

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

PubMed

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.

PubMed

Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M

2017-01-24

Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

PubMed Central

Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

2002-01-01

The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

Conditional Inactivation of Upstream Binding Factor Reveals Its Epigenetic Functions and the Existence of a Somatic Nucleolar Precursor Body

PubMed Central

Hamdane, Nourdine; Stefanovsky, Victor Y.; Tremblay, Michel G.; Németh, Attila; Paquet, Eric; Lessard, Frédéric; Sanij, Elaine; Hannan, Ross; Moss, Tom

2014-01-01

Upstream Binding Factor (UBF) is a unique multi-HMGB-box protein first identified as a co-factor in RNA polymerase I (RPI/PolI) transcription. However, its poor DNA sequence selectivity and its ability to generate nucleosome-like nucleoprotein complexes suggest a more generalized role in chromatin structure. We previously showed that extensive depletion of UBF reduced the number of actively transcribed ribosomal RNA (rRNA) genes, but had little effect on rRNA synthesis rates or cell proliferation, leaving open the question of its requirement for RPI transcription. Using gene deletion in mouse, we now show that UBF is essential for embryo development beyond morula. Conditional deletion in cell cultures reveals that UBF is also essential for transcription of the rRNA genes and that it defines the active chromatin conformation of both gene and enhancer sequences. Loss of UBF prevents formation of the SL1/TIF1B pre-initiation complex and recruitment of the RPI-Rrn3/TIF1A complex. It is also accompanied by recruitment of H3K9me3, canonical histone H1 and HP1α, but not by de novo DNA methylation. Further, genes retain penta-acetyl H4 and H2A.Z, suggesting that even in the absence of UBF the rRNA genes can maintain a potentially active state. In contrast to canonical histone H1, binding of H1.4 is dependent on UBF, strongly suggesting that it plays a positive role in gene activity. Unexpectedly, arrest of rRNA synthesis does not suppress transcription of the 5S, tRNA or snRNA genes, nor expression of the several hundred mRNA genes implicated in ribosome biogenesis. Thus, rRNA gene activity does not coordinate global gene expression for ribosome biogenesis. Loss of UBF also unexpectedly induced the formation in cells of a large sub-nuclear structure resembling the nucleolar precursor body (NPB) of oocytes and early embryos. These somatic NPBs contain rRNA synthesis and processing factors but do not associate with the rRNA gene loci (NORs). PMID:25121932

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

PubMed

Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

2017-01-01

Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

What's the FOX Got to Do with the KITten? Regulating the Lineage-Specific Transcriptional Landscape in GIST.

PubMed

Lee, Donna M; Duensing, Anette

2018-02-01

Transcriptional regulation of the KIT receptor tyrosine kinase, a master regulator in gastrointestinal stromal tumors (GIST) and their precursors, the interstitial cells of Cajal (ICC), is part of a positive feedback loop involving the transcription factor ETV1. A new study now shows that the forkhead box (FOX) family transcription factor FOXF1 not only is an upstream regulator of ETV1 and hence ICC/GIST lineage-specific gene transcription, but also functions as lineage-specific pioneer factor with an active role in chromatin rearrangement to facilitate ETV1 binding and transcriptional activity. Cancer Discov; 8(2); 146-9. ©2018 AACR See related article by Ran et al., p. 234 . ©2018 American Association for Cancer Research.

Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

PubMed

Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

2011-09-23

Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

PubMed

Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

2015-06-01

IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

PubMed

Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

2016-09-01

Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

The Fur-Iron Complex Modulates Expression of the Quorum-Sensing Master Regulator, SmcR, To Control Expression of Virulence Factors in Vibrio vulnificus

PubMed Central

Kim, In Hwang; Wen, Yancheng; Son, Jee-Soo; Lee, Kyu-Ho

2013-01-01

The gene vvpE, encoding the virulence factor elastase, is a member of the quorum-sensing regulon in Vibrio vulnificus and displays enhanced expression at high cell density. We observed that this gene was repressed under iron-rich conditions and that the repression was due to a Fur (ferric uptake regulator)-dependent repression of smcR, a gene encoding a quorum-sensing master regulator with similarity to luxR in Vibrio harveyi. A gel mobility shift assay and a footprinting experiment demonstrated that the Fur-iron complex binds directly to two regions upstream of smcR (−82 to −36 and −2 to +27, with respect to the transcription start site) with differing affinities. However, binding of the Fur-iron complex is reversible enough to allow expression of smcR to be induced by quorum sensing at high cell density under iron-rich conditions. Under iron-limiting conditions, Fur fails to bind either region and the expression of smcR is regulated solely by quorum sensing. These results suggest that two biologically important environmental signals, iron and quorum sensing, converge to direct the expression of smcR, which then coordinates the expression of virulence factors. PMID:23716618

Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

PubMed

Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

PubMed Central

Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

A critical role for the transcription factor Scl in platelet production during stress thrombopoiesis.

PubMed

McCormack, Matthew P; Hall, Mark A; Schoenwaelder, Simone M; Zhao, Quan; Ellis, Sarah; Prentice, Julia A; Clarke, Ashleigh J; Slater, Nicholas J; Salmon, Jessica M; Jackson, Shaun P; Jane, Stephen M; Curtis, David J

2006-10-01

The generation of platelets from megakaryocytes in the steady state is regulated by a variety of cytokines and transcription factors, including thrombopoietin (TPO), GATA-1, and NF-E2. Less is known about platelet production in the setting of stress thrombopoiesis, a pivotal event in the context of cytotoxic chemotherapy. Here we show in mice that the transcription factor Scl is critical for platelet production after chemotherapy and in thrombopoiesis induced by administration of TPO. Megakaryocytes from these mice showed appropriate increases in number and ploidy but failed to shed platelets. Ultrastructural examination of Scl-null megakaryocytes revealed a disorganized demarcation membrane and reduction in platelet granules. Quantitative real-time polymerase chain reaction showed that Scl-null platelets lacked NF-E2, and chromatin immunoprecipitation analysis demonstrated Scl binding to the NF-E2 promoter in the human megakaryoblastic-cell line Meg-01, along with its binding partners E47, Lmo2, and the cofactors Ldb1 and GATA-2. These findings suggest that Scl acts up-stream of NF-E2 expression to control megakaryocyte development and platelet release in settings of thrombopoietic stress.

Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

PubMed Central

Fisher, Susan H.; Wray, Lewis V.

2002-01-01

Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

PubMed

Fisher, Susan H; Wray, Lewis V

2002-04-01

Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

The TRA-1 transcription factor binds TRA-2 to regulate sexual fates in Caenorhabditis elegans

PubMed Central

Wang, Shanping; Kimble, Judith

2001-01-01

The tra-1 and tra-2 sex-determining genes promote female fates in Caenorhabditis elegans. Classical genetic studies placed tra-1 as the terminal regulator of the pathway with tra-2 acting upstream as a regulator of regulators of tra-1. Here we report the surprising result that the TRA-1 transcription factor binds the intracellular domain of the TRA-2 membrane protein. This binding is dependent on the MX regulatory domain, a region of the TRA-2 intracellular domain shown previously to be critical for the onset of hermaphrodite spermatogenesis. The functional importance of the TRA-1–TRA-2 physical interaction is supported by genetic interactions between tra-1(0) and tra-2(mx) mutations: a reduction of tra-1 gene dose from two copies to one copy enhances the tra-2(mx) feminization phenotype, but has no apparent somatic effect. In Caenorhabditis briggsae, we also find an MX-dependent interaction between Cb-TRA-1 and Cb-TRA-2, but intriguingly, no cross-species interactions are seen. The conservation of the TRA-1– TRA-2 interaction underscores its importance in sex determination. PMID:11250902

Co-regulation of Iron Metabolism and Virulence Associated Functions by Iron and XibR, a Novel Iron Binding Transcription Factor, in the Plant Pathogen Xanthomonas

PubMed Central

Pandey, Sheo Shankar; Patnana, Pradeep Kumar; Lomada, Santosh Kumar; Tomar, Archana; Chatterjee, Subhadeep

2016-01-01

Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur) functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named X anthomonas iron binding regulator) of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc). Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon’s involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in Xanthomonads in response to iron availability. Our results provide insight of the complex regulatory mechanism of fine-tuning of virulence associated functions with iron availability in this important group of phytopathogen. PMID:27902780

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

1989-02-01

We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

Orphan nuclear receptor chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) protein negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation through suppressing runt-related gene 2 (Runx2) activity.

PubMed

Lee, Kkot-Nim; Jang, Won-Gu; Kim, Eun-Jung; Oh, Sin-Hye; Son, Hye-Ju; Kim, Sun-Hun; Franceschi, Renny; Zhang, Xiao-Kun; Lee, Shee-Eun; Koh, Jeong-Tae

2012-06-01

Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) is an orphan nuclear receptor of the steroid-thyroid hormone receptor superfamily. COUP-TFII is widely expressed in multiple tissues and organs throughout embryonic development and has been shown to regulate cellular growth, differentiation, and organ development. However, the role of COUP-TFII in osteoblast differentiation has not been systematically evaluated. In the present study, COUP-TFII was strongly expressed in multipotential mesenchymal cells, and the endogenous expression level decreased during osteoblast differentiation. Overexpression of COUP-TFII inhibited bone morphogenetic protein 2 (BMP2)-induced osteoblastic gene expression. The results of alkaline phosphatase, Alizarin Red staining, and osteocalcin production assay showed that COUP-TFII overexpression blocks BMP2-induced osteoblast differentiation. In contrast, the down-regulation of COUP-TFII synergistically induced the expression of BMP2-induced osteoblastic genes and osteoblast differentiation. Furthermore, the immunoprecipitation assay showed that COUP-TFII and Runx2 physically interacted and COUP-TFII significantly impaired the Runx2-dependent activation of the osteocalcin promoter. From the ChIP assay, we found that COUP-TFII repressed DNA binding of Runx2 to the osteocalcin gene, whereas Runx2 inhibited COUP-TFII expression via direct binding to the COUP-TFII promoter. Taken together, these findings demonstrate that COUP-TFII negatively regulates osteoblast differentiation via interaction with Runx2, and during the differentiation state, BMP2-induced Runx2 represses COUP-TFII expression and promotes osteoblast differentiation.

Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

PubMed Central

Veldman, Matthew B.; Lin, Shuo

2012-01-01

Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

PubMed

Veldman, Matthew B; Lin, Shuo

2012-01-20

Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

PubMed

Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

2016-10-01

During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

PubMed

Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

2011-02-01

We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

PubMed Central

Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

1997-01-01

The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

PubMed

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

NFI-Ski interactions mediate transforming growth factor beta modulation of human papillomavirus type 16 early gene expression.

PubMed

Baldwin, Amy; Pirisi, Lucia; Creek, Kim E

2004-04-01

Human papillomaviruses (HPVs) are present in virtually all cervical cancers. An important step in the development of malignant disease, including cervical cancer, involves a loss of sensitivity to transforming growth factor beta (TGF-beta). HPV type 16 (HPV16) early gene expression, including that of the E6 and E7 oncoprotein genes, is under the control of the upstream regulatory region (URR), and E6 and E7 expression in HPV16-immortalized human epithelial cells is inhibited at the transcriptional level by TGF-beta. While the URR contains a myriad of transcription factor binding sites, including seven binding sites for nuclear factor I (NFI), the specific sequences within the URR or the transcription factors responsible for TGF-beta modulation of the URR remain unknown. To identify potential transcription factors and binding sites involved in TGF-beta modulation of the URR, we performed DNase I footprint analysis on the HPV16 URR using nuclear extracts from TGF-beta-sensitive HPV16-immortalized human keratinocytes (HKc/HPV16) treated with and without TGF-beta. Differentially protected regions were found to be located around NFI binding sites. Electrophoretic mobility shift assays, using the NFI binding sites as probes, showed decreased binding upon TGF-beta treatment. This decrease in binding was not due to reduced NFI protein or NFI mRNA levels. Mutational analysis of individual and multiple NFI binding sites in the URR defined their role in TGF-beta sensitivity of the promoter. Overexpression of the NFI family members in HKc/HPV16 decreased the ability of TGF-beta to inhibit the URR. Since the oncoprotein Ski has been shown to interact with and increase the transcriptional activity of NFI and since cellular Ski levels are decreased by TGF-beta treatment, we explored the possibility that Ski may provide a link between TGF-beta signaling and NFI activity. Anti-NFI antibodies coimmunoprecipitated endogenous Ski in nuclear extracts from HKc/HPV16, confirming that NFI and Ski interact in these cells. Ski levels dramatically decreased upon TGF-beta treatment of HKc/HPV16, and overexpression of Ski eliminated the ability of TGF-beta to inhibit the URR. Based on these studies, we propose that TGF-beta inhibition of HPV16 early gene expression is mediated by a decrease in Ski levels, which in turn dramatically reduces NFI activity.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

PubMed

Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

2011-02-10

Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

Transcriptional activation of Mina by Sp1/3 factors.

PubMed

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Transcriptional Activation of Mina by Sp1/3 Factors

PubMed Central

Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

The zinc finger gene Krox20 regulates HoxB2 (Hox2.8) during hindbrain segmentation.

PubMed

Sham, M H; Vesque, C; Nonchev, S; Marshall, H; Frain, M; Gupta, R D; Whiting, J; Wilkinson, D; Charnay, P; Krumlauf, R

1993-01-29

The zinc finger gene Krox20 and many Hox homeobox genes are expressed in segment-restricted domains in the hindbrain. The restricted expression patterns appear before morphological segmentation, suggesting that these transcription factors may play an early role in the establishment and identity of rhombomeric segments. In this paper, we show that the HoxB2 (Hox2.8) gene is normally upregulated in rhombomeres (r) 3, 4, and 5, and we identify an enhancer region upstream of the gene that imposes r3/r5 expression in transgenic mice. This enhancer contains three Krox20-binding sites required in vitro for complex formation with Krox20 protein and in vivo for rhombomere-restricted expression. In transgenic mice, Krox20 expressed in ectopic domains can transactivate a reporter construct containing the HoxB2 r3/r5 enhancer. These data demonstrate that Krox20 is a part of the upstream transcriptional cascade that directly regulates HoxB2 expression during hindbrain segmentation.

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

PubMed

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

The casein kinases Yck1p and Yck2p act in the secretory pathway, in part, by regulating the Rab exchange factor Sec2p

PubMed Central

Stalder, Danièle; Novick, Peter J.

2016-01-01

Sec2p is a guanine nucleotide exchange factor that activates Sec4p, the final Rab GTPase of the yeast secretory pathway. Sec2p is recruited to secretory vesicles by the upstream Rab Ypt32p acting in concert with phosphatidylinositol-4-phosphate (PI(4)P). Sec2p also binds to the Sec4p effector Sec15p, yet Ypt32p and Sec15p compete against each other for binding to Sec2p. We report here that the redundant casein kinases Yck1p and Yck2p phosphorylate sites within the Ypt32p/Sec15p binding region and in doing so promote binding to Sec15p and inhibit binding to Ypt32p. We show that Yck2p binds to the autoinhibitory domain of Sec2p, adjacent to the PI(4)P binding site, and that addition of PI(4)P inhibits Sec2p phosphorylation by Yck2p. Loss of Yck1p and Yck2p function leads to accumulation of an intracellular pool of the secreted glucanase Bgl2p, as well as to accumulation of Golgi-related structures in the cytoplasm. We propose that Sec2p is phosphorylated after it has been recruited to secretory vesicles and the level of PI(4)P has been reduced. This promotes Sec2p function by stimulating its interaction with Sec15p. Finally, Sec2p is dephosphorylated very late in the exocytic reaction to facilitate recycling. PMID:26700316

Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

PubMed Central

Bigler, J; Eisenman, R N

1994-01-01

Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

PubMed Central

Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

2015-01-01

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

Biochemical and structural characterization of a novel cooperative binding mode by Pit-1 with CATT repeats in the macrophage migration inhibitory factor promoter

PubMed Central

Agarwal, Sorabh

2018-01-01

Abstract Overexpression of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) is linked to a number of autoimmune diseases and cancer. MIF production has been correlated to the number of CATT repeats in a microsatellite region upstream of the MIF gene. We have characterized the interaction of pituitary-specific positive transcription factor 1 (Pit-1) with a portion of the MIF promoter region flanking a microsatellite polymorphism (−794 CATT5–8). Using fluorescence anisotropy, we quantified tight complex formation between Pit-1 and an oligonucleotide consisting of eight consecutive CATT repeats (8xCATT) with an apparent Kd of 35 nM. Using competition experiments we found a 23 base pair oligonucleotide with 4xCATT repeats to be the minimum DNA sequence necessary for high affinity interaction with Pit-1. The stoichiometry of the Pit-1 DNA interaction was determined to be 2:1 and binding is cooperative in nature. We subsequently structurally characterized the complex and discovered a completely novel binding mode for Pit-1 in contrast to previously described Pit-1 complex structures. The affinity of Pit-1 for the CATT target sequence was found to be highly dependent on cooperativity. This work lays the groundwork for understanding transcriptional regulation of MIF and pursuing Pit-1 as a therapeutic target to treat MIF-mediated inflammatory disorders. PMID:29186613

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression.

PubMed

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-03-07

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on-off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis.

The DEK oncogene activates VEGF expression and promotes tumor angiogenesis and growth in HIF-1α-dependent and -independent manners

PubMed Central

Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong

2016-01-01

The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756

Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

PubMed Central

Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

2012-01-01

NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk

PubMed Central

Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.

2016-01-01

It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Src is a major signaling component for CTGF induction by TGF-β1 in osteoblasts

PubMed Central

X, Zhang; JA, Arnott; S, Rehman; WG, DeLong; A, Sanjay; FF, Safadi; SN, Popoff

2010-01-01

Connective tissue growth factor (CTGF/CCN2) is induced by transforming growth factor beta 1(TGF-β1) where it acts as a downstream mediator of TGF-β1 induced matrix production in osteoblasts. We have shown the requirement of Src, Erk and Smad signaling for CTGF induction by TGF-β1 in osteoblasts, however the potential interaction among these signaling pathways remains undetermined. In this study we demonstrate that TGF-β1 activates Src kinase in ROS17/2.8 cells and that treatment with the Src family kinase inhibitor PP2 prevents Src activation and CTGF induction by TGF-β1. Additionally, inhibiting Src activation prevented Erk activation, Smad 2 & 3 activation and nuclear translocation by TGF-β1, demonstrating that Src is an essential upstream signaling partner of both Erk and Smads in osteoblasts. MAPKs such as Erk can modulate the Smad pathway through directly mediating the phosphorylation of Smads or indirectly through activation/inactivation of required nuclear co-activators that mediate Smad DNA binding. When we treated cells with the Erk inhibitor, PD98059 it inhibited TGF-β1-induced CTGF protein expression but had no effect on Src activation, Smad activation or Smad nuclear translocation. However PD98059 impaired transcriptional complex formation on the Smad binding element (SBE) on the CTGF promoter, demonstrating that Erk activation was required for SBE transactivation. This data demonstrates that Src is an essential upstream signaling transducer of Erk and Smad signaling with respect to TGF-β1 in osteoblasts and that Smads and Erk function independently but are both essential for forming a transcriptionally active complex on the CTGF promoter in osteoblasts. PMID:20432467

A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-03-01

MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

Function-specific intracellular signaling pathways downstream of heparin-binding EGF-like growth factor utilized by human trophoblasts.

PubMed

Jessmon, Philip; Kilburn, Brian A; Romero, Roberto; Leach, Richard E; Armant, D Randall

2010-05-01

Heparin-binding EGF-like growth factor (HBEGF) is expressed by trophoblast cells throughout gestation. First-trimester cytotrophoblast cells are protected from hypoxia-induced apoptosis because of the accumulation of HBEGF through a posttranscriptional autocrine mechanism. Exogenous application of HBEGF is cytoprotective in a hypoxia/reoxygenation (H/R) injury model and initiates trophoblast extravillous differentiation to an invasive phenotype. The downstream signaling pathways induced by HBEGF that mediate these various cellular activities were identified using two human first-trimester cytotrophoblast cell lines, HTR-8/SVneo and SW.71, with similar results. Recombinant HBEGF (1 nM) induced transient phosphorylation of MAPK3/1 (ERK), MAPK14 (p38), and AKT within 15 min and JNK after 1-2 h. To determine which downstream pathways regulate the various functions of HBEGF, cells were treated with specific inhibitors of the ERK upstream regulator MEK (U0126), the AKT upstream regulator phosphoinositide-3 (PI3)-kinase (LY294002), MAPK14 (SB203580), and JNK (SP600125), as well as with inactive structural analogues. Only SB203580 specifically prevented HBEGF-mediated rescue during H/R, while each inhibitor attenuated HBEGF-stimulated cell migration. Accumulation of HBEGF at reduced oxygen was blocked only by a combination of U0126, SB203580, and SP600125. We conclude that HBEGF advances trophoblast extravillous differentiation through coordinate activation of PI3 kinase, ERK, MAPK14, and JNK, while only MAPK14 is required for its antiapoptotic activity. Additionally, hypoxia induces an autocrine increase in HBEGF protein levels through MAPK14, JNK or ERK. These experiments reveal a complexity of the intracellular signaling circuitry that regulates trophoblast functions critical for implantation and placentation.

Function-Specific Intracellular Signaling Pathways Downstream of Heparin-Binding EGF-Like Growth Factor Utilized by Human Trophoblasts1

PubMed Central

Jessmon, Philip; Kilburn, Brian A.; Romero, Roberto; Leach, Richard E.; Armant, D. Randall

2010-01-01

Heparin-binding EGF-like growth factor (HBEGF) is expressed by trophoblast cells throughout gestation. First-trimester cytotrophoblast cells are protected from hypoxia-induced apoptosis because of the accumulation of HBEGF through a posttranscriptional autocrine mechanism. Exogenous application of HBEGF is cytoprotective in a hypoxia/reoxygenation (H/R) injury model and initiates trophoblast extravillous differentiation to an invasive phenotype. The downstream signaling pathways induced by HBEGF that mediate these various cellular activities were identified using two human first-trimester cytotrophoblast cell lines, HTR-8/SVneo and SW.71, with similar results. Recombinant HBEGF (1 nM) induced transient phosphorylation of MAPK3/1 (ERK), MAPK14 (p38), and AKT within 15 min and JNK after 1–2 h. To determine which downstream pathways regulate the various functions of HBEGF, cells were treated with specific inhibitors of the ERK upstream regulator MEK (U0126), the AKT upstream regulator phosphoinositide-3 (PI3)-kinase (LY294002), MAPK14 (SB203580), and JNK (SP600125), as well as with inactive structural analogues. Only SB203580 specifically prevented HBEGF-mediated rescue during H/R, while each inhibitor attenuated HBEGF-stimulated cell migration. Accumulation of HBEGF at reduced oxygen was blocked only by a combination of U0126, SB203580, and SP600125. We conclude that HBEGF advances trophoblast extravillous differentiation through coordinate activation of PI3 kinase, ERK, MAPK14, and JNK, while only MAPK14 is required for its antiapoptotic activity. Additionally, hypoxia induces an autocrine increase in HBEGF protein levels through MAPK14, JNK or ERK. These experiments reveal a complexity of the intracellular signaling circuitry that regulates trophoblast functions critical for implantation and placentation. PMID:20130271

Development of novel NEMO-binding domain mimetics for inhibiting IKK/NF-κB activation.

PubMed

Zhao, Jing; Zhang, Lei; Mu, Xiaodong; Doebelin, Christelle; Nguyen, William; Wallace, Callen; Reay, Daniel P; McGowan, Sara J; Corbo, Lana; Clemens, Paula R; Wilson, Gabriela Mustata; Watkins, Simon C; Solt, Laura A; Cameron, Michael D; Huard, Johnny; Niedernhofer, Laura J; Kamenecka, Theodore M; Robbins, Paul D

2018-06-11

Nuclear factor κB (NF-κB) is a transcription factor important for regulating innate and adaptive immunity, cellular proliferation, apoptosis, and senescence. Dysregulation of NF-κB and its upstream regulator IκB kinase (IKK) contributes to the pathogenesis of multiple inflammatory and degenerative diseases as well as cancer. An 11-amino acid peptide containing the NF-κB essential modulator (NEMO)-binding domain (NBD) derived from the C-terminus of β subunit of IKK, functions as a highly selective inhibitor of the IKK complex by disrupting the association of IKKβ and the IKKγ subunit NEMO. A structure-based pharmacophore model was developed to identify NBD mimetics by in silico screening. Two optimized lead NBD mimetics, SR12343 and SR12460, inhibited tumor necrosis factor α (TNF-α)- and lipopolysaccharide (LPS)-induced NF-κB activation by blocking the interaction between IKKβ and NEMO and suppressed LPS-induced acute pulmonary inflammation in mice. Chronic treatment of a mouse model of Duchenne muscular dystrophy (DMD) with SR12343 and SR12460 attenuated inflammatory infiltration, necrosis and muscle degeneration, demonstrating that these small-molecule NBD mimetics are potential therapeutics for inflammatory and degenerative diseases.

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Inhibition of the Ras-Net (Elk-3) pathway by a novel pyrazole that affects microtubules.

PubMed

Wasylyk, Christine; Zheng, Hong; Castell, Christelle; Debussche, Laurent; Multon, Marie-Christine; Wasylyk, Bohdan

2008-03-01

Net (Elk-3/SAP-2/Erp) is a transcription factor that is phosphorylated and activated by the Ras-extracellular signal-regulated kinase (Erk) signaling pathway and is involved in wound healing, angiogenesis, and tumor growth. In a cell-based screen for small molecule inhibitors of Ras activation of Net transcriptional activity, we identified a novel pyrazole, XRP44X. XRP44X inhibits fibroblast growth factor 2 (FGF-2)-induced Net phosphorylation by the Ras-Erk signaling upstream from Ras. It also binds to the colchicine-binding site of tubulin, depolymerizes microtubules, stimulates cell membrane blebbing, and affects the morphology of the actin skeleton. Interestingly, Combretastin-A4, which produces similar effects on the cytoskeleton, also inhibits FGF-2 Ras-Net signaling. This differs from other classes of agents that target microtubules, which have either little effect (vincristine) or no effect (docetaxel and nocodazole) on the Ras-Net pathway. XRP44X inhibits various cellular properties, including cell growth, cell cycle progression, and aortal sprouting, similar to other molecules that bind to the tubulin colchicine site. XRP44X has the potentially interesting property of connecting two important pathways involved in cell transformation and may thereby represent an interesting class of molecules that could be developed for cancer treatment.

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.

PubMed

García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana

2018-03-29

Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.

Involvement of the Global Crp Regulator in Cyclic AMP-Dependent Utilization of Aromatic Amino Acids by Pseudomonas putida

PubMed Central

Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana

2012-01-01

The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386

Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

2010-01-12

The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

Perineural Dexmedetomidine Attenuates Inflammation in Rat Sciatic Nerve via the NF-κB Pathway

PubMed Central

Huang, Yan; Lu, Yi; Zhang, Lei; Yan, Jia; Jiang, Jue; Jiang, Hong

2014-01-01

Recent studies have shown that dexmedetomidine exerts an anti-inflammatory effect by reducing serum levels of inflammatory factors, however, the up-stream mechanism is still unknown. The transcription factor NF-κB enters the nucleus and promotes the transcription of its target genes, including those encoding the pro-inflammatory cytokines IL-6 and TNF-α. In this study, we established a rat model that simulates a clinical surgical procedure to investigate the anti-inflammatory effect of perineural administration of dexmedetomidine and the underlying mechanism. Dexmedetomidine reduced the sciatic nerve levels of IL-6 and TNF-α at both the mRNA and protein level. Dexmedetomidine also inhibited the translocation of activated NF-κB to the nucleus and the binding activity of NF-κB. The anti-inflammatory effect is confirmed to be dose-dependent. Finally, pyrrolidine dithiocarbamate also reduced the levels of IL-6 and TNF-α and the activation of NF-κB. In conclusion, dexmedetomidine inhibited the nuclear translocation and binding activity of activated NF-κB, thus reducing inflammatory cytokines. PMID:24663080

TAK1 regulates NF-{Kappa}B and AP-1 activation in airway epithelial cells following RSV infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dey, Nilay; Liu Tianshuang; Garofalo, Roberto P.

2011-09-30

Respiratory syncytial virus (RSV) is the most common cause of epidemic respiratory diseases in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B) and AP-1. In this study, we have investigated the signaling pathway leading to activation of these two transcription factors in response to RSV infection. Our results show that IKK{beta} plays a key role in viral-induced NF-{kappa}B activation, while JNK regulates AP-1-dependent gene transcription, as demonstrated by using kinase inactive proteins and chemical inhibitors of the two kinases.more » Inhibition of TAK1 activation, by overexpression of kinase inactive TAK1 or using cells lacking TAK1 expression, significantly reduced RSV-induced NF-{kappa}B and AP-1 nuclear translocation and DNA-binding activity, as well as NF-{kappa}B-dependent gene expression, identifying TAK1 as an important upstream signaling molecule regulating RSV-induced NF-{kappa}B and AP-1 activation. - Highlights: > IKK{beta} is a major kinase involved in RSV-induced NF-{kappa}B activation. > JNK regulates AP-1-dependent gene transcription in RSV infection. > TAK1 is a critical upstream signaling molecule for both pathways in infected cells.« less

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Cnm is a major virulence factor of invasive Streptococcus mutans and part of a conserved three-gene locus

PubMed Central

Avilés-Reyes, A.; Miller, J.H.; Simpson-Haidaris, P.J.; Lemos, J.A.; Abranches, J.

2014-01-01

SUMMARY Cnm, a collagen- and laminin-binding protein present in a subset of Streptococcus mutans strains, mediates binding to extracellular matrices (ECM), intracellular invasion and virulence in the Galleria mellonella model. Antibodies raised against Cnm were used to confirm expression and the cell surface localization of Cnm in the highly invasive OMZ175 strain. Sequence analysis identified two additional genes (cnaB and cbpA) encoding putative surface proteins immediately upstream of cnm. Inactivation of cnaB and cbpA in OMZ175, individually or in combination, did not decrease the ability of this highly invasive and virulent strain to bind to different ECM proteins, invade human coronary artery endothelial cells (HCAEC), or kill G. mellonella. Similarly, expression of cnaB and cbpA in the cnm− strain UA159 revealed that these genes did not enhance Cnmrelated phenotypes. However, integration of cnm in the chromosome of UA159 significantly increased its ability to bind to collagen and laminin, invade HCAEC, and kill G. mellonella. Moreover, the presence of antibodies against Cnm nearly abolished the ability of OMZ175 to bind to collagen and laminin and invade HCAEC, and significantly protected G. mellonella against OMZ175 infection. We concluded that neither CnaB nor CbpA is necessary for the expression of Cnm-related traits. We also provided definitive evidence that Cnm is an important virulence factor and a suitable target for the development of novel preventive and therapeutic strategies to combat invasive S. mutans strains. PMID:24103776

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

Hepatocyte Nuclear Factor 4α (HNF4α) Is a Transcription Factor of Vertebrate Fatty Acyl Desaturase Gene as Identified in Marine Teleost Siganus canaliculatus

PubMed Central

Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou

2016-01-01

Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219

Up-Regulation of HSFA2c and HSPs by ABA Contributing to Improved Heat Tolerance in Tall Fescue and Arabidopsis

PubMed Central

Wang, Xiuyun; Zhuang, Lili; Huang, Bingru

2017-01-01

Abscisic acid (ABA) is known to play roles in regulating plant tolerance to various abiotic stresses, but whether ABA’s effects on heat tolerance are associated with its regulation of heat stress transcription factors (HSFs) and heat shock proteins (HSPs) is not well documented. The objective of this study was to determine whether improved heat tolerance of tall fescue (Festuca arundinacea Schreb.) by ABA was through the regulation of HSFs and HSPs. ABA-responsive transcriptional factors, ABA-responsive element binding protein 3 (FaAREB3) and dehydration-responsive element binding protein 2A (FaDREB2A) of tall fescue, were able to bind to the cis-elements in the promoter of tall fescue heat stress transcription factor A2c (FaHSFA2c). Exogenous ABA (5 μM) application enhanced heat tolerance of tall fescue, as manifested by increased leaf photochemical efficiency and membrane stability under heat stress (37/32 °C, day/night). The expression levels of FaHSFA2c, several tall fescue HSPs (FaHSPs), and ABA-responsive transcriptional factors were up-regulated in plants treated with ABA. Deficiency of Arabidopsis heat stress transcription factor A2 (AtHSFA2) suppressed ABA-induction of AtHSPs expression and ABA-improved heat tolerance in Arabidopsis. These results suggested that HSFA2 plays an important role in ABA-mediated plant heat tolerance, and FaAREB3 and FaDREB2A may function as upstream trans-acting factors and regulate transcriptional activity of FaHSFA2c and the downstream FaHSPs, leading to improved heat tolerance. PMID:28914758

A mechanism underlying position-specific regulation of alternative splicing

PubMed Central

Hamid, Fursham M.

2017-01-01

Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

PubMed Central

Zheng, Zhaoqing; Keifer, Joyce

2014-01-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression

PubMed Central

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-01-01

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on–off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis. PMID:16505380

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

2010-11-05

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

C/EBPβ (CCAAT/enhancer-binding protein β) mediates progesterone production through transcriptional regulation in co-operation with SF-1 (steroidogenic factor-1).

PubMed

Mizutani, Tetsuya; Ju, Yunfeng; Imamichi, Yoshitaka; Osaki, Tsukasa; Yazawa, Takashi; Kawabe, Shinya; Ishikane, Shin; Matsumura, Takehiro; Kanno, Masafumi; Kamiki, Yasue; Kimura, Kohei; Minamino, Naoto; Miyamoto, Kaoru

2014-06-15

The transcription factor SF-1 (steroidogenic factor-1) is a master regulator of steroidogenesis. Previously, we have found that SF-1 induces the differentiation of mesenchymal stem cells into steroidogenic cells. To elucidate the molecular mechanisms of SF-1-mediated functions, we attempted to identify protein components of the SF-1 nuclear protein complex in differentiated cells. SF-1 immunoaffinity chromatography followed by MS/MS analysis was performed, and 24 proteins were identified. Among these proteins, we focused on C/EBPβ (CCAAT/enhancer-binding protein β), which is an essential transcription factor for ovulation and luteinization, as the transcriptional mechanisms of C/EBPβ working together with SF-1 are poorly understood. C/EBPβ knockdown attenuated cAMP-induced progesterone production in granulosa tumour-derived KGN cells by altering STAR (steroidogenic acute regulatory protein), CYP11A1 (cytochrome P450, family 11, subfamily A, polypeptide 1) and HSD3B2 (hydroxy-δ-5-steroid dehydrogenase, 3β- and steroid δ-isomerase 2) expression. EMSA and ChIP assays revealed novel C/EBPβ-binding sites in the upstream regions of the HSD3B2 and CYP11A1 genes. These interactions were enhanced by cAMP stimulation. Luciferase assays showed that C/EBPβ-responsive regions were found in each promoter and C/EBPβ is involved in the cAMP-induced transcriptional activity of these genes together with SF-1. These results indicate that C/EBPβ is an important mediator of progesterone production by working together with SF-1, especially under tropic hormone-stimulated conditions.

Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

PubMed Central

Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P

1995-01-01

The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084

Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.

PubMed

Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R

2001-08-10

The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

PubMed

Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

2015-07-13

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

Common and divergent features in transcriptional control of the homologous small RNAs GlmY and GlmZ in Enterobacteriaceae

PubMed Central

Göpel, Yvonne; Lüttmann, Denise; Heroven, Ann Kathrin; Reichenbach, Birte; Dersch, Petra; Görke, Boris

2011-01-01

Small RNAs GlmY and GlmZ compose a cascade that feedback-regulates synthesis of enzyme GlmS in Enterobacteriaceae. Here, we analyzed the transcriptional regulation of glmY/glmZ from Yersinia pseudotuberculosis, Salmonella typhimurium and Escherichia coli, as representatives for other enterobacterial species, which exhibit similar promoter architectures. The GlmY and GlmZ sRNAs of Y. pseudotuberculosis are transcribed from σ54-promoters that require activation by the response regulator GlrR through binding to three conserved sites located upstream of the promoters. This also applies to glmY/glmZ of S. typhimurium and glmY of E. coli, but as a difference additional σ70-promoters overlap the σ54-promoters and initiate transcription at the same site. In contrast, E. coli glmZ is transcribed from a single σ70-promoter. Thus, transcription of glmY and glmZ is controlled by σ54 and the two-component system GlrR/GlrK (QseF/QseE) in Y. pseudotuberculosis and presumably in many other Enterobacteria. However, in a subset of species such as E. coli this relationship is partially lost in favor of σ70-dependent transcription. In addition, we show that activity of the σ54-promoter of E. coli glmY requires binding of the integration host factor to sites upstream of the promoter. Finally, evidence is provided that phosphorylation of GlrR increases its activity and thereby sRNA expression. PMID:20965974

Rv2358 and FurB: Two Transcriptional Regulators from Mycobacterium tuberculosis Which Respond to Zinc

PubMed Central

Canneva, Fabio; Branzoni, Manuela; Riccardi, Giovanna; Provvedi, Roberta; Milano, Anna

2005-01-01

In a previous work, we demonstrated that the Mycobacterium tuberculosis Rv2358-furB operon is induced by zinc. In this study, the orthologous genes from Mycobacterium smegmatis mc2155 were inactivated and mutants analyzed. Rv2358 protein was purified and found to bind upstream of the Rv2358 gene. Binding was inhibited by Zn2+ ions. PMID:16077132

Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

PubMed Central

Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

2005-01-01

Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

Long-term memory deficits in Pavlovian fear conditioning in Ca2+/calmodulin kinase kinase alpha-deficient mice.

PubMed

Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A

2006-12-01

Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Regulation of the yjjQ-bglJ Operon, Encoding LuxR-Type Transcription Factors, and the Divergent yjjP Gene by H-NS and LeuO▿ †

PubMed Central

Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin

2008-01-01

The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596

Opposing Control by Transcription Factors MYB61 and MYB3 Increases Freezing Tolerance by Relieving C-Repeat Binding Factor Suppression1[OPEN

PubMed Central

Zhang, Yunqin; Miao, Zhenyan; Xie, Can; Meng, Xiangzhao; Deng, Jie; Mysore, Kirankumar S.; Frugier, Florian; Wang, Tao

2016-01-01

Cold acclimation is an important process by which plants respond to low temperature and enhance their winter hardiness. C-REPEAT BINDING FACTOR1 (CBF1), CBF2, and CBF3 genes were shown previously to participate in cold acclimation in Medicago truncatula. In addition, MtCBF4 is transcriptionally induced by salt, drought, and cold stresses. We show here that MtCBF4, shown previously to enhance drought and salt tolerance, also positively regulates cold acclimation and freezing tolerance. To identify molecular factors acting upstream and downstream of the MtCBF4 transcription factor (TF) in cold responses, we first identified genes that are differentially regulated upon MtCBF4 overexpression using RNAseq Digital Gene Expression Profiling. Among these, we showed that MtCBF4 directly activates the transcription of the COLD ACCLIMATION SPECIFIC15 (MtCAS15) gene. To gain insights into how MtCBF4 is transcriptionally regulated in response to cold, an R2R3-MYB TF, MtMYB3, was identified based on a yeast one-hybrid screen as binding directly to MYB cis-elements in the MtCBF4 promoter, leading to the inhibition of MtCBF4 expression. In addition, another MYB TF, MtMYB61, identified as an interactor of MtMYB3, can relieve the inhibitory effect of MtMYB3 on MtCBF4 transcription. This study, therefore, supports a model describing how MtCBF4 is regulated by antagonistic MtMYB3/MtMYB61 TFs, leading to the up-regulation of downstream targets such as MtCAS15 acting in cold acclimation in M. truncatula. PMID:27578551

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

2010-12-03

Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

Deletion of the Distal Tnfsf11 RL-D2 Enhancer That Contributes to PTH-Mediated RANKL Expression in Osteoblast Lineage Cells Results in a High Bone Mass Phenotype in Mice.

PubMed

Onal, Melda; St John, Hillary C; Danielson, Allison L; Pike, J Wesley

2016-02-01

Receptor activator of nuclear factor-κB ligand (RANKL) is a tumor necrosis factor (TNF)-like cytokine that is necessary for osteoclast formation and survival. Elevated RANKL synthesis is associated with both increased osteoclast number and bone resorption. Earlier studies identified an enhancer 76 kb upstream of the Tnfsf11 transcriptional start site (TSS) termed RL-D5 or the distal control region (DCR) that modulates RANKL expression in response to PTH, 1,25(OH)2D3,, and an array of cytokines. Mice lacking RL-D5 exhibit high bone mass associated with decreased RANKL expression in bone, spleen, and thymus. In addition to RL-D5, genome-wide studies have identified 9 additional Tnfsf11 enhancers residing upstream of the gene's TSS, which provide RANKL cell type-specificity and responsiveness to local and systemic factors. ChIP-chip analyses has revealed inducible vitamin D receptor (VDR) and cAMP response element-binding protein (CREB) binding at an enhancer termed RL-D2 23 kb upstream of the Tnfsf11 TSS in osteoblastic ST2 cells. Herein, we use ChIP-seq analyses to confirm this finding and then delete this enhancer from the mouse genome to determine its physiological role in vivo. RL-D2(-/-) primary stromal cells showed decreased RANKL-induction by both forskolin and 1,25(OH)2D3 ex vivo. Consistent with this, the parathyroid hormone (PTH) induction of RANKL expression was significantly blunted in RL-D2(-/-) mice in vivo. In contrast, lack of RL-D2 had no effect on 1,25(OH)2D3 induction of RANKL in vivo. Similar to the results found in RL-D5(-/-) mice, lack of RL-D2 led to decreased skeletal RANKL expression, resulting in decreased osteoclast numbers and a progressive increase in bone mineral density. Lack of RL-D2 increased cancellous bone mass in femur and spine but did not alter femoral cortical bone thickness. These results highlight the role of distal enhancers in the regulation of RANKL expression by PTH and perhaps 1,25(OH)2D3 and suggest that the RL-D2 and RL-D5 enhancers contribute in either an additive or synergistic manner to regulate bone remodeling. © 2015 American Society for Bone and Mineral Research.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

A non-canonical role for Rgnef in promoting integrin-stimulated focal adhesion kinase activation

PubMed Central

Miller, Nichol L. G.; Lawson, Christine; Kleinschmidt, Elizabeth G.; Tancioni, Isabelle; Uryu, Sean; Schlaepfer, David D.

2013-01-01

Summary Rgnef (also known as p190RhoGEF or ARHGEF28) is a Rho guanine-nucleotide-exchange factor (GEF) that binds focal adhesion kinase (FAK). FAK is recruited to adhesions and activated by integrin receptors binding to matrix proteins, such as fibronectin (FN). Canonical models place Rgnef downstream of integrin–FAK signaling in regulating Rho GTPase activity and cell movement. Herein, we establish a new, upstream role for Rgnef in enhancing FAK localization to early peripheral adhesions and promoting FAK activation upon FN binding. Rgnef-null mouse embryo fibroblasts (MEFs) exhibit defects in adhesion formation, levels of FAK phosphotyrosine (pY)-397 and FAK localization to peripheral adhesions upon re-plating on FN. Rgnef re-expression rescues these defects, but requires Rgnef–FAK binding. A mutation in the Rgnef pleckstrin homology (PH) domain inhibits adhesion formation, FAK localization, and FAK-Y397 and paxillin-Y118 phosphorylation without disrupting the Rgnef–FAK interaction. A GEF-inactive Rgnef mutant rescues FAK-Y397 phosphorylation and early adhesion localization, but not paxillin-Y118 phosphorylation. This suggests that, downstream of FN binding, paxillin-pY118 requires Rgnef GEF activity through a mechanism distinct from adhesion formation and FAK activation. These results support a scaffolding role for Rgnef in FAK localization and activation at early adhesions in a PH-domain-dependent but GEF-activity-independent manner. PMID:24006257

CCCTC-binding Factor Mediates Effects of Glucose On Beta Cell Survival

PubMed Central

Tsui, Shanli; Dai, Wei; Lu, Luo

2013-01-01

Objectives Pancreatic islet β-cell survival is important in regulating insulin activities and maintaining glucose homeostasis. Recently, Pax6 has been shown to be essential for many vital functions in β-cells, though the molecular mechanisms of its regulation in β-cells remain unclear. The present study investigates the novel effects of glucose- and insulin-induced CTCF activity on Pax6 gene expression as well as the subsequent effects of insulin-activated signaling pathways on β-cell proliferation. Material and methods Pancreatic β-TC-1-6 cells were cultured in DMEM medium and stimulated with high concentrations of glucose (5 to 125 mM) and cell viability was assessed by MTT assays. The effect of CTCF on Pax6 was evaluated in high glucose-induced and CCCTC-binding Factor (CTCF)/Erk suppressed cells by promoter reporter and Western analyses. Results Increases in glucose and insulin concentrations up-regulated CTCF and consequently down-regulated Pax6 in β-cell survival and proliferation. Knocking-down CTCF directly affected Pax6 transcription through CTCF binding and blocked the response to glucose. Altered Erk activity mediated the effects of CTCF on controlling Pax6 expression, which partially regulates β-cell proliferation. Conclusions CTCF functions as a molecular mediator between insulin-induced upstream Erk signaling and Pax6 expression in pancreatic β-cells. This pathway may contribute to regulation of β-cell survival and proliferation. PMID:24354619

GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility.

PubMed

Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S

2013-01-01

Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen-ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer.

GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility

PubMed Central

Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S.

2013-01-01

Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen–ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer. PMID:23172872

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

PubMed Central

Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

2010-01-01

Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

PubMed

Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

2010-06-01

Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

Differential expression of upstream stimulatory factor (USF) 2 variants in eutopic endometria from women with endometriosis: estradiol regulation.

PubMed

Castro, Jazmin; Araya, Germán; Inostroza, Pamela; Hidalgo, Paulina; González-Ramos, Reinaldo; Sovino, Hugo; Boric, M Angélica; Fuentes, Ariel; Johnson, M Cecilia

2015-10-09

Endometriosis, pro-inflammatory and invasive benign disease estrogen dependent, abnormally express in endometria the enzyme P450Arom, positively regulated by steroid factor-1 (SF-1). Our objective was to study the nuclear protein contents of upstream stimulating factor 2 (USF2a and USF2b), a positive regulator of SF-1, throughout the menstrual cycle in eutopic endometria from women with and without (control) endometriosis and the involvement of nuclear estrogen receptors (ER) and G-coupled protein estrogen receptor (GPER)-1. Upstream stimulating factor 2 protein contents were higher in mid (USF2b) and late (USF2a and USF2b) secretory phase in eutopic endometria from endometriosis than control (p < 0.05). In isolated control epithelial cells incubated with E2 and PGE2, to resemble the endometriosis condition, the data showed: (a) significant increase of USF2a and USF2b nuclear protein contents when treated with E2, PPT (specific agonist for ERα) or G1 (specific agonist for GPER1); (b) no increase in USF2 binding to SF-1 E-Box/DNA consensus sequence in E2-treated cells; (c) USF2 variants protein contents were not modified by PGE2; (d) SF-1 nuclear protein content was significantly higher than basal when treated with PGE2, E2 or G1, stimulation unaffected by ICI (nuclear ER antagonist); and (e) increased (p < 0.05) cytosolic protein contents of P450Arom when treated with PGE2, E2, PPT or G1 compared to basal, effect that was additive with E2 + PGE2 together. Nevertheless, in endometriosis cells, the high USF2, SF-1 and P450Arom protein contents in basal condition were unmodified. These data strongly suggest that USF2 variants and P450Arom are regulated by E2 through ERα and GPER1, whereas SF-1 through GPER1, visualized by the response of the cells obtained from control endometria, being unaffected the endogenously stimulated cells from endometriosis origin. The lack of E2 stimulation on USF2/SF-1 E-Box/DNA-sequence binding and the absence of PGE2 effect on USF2 variants opposite to the strong induction that they exert on SF1 and P450 proteins suggest different mechanisms and indirect regulations. The sustained USF2 variants protein expression during the secretory phase in eutopic endometria from women with endometriosis may participate in the pathophysiology of this disease strongly associated with infertility and its characteristic endometrial invasion to ectopic sites in the pelvic cavity.

Expression of eukaryotic polypeptides in chloroplasts

DOEpatents

Mayfield, Stephen P.

2013-06-04

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Cadherin-11 regulates protrusive activity in Xenopus cranial neural crest cells upstream of Trio and the small GTPases.

PubMed

Kashef, Jubin; Köhler, Almut; Kuriyama, Sei; Alfandari, Dominique; Mayor, Roberto; Wedlich, Doris

2009-06-15

Xenopus Cadherin-11 (Xcad-11) is expressed when cranial neural crest cells (CNC) acquire motility. However, its function in stimulating cell migration is poorly understood. Here, we demonstrate that Xcad-11 initiates filopodia and lamellipodia formation, which is essential for CNC to populate pharyngeal pouches. We identified the cytoplasmic tail of Xcad-11 as both necessary and sufficient for proper CNC migration as long as it was linked to the plasma membrane. Our results showing that guanine nucleotide exchange factor (GEF)-Trio binds to Xcad-11 and can functionally substitute for it like constitutively active forms of RhoA, Rac, and cdc42 unravel a novel cadherin function.

Insulin signalling mechanisms for triacylglycerol storage.

PubMed

Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M

2013-05-01

Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.

Engineering of synthetic, stress-responsive yeast promoters

PubMed Central

Rajkumar, Arun S.; Liu, Guodong; Bergenholm, David; Arsovska, Dushica; Kristensen, Mette; Nielsen, Jens; Jensen, Michael K.; Keasling, Jay D.

2016-01-01

Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducible by specific endogenous or environmental conditions is still rarely undertaken. In this study, we engineered and characterized a set of strong, synthetic promoters for budding yeast Saccharomyces cerevisiae that are inducible under acidic conditions (pH ≤ 3). Using available expression and transcription factor binding data, literature on transcriptional regulation, and known rules of promoter architecture we improved the low-pH performance of the YGP1 promoter by modifying transcription factor binding sites in its upstream activation sequence. The engineering strategy outlined for the YGP1 promoter was subsequently applied to create a response to low pH in the unrelated CCW14 promoter. We applied our best promoter variants to low-pH fermentations, enabling ten-fold increased production of lactic acid compared to titres obtained with the commonly used, native TEF1 promoter. Our findings outline and validate a general strategy to iteratively design and engineer synthetic yeast promoters inducible to environmental conditions or stresses of interest. PMID:27325743

Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

PubMed Central

Shiang, Rita

2008-01-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae

PubMed Central

Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

2016-01-01

In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735

Inhibition of Oncogenic Transcription Factor REL by the Natural Product Derivative Calafianin Monomer 101 Induces Proliferation Arrest and Apoptosis in Human B-Lymphoma Cell Lines.

PubMed

Yeo, Alan T; Chennamadhavuni, Spandan; Whitty, Adrian; Porco, John A; Gilmore, Thomas D

2015-04-23

Increased activity of transcription factor NF-κB has been implicated in many B-cell lymphomas. We investigated effects of synthetic compound calafianin monomer (CM101) on biochemical and biological properties of NF-κB. In human 293 cells, CM101 selectively inhibited DNA binding by overexpressed NF-κB subunits REL (human c-Rel) and p65 as compared to NF-κB p50, and inhibition of REL and p65 DNA binding by CM101 required a conserved cysteine residue. CM101 also inhibited DNA binding by REL in human B-lymphoma cell lines, and the sensitivity of several B-lymphoma cell lines to CM101-induced proliferation arrest and apoptosis correlated with levels of cellular and nuclear REL. CM101 treatment induced both phosphorylation and decreased expression of anti-apoptotic protein Bcl-XL, a REL target gene product, in sensitive B-lymphoma cell lines. Ectopic expression of Bcl-XL protected SUDHL-2 B-lymphoma cells against CM101-induced apoptosis, and overexpression of a transforming mutant of REL decreased the sensitivity of BJAB B-lymphoma cells to CM101-induced apoptosis. Lipopolysaccharide-induced activation of NF-κB signaling upstream components occurred in RAW264.7 macrophages at CM101 concentrations that blocked NF-κB DNA binding. Direct inhibitors of REL may be useful for treating B-cell lymphomas in which REL is active, and may inhibit B-lymphoma cell growth at doses that do not affect some immune-related responses in normal cells.

Huntingtin-interacting protein 1-mediated neuronal cell death occurs through intrinsic apoptotic pathways and mitochondrial alterations.

PubMed

Choi, Shin Ae; Kim, Steven J; Chung, Kwang Chul

2006-10-02

Huntingtin interacting protein-1 (Hip1) is known to be associated with the N-terminal domain of huntingtin. Although Hip1 can induce apoptosis, the exact upstream signal transduction pathways have not been clarified yet. In the present study, we examined whether activation of intrinsic and/or extrinsic apoptotic pathways occurs during Hip1-mediated neuronal cell death. Overexpression of Hip1 induced cell death through caspase-3 activation in immortalized hippocampal neuroprogenitor cells. Interestingly, proteolytic processing of Hip1 into partial fragments was observed in response to Hip1 transfection and apoptosis-inducing drugs. Moreover, Hip1 was found to directly bind to and activate caspase-9. This promoted cytosolic release of cytochrome c and apoptosis-inducing factor via mitochondrial membrane perturbation. Furthermore, Hip1 could directly bind to Apaf-1, suggesting that the neurotoxic signals of Hip1 transmit through the intrinsic mitochondrial apoptotic pathways and the formation of apoptosome complex.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

PubMed Central

Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret

2015-01-01

ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636

Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?

PubMed

Cheregi, Otilia; Funk, Christiane

2015-08-12

In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.

Probing the structure of Nun transcription arrest factor bound to RNA polymerase

PubMed Central

Mustaev, Arkady; Vitiello, Christal L.; Gottesman, Max E.

2016-01-01

The coliphage HK022 protein Nun transcription elongation arrest factor inhibits RNA polymerase translocation. In vivo, Nun acts specifically to block transcription of the coliphage λ chromosome. Using in vitro assays, we demonstrate that Nun cross-links RNA in an RNA:DNA hybrid within a ternary elongation complex (TEC). Both the 5′ and the 3′ ends of the RNA cross-link Nun, implying that Nun contacts RNA polymerase both at the upstream edge of the RNA:DNA hybrid and in the vicinity of the catalytic center. This finding suggests that Nun may inhibit translocation by more than one mechanism. Transcription elongation factor GreA efficiently blocked Nun cross-linking to the 3′ end of the transcript, whereas the highly homologous GreB factor did not. Surprisingly, both factors strongly suppressed Nun cross-linking to the 5′ end of the RNA, suggesting that GreA and GreB can enter the RNA exit channel as well as the secondary channel, where they are known to bind. These findings extend the known action mechanism for these ubiquitous cellular factors. PMID:27436904

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

PubMed

Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

2014-08-01

Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genome-wide Determinants of Proviral Targeting, Clonal Abundance and Expression in Natural HTLV-1 Infection

PubMed Central

Melamed, Anat; Laydon, Daniel J.; Gillet, Nicolas A.; Tanaka, Yuetsu; Taylor, Graham P.; Bangham, Charles R. M.

2013-01-01

The regulation of proviral latency is a central problem in retrovirology. We postulate that the genomic integration site of human T lymphotropic virus type 1 (HTLV-1) determines the pattern of expression of the provirus, which in turn determines the abundance and pathogenic potential of infected T cell clones in vivo. We recently developed a high-throughput method for the genome-wide amplification, identification and quantification of proviral integration sites. Here, we used this protocol to test two hypotheses. First, that binding sites for transcription factors and chromatin remodelling factors in the genome flanking the proviral integration site of HTLV-1 are associated with integration targeting, spontaneous proviral expression, and in vivo clonal abundance. Second, that the transcriptional orientation of the HTLV-1 provirus relative to that of the nearest host gene determines spontaneous proviral expression and in vivo clonal abundance. Integration targeting was strongly associated with the presence of a binding site for specific host transcription factors, especially STAT1 and p53. The presence of the chromatin remodelling factors BRG1 and INI1 and certain host transcription factors either upstream or downstream of the provirus was associated respectively with silencing or spontaneous expression of the provirus. Cells expressing HTLV-1 Tax protein were significantly more frequent in clones of low abundance in vivo. We conclude that transcriptional interference and chromatin remodelling are critical determinants of proviral latency in natural HTLV-1 infection. PMID:23555266

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

PubMed Central

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

2012-01-01

The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

PubMed Central

Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

2011-01-01

Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

Histone Deacetylase-1 Is Enriched at the Platelet-derived Growth Factor-D Promoter in Response to Interleukin-1β and Forms a Cytokine-inducible Gene-silencing Complex with NF-κB p65 and Interferon Regulatory Factor-1*

PubMed Central

Liu, Mary Y.; Khachigian, Levon M.

2009-01-01

Understanding the mechanisms governing cytokine control of growth factor expression in smooth muscle cells would provide invaluable insight into the molecular regulation of vascular phenotypes and create future opportunities for therapeutic intervention. Here, we report that the proinflammatory cytokine interleukin (IL)-1β suppresses platelet-derived growth factor (PDGF)-D promoter activity and mRNA and protein expression in smooth muscle cells. NF-κB p65, induced by IL-1β, interacts with a novel element in the PDGF-D promoter and inhibits PDGF-D transcription. Interferon regulatory factor-1 (IRF-1) is also induced by IL-1β and binds to a different element upstream in the promoter. Immunoprecipitation and chromatin immunoprecipitation experiments showed that IL-1β stimulates p65 interaction with IRF-1 and the accumulation of both factors at the PDGF-D promoter. Mutation of the IRF-1 and p65 DNA-binding elements relieved the promoter from IL-1β-mediated repression. PDGF-D repression by IL-1β involves histone deacetylation and interaction of HDAC-1 with IRF-1 and p65. HDAC-1 small interfering RNA ablates complex formation with IRF-1 and p65 and abrogates IRF-1 and p65 occupancy of the PDGF-D promoter. Thus, HDAC-1 is enriched at the PDGF-D promoter in cells exposed to IL-1β and forms a cytokine-inducible gene-silencing complex with p65 and IRF-1. PMID:19843519

New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

PubMed

Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

2015-09-01

Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

Caenorhabditis elegans fibroblast growth factor receptor signaling can occur independently of the multi-substrate adaptor FRS2.

PubMed

Lo, Te-Wen; Bennett, Daniel C; Goodman, S Jay; Stern, Michael J

2010-06-01

The components of receptor tyrosine kinase signaling complexes help to define the specificity of the effects of their activation. The Caenorhabditis elegans fibroblast growth factor receptor (FGFR), EGL-15, regulates a number of processes, including sex myoblast (SM) migration guidance and fluid homeostasis, both of which require a Grb2/Sos/Ras cassette of signaling components. Here we show that SEM-5/Grb2 can bind directly to EGL-15 to mediate SM chemoattraction. A yeast two-hybrid screen identified SEM-5 as able to interact with the carboxy-terminal domain (CTD) of EGL-15, a domain that is specifically required for SM chemoattraction. This interaction requires the SEM-5 SH2-binding motifs present in the CTD (Y(1009) and Y(1087)), and these sites are required for the CTD role of EGL-15 in SM chemoattraction. SEM-5, but not the SEM-5 binding sites located in the CTD, is required for the fluid homeostasis function of EGL-15, indicating that SEM-5 can link to EGL-15 through an alternative mechanism. The multi-substrate adaptor protein FRS2 serves to link vertebrate FGFRs to Grb2. In C. elegans, an FRS2-like gene, rog-1, functions upstream of a Ras/MAPK pathway for oocyte maturation but is not required for EGL-15 function. Thus, unlike the vertebrate FGFRs, which require the multi-substrate adaptor FRS2 to recruit Grb2, EGL-15 can recruit SEM-5/Grb2 directly.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells

PubMed Central

Galardi, Silvia; Mercatelli, Neri; Farace, Maria G.; Ciafrè, Silvia A.

2011-01-01

MicroRNAs (miRNAs) are potent negative regulators of gene expression involved in all aspects of cell biology. They finely modulate virtually all physiological pathways in metazoans, and are deeply implicated in all main pathologies, among which cancer. Mir-221 and miR-222, two closely related miRNAs encoded in cluster from a genomic region on chromosome X, are strongly upregulated in several forms of human tumours. In this work, we report that the ectopic modulation of NF-kB modifies miR-221/222 expression in prostate carcinoma and glioblastoma cell lines, where we had previously shown their oncogenic activity. We identify two separate distal regions upstream of miR-221/222 promoter which are bound by the NF-kB subunit p65 and drive efficient transcription in luciferase reporter assays; consistently, the site-directed mutagenesis disrupting p65 binding sites or the ectopical inhibition of NF-kB activity significantly reduce luciferase activity. In the most distal enhancer region, we also define a binding site for c-Jun, and we show that the binding of this factor cooperates with that of p65, fully accounting for the observed upregulation of miR-221/222. Thus our work uncovers an additional mechanism through which NF-kB and c-Jun, two transcription factors deeply involved in cancer onset and progression, contribute to oncogenesis, by inducing miR-221/222 transcription. PMID:21245048

A novel polymorphism in the PAI-1 gene promoter enhances gene expression. A novel pro-thrombotic risk factor?

PubMed

Liguori, Renato; Quaranta, Sandro; Di Fiore, Rosanna; Elce, Ausilia; Castaldo, Giuseppe; Amato, Felice

2014-12-01

Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of tissue-type plasminogen activator in plasma and the most important regulator of the fibrinolytic pathway. The 4G/5G polymorphism (rs1799889) in the PAI-1 promoter is associated with altered PAI-1 transcription. We have identified a new 4G/5G allele, in which a T is inserted near the 4G tract or replaces a G in the 5G tract, forming a T plus 4G (T4G) region. This new variant was first identified in two women, one had experienced juvenile myocardial infarction, the other repeated miscarriage; both had increased PAI-1 plasma activity. In view of the important influence of this promoter region on PAI-1 protein plasma level, we performed in vitro evaluation of the effects of the T4G variant on the transcription activity of the PAI-1 gene promoter. In silico prediction analysis showed that presence of the T4G allele disrupts the E-Box region upstream of the T4G variant, altering the affinity of the target sequence for E-Box binding factors like upstream stimulatory factor-1 (USF-1). Basal T4G promoter activity was 50% higher compared to 4G and 5G variants, but it was less stimulated by USF-1 overexpression. We also analyzed the effects of IL-1β and IL-6 on the PAI-1 promoter activity of our three constructs and showed that the T4G variant was less affected by IL-1β than the other variants. These findings indicate that the T4G variant may be a novel risk factor for thrombotic events. Copyright © 2014 Elsevier Ltd. All rights reserved.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation.

PubMed

Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen

2018-05-05

Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.

Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2003-01-01

Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

The TCP4 transcription factor regulates trichome cell differentiation by directly activating GLABROUS INFLORESCENCE STEMS in Arabidopsis thaliana.

PubMed

Vadde, Batthula Vijaya Lakshmi; Challa, Krishna Reddy; Nath, Utpal

2018-01-01

Trichomes are the first cell type to be differentiated during the morphogenesis of leaf epidermis and serve as an ideal model to study cellular differentiation. Many genes involved in the patterning and differentiation of trichome cells have been studied over the past decades, and the majority of these genes encode transcription factors that specifically regulate epidermal cell development. However, the upstream regulators of these genes that link early leaf morphogenesis with cell type differentiation are less studied. The TCP proteins are the plant-specific transcription factors involved in regulating diverse aspects of plant development including lateral organ morphogenesis by modulating cell proliferation and differentiation. Here, we show that the miR319-regulated class II TCP proteins, notably TCP4, suppress trichome branching in Arabidopsis leaves and inflorescence stem by direct transcriptional activation of GLABROUS INFLORESCENCE STEMS (GIS), a known negative regulator of trichome branching. The trichome branch number is increased in plants with reduced TCP activity and decreased in the gain-of-function lines of TCP4. Biochemical analyses show that TCP4 binds to the upstream regulatory region of GIS and activates its expression. Detailed genetic analyses show that GIS and TCP4 work in same pathway and GIS function is required for TCP4-mediated regulation of trichome differentiation. Taken together, these results identify a role for the class II TCP genes in trichome differentiation, thus providing a connection between organ morphogenesis and cellular differentiation. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

Cadherin-11 regulates protrusive activity in Xenopus cranial neural crest cells upstream of Trio and the small GTPases

PubMed Central

Kashef, Jubin; Köhler, Almut; Kuriyama, Sei; Alfandari, Dominique; Mayor, Roberto; Wedlich, Doris

2009-01-01

Xenopus Cadherin-11 (Xcad-11) is expressed when cranial neural crest cells (CNC) acquire motility. However, its function in stimulating cell migration is poorly understood. Here, we demonstrate that Xcad-11 initiates filopodia and lamellipodia formation, which is essential for CNC to populate pharyngeal pouches. We identified the cytoplasmic tail of Xcad-11 as both necessary and sufficient for proper CNC migration as long as it was linked to the plasma membrane. Our results showing that guanine nucleotide exchange factor (GEF)-Trio binds to Xcad-11 and can functionally substitute for it like constitutively active forms of RhoA, Rac, and cdc42 unravel a novel cadherin function. PMID:19528317

Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

PubMed

Behrens, R; Hayles, J; Nurse, P

2000-12-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

PubMed Central

Behrens, Ralf; Hayles, Jacky; Nurse, Paul

2000-01-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

Ectopic expression of a polyalanine expansion mutant of poly(A)-binding protein N1 in muscle cells in culture inhibits myogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Qishan; Bag, Jnanankur

2006-02-17

Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset dominant genetic disease caused by the expansion of a GCG trinucleotide repeat that encodes the polyalanine tract at the N-terminus of the nuclear poly(A)-binding protein (PABPN1). Presence of intranuclear inclusions (INIs) containing PABPN1 aggregates in the skeletal muscles is the hallmark of OPMD. Here, we show that ectopic expression of the mutant PABPN1 produced INIs in a muscle cell culture model and reduced expression of several muscle-specific proteins including {alpha}-actin, slow troponin C, muscle creatine kinase, and two myogenic transcription factors, myogenin and MyoD. However, the levels of two upstream regulators of themore » MyoD gene, the Myf-5 and Pax3/7, were not affected, but both proteins co-localized with the PABPN1 aggregates in the mutant PABPN1 overexpressing cells. In these cells, although myogenin and MyoD levels were reduced, these two transcription factors did not co-localize with the mutant PABPN1 aggregates. Therefore, sequestration of Myf5 and Pax3/7 by the mutant PABPN1 aggregates was a specific effect on these factors. Our results suggest that trapping of these two important myogenic determinants may interfere with an early step in myogenesis.« less

Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos

PubMed Central

Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.

2012-01-01

The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570

Withaferin A inhibits tumor necrosis factor-alpha-induced expression of cell adhesion molecules by inactivation of Akt and NF-kappaB in human pulmonary epithelial cells.

PubMed

Oh, Jung Hwa; Kwon, Taeg Kyu

2009-05-01

We here investigated the functional effect of withaferin A on airway inflammation and its action mechanism. Withaferin A inhibited the expression of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) in human lung epithelial A549 cells stimulated with tumor necrosis factor-alpha (TNF-alpha), resulting in the suppression of leukocyte adhesion to lung epithelial A549 cells. In addition, withaferin A inhibited TNF-alpha-induced expression of adhesion molecules (ICAM-1 and VCAM-1) protein and mRNA in a dose-dependent manner. Withaferin A prevented DNA binding activity of nuclear factor-kappaB (NF-kappaB) and nuclear translocation of NF-kappaB. It also inhibited phosphorylation of Akt and extracellular signal-regulated kinase (ERK), which are upstream in the regulation of adhesion molecules by TNF-alpha. Furthermore, withaferin A inhibited U937 monocyte adhesion to A549 cells stimulated by TNF-alpha, suggesting that it may inhibit the binding of these cells by regulating the expression of critical adhesion molecules by TNF-alpha. Taken together, these results suggest that withaferin A inhibits cell adhesion through inhibition of ICAM-1 and VCAM-1 expression, at least in part, by blocking Akt and down-regulating NF-kappaB activity.

Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

PubMed Central

Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

2009-01-01

Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

The components of the unique Zur regulon of Cupriavidus metallidurans mediate cytoplasmic zinc handling.

PubMed

Bütof, Lucy; Schmidt-Vogler, Christopher; Herzberg, Martin; Große, Cornelia; Nies, Dietrich H

2017-08-14

Zinc is an essential trace element and at the same time it is toxic at high concentrations. In the beta-proteobacterium Cupriavidus metallidurans the highly efficient removal of surplus zinc from the periplasm is responsible for its outstanding metal resistance. Rather than having a typical Zur-dependent, high-affinity ATP-binding cassette transporter of the ABC protein superfamily for zinc uptake at low concentrations, C. metallidurans instead has the secondary zinc importer ZupT of the ZRT/IRT (ZIP) family. It is important to understand, therefore, how this zinc-resistant bacterium copes when it is exposed to low zinc concentrations. Members of the Zur regulon in C. metallidurans were identified by comparing the transcriptomes of a Δ zur mutant and its parent strain. The consensus sequence of the Zur-binding box was derived for the zupTp promoter-regulatory region using a truncation assay. The motif was used to predict possible Zur-boxes upstream of Zur regulon members. Binding of Zur to these boxes was confirmed. Two Zur-boxes upstream of the cobW 1 gene, encoding a putative zinc chaperone, proved to be required for complete repression of cobW 1 and its downstream genes in cells cultivated in mineral salts medium. A Zur box upstream of each of zur-cobW 2 , cobW 3 and zupT permitted low-expression level of these genes plus their up-regulation under zinc starvation conditions. This demonstrates a compartmentalization of zinc homeostasis in C. metallidurans with the periplasm being responsible for removal of surplus zinc and cytoplasmic components for management of zinc as an essential co-factor, with both compartments connected by ZupT. Importance Elucidating zinc homeostasis is necessary to understand both host-pathogen interactions and performance of free-living bacteria in their natural environment. Escherichia coli acquires zinc under low zinc concentrations by the Zur-controlled ZnuABC importer of the ABC superfamily, and this was also the paradigm for other bacteria. In contrast, the heavy metal-resistant bacterium C. metallidurans achieves high tolerance to zinc due to sophisticated zinc handling and efflux systems operating on periplasmic zinc ions, so that removal of surplus zinc is a periplasmic feature in this bacterium. It is shown here that this process is augmented by management of zinc through cytoplasmic zinc chaperones, whose syntheses are controlled by the Zur regulator. This demonstrates a new mechanism to organize zinc homeostasis through compartmentalization. Copyright © 2017 American Society for Microbiology.

Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae.

PubMed

Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

2016-07-27

In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

EPA Science Inventory

Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

Identification of Natural RORγ Ligands that Regulate the Development of Lymphoid Cells

PubMed Central

Santori, Fabio R.; Huang, Pengxiang; van de Pavert, Serge A.; Douglass, Eugene F.; Leaver, David J.; Haubrich, Brad A.; Keber, Rok; Lorbek, Gregor; Konijn, Tanja; Rosales, Brittany N.; Horvat, Simon; Rozman, Damjana; Rahier, Alain; Mebius, Reina E.; Rastinejad, Fraydoon; Nes, W. David; Littman, Dan R.

2015-01-01

SUMMARY Mice deficient in the nuclear hormone receptor RORγt have defective development of thymocytes, lymphoid organs, Th17 cells and type 3 innate lymphoid cells. RORγt binds to oxysterols derived from cholesterol catabolism but it is not clear whether these are its natural ligands. Here, we show that sterol lipids are necessary and sufficient to drive RORγt-dependent transcription. We combined overexpression, RNA interference and genetic deletion of metabolic enzymes to study RORγ-dependent transcription. Our results are consistent with the RORγt ligand(s) being a cholesterol biosynthetic intermediate (CBI) downstream of lanosterol and upstream of zymosterol. Analysis of lipids bound to RORγ identified molecules with molecular weights consistent with CBIs. Furthermore, CBIs stabilized the RORγ ligand-binding domain and induced co-activator recruitment. Genetic deletion of metabolic enzymes upstream of the RORγt-ligand(s) affected the development of lymph nodes and Th17 cells. Our data suggest that CBIs play a role in lymphocyte development potentially through regulation of RORγt. PMID:25651181

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

PubMed

Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

2017-05-05

The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

PubMed

Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella

2014-01-01

EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

DEAR1, a transcriptional repressor of DREB protein that mediates plant defense and freezing stress responses in Arabidopsis.

PubMed

Tsutsui, Tomokazu; Kato, Wataru; Asada, Yutaka; Sako, Kaori; Sato, Takeo; Sonoda, Yutaka; Kidokoro, Satoshi; Yamaguchi-Shinozaki, Kazuko; Tamaoki, Masanori; Arakawa, Keita; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Shinozaki, Kazuo; Matsui, Minami; Ikeda, Akira; Yamaguchi, Junji

2009-11-01

Plants have evolved intricate mechanisms to respond and adapt to a wide variety of biotic and abiotic stresses in their environment. The Arabidopsis DEAR1 (DREB and EAR motif protein 1; At3g50260) gene encodes a protein containing significant homology to the DREB1/CBF (dehydration-responsive element binding protein 1/C-repeat binding factor) domain and the EAR (ethylene response factor-associated amphiphilic repression) motif. We show here that DEAR1 mRNA accumulates in response to both pathogen infection and cold treatment. Transgenic Arabidopsis overexpressing DEAR1 (DEAR1ox) showed a dwarf phenotype and lesion-like cell death, together with constitutive expression of PR genes and accumulation of salicylic acid. DEAR1ox also showed more limited P. syringae pathogen growth compared to wild-type, consistent with an activated defense phenotype. In addition, transient expression experiments revealed that the DEAR1 protein represses DRE/CRT (dehydration-responsive element/C-repeat)-dependent transcription, which is regulated by low temperature. Furthermore, the induction of DREB1/CBF family genes by cold treatment was suppressed in DEAR1ox, leading to a reduction in freezing tolerance. These results suggest that DEAR1 has an upstream regulatory role in mediating crosstalk between signaling pathways for biotic and abiotic stress responses.

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

The Gene Regulatory Network of Lens Induction Is Wired through Meis-Dependent Shadow Enhancers of Pax6

PubMed Central

Antosova, Barbora; Smolikova, Jana; Klimova, Lucie; Lachova, Jitka; Bendova, Michaela; Kozmikova, Iryna; Machon, Ondrej; Kozmik, Zbynek

2016-01-01

Lens induction is a classical developmental model allowing investigation of cell specification, spatiotemporal control of gene expression, as well as how transcription factors are integrated into highly complex gene regulatory networks (GRNs). Pax6 represents a key node in the gene regulatory network governing mammalian lens induction. Meis1 and Meis2 homeoproteins are considered as essential upstream regulators of Pax6 during lens morphogenesis based on their interaction with the ectoderm enhancer (EE) located upstream of Pax6 transcription start site. Despite this generally accepted regulatory pathway, Meis1-, Meis2- and EE-deficient mice have surprisingly mild eye phenotypes at placodal stage of lens development. Here, we show that simultaneous deletion of Meis1 and Meis2 in presumptive lens ectoderm results in arrested lens development in the pre-placodal stage, and neither lens placode nor lens is formed. We found that in the presumptive lens ectoderm of Meis1/Meis2 deficient embryos Pax6 expression is absent. We demonstrate using chromatin immunoprecipitation (ChIP) that in addition to EE, Meis homeoproteins bind to a remote, ultraconserved SIMO enhancer of Pax6. We further show, using in vivo gene reporter analyses, that the lens-specific activity of SIMO enhancer is dependent on the presence of three Meis binding sites, phylogenetically conserved from man to zebrafish. Genetic ablation of EE and SIMO enhancers demostrates their requirement for lens induction and uncovers an apparent redundancy at early stages of lens development. These findings identify a genetic requirement for Meis1 and Meis2 during the early steps of mammalian eye development. Moreover, they reveal an apparent robustness in the gene regulatory mechanism whereby two independent "shadow enhancers" maintain critical levels of a dosage-sensitive gene, Pax6, during lens induction. PMID:27918583

Dysregulation of the IGF-I/PI3K/AKT/mTOR signaling pathway in autism spectrum disorders.

PubMed

Chen, Jianling; Alberts, Ian; Li, Xiaohong

2014-06-01

The IGF-I/PI3K/AKT/mTOR signaling pathway plays an important role in the regulation of cell growth, proliferation, differentiation, motility, survival, metabolism and protein synthesis. Insulin-like growth factor-I (IGF-I) is synthesized in the liver and fibroblasts, and its biological actions are mediated by the IGF-I receptor (IGF-IR). The binding of IGF-I to IGF-IR leads to the activation of phosphatidylinositol 3-kinase (PI3K). Activated PI3K stimulates the production of phosphatidylinositol (4,5)-bisphosphate [PI(4,5)P2] and phosphatidylinositol (3,4,5)-trisphosphate [PI(3,4,5)P3]. The PH domain of AKT (protein kinase B, PKB) (v-AKT murine thymoma viral oncogene homolog) binds to PI(4,5)P2 and PI(3,4,5)P3, followed by phosphorylation of the Thr308 and Ser473 regulatory sites. Tuberous sclerosis complex 1 (TSC1) and TSC2 are upstream regulators of mammalian target of rapamycin (mTOR) and downstream effectors of the PI3K/AKT signaling pathway. The activation of AKT suppresses the TSC1/TSC2 heterodimer, which is an upstream regulator of mTOR. Dysregulated IGF-I/PI3K/AKT/mTOR signaling has been shown to be associated with autism spectrum disorders (ASDs). In this review, we discuss the emerging evidence for a functional relationship between the IGF-I/PI3K/AKT/mTOR pathway and ASDs, as well as a possible role of this signaling pathway in the diagnosis and treatment of ASDs. Copyright © 2014 ISDN. Published by Elsevier Ltd. All rights reserved.

SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

PubMed

Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

1997-10-31

Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

Concomitant expression of far upstream element (FUSE) binding protein (FBP) interacting repressor (FIR) and its splice variants induce migration and invasion of non-small cell lung cancer (NSCLC) cells.

PubMed

Müller, Benedikt; Bovet, Michael; Yin, Yi; Stichel, Damian; Malz, Mona; González-Vallinas, Margarita; Middleton, Alistair; Ehemann, Volker; Schmitt, Jennifer; Muley, Thomas; Meister, Michael; Herpel, Esther; Singer, Stephan; Warth, Arne; Schirmacher, Peter; Drasdo, Dirk; Matthäus, Franziska; Breuhahn, Kai

2015-11-01

Transcription factors integrate a variety of oncogenic input information, facilitate tumour growth and cell dissemination, and therefore represent promising therapeutic target structures. Because over-expression of DNA-interacting far upstream element binding protein (FBP) supports non-small cell lung cancer (NSCLC) migration, we asked whether its repressor, FBP-interacting repressor (FIR) is functionally inactivated and how FIR might affect NSCLC cell biology. Different FIR splice variants were highly expressed in the majority of NSCLCs, with the highest levels in tumours carrying genomic gains of chromosome 8q24.3, which contained the FIR gene locus. Nuclear FIR expression was significantly enriched at the invasion front of primary NSCLCs, but this did not correlate with tumour cell proliferation. FIR accumulation was associated with worse patient survival and tumour recurrence; in addition, FIR over-expression significantly correlated with lymph node metastasis in squamous cell carcinomas (SCCs). In vitro, we applied newly developed methods and modelling approaches for the quantitative and time-resolved description of the pro-migratory and pro-invasive capacities of SCC cells. siRNA-mediated silencing of all FIR variants significantly reduced the speed and directional movement of tumour cells in all phases of migration. Furthermore, sprouting efficiency and single cell invasiveness were diminished following FIR inhibition. Interestingly, the silencing of FIR isoforms lacking exon 2 (FIR(Δexon2)) alone was sufficient to reduce lateral migration and invasion. In summary, by using scale-spanning data derived from primary human tissues, quantitative cellular analyses and mathematical modelling, we have demonstrated that concomitant over-expression of FIR and its splice variants drives NSCLC migration and dissemination. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Trithorax Group Protein Oryza sativa Trithorax1 Controls Flowering Time in Rice via Interaction with Early heading date31[W][OPEN

PubMed Central

Choi, Sang Chul; Lee, Shinyoung; Kim, Sung-Ryul; Lee, Yang-Seok; Liu, Chunyan; Cao, Xiaofeng; An, Gynheung

2014-01-01

Trithorax group proteins are chromatin-remodeling factors that activate target gene expression by antagonistically functioning against the Polycomb group. In Arabidopsis (Arabidopsis thaliana), Arabidopsis Trithorax protein1 (ATX1) regulates flowering time and floral organ identity. Here, we observed that suppression of Oryza sativa Trithorax1 (OsTrx1), an ortholog of ATX1, delayed flowering time in rice (Oryza sativa). Because the delay occurred only under long-day conditions, we evaluated the flowering signal pathways that specifically function under long-day conditions. Among them, the OsMADS50 and Heading date1 pathways were not affected by the mutation. However, the Grain number, plant height, and heading date7 (Ghd7) pathway was altered in ostrx1. Transcript levels of OsGI, phytochrome genes, and Early heading date3 (Ehd3), which function upstream of Ghd7, were unchanged in the mutant. Because Trx group proteins form a complex with other proteins to modify the chromatin structure of target genes, we investigated whether OsTrx1 interacts with a previously identified protein that functions upstream of Ghd7. We demonstrated that the plant homeodomain motif of OsTrx1 binds to native histone H3 from the calf thymus and that OsTrx1 binds to Ehd3 through the region between the plant homeodomain and SET domains. Finally, we showed that the SET domain at the C-terminal end of OsTrx1 has histone H3 methyltransferase activity when incubated with oligonucleosomes. Our results suggest that OsTrx1 plays an important role in regulating flowering time in rice by modulating chromatin structure. PMID:24420930

Dysregulation of mTOR signaling in fragile X syndrome.

PubMed

Sharma, Ali; Hoeffer, Charles A; Takayasu, Yukihiro; Miyawaki, Takahiro; McBride, Sean M; Klann, Eric; Zukin, R Suzanne

2010-01-13

Fragile X syndrome, the most common form of inherited mental retardation and leading genetic cause of autism, is caused by transcriptional silencing of the Fmr1 gene. The fragile X mental retardation protein (FMRP), the gene product of Fmr1, is an RNA binding protein that negatively regulates translation in neurons. The Fmr1 knock-out mouse, a model of fragile X syndrome, exhibits cognitive deficits and exaggerated metabotropic glutamate receptor (mGluR)-dependent long-term depression at CA1 synapses. However, the molecular mechanisms that link loss of function of FMRP to aberrant synaptic plasticity remain unclear. The mammalian target of rapamycin (mTOR) signaling cascade controls initiation of cap-dependent translation and is under control of mGluRs. Here we show that mTOR phosphorylation and activity are elevated in hippocampus of juvenile Fmr1 knock-out mice by four functional readouts: (1) association of mTOR with regulatory associated protein of mTOR; (2) mTOR kinase activity; (3) phosphorylation of mTOR downstream targets S6 kinase and 4E-binding protein; and (4) formation of eukaryotic initiation factor complex 4F, a critical first step in cap-dependent translation. Consistent with this, mGluR long-term depression at CA1 synapses of FMRP-deficient mice is exaggerated and rapamycin insensitive. We further show that the p110 subunit of the upstream kinase phosphatidylinositol 3-kinase (PI3K) and its upstream activator PI3K enhancer PIKE, predicted targets of FMRP, are upregulated in knock-out mice. Elevated mTOR signaling may provide a functional link between overactivation of group I mGluRs and aberrant synaptic plasticity in the fragile X mouse, mechanisms relevant to impaired cognition in fragile X syndrome.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

PubMed Central

Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

2016-01-01

Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

A Catharanthus roseus BPF-1 homologue interacts with an elicitor-responsive region of the secondary metabolite biosynthetic gene Str and is induced by elicitor via a JA-independent signal transduction pathway.

PubMed

van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J

2000-11-01

Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis

PubMed Central

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L. M.; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT. PMID:28704421

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis.

PubMed

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L M; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana; Parati, Eugenio A; Gorio, Alfredo

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

2006-07-07

In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

A dual switch controls bacterial enhancer-dependent transcription

PubMed Central

Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

2012-01-01

Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

Phosphorylated 4E binding protein 1: a hallmark of cell signaling that correlates with survival in ovarian cancer.

PubMed

Castellvi, Josep; Garcia, Angel; Rojo, Federico; Ruiz-Marcellan, Carmen; Gil, Antonio; Baselga, Jose; Ramon y Cajal, Santiago

2006-10-15

Growth factor receptors and cell signaling factors play a crucial role in human carcinomas and have been studied in ovarian tumors with varying results. Cell signaling involves multiple pathways and a myriad of factors that can be mutated or amplified. Cell signaling is driven through the mammalian target of rapamycin (mTOR) and extracellular regulated kinase (ERK) pathways and by some downstream molecules, such as 4E binding protein 1 (4EBP1), eukaryotic initiation factor 4E, and p70 ribosomal protein S6 kinase (p70S6K). The objectives of this study were to analyze the real role that these pathways play in ovarian cancer, to correlate them with clinicopathologic characteristics, and to identify the factors that transmit individual proliferation signals and are associated with pathologic grade and prognosis, regardless specific oncogenic alterations upstream. One hundred twenty-nine ovarian epithelial tumors were studied, including 20 serous cystadenomas, 7 mucinous cystadenomas, 11 serous borderline tumors, 16 mucinous borderline tumors, 29 serous carcinomas, 16 endometrioid carcinomas, 15 clear cell carcinomas, and 15 mucinous carcinomas. Tissue microarrays were constructed, and immunohistochemistry for the receptors epidermal growth factor receptor (EGFR) and c-erb-B2 was performed and with phosphorylated antibodies for protein kinase B (AKT), 4EBP1, p70S6K, S6, and ERK. Among 129 ovarian neoplasms, 17.8% were positive for c-erb-B2, 9.3% were positive for EGFR, 47.3% were positive for phosphorylated AKT (p-AKT), 58.9% were positive for p-ERK, 41.1% were positive for p-4EBP1, 26.4% were positive for p70S6K, and 15.5% were positive for p-S6. Although EGFR, p-AKT, and p-ERK expression did not differ between benign, borderline, or malignant tumors, c-erb-B2, p-4EBP1, p-p70S6K, and p-S6 were expressed significantly more often in malignant tumors. Only p-4EBP1 expression demonstrated prognostic significance (P = .005), and only surgical stage and p-4EBP1 expression had statistical significance in the multivariate analysis. In patients with ovarian carcinoma, significant expression of p-4EBP1 was associated with high-grade tumors and a poor prognosis, regardless other oncogenic alterations upstream. This finding supports the study of this factor as a hallmark or pivotal factor in cell signaling in ovarian carcinoma that may crucial in the transmission of the proliferation cell signal and may reflect the real oncogenic role of this pathway in ovarian tumors. 2006 American Cancer Society

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

PubMed

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

PubMed Central

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

Identification, cloning and characterization of the tomato TCP transcription factor family.

PubMed

Parapunova, Violeta; Busscher, Marco; Busscher-Lange, Jacqueline; Lammers, Michiel; Karlova, Rumyana; Bovy, Arnaud G; Angenent, Gerco C; de Maagd, Ruud A

2014-06-06

TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development.

Identification, cloning and characterization of the tomato TCP transcription factor family

PubMed Central

2014-01-01

Background TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. Results We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. Conclusions The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development. PMID:24903607

Role of extracytoplasmic function sigma factor PG1660 (RpoE) in the oxidative stress resistance regulatory network of Porphyromonas gingivalis

PubMed Central

Dou, Y.; Rutanhira, H.; Chen, X.; Mishra, A.; Wang, C.; Fletcher, H.M.

2018-01-01

Summary In Porphyromonas gingivalis, the protein PG1660, composed of 174 amino acids, is annotated as an extracytoplasmic function (ECF) sigma factor (RpoE homologue-σ24). Because PG1660 can modulate several virulence factors and responds to environmental signals in P. gingivalis, its genetic properties were evaluated. PG1660 is co-transcribed with its downstream gene PG1659, and the transcription start site was identified as adenine residue 54-nucleotides upstream of the ATG translation start codon. In addition to binding its own promoter, using the purified rPG1660 and RNAP core enzyme from Escherichia coli with the PG1660 promoter DNA as template, the function of PG1660 as a sigma factor was demonstrated in an in vitro transcription assay. Transcriptome analyses of a P. gingivalis PG1660-defective isogenic mutant revealed that under oxidative stress conditions 176 genes including genes involved in secondary metabolism were downregulated more than two-fold compared with the parental strain. The rPG1660 protein also showed the ability to bind to the promoters of the highly downregulated genes in the PG1660-deficient mutant. As the ECF sigma factor PG0162 has a 29% identity with PG1660 and can modulate its expression, the cross-talk between their regulatory networks was explored. The expression profile of the PG0162PG1660-deficient mutant (P. gingivalis FLL356) revealed that the type IX secretion system genes and several virulence genes were downregulated under hydrogen peroxide stress conditions. Taken together, we have confirmed that PG1660 can function as a sigma factor, and plays an important regulatory role in the oxidative stress and virulence regulatory network of P. gingivalis. PMID:29059500

Characterization of the Truncated Androgen Receptor Generated by Calpain-Dependent Proteolysis in Prostate Cancer

DTIC Science & Technology

2009-08-31

hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol Cell, 2007. 27(3): p. 380 -92. 26. Takayama, K...TSS_upstream * 69570641 69571326 0.02 UGT2B15 -5 TSS_upstream 71417985 71418195 0.05 UNQ689 -796 TSS_upstream 29 83631386 83632082 0.02 MASA 60948

Transcription factor AP-2γ induces early Cdx2 expression and represses HIPPO signaling to specify the trophectoderm lineage

PubMed Central

Cao, Zubing; Carey, Timothy S.; Ganguly, Avishek; Wilson, Catherine A.; Paul, Soumen; Knott, Jason G.

2015-01-01

Cell fate decisions are fundamental to the development of multicellular organisms. In mammals the first cell fate decision involves segregation of the pluripotent inner cell mass and the trophectoderm, a process regulated by cell polarity proteins, HIPPO signaling and lineage-specific transcription factors such as CDX2. However, the regulatory mechanisms that operate upstream to specify the trophectoderm lineage have not been established. Here we report that transcription factor AP-2γ (TFAP2C) functions as a novel upstream regulator of Cdx2 expression and position-dependent HIPPO signaling in mice. Loss- and gain-of-function studies and promoter analysis revealed that TFAP2C binding to an intronic enhancer is required for activation of Cdx2 expression during early development. During the 8-cell to morula transition TFAP2C potentiates cell polarity to suppress HIPPO signaling in the outside blastomeres. TFAP2C depletion triggered downregulation of PARD6B, loss of apical cell polarity, disorganization of F-actin, and activation of HIPPO signaling in the outside blastomeres. Rescue experiments using Pard6b mRNA restored cell polarity but only partially corrected position-dependent HIPPO signaling, suggesting that TFAP2C negatively regulates HIPPO signaling via multiple pathways. Several genes involved in regulation of the actin cytoskeleton (including Rock1, Rock2) were downregulated in TFAP2C-depleted embryos. Inhibition of ROCK1 and ROCK2 activity during the 8-cell to morula transition phenocopied TFAP2C knockdown, triggering a loss of position-dependent HIPPO signaling and decrease in Cdx2 expression. Altogether, these results demonstrate that TFAP2C facilitates trophectoderm lineage specification by functioning as a key regulator of Cdx2 transcription, cell polarity and position-dependent HIPPO signaling. PMID:25858457

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Secretomes reveal several novel proteins as well as TGF-β1 as the top upstream regulator of metastatic process in breast cancer.

PubMed

Erin, Nuray; Ogan, Nur; Yerlikaya, Azmi

2018-03-20

Metastatic breast cancer is resistant to many conventional treatments and novel therapeutic targets are needed. We previously isolated subsets of 4T1 murine breast cancer cells which metastasized to liver (4TLM), brain (4TBM), and heart (4THM). Among these cells, 4TLM is the most aggressive one, demonstrating mesenchymal phenotype. Here we compared secreted proteins from 4TLM, 4TBM, and 4THM cells and compared with that of hardly metastatic 67NR cells to detect differentially secreted factors involved in organ-specific metastasis. Label-free LC-MS/MS proteomic technique was used to detect the differentially secreted proteins. Eighty-five of over 500 secreted proteins were significantly altered in metastatic breast cancer cells. Differential expression of several proteins such as fibulin-4, Bone Morphogenetic Protein 1, TGF-β1 MMP-3, MMP-9, and Thymic Stromal Lymphopoietin were further verified using ELISA or Western blotting. Many of these identified proteins were also present in human metastatic breast carcinomas. Annexin A1 and A5, laminin beta 1, Neutral alpha-glucosidase AB were commonly found at least in three out of six studies examined here. Ingenuity Pathway Analysis showed that proteins differentially secreted from metastatic cells are involved primarily in carcinogenesis and TGF-β1 is the top upstream regulator in all metastatic cells. Cells metastasized to different organs displayed significant differences in several of secreted proteins. Proteins differentially altered were fibronectin, insulin-like growth factor-binding protein 7, and Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1. On the other hand, many exosomal proteins were also common to all metastatic cells, demonstrating involvement of key universal factors in distant metastatic process.

Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

NASA Astrophysics Data System (ADS)

Baghaee Ravari, Soodeh

G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

Universal light-switchable gene promoter system

DOEpatents

Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

2005-02-22

An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

Regulation of the plasma cell transcription factor Blimp-1 gene by Bach2 and Bcl6.

PubMed

Ochiai, Kyoko; Muto, Akihiko; Tanaka, Hiromu; Takahashi, Shinichiro; Igarashi, Kazuhiko

2008-03-01

B lymphocyte-induced maturation protein 1 (Blimp-1) is a key regulator for plasma cell differentiation. Prior to the terminal differentiation into plasma cells, Blimp-1 expression is suppressed in B cells by transcription repressors BTB and CNC homology 2 (Bach2) and B cell lymphoma 6 (Bcl6). Bach2 binds to the Maf recognition element (MARE) of the promoter upstream region of the Blimp-1 gene (Prdm1) by forming a heterodimer with MafK. Bach2 and Bcl6 were found to interact with each other in B cells. While both Bach2 and Bcl6 possess the BTB domain which mediates protein-protein interactions, they interacted in a BTB-independent manner. Bcl6 is known to repress Prdm1 through a Bcl6 recognition element 1 in the intron 5, in which a putative, evolutionarily conserved MARE was identified. Both repressed the expression of a reporter gene containing the intron 5 region depending on the presence of the respective binding sites in 18-81 pre-B cells. Co-expression of Bach2 and Bcl6 resulted in further repression of the reporter plasmid. Chromatin immunoprecipitation assays showed MafK to bind to the intron MARE in various B cell lines, thus suggesting that it binds as a heterodimer with Bach2. Therefore, the interaction between Bach2 and Bcl6 might be crucial for the proper repression of Prdm1 in B cells.

Phosphorylation-dependent down-regulation of apolipoprotein A5 by insulin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nowak, Maxine; Helleboid-Chapman, Audrey; Jakel, Heidelinde

2004-02-15

The apolipoprotein A5 (APOA5) gene has been shown to be important in lowering plasma triglyceride levels. Since several studies have shown that hyperinsulinemia is associated with hypertriglyceridemia, we sought to determine whether APOA5 gene is regulated by insulin. We show here that cell and mouse treatments with insulin down-regulated APOA5 expression in a dose-dependent manner. Furthermore, we determined that insulin decreases APOA5 promoter activity and subsequent deletion analyses revealed an E-box-containing fragment. We showed that Upstream Stimulatory Factors, USF1/USF2, bind to the identified E-box in the APOA5 promoter. Moreover, in cotransfection studies, USF1 stimulates APOA5 promoter activity. The treatment withmore » insulin reduces the binding of USF1/USF2 to APOA5 promoter. The inhibition of PI3K pathway with wortmannin abolished the insulin s effect on APOA5 gene transcription. Using oligoprecipitation method of USF from nuclear extracts, we demonstrated that phosphorylated USF1 failed to bind to APOA5 promoter. This indicates that the APOA5 gene transrepression by insulin involves a phosphorylation of USF through PI3K, that modulate their binding to APOA5 promoter and results in APOA5 down-regulation. The effect of exogenous hyperinsulinemia in healthy men shows a decrease of the plasma ApoAV level. These data suggest a potential mechanism involving APOA5 gene in hypertriglyceridemia associated with hyperinsulinemia.« less

The Transcription Factor AlsR Binds and Regulates the Promoter of the alsSD Operon Responsible for Acetoin Formation in Bacillus subtilis

PubMed Central

Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter

2012-01-01

Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965

[Detection of Physiological Activity of Pharmaceuticals in Wastewater and River Water].

PubMed

Ihara, Masaru; Zhang, Han; Hanamoto, Seiya; Tanaka, Hiroaki

2018-01-01

　Pharmaceuticals are widely found in aquatic environments worldwide. Concern about their potential risks to aquatic species has been raised because they are designed to be biologically active. To address this concern, we must know whether biological activity of pharmaceuticals can be detected in waters. Nearly half of all marketed pharmaceuticals act by binding to the G protein-coupled receptor (GPCR). In this study, we measured the physiological activity of GPCR-acting pharmaceuticals in effluent from a wastewater treatment plant (WWTP) and upstream and downstream of its outfall in Japan during 2 years. We used the in vitro transforming growth factor-α (TGFα) shedding assay, which accurately and sensitively detects GPCR activation, to investigate the antagonistic activities of water extracts against receptors for dopamine (D2) and histamine (H1). Activities detected in waters were quantified as antagonist equivalent quantities (EQs). In WWTP effluent extracts, antagonistic activity was detected at several hundred ng/L of sulpiride-EQ (D2) and several μg/L of diphenhydramine (DIP)-EQ (H1). In downstream river water extracts, antagonistic activity against H1 was around several hundred ng/L of DIP-EQ, higher than that upstream owing to the WWTP effluent. This review discusses the research needed to resolve the concern about potential risks of pharmaceuticals in waters to aquatic species.

Regulation of the human ascorbate transporter SVCT2 exon 1b gene by zinc-finger transcription factors

PubMed Central

Qiao, Huan; May, James M.

2011-01-01

The sodium-dependent vitamin C transporter (SVCT) 2 is crucial for ascorbate uptake in metabolically active and specialized tissues. The present study focused on the gene regulation of the SVCT2 exon 1b, which is ubiquitously expressed in human and mouse tissues. Although the human SVCT2 exon 1b promoter doesn’t contain a classical TATA-box, we found that it does contain a functional initiator (Inr) that binds YY1 and interacts with upstream Sp1/Sp3 elements in the proximal promoter region. These elements in turn play a critical role in regulating YY1-mediated transcription of the exon 1b gene. Formation of YY1/Sp complexes on the promoter is required for its optional function. YY1 with Sp1 or Sp3 synergistically enhanced exon 1b promoter activity as well as the endogenous SVCT2 protein expression. Further, in addition to Sp1/Sp3 both EGR-1 and -2 were detected in the protein complexes that bound the three GC boxes bearing overlapping binding sites for EGR/WT1 and Sp1/3. The EGR family factors, WT1 and MAZ were found to differentially regulate exon 1b promoter activity. These results show that differential occupancy of transcription factors on the GC-rich consensus sequences in SVCT2 exon 1b promoter contributes to the regulation of cell and tissue expression of SVCT2. PMID:21335086

Diadenosine Tetraphosphate Hydrolase Is Part of the Transcriptional Regulation Network in Immunologically Activated Mast Cells▿

PubMed Central

Carmi-Levy, Irit; Yannay-Cohen, Nurit; Kay, Gillian; Razin, Ehud; Nechushtan, Hovav

2008-01-01

We previously discovered that microphthalmia transcription factor (MITF) and upstream stimulatory factor 2 (USF2) each forms a complex with its inhibitor histidine triad nucleotide-binding 1 (Hint-1) and with lysyl-tRNA synthetase (LysRS). Moreover, we showed that the dinucleotide diadenosine tetraphosphate (Ap4A), previously shown to be synthesized by LysRS, binds to Hint-1, and as a result the transcription factors are released from their suppression. Thus, transcriptional activity is regulated by Ap4A, suggesting that Ap4A is a second messenger in this context. For Ap4A to be unambiguously established as a second messenger, several criteria have to be fulfilled, including the presence of a metabolizing enzyme. Since several enzymes are able to hydrolize Ap4A, we provided here evidence that the “Nudix” type 2 gene product, Ap4A hydrolase, is responsible for Ap4A degradation following the immunological activation of mast cells. The knockdown of Ap4A hydrolase modulated Ap4A accumulation, resulting in changes in the expression of MITF and USF2 target genes. Moreover, our observations demonstrated that the involvement of Ap4A hydrolase in gene regulation is not a phenomenon exclusive to mast cells but can also be found in cardiac cells activated with the β-agonist isoproterenol. Thus, we have provided concrete evidence establishing Ap4A as a second messenger in the regulation of gene expression. PMID:18644867

Diadenosine tetraphosphate hydrolase is part of the transcriptional regulation network in immunologically activated mast cells.

PubMed

Carmi-Levy, Irit; Yannay-Cohen, Nurit; Kay, Gillian; Razin, Ehud; Nechushtan, Hovav

2008-09-01

We previously discovered that microphthalmia transcription factor (MITF) and upstream stimulatory factor 2 (USF2) each forms a complex with its inhibitor histidine triad nucleotide-binding 1 (Hint-1) and with lysyl-tRNA synthetase (LysRS). Moreover, we showed that the dinucleotide diadenosine tetraphosphate (Ap(4)A), previously shown to be synthesized by LysRS, binds to Hint-1, and as a result the transcription factors are released from their suppression. Thus, transcriptional activity is regulated by Ap(4)A, suggesting that Ap(4)A is a second messenger in this context. For Ap(4)A to be unambiguously established as a second messenger, several criteria have to be fulfilled, including the presence of a metabolizing enzyme. Since several enzymes are able to hydrolyze Ap(4)A, we provided here evidence that the "Nudix" type 2 gene product, Ap(4)A hydrolase, is responsible for Ap(4)A degradation following the immunological activation of mast cells. The knockdown of Ap(4)A hydrolase modulated Ap(4)A accumulation, resulting in changes in the expression of MITF and USF2 target genes. Moreover, our observations demonstrated that the involvement of Ap(4)A hydrolase in gene regulation is not a phenomenon exclusive to mast cells but can also be found in cardiac cells activated with the beta-agonist isoproterenol. Thus, we have provided concrete evidence establishing Ap(4)A as a second messenger in the regulation of gene expression.

Soybean (Glycine max) WRINKLED1 transcription factor, GmWRI1a, positively regulates seed oil accumulation.

PubMed

Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming

2018-04-01

Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Fisetin inhibits TNF-α/NF-κB-induced IL-8 expression by targeting PKCδ in human airway epithelial cells.

PubMed

Lee, Seoghyun; Ro, Hyunju; In, Hyun Ju; Choi, Ji-Hee; Kim, Mun-Ock; Lee, Jinhyuk; Hong, Sung-Tae; Lee, Su Ui

2018-08-01

Fisetin (3,7,3',4'-tetrahydroxyflavone), a natural flavonoid, is a therapeutic agent for respiratory inflammatory diseases such as chronic obstructive pulmonary disease (COPD). However, detailed molecular mechanisms regarding the target protein of fisetin remain unknown. Fisetin significantly reduces tumour necrosis factor alpha (TNF-α)-induced interleukin (IL)-8 levels by inhibiting both nuclear factor kappa B (NF-κB) transcriptional activity and the phosphorylation of its upstream effectors. We show that fisetin prevents interactions between protein kinase C (PKC)δ and TNF receptor-associated factor 2 (TRAF2), thereby inhibiting the inhibitor of kappa B kinase (IKK)/NF-κB downstream signalling cascade. Furthermore, we found that fisetin directly binds to PKCδ in vitro. Our findings provide evidence that fisetin inhibits the TNF-α-activated IKK/NF-κB cascade by targeting PKCδ, thereby mediating inflammatory diseases such as COPD. These data suggest that fisetin is a good therapeutic drug for the treatment of inflammatory lung diseases, such as COPD, by inhibiting the TNF-α/NF-κB signalling pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Endometrial Expression of Steroidogenic Factor 1 Promotes Cystic Glandular Morphogenesis

PubMed Central

Vasquez, Yasmin M.; Wu, San-Pin; Anderson, Matthew L.; Hawkins, Shannon M.; Creighton, Chad J.; Ray, Madhumita; Tsai, Sophia Y.; Tsai, Ming-Jer; Lydon, John P.

2016-01-01

Epigenetic silencing of steroidogenic factor 1 (SF1) is lost in endometriosis, potentially contributing to de novo local steroidogenesis favoring inflammation and growth of ectopic endometrial tissue. In this study, we examine the impact of SF1 expression in the eutopic uterus by a novel mouse model that conditionally expresses SF1 in endometrium. In vivo SF1 expression promoted the development of enlarged endometrial glands and attenuated estrogen and progesterone responsiveness. Endometriosis induction by autotransplantation of uterine tissue to the mesenteric membrane resulted in the increase in size of ectopic lesions from SF1-expressing mice. By integrating the SF1-dependent transcriptome with the whole genome binding profile of SF1, we identified uterine-specific SF1-regulated genes involved in Wingless and Progesterone receptor-Hedgehog-Chicken ovalbumin upstream promoter transcription factor II signaling for gland development and epithelium-stroma interaction, respectively. The present results indicate that SF1 directly contributes to the abnormal uterine gland morphogenesis, an inhibition of steroid hormone signaling and activation of an immune response, in addition to previously postulated estrogen production. PMID:27018534

BCL11B enhances TCR/CD28-triggered NF-kappaB activation through up-regulation of Cot kinase gene expression in T-lymphocytes.

PubMed

Cismasiu, Valeriu B; Duque, Javier; Paskaleva, Elena; Califano, Danielle; Ghanta, Sailaja; Young, Howard A; Avram, Dorina

2009-01-15

BCL11B is a transcriptional regulator with an important role in T-cell development and leukaemogenesis. We demonstrated recently that BCL11B controls expression from the IL (interleukin)-2 promoter through direct binding to the US1 (upstream site 1). In the present study, we provide evidence that BCL11B also participates in the activation of IL-2 gene expression by enhancing NF-kappaB (nuclear factor kappaB) activity in the context of TCR (T-cell receptor)/CD28-triggered T-cell activation. Enhanced NF-kappaB activation is not a consequence of BCL11B binding to the NF-kappaB response elements or association with the NF-kappaB-DNA complexes, but rather the result of higher translocation of NF-kappaB to the nucleus caused by enhanced degradation of IkappaB (inhibitor of NF-kappaB). The enhanced IkappaB degradation in cells with increased levels of BCL11B was specific for T-cells activated through the TCR, but not for cells activated through TNFalpha (tumour necrosis factor alpha) or UV light, and was caused by increased activity of IkappaB kinase, as indicated by its increase in phosphorylation. As BCL11B is a transcription factor, we investigated whether the expression of genes upstream of IkappaB kinase in the TCR/CD28 signalling pathway was affected by increased BCL11B expression, and found that Cot (cancer Osaka thyroid oncogene) kinase mRNA levels were elevated. Cot kinase is known to promote enhanced IkappaB kinase activity, which results in the phosphorylation and degradation of IkappaB and activation of NF-kappaB. The implied involvement of Cot kinase in BCL11B-mediated NF-kappaB activation in response to TCR activation is supported by the fact that a Cot kinase dominant-negative mutant or Cot kinase siRNA (small interfering RNA) knockdown blocked BCL11B-mediated NF-kappaB activation. In support of our observations, in the present study we report that BCL11B enhances the expression of several other NF-kappaB target genes, in addition to IL-2. In addition, we provide evidence that BCL11B associates with intron 2 of the Cot kinase gene to regulate its expression.

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

A Protein Scaffold Coordinates SRC-Mediated JNK Activation in Response to Metabolic Stress.

PubMed

Kant, Shashi; Standen, Claire L; Morel, Caroline; Jung, Dae Young; Kim, Jason K; Swat, Wojciech; Flavell, Richard A; Davis, Roger J

2017-09-19

Obesity is a major risk factor for the development of metabolic syndrome and type 2 diabetes. How obesity contributes to metabolic syndrome is unclear. Free fatty acid (FFA) activation of a non-receptor tyrosine kinase (SRC)-dependent cJun NH 2 -terminal kinase (JNK) signaling pathway is implicated in this process. However, the mechanism that mediates SRC-dependent JNK activation is unclear. Here, we identify a role for the scaffold protein JIP1 in SRC-dependent JNK activation. SRC phosphorylation of JIP1 creates phosphotyrosine interaction motifs that bind the SH2 domains of SRC and the guanine nucleotide exchange factor VAV. These interactions are required for SRC-induced activation of VAV and the subsequent engagement of a JIP1-tethered JNK signaling module. The JIP1 scaffold protein, therefore, plays a dual role in FFA signaling by coordinating upstream SRC functions together with downstream effector signaling by the JNK pathway. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Modeling of the structure and interactions of the B. anthracis antitoxin, MoxX: deletion mutant studies highlight its modular structure and repressor function

NASA Astrophysics Data System (ADS)

Chopra, Nikita; Agarwal, Shivangi; Verma, Shashikala; Bhatnagar, Sonika; Bhatnagar, Rakesh

2011-03-01

Our previous report on Bacillus anthracis toxin-antitoxin module (MoxXT) identified it to be a two component system wherein, PemK-like toxin (MoxT) functions as a ribonuclease (Agarwal S et al. JBC 285:7254-7270, 2010). The labile antitoxin (MoxX) can bind to/neutralize the action of the toxin and is also a DNA-binding protein mediating autoregulation. In this study, molecular modeling of MoxX in its biologically active dimeric form was done. It was found that it contains a conserved Ribbon-Helix-Helix (RHH) motif, consistent with its DNA-binding function. The modeled MoxX monomers dimerize to form a two-stranded antiparallel ribbon, while the C-terminal region adopts an extended conformation. Knowledge guided protein-protein docking, molecular dynamics simulation, and energy minimization was performed to obtain the structure of the MoxXT complex, which was exploited for the de novo design of a peptide capable of binding to MoxT. It was found that the designed peptide caused a decrease in MoxX binding to MoxT by 42% at a concentration of 2 μM in vitro. We also show that MoxX mediates negative transcriptional autoregulation by binding to its own upstream DNA. The interacting regions of both MoxX and DNA were identified in order to model their complex. The repressor activity of MoxX was found to be mediated by the 16 N-terminal residues that contains the ribbon of the RHH motif. Based on homology with other RHH proteins and deletion mutant studies, we propose a model of the MoxX-DNA interaction, with the antiparallel β-sheet of the MoxX dimer inserted into the major groove of its cognate DNA. The structure of the complex of MoxX with MoxT and its own upstream regulatory region will facilitate design of molecules that can disrupt these interactions, a strategy for development of novel antibacterials.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

PubMed

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

PubMed

Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

2010-12-01

The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

PubMed Central

Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

2000-01-01

Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

Heat Shock Response of Archaeoglobus fulgidus†

PubMed Central

Rohlin, Lars; Trent, Jonathan D.; Salmon, Kirsty; Kim, Unmi; Gunsalus, Robert P.; Liao, James C.

2005-01-01

The heat shock response of the hyperthermophilic archaeon Archaeoglobus fulgidus strain VC-16 was studied using whole-genome microarrays. On the basis of the resulting expression profiles, approximately 350 of the 2,410 open reading frames (ORFs) (ca. 14%) exhibited increased or decreased transcript abundance. These span a range of cell functions, including energy production, amino acid metabolism, and signal transduction, where the majority are uncharacterized. One ORF called AF1298 was identified that contains a putative helix-turn-helix DNA binding motif. The gene product, HSR1, was expressed and purified from Escherichia coli and was used to characterize specific DNA recognition regions upstream of two A. fulgidus genes, AF1298 and AF1971. The results indicate that AF1298 is autoregulated and is part of an operon with two downstream genes that encode a small heat shock protein, Hsp20, and cdc48, an AAA+ ATPase. The DNase I footprints using HSR1 suggest the presence of a cis-binding motif upstream of AF1298 consisting of CTAAC-N5-GTTAG. Since AF1298 is negatively regulated in response to heat shock and encodes a protein only distantly related to the N-terminal DNA binding domain of Phr of Pyrococcus furiosus, these results suggest that HSR1 and Phr may belong to an evolutionarily diverse protein family involved in heat shock regulation in hyperthermophilic and mesophilic Archaea organisms. PMID:16109946

Polypyrimidine Tract Binding Protein Homologs from Arabidopsis Are Key Regulators of Alternative Splicing with Implications in Fundamental Developmental Processes[W

PubMed Central

Rühl, Christina; Stauffer, Eva; Kahles, André; Wagner, Gabriele; Drechsel, Gabriele; Rätsch, Gunnar; Wachter, Andreas

2012-01-01

Alternative splicing (AS) generates transcript variants by variable exon/intron definition and massively expands transcriptome diversity. Changes in AS patterns have been found to be linked to manifold biological processes, yet fundamental aspects, such as the regulation of AS and its functional implications, largely remain to be addressed. In this work, widespread AS regulation by Arabidopsis thaliana Polypyrimidine tract binding protein homologs (PTBs) was revealed. In total, 452 AS events derived from 307 distinct genes were found to be responsive to the levels of the splicing factors PTB1 and PTB2, which predominantly triggered splicing of regulated introns, inclusion of cassette exons, and usage of upstream 5′ splice sites. By contrast, no major AS regulatory function of the distantly related PTB3 was found. Dependent on their position within the mRNA, PTB-regulated events can both modify the untranslated regions and give rise to alternative protein products. We find that PTB-mediated AS events are connected to diverse biological processes, and the functional implications of selected instances were further elucidated. Specifically, PTB misexpression changes AS of PHYTOCHROME INTERACTING FACTOR6, coinciding with altered rates of abscisic acid–dependent seed germination. Furthermore, AS patterns as well as the expression of key flowering regulators were massively changed in a PTB1/2 level-dependent manner. PMID:23192226

Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

DOE PAGES

Zhao, Baoyu; Shu, Chang; Gao, Xinsheng; ...

2016-06-02

Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Baoyu; Shu, Chang; Gao, Xinsheng

Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less

Theory on the mechanism of distal action of transcription factors: looping of DNA versus tracking along DNA

NASA Astrophysics Data System (ADS)

Murugan, R.

2010-10-01

In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L < 2πR. The time required for the distal action will be minimum when L = 2πR where the typical value of R for the binding of histones will be R ~ 16 bps and L ~ 102 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using the position weight matrices available with the JASPAR database indicates the presence of cis-acting elements with maximum probability at a distance of ~102 bps from the promoters which substantiates our theoretical predictions.

A genetic screen for terminator function in yeast identifies a role for a new functional domain in termination factor Nab3.

PubMed

Loya, Travis J; O'Rourke, Thomas W; Reines, Daniel

2012-08-01

The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 'tail' forms an α-helical multimerization domain that helps assemble it onto an RNA substrate.

Cloning, expression and purification of a glycosylated form of the DNA-binding protein Dps from Salmonella enterica Typhimurium.

PubMed

Hanna, Ebert Seixas; Roque-Barreira, Maria-Cristina; Mendes, Guilherme Martines Teixeira; Soares, Sandro Gomes; Brocchi, Marcelo

2008-06-01

Dps, found in many eubacterial and archaebacterial species, appears to protect cells from oxidative stress and/or nutrient-limited environment. Dps has been shown to accumulate during the stationary phase, to bind to DNA non-specifically, and to form a crystalline structure that compacts and protects the chromosome. Our previous results have indicated that Dps is glycosylated at least for a certain period of the bacterial cell physiology and this glycosylation is thought to be orchestrated by some factors not yet understood, explaining our difficulties in standardizing the Dps purification process. In the present work, the open reading frame of the dps gene, together with all the upstream regulatory elements, were cloned into a PCR cloning vector. As a result, the expression of dps was also controlled by the plasmid system introduced in the bacterial cell. The gene was then over-expressed regardless of the growth phase of the culture and a glycosylated fraction was purified to homogeneity by lectin-immobilized chromatography assay. Unlike the high level expression of Dps in Salmonella cells, less than 1% of the recombinant protein was purified by affinity chromatography using jacalin column. Sequencing and mass spectrometry data confirmed the identity of the dps gene and the protein, respectively. In spite of the low level of purification of the jacalin-binding Dps, this work shall aid further investigations into the mechanism of Dps glycosylation.

Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR.

PubMed

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter

2011-05-01

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.

E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

PubMed

Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

2008-08-01

Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Developmental Control of NRAMP1 (SLC11A1) Expression in Professional Phagocytes.

PubMed

Cellier, Mathieu F M

2017-05-03

NRAMP1 (SLC11A1) is a professional phagocyte membrane importer of divalent metals that contributes to iron recycling at homeostasis and to nutritional immunity against infection. Analyses of data generated by several consortia and additional studies were integrated to hypothesize mechanisms restricting NRAMP1 expression to mature phagocytes. Results from various epigenetic and transcriptomic approaches were collected for mesodermal and hematopoietic cell types and compiled for combined analysis with results of genetic studies associating single nucleotide polymorphisms (SNPs) with variations in NRAMP1 expression (eQTLs). Analyses establish that NRAMP1 is part of an autonomous topologically associated domain delimited by ubiquitous CCCTC-binding factor (CTCF) sites. NRAMP1 locus contains five regulatory regions: a predicted super-enhancer (S-E) key to phagocyte-specific expression; the proximal promoter; two intronic areas, including 3' inhibitory elements that restrict expression during development; and a block of upstream sites possibly extending the S-E domain. Also the downstream region adjacent to the 3' CTCF locus boundary may regulate expression during hematopoiesis. Mobilization of the locus 14 predicted transcriptional regulatory elements occurs in three steps, beginning with hematopoiesis; at the onset of myelopoiesis and through myelo-monocytic differentiation. Basal expression level in mature phagocytes is further influenced by genetic variation, tissue environment, and in response to infections that induce various epigenetic memories depending on microorganism nature. Constitutively associated transcription factors (TFs) include CCAAT enhancer binding protein beta (C/EBPb), purine rich DNA binding protein (PU.1), early growth response 2 (EGR2) and signal transducer and activator of transcription 1 (STAT1) while hypoxia-inducible factors (HIFs) and interferon regulatory factor 1 (IRF1) may stimulate iron acquisition in pro-inflammatory conditions. Mouse orthologous locus is generally conserved; chromatin patterns typify a de novo myelo-monocytic gene whose expression is tightly controlled by TFs Pu.1, C/ebps and Irf8; Irf3 and nuclear factor NF-kappa-B p 65 subunit (RelA) regulate expression in inflammatory conditions. Functional differences in the determinants identified at these orthologous loci imply that species-specific mechanisms control gene expression.

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

TW-01, a piperazinedione-derived compound, inhibits Ras-mediated cell proliferation and angioplasty-induced vascular restenosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Chao-Feng

Purpose: Vascular smooth muscle cell (VSMC) proliferation plays a critical role in the pathogenesis of atherosclerosis and restenosis. This study investigated piperazinedione derived compound TW-01-mediated inhibitory effects on VSMC proliferation and intimal hyperplasia. Methods: Cell proliferation was determined using [{sup 3}H]-thymidine incorporation and MTT assay; cell cycle distribution was measured using flow cytometry; proteins and mRNA expression were determined using western blotting and RT-PCR analyses; DNA binding activity of nuclear factor-κB (NF-κB), as measured using enzyme-linked immunosorbent assays (ELISA); in vivo effects of TW-01 were determined using balloon angioplasty in the rat. Results: TW-01 significantly inhibited cell proliferation. At themore » concentrations used, no cytotoxic effects were observed. Three predominant signaling pathways were inhibited by TW-01: (a) extracellular signal-regulated kinase (ERK)1/2 mitogen-activated protein kinase (MAPK) activation and its downstream effectors of c-fos, c-jun, and c-myc; (b) DNA binding activity of nuclear factor-κB (NF-κB); and, (c) Akt/protein kinase B (PKB) and cell cycle progression. Furthermore, TW-01 also inhibited Ras activation, a shared upstream event of each of these signaling cascades. In vascular injury studies, oral administration of TW-01 significantly suppressed intimal hyperplasia induced by balloon angioplasty. Conclusion: The present study suggests that TW-01 might be a potential candidate for atherosclerosis treatment. - Highlights: • TW-01significantly inhibits vascular smooth muscle cell proliferation. • TW-01 inhibits ERK, Akt and Ras pathway and DNA binding activity of NF-κB. • TW-01 significantly suppresses intimal hyperplasia induced by balloon angioplasty. • TW-01 might be a potential candidate for atherosclerosis treatment.« less

Histone deacetylase and GATA-binding factor 6 regulate arterial remodeling in angiotensin II-induced hypertension.

PubMed

Kim, Gwi Ran; Cho, Soo-Na; Kim, Hyung-Seok; Yu, Seon Young; Choi, Sin Young; Ryu, Yuhee; Lin, Ming Quan; Jin, Li; Kee, Hae Jin; Jeong, Myung Ho

2016-11-01

Histone deacetylase (HDAC) inhibitors have been reported to improve essential and secondary hypertension. However, the specific HDAC that might serve as a therapeutic target and the associated upstream and downstream molecules involved in regulating hypertension remain unknown. Our study was aimed at investigating whether a selective inhibitor of class II HDAC (MC1568) modulates hypertension, elucidating the underlying mechanism. Hypertension was established by administering angiotensin II (Ang II) to mice before treatment with MC1568. SBP was measured. Treatment with MC1568 reduced elevated SBP; attenuated arterial remodeling in the kidney's small arteries and thoracic aorta; and inhibited cell cycle regulatory gene expression, vascular smooth muscle cell (VSMC) proliferation, DNA synthesis, and VSMC hypertrophy in vivo and in vitro. Ang II enhanced the expression of phosphorylated HDAC4 and GATA-binding factor 6 (GATA6) proteins, which were specifically localized in the cytoplasm of cells in the arteries of kidneys and in aortas. Forced expression and knockdown of HDAC4 increased and decreased, respectively, the proliferation and expression of cell cycle genes in VSMCs. GATA6, a newly described binding partner of HDAC4, markedly enhanced the size and number of VSMCs. Calcium/calmodulin-dependent kinase IIα (CaMKIIα), but not HDAC4, translocated from the nucleus to the cytoplasm in response to Ang II. CaMKIIα and protein kinase D1 were associated with VSMC hypertrophy and hyperplasia via direct interaction with HDAC4. MC1568 treatment weakened the association between HDAC4 and CaMKIIα. These results suggest that class II HDAC inhibition attenuates hypertension by negatively regulating VSMC hypertrophy and hyperplasia via the CaMKIIα/protein kinase D1/HDAC4/GATA6 pathway.

Molecular identification and transcriptional regulation of porcine IFIT2 gene.

PubMed

Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

2018-04-06

IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Scale Factor Study for 1:30 Local Scour Model

DTIC Science & Technology

2016-08-01

railway crossing on the Santa Ana River near Corona , CA. Data from the scale factor study provide an adjustment for applying documented scour...upstream and downstream of the test section respectively. Discharge into the model came from three recirculation pumps with a total capacity of ERDC...upstream baffle blocks. The total discharge was measured by reading the differential from a manometer across a venturi meter and verified with a total

Genome-Wide Analysis of Androgen Receptor Targets Reveals COUP-TF1 as a Novel Player in Human Prostate Cancer

PubMed Central

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR – COUP-TF1 – which could possibly play a role in human prostate cancer. PMID:23056316

Genome-wide analysis of androgen receptor targets reveals COUP-TF1 as a novel player in human prostate cancer.

PubMed

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR - COUP-TF1 - which could possibly play a role in human prostate cancer.

Potential Direct Regulators of the Drosophila yellow Gene Identified by Yeast One-Hybrid and RNAi Screens

PubMed Central

Kalay, Gizem; Lusk, Richard; Dome, Mackenzie; Hens, Korneel; Deplancke, Bart; Wittkopp, Patricia J.

2016-01-01

The regulation of gene expression controls development, and changes in this regulation often contribute to phenotypic evolution. Drosophila pigmentation is a model system for studying evolutionary changes in gene regulation, with differences in expression of pigmentation genes such as yellow that correlate with divergent pigment patterns among species shown to be caused by changes in cis- and trans-regulation. Currently, much more is known about the cis-regulatory component of divergent yellow expression than the trans-regulatory component, in part because very few trans-acting regulators of yellow expression have been identified. This study aims to improve our understanding of the trans-acting control of yellow expression by combining yeast-one-hybrid and RNAi screens for transcription factors binding to yellow cis-regulatory sequences and affecting abdominal pigmentation in adults, respectively. Of the 670 transcription factors included in the yeast-one-hybrid screen, 45 showed evidence of binding to one or more sequence fragments tested from the 5′ intergenic and intronic yellow sequences from D. melanogaster, D. pseudoobscura, and D. willistoni, suggesting that they might be direct regulators of yellow expression. Of the 670 transcription factors included in the yeast-one-hybrid screen, plus another TF previously shown to be genetically upstream of yellow, 125 were also tested using RNAi, and 32 showed altered abdominal pigmentation. Nine transcription factors were identified in both screens, including four nuclear receptors related to ecdysone signaling (Hr78, Hr38, Hr46, and Eip78C). This finding suggests that yellow expression might be directly controlled by nuclear receptors influenced by ecdysone during early pupal development when adult pigmentation is forming. PMID:27527791

A Network of HMG-box Transcription Factors Regulates Sexual Cycle in the Fungus Podospora anserina

PubMed Central

Ait Benkhali, Jinane; Coppin, Evelyne; Brun, Sylvain; Peraza-Reyes, Leonardo; Martin, Tom; Dixelius, Christina; Lazar, Noureddine; van Tilbeurgh, Herman; Debuchy, Robert

2013-01-01

High-mobility group (HMG) B proteins are eukaryotic DNA-binding proteins characterized by the HMG-box functional motif. These transcription factors play a pivotal role in global genomic functions and in the control of genes involved in specific developmental or metabolic pathways. The filamentous ascomycete Podospora anserina contains 12 HMG-box genes. Of these, four have been previously characterized; three are mating-type genes that control fertilization and development of the fruit-body, whereas the last one encodes a factor involved in mitochondrial DNA stability. Systematic deletion analysis of the eight remaining uncharacterized HMG-box genes indicated that none were essential for viability, but that seven were involved in the sexual cycle. Two HMG-box genes display striking features. PaHMG5, an ortholog of SpSte11 from Schizosaccharomyces pombe, is a pivotal activator of mating-type genes in P. anserina, whereas PaHMG9 is a repressor of several phenomena specific to the stationary phase, most notably hyphal anastomoses. Transcriptional analyses of HMG-box genes in HMG-box deletion strains indicated that PaHMG5 is at the hub of a network of several HMG-box factors that regulate mating-type genes and mating-type target genes. Genetic analyses revealed that this network also controls fertility genes that are not regulated by mating-type transcription factors. This study points to the critical role of HMG-box members in sexual reproduction in fungi, as 11 out of 12 members were involved in the sexual cycle in P. anserina. PaHMG5 and SpSte11 are conserved transcriptional regulators of mating-type genes, although P. anserina and S. pombe diverged 550 million years ago. Two HMG-box genes, SOX9 and its upstream regulator SRY, also play an important role in sex determination in mammals. The P. anserina and S. pombe mating-type genes and their upstream regulatory factor form a module of HMG-box genes analogous to the SRY/SOX9 module, revealing a commonality of sex regulation in animals and fungi. PMID:23935511

Coordination of hepatocyte nuclear factor 4 and seven-up controls insect counter-defense cathepsin B expression.

PubMed

Ahn, Ji-Eun; Guarino, Linda A; Zhu-Salzman, Keyan

2010-02-26

CmCatB, a cathepsin B-type cysteine protease, is insensitive to inhibition by the soybean cysteine protease inhibitor (scN). Cowpea bruchids dramatically induce CmCatB expression when major digestive proteases are inactivated by dietary scN, which is presumably an adaptive strategy that insects use to minimize effects of nutrient deficiency. In this study, we cloned the cowpea bruchid hepatocyte nuclear factor 4 (CmHNF-4) and demonstrated its involvement in transcriptional activation of CmCatB in the digestive tract of scN-adapted bruchids. Electrophoretic mobility shift assays demonstrated that CmHNF-4 binds to a CmCatB promoter region containing two tandem chicken ovalbumin upstream promoter (COUP) sites, which is also the cis-element for Seven-up (CmSvp), a previously identified transcriptional repressor of CmCatB. Although CmSvp is predominantly expressed in unadapted insect midgut, CmHNF-4 is more abundant in adapted bruchids. When transiently expressed in Drosophila S2 cells, CmHNF-4 substantially increased CmCatB expression through COUP binding. CmSvp inhibited CmHNF-4-mediated transcriptional activation even in the absence of its DNA-binding domain. Thus antagonism resulted, at least in part, from protein-protein interactions between CmSvp and CmHNF-4. Association of the two transcription factors was subsequently confirmed by glutathione S-transferase pulldown assays. Interestingly, anti-CmHNF-4 serum caused a supershift not only with nuclear extracts of scN-adapted insect midgut but with that of unadapted control insects as well. The presence of CmHNF-4 in unadapted insects further supported the idea that interplay between CmSvp and CmHNF-4 controls CmCatB transcription activation. Together, these results suggest that coordination between CmHNF-4 and CmSvp is important in counter-defense gene regulation in insects.

Thyroid hormone and COUP-TF1 regulate kallikrein-binding protein (KBP) gene expression.

PubMed

Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen; Brent, Gregory A

2011-03-01

Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).

Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression

PubMed Central

Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen

2011-01-01

Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T3 and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5′ flanking region (−53 to −29) and nTRE2, located in the first intron (104–132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T3. COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T3 repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T3. Nuclear corepressor knockdown resulted in loss of T3 repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T3 induction of positive thyroid hormone response elements, reverses T3 repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T3 and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T3. PMID:21266512

Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

PubMed

Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

2016-11-15

Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

Tumour necrosis factor-α regulates human eosinophil apoptosis via ligation of TNF-receptor 1 and balance between NF-κB and AP-1.

PubMed

Kankaanranta, Hannu; Ilmarinen, Pinja; Zhang, Xianzhi; Adcock, Ian M; Lahti, Aleksi; Barnes, Peter J; Giembycz, Mark A; Lindsay, Mark A; Moilanen, Eeva

2014-01-01

Eosinophils play a central role in asthma. The present study was performed to investigate the effect of tumour necrosis factor-α (TNF-α) on longevity of isolated human eosinophils. In contrast to Fas, TNF-α inhibited eosinophil apoptosis as evidenced by a combination of flow cytometry, DNA fragmentation assay and morphological analyses. The effect of TNF-α on eosinophil apoptosis was reversed by a TNF-α neutralising antibody. The anti-apoptotic effect of TNF-α was not due to autocrine release of known survival-prolonging cytokines interleukins 3 and 5 or granulocyte-macrophage-colony-stimulating factor as their neutralisation did not affect the effect of TNF-α. The anti-apoptotic signal was mediated mainly by the TNF-receptor 1. TNF-α induced phosphorylation and degradation of IκB and an increase in NF-κB DNA-binding activity. The survival-prolonging effect of TNF-α was reversed by inhibitors of NF-κB pyrrolidinedithiocarbamate and gliotoxin and by an inhibitor of IκB kinase, BMS-345541. TNF-α induced also an increase in AP-1 DNA-binding activity and the antiapoptotic effect of TNF-α was potentiated by inhibitors of AP-1, SR 11302 and tanshinone IIA and by an inhibitor of c-jun-N-terminal kinase, SP600125, which is an upstream kinase activating AP-1. Our results thus suggest that TNF-α delays human eosinophil apoptosis via TNF-receptor 1 and the resulting changes in longevity depend on yin-yang balance between activation of NF-κB and AP-1.

Stimulatory and inhibitory mechanisms of slow muscle-specific myosin heavy chain gene expression in fish: Transient and transgenic analysis of torafugu MYH{sub M86-2} promoter in zebrafish embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asaduzzaman, Md.; Kinoshita, Shigeharu, E-mail: akino@mail.ecc.u-tokyo.ac.jp; Bhuiyan, Sharmin Siddique

The myosin heavy chain gene, MYH{sub M86-2}, exhibited restricted expression in slow muscle fibers of torafugu embryos and larvae, suggesting its functional roles for embryonic and larval muscle development. However, the transcriptional mechanisms involved in its expression are still ambiguous. The present study is the first extensive analysis of slow muscle-specific MYH{sub M86-2} promoter in fish for identifying the cis-elements that are crucial for its expression. Combining both transient transfection and transgenic approaches, we demonstrated that the 2614 bp 5′-flanking sequences of MYH{sub M86-2} contain a sufficient promoter activity to drive gene expression specific to superficial slow muscle fibers. Bymore » cyclopamine treatment, we also demonstrated that the differentiation of such superficial slow muscle fibers depends on hedgehog signaling activity. The deletion analyses defined an upstream fragment necessary for repressing ectopic MYH{sub M86-2} expression in the fast muscle fibers. The transcriptional mechanism that prevents MYH{sub M86-2} expression in the fast muscle fibers is mediated through Sox6 binding elements. We also demonstrated that Sox6 may function as a transcriptional repressor of MYH{sub M86-2} expression. We further discovered that nuclear factor of activated T cells (NFAT) binding elements plays a key role and myocyte enhancer factor-2 (MEF2) binding elements participate in the transcriptional regulation of MYH{sub M86-2} expression. - Highlights: ► MYH{sub M86-2} is highly expressed in slow muscle fibers of torafugu embryos and larvae. ► MYH{sub M86-2} promoter activity depends on the hedgehog signaling. ► Sox6 binding elements inhibits MYH{sub M86-2} expression in fast muscle fibers. ► Sox6 elements function as transcriptional repressor of MYH{sub M86-2} promoter activity. ► NFAT and MEF2 binding elements play a key role for directing MYH{sub M86-2} expression.« less

Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

PubMed

Yamasu, K; Wilt, F H

1999-02-01

The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

VIH from the mud crab is specifically expressed in the eyestalk and potentially regulated by transactivator of Sox9/Oct4/Oct1.

PubMed

Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping

2018-01-01

Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.

ASR5 is involved in the regulation of miRNA expression in rice.

PubMed

Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

2015-11-01

The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

Light exposure influences the diurnal oscillation of gut microbiota in mice.

PubMed

Wu, Guangyan; Tang, Wenli; He, Yan; Hu, Jingjuan; Gong, Shenhai; He, Zhanke; Wei, Guoquan; Lv, Liyi; Jiang, Yong; Zhou, Hongwei; Chen, Peng

2018-06-18

The gut microbiota exhibit diurnal compositional and functional oscillations that influence the host homeostasis. However, the upstream factors that affect the microbial oscillations remain elusive. Here, we focused on the potential impact of light exposure, the main factor that affects the host circadian oscillation, on the diurnal oscillations of intestinal microflora to explore the upstream factor that governs the fluctuations of the gut microbes. The gut microbiota of the mice that were underwent regular light/dark (LD) cycles exhibited a robust rhythm at both compositional and functional level, in all parts of the intestine. Comparably, constant darkness (Dark-Dark, DD) led to the loss of the rhythmic oscillations in almost all parts of the intestine. Additionally, the abundance of Clostridia in DD conditions was dramatically enhanced in the small intestine. Our data indicated light exposure is the upstream factor that governs the regular diurnal fluctuations of gut microbiota in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.

The Global Redox Responding RegB/RegA Signal Transduction System Regulates the Genes Involved in Ferrous Iron and Inorganic Sulfur Compound Oxidation of the Acidophilic Acidithiobacillus ferrooxidans.

PubMed

Moinier, Danielle; Byrne, Deborah; Amouric, Agnès; Bonnefoy, Violaine

2017-01-01

The chemical attack of ore by ferric iron and/or sulfuric acid releases valuable metals. The products of these reactions are recycled by iron and sulfur oxidizing microorganisms. These acidophilic chemolithotrophic prokaryotes, among which Acidithiobacillus ferrooxidans , grow at the expense of the energy released from the oxidation of ferrous iron and/or inorganic sulfur compounds (ISCs). In At. ferrooxidans , it has been shown that the expression of the genes encoding the proteins involved in these respiratory pathways is dependent on the electron donor and that the genes involved in iron oxidation are expressed before those responsible for ISCs oxidation when both iron and sulfur are present. Since the redox potential increases during iron oxidation but remains stable during sulfur oxidation, we have put forward the hypothesis that the global redox responding two components system RegB/RegA is involved in this regulation. To understand the mechanism of this system and its role in the regulation of the aerobic respiratory pathways in At. ferrooxidans , the binding of different forms of RegA (DNA binding domain, wild-type, unphosphorylated and phosphorylated-like forms of RegA) on the regulatory region of different genes/operons involved in ferrous iron and ISC oxidation has been analyzed. We have shown that the four RegA forms are able to bind specifically the upstream region of these genes. Interestingly, the phosphorylation of RegA did not change its affinity for its cognate DNA. The transcriptional start site of these genes/operons has been determined. In most cases, the RegA binding site(s) was (were) located upstream from the -35 (or -24) box suggesting that RegA does not interfere with the RNA polymerase binding. Based on the results presented in this report, the role of the RegB/RegA system in the regulation of the ferrous iron and ISC oxidation pathways in At. ferrooxidans is discussed.

Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

PubMed Central

Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

2011-01-01

Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248

Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

PubMed Central

Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

2007-01-01

Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

Factor VII deficiency: a novel missense variant and genotype-phenotype correlation in patients from Southern Italy.

PubMed

Tiscia, Giovanni; Favuzzi, Giovanni; Chinni, Elena; Colaizzo, Donatella; Fischetti, Lucia; Intrieri, Mariano; Margaglione, Maurizio; Grandone, Elvira

2017-01-01

This study aimed at attempting to correlate genotype and phenotype in factor VII deficiency. Here, we present molecular and clinical findings of 10 patients with factor VII deficiency. From 2013 to 2016, 10 subjects were referred to our center because of a prolonged prothrombin time identified during routine or presurgery examinations or after a laboratory assessment of a bleeding episode. Mutation characterization was performed using the bioinformatics applications PROMO, SIFT, and Polyphen-2. Structural changes in the factor VII protein were analyzed using the SPDB viewer tool. Of the 10 variants we identified, 1 was responsible for a novel missense change (c.1199G>C, p.Cys400Ser); in 2 cases we identified the c.-54G>A and c.509G>A (p.Arg170His) polymorphic variants in the 5'-upstream region of the factor VII gene and exon 6, respectively. To our knowledge, neither of these polymorphic variants has been described previously in factor VII-deficient patients. In silico predictions showed differences in binding sites for transcription factors caused by the c.-54G>A variant and a probable damaging effect of the p.Cys400Ser missense change on factor VII active conformation, leading to breaking of the Cys400-Cys428 disulfide bridge. Our findings further suggest that, independently of factor VII levels and of variants potentially affecting factor VII levels, environmental factors, e.g., trauma, could heavily influence the clinical phenotype of factor VII-deficient patients.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

STAT3 inhibition as a therapeutic strategy for leukemia.

PubMed

Kanna, Rubashruti; Choudhary, Gaurav; Ramachandra, Nandini; Steidl, Ulrich; Verma, Amit; Shastri, Aditi

2017-11-22

Leukemia is characterized by selective overgrowth of malignant hematopoietic stem cells (HSC's) that interfere with HSC differentiation. Cytoreductive chemotherapy can kill rapidly dividing cancerous cells but cannot eradicate the malignant HSC pool leading to relapses. Leukemic stem cells have several dysregulated pathways and the Janus kinases (JAKs) and signal transducer and activator of transcription (STAT) pathway are prominent among them. STAT3 is an important transcription factor that regulates cell growth, proliferation, and inhibits apoptosis. High STAT3 expression in leukemia has been associated with an increased risk for relapse and decreased overall survival. Multiple strategies for interfering with STAT3 activity in leukemic cells include inhibition of STAT3 phosphorylation, interfering with STAT3 interactions, preventing nuclear transfer, inhibiting transcription and causing interference in STAT: DNA binding. A better understanding of key interactions and upstream mediators of STAT3 activity will help facilitate the development of effective cancer therapies and may result in durable remissions.

A Gibbs sampler for motif detection in phylogenetically close sequences

NASA Astrophysics Data System (ADS)

Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

2004-03-01

Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Identification of Akt Interaction Protein PHF20/TZP That Transcriptionally Regulates p53*

PubMed Central

Park, Sungman; Kim, Donghwa; Dan, Han C.; Chen, Huihua; Testa, Joseph R.; Cheng, Jin Q.

2012-01-01

Akt regulates a diverse array of cellular functions, including cell survival, proliferation, differentiation, and metabolism. Although a number of molecules have been identified as upstream regulators and downstream targets of Akt, the mechanisms by which Akt regulates these cellular processes remain elusive. Here, we demonstrate that a novel transcription factor, PHF20/TZP (referring to Tudor and zinc finger domain containing protein), binds to Akt and induces p53 expression at the transcription level. Knockdown of PHF20 significantly reduces p53. PHF20 inhibits cell growth, DNA synthesis, and cell survival. Akt phosphorylates PHF20 at Ser291 in vitro and in vivo, which results in its translocation from the nucleus to the cytoplasm and attenuation of PHF20 function. These data indicate that PHF20 is a substrate of Akt and plays a role in Akt cell survival/growth signaling. PMID:22334668

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

PubMed Central

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

2015-01-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

PubMed

Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

2011-02-24

We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

Midkine-A functions upstream of Id2a to regulate cell cycle kinetics in the developing vertebrate retina

PubMed Central

2012-01-01

Background Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina’s stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. Results The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. Conclusions These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins. PMID:23111152

Midkine-A functions upstream of Id2a to regulate cell cycle kinetics in the developing vertebrate retina.

PubMed

Luo, Jing; Uribe, Rosa A; Hayton, Sarah; Calinescu, Anda-Alexandra; Gross, Jeffrey M; Hitchcock, Peter F

2012-10-30

Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina's stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins.

HSI2/VAL1 Silences AGL15 to Regulate the Developmental Transition from Seed Maturation to Vegetative Growth in Arabidopsis[OPEN

PubMed Central

Abdelmageed, Haggag; Kang, Miyoung

2018-01-01

Gene expression during seed development in Arabidopsis thaliana is controlled by transcription factors including LEAFY COTYLEDON1 (LEC1) and LEC2, ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), known as LAFL proteins, and AGAMOUS-LIKE15 (AGL15). The transition from seed maturation to germination and seedling growth requires the transcriptional silencing of these seed maturation-specific factors leading to downregulation of structural genes including those that encode seed storage proteins, oleosins, and dehydrins. During seed germination and vegetative growth, B3-domain protein HSI2/VAL1 is required for the transcriptional silencing of LAFL genes. Here, we report chromatin immunoprecipitation analysis indicating that HSI2/VAL1 binds to the upstream sequences of the AGL15 gene but not at LEC1, ABI3, FUS3, or LEC2 loci. Functional analysis indicates that the HSI2/VAL1 B3 domain interacts with two RY elements upstream of the AGL15 coding region and at least one of them is required for HSI2/VAL1-dependent AGL15 repression. Expression analysis of the major seed maturation regulatory genes LEC1, ABI3, FUS3, and LEC2 in different genetic backgrounds demonstrates that HSI2/VAL1 is epistatic to AGL15 and represses the seed maturation regulatory program through downregulation of AGL15 by deposition of H3K27me3 at this locus. This hypothesis is further supported by results that show that HSI2/VAL1 physically interacts with the Polycomb Repressive Complex 2 component protein MSI1, which is also enriched at the AGL15 locus. PMID:29475938

Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

PubMed Central

Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

2014-01-01

Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

Signaling coupled epigenomic regulation of gene expression.

PubMed

Kumar, R; Deivendran, S; Santhoshkumar, T R; Pillai, M R

2017-10-26

Inheritance of genomic information independent of the DNA sequence, the epigenetics, as well as gene transcription are profoundly shaped by serine/threonine and tyrosine signaling kinases and components of the chromatin remodeling complexes. To precisely respond to a changing external milieu, human cells efficiently translate upstream signals into post-translational modifications (PTMs) on histones and coregulators such as corepressors, coactivators, DNA-binding factors and PTM modifying enzymes. Because a protein with multiple residues for putative PTMs is expected to undergo more than one PTM in cells stimulated with growth factors, the outcome of combinational PTM codes on histones and coregulators is profoundly shaped by regulatory interplays between PTMs. The genomic functions of signaling kinases in cancer cells are manifested by the downstream effectors of cytoplasmic signaling cascades as well as translocation of the cytoplasmic signaling kinases to the nucleus. Signaling-mediated phosphorylation of histones serves as a regulatory switch for other PTMs, and connects chromatin remodeling complexes into gene transcription and gene activity. Here, we will discuss the recent advances in signaling-dependent epigenomic regulation of gene transcription using a few representative cancer-relevant serine/threonine and tyrosine kinases and their interplay with chromatin remodeling factors in cancer cells.

Pleiotrophin is downregulated in human keloids.

PubMed

Lee, Dong Hun; Jin, Cheng Long; Kim, Yeji; Shin, Mi Hee; Kim, Ji Eun; Kim, Minji; Lee, Min Jung; Cho, Soyun

2016-10-01

Keloid is an abnormal hyperproliferative scarring process with involvement of complex genetic and triggering environmental factors. Previously published dysregulated gene expression profile of keloids includes genes involved in tumor formation. Pleiotrophin (PTN) is a secreted, heparin-binding growth factor which is involved in various biological functions such as cell growth, differentiation, and tumor progression. Although PTN expression was reported to be increased in hypertrophic scars, there is no study on PTN expression in keloids, and previous microarray results are controversial. To clarify differential expression of PTN in keloids, we investigated the expression of PTN and its interacting molecules in keloid and control fibroblasts, and performed immunohistochemical staining of PTN using tissue arrays. The expressions of PTN, its upstream regulator platelet-derived growth factor subunit B (PDGF-B) and corresponding PDGF receptors were significantly downregulated in keloid fibroblasts compared to normal human fibroblasts, and the decreased PTN protein expression was confirmed by immunohistochemistry as well as Western blot. Moreover, functional downstream receptor protein tyrosine phosphatase β/ζ was significantly upregulated in keloid fibroblasts, supporting overall downregulation of PTN signaling pathway. The lowered PTN expression in keloids suggests a different pathomechanism from that of hypertrophic scars.

Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391▿ †

PubMed Central

Girard, Geneviève; Barends, Sharief; Rigali, Sébastien; van Rij, E. Tjeerd; Lugtenberg, Ben J. J.; Bloemberg, Guido V.

2006-01-01

Secondary metabolites are important factors for interactions between bacteria and other organisms. Pseudomonas chlororaphis PCL1391 produces the antifungal secondary metabolite phenazine-1-carboxamide (PCN) that inhibits growth of Fusarium oxysporum f. sp. radius lycopersici the causative agent of tomato foot and root rot. Our previous work unraveled a cascade of genes regulating the PCN biosynthesis operon, phzABCDEFGH. Via a genetic screen, we identify in this study a novel TetR/AcrR regulator, named Pip (phenazine inducing protein), which is essential for PCN biosynthesis. A combination of a phenotypical characterization of a pip mutant, in trans complementation assays of various mutant strains, and electrophoretic mobility shift assays identified Pip as the fifth DNA-binding protein so far involved in regulation of PCN biosynthesis. In this regulatory pathway, Pip is positioned downstream of PsrA (Pseudomonas sigma factor regulator) and the stationary-phase sigma factor RpoS, while it is upstream of the quorum-sensing system PhzI/PhzR. These findings provide further evidence that the path leading to the expression of secondary metabolism gene clusters in Pseudomonas species is highly complex. PMID:16997957

Expression of caveolin in trabecular meshwork cells and its possible implication in pathogenesis of primary open angle glaucoma

PubMed Central

Surgucheva, Irina

2011-01-01

Purpose Primary open-angle glaucoma (POAG), which is the most common form of glaucoma, has been associated with a heterogeneous genetic component. A genome-wide association study has identified a common sequence variant at 7q31 (rs4236601 [A]) near the caveolin genes in patients with POAG. Caveolins are a family of integral membrane proteins which participate in many cellular processes, including vesicular transport, cholesterol homeostasis, signal transduction, cell adhesion and migration. The goal of this study was to investigate the expression and regulation of caveolin 1 (CAV-1) and caveolin 2 (CAV-2) in normal and glaucoma trabecular meshwork (TM) cells. Methods CAV-1 and CAV-2 protein expression was quantified by immunoblot analysis using lysates isolated from primary and immortalized TM cells or TM tissue dissected from normal and POAG eyes. The localization of caveolins in TM cells was assessed by immunofluorescent microscopy. CAV-1 and CAV-2 protein expression was also investigated in TM cells at various time points after subjecting the cells to known glaucomatous insults like dexamethasone (DEX) and tumor growth factor beta2 (TGF-β2) treatment. Phosphorylation of CAV-1 at tyrosine 14 in normal and glaucoma TM cell lines was evaluated using a specific monoclonal antibody (Ab). The 5′ upstream region of the CAV-1 gene was amplified and the sequence variant rs4236601 (A/G polymorphic site) and several putative transcription factor-binding sites were modified by in vitro mutagenesis. The effect of nucleotide sequence modifications in the CAV-1 upstream region on gene expression was assayed in a luciferase-based system in TM and non-TM cells. Results CAV-1 and CAV-2 are expressed in TM cells, with localization to the cytoplasm and perinuclear region. DEX increased CAV-1 expression in immortalized glaucoma TM cells by 2.8±0.1 (n=3) fold at 24 h and 2.5±0.1 (n=3) fold at 48 h, compared to 1.3±0.06 (n=3) fold at 24 and 48 h in immortalized normal TM cells. Phosphorylation of CAV-1 at Tyr14 was reduced by 3.2±0.15 (n=3) fold in glaucomatous TM cells when compared to normal TM cells. In POAG and normal TM tissue, CAV-1 expression was found to be uniform. CAV-2, on the other hand, was variable in independent normal and glaucoma TM tissue. Substitution of a G for an A at base pair −2,388 upstream of the start codon of CAV-1, corresponding to the minor allele rs4236601 [A], increased transcriptional activity in TM and non-TM cells when compared to the native sequence. Deletion analysis of putative transcription factor binding sites in the CAV-1 promoter region caused cell-specific effects on gene expression. Conclusions CAV-1 and CAV-2 are expressed in normal and glaucoma tissue and TM cell lines. Phosphorylation of Tyr14 in CAV-1 and transcriptional regulation of CAV-1 expression may have a role in glaucomatous alterations in TM cells. PMID:22128235

Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.

PubMed

Abedini, Davar; Rashidi Monfared, Sajad

2018-06-01

A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.

The mycobacterial antibiotic resistance determinant WhiB7 acts as a transcriptional activator by binding the primary sigma factor SigA (RpoV)

PubMed Central

Burian, Ján; Yim, Grace; Hsing, Michael; Axerio-Cilies, Peter; Cherkasov, Artem; Spiegelman, George B.; Thompson, Charles J.

2013-01-01

Tuberculosis therapeutic options are limited by the high intrinsic antibiotic resistance of Mycobacterium tuberculosis. The putative transcriptional regulator WhiB7 is crucial for the activation of systems that provide resistance to diverse antibiotic classes. Here, we used in vitro run-off, two-hybrid assays, as well as mutagenic, complementation and protein pull-down experiments, to characterize WhiB7 as an auto-regulatory, redox-sensitive transcriptional activator in Mycobacterium smegmatis. We provide the first direct biochemical proof that a WhiB protein promotes transcription and also demonstrate that this activity is sensitive to oxidation (diamide). Its partner protein for transcriptional activation was identified as SigA, the primary sigma factor subunit of RNA polymerase. Residues required for the interaction mapped to region 4 of SigA (including R515H) or adjacent domains of WhiB7 (including E63D). WhiB7’s ability to provide a specific spectrum of antibiotic-resistance was dependent on these residues as well as its C-terminal AT-hook module that binds to an AT-rich motif immediately upstream of the −35 hexamer recognized by SigA. These experimentally established constrains, combined with protein structure predictions, were used to generate a working model of the WhiB7–SigA-promoter complex. Inhibitors preventing WhiB7 interactions could allow the use of previously ineffective antibiotics for treatment of mycobacterial diseases. PMID:23990327

The mycobacterial antibiotic resistance determinant WhiB7 acts as a transcriptional activator by binding the primary sigma factor SigA (RpoV).

PubMed

Burian, Ján; Yim, Grace; Hsing, Michael; Axerio-Cilies, Peter; Cherkasov, Artem; Spiegelman, George B; Thompson, Charles J

2013-12-01

Tuberculosis therapeutic options are limited by the high intrinsic antibiotic resistance of Mycobacterium tuberculosis. The putative transcriptional regulator WhiB7 is crucial for the activation of systems that provide resistance to diverse antibiotic classes. Here, we used in vitro run-off, two-hybrid assays, as well as mutagenic, complementation and protein pull-down experiments, to characterize WhiB7 as an auto-regulatory, redox-sensitive transcriptional activator in Mycobacterium smegmatis. We provide the first direct biochemical proof that a WhiB protein promotes transcription and also demonstrate that this activity is sensitive to oxidation (diamide). Its partner protein for transcriptional activation was identified as SigA, the primary sigma factor subunit of RNA polymerase. Residues required for the interaction mapped to region 4 of SigA (including R515H) or adjacent domains of WhiB7 (including E63D). WhiB7's ability to provide a specific spectrum of antibiotic-resistance was dependent on these residues as well as its C-terminal AT-hook module that binds to an AT-rich motif immediately upstream of the -35 hexamer recognized by SigA. These experimentally established constrains, combined with protein structure predictions, were used to generate a working model of the WhiB7-SigA-promoter complex. Inhibitors preventing WhiB7 interactions could allow the use of previously ineffective antibiotics for treatment of mycobacterial diseases.

SmgGDS is a transient nucleolar protein that protects cells from nucleolar stress and promotes the cell cycle by regulating DREAM complex gene expression.

PubMed

Gonyo, P; Bergom, C; Brandt, A C; Tsaih, S-W; Sun, Y; Bigley, T M; Lorimer, E L; Terhune, S S; Rui, H; Flister, M J; Long, R M; Williams, C L

2017-12-14

The chaperone protein and guanine nucleotide exchange factor SmgGDS (RAP1GDS1) is a key promoter of cancer cell proliferation and tumorigenesis. SmgGDS undergoes nucleocytoplasmic shuttling, suggesting that it has both cytoplasmic and nuclear functions that promote cancer. Previous studies indicate that SmgGDS binds cytoplasmic small GTPases and promotes their trafficking to the plasma membrane. In contrast, little is known about the functions of SmgGDS in the nucleus, or how these nuclear functions might benefit cancer cells. Here we show unique nuclear localization and regulation of gene transcription pathways by SmgGDS. Strikingly, SmgGDS depletion significantly reduces expression of over 600 gene products that are targets of the DREAM complex, which is a transcription factor complex that regulates expression of proteins controlling the cell cycle. The cell cycle regulators E2F1, MYC, MYBL2 (B-Myb) and FOXM1 are among the DREAM targets that are diminished by SmgGDS depletion. E2F1 is well known to promote G1 cell cycle progression, and the loss of E2F1 in SmgGDS-depleted cells provides an explanation for previous reports that SmgGDS depletion characteristically causes a G1 cell cycle arrest. We show that SmgGDS localizes in nucleoli, and that RNAi-mediated depletion of SmgGDS in cancer cells disrupts nucleolar morphology, signifying nucleolar stress. We show that nucleolar SmgGDS interacts with the RNA polymerase I transcription factor upstream binding factor (UBF). The RNAi-mediated depletion of UBF diminishes nucleolar localization of SmgGDS and promotes proteasome-mediated degradation of SmgGDS, indicating that nucleolar sequestration of SmgGDS by UBF stabilizes SmgGDS protein. The ability of SmgGDS to interact with UBF and localize in the nucleolus is diminished by expressing DiRas1 or DiRas2, which are small GTPases that bind SmgGDS and act as tumor suppressors. Taken together, our results support a novel nuclear role for SmgGDS in protecting malignant cells from nucleolar stress, thus promoting cell cycle progression and tumorigenesis.

Molecular Characterization of the Schistosoma mansoni Zinc Finger Protein SmZF1 as a Transcription Factor

PubMed Central

D'Astolfo, Diego S.; Cardoso, Fernanda C.; Rajão, Matheus A.; Mourão, Marina M.; Gava, Elisandra; Oliveira, Sérgio C.; Macedo, Andréa M.; Machado, Carlos R.; Pena, Sérgio D. J.; Kitten, Gregory T.; Franco, Glória R.

2009-01-01

Background During its development, the parasite Schistosoma mansoni is exposed to different environments and undergoes many morphological and physiological transformations as a result of profound changes in gene expression. Characterization of proteins involved in the regulation of these processes is of importance for the understanding of schistosome biology. Proteins containing zinc finger motifs usually participate in regulatory processes and are considered the major class of transcription factors in eukaryotes. It has already been shown, by EMSA (Eletrophoretic Mobility Shift Assay), that SmZF1, a S. mansoni zinc finger (ZF) protein, specifically binds both DNA and RNA oligonucleotides. This suggests that this protein might act as a transcription factor in the parasite. Methodology/Principal Findings In this study we extended the characterization of SmZF1 by determining its subcellular localization and by verifying its ability to regulate gene transcription. We performed immunohistochemistry assays using adult male and female worms, cercariae and schistosomula to analyze the distribution pattern of SmZF1 and verified that the protein is mainly detected in the cells nuclei of all tested life cycle stages except for adult female worms. Also, SmZF1 was heterologously expressed in mammalian COS-7 cells to produce the recombinant protein YFP-SmZF1, which was mainly detected in the nucleus of the cells by confocal microscopy and Western blot assays. To evaluate the ability of this protein to regulate gene transcription, cells expressing YFP-SmZF1 were tested in a luciferase reporter system. In this system, the luciferase gene is downstream of a minimal promoter, upstream of which a DNA region containing four copies of the SmZF1 putative best binding site (D1-3DNA) was inserted. SmZF1 increased the reporter gene transcription by two fold (p≤0.003) only when its specific binding site was present. Conclusion Taken together, these results strongly support the hypothesis that SmZF1 acts as a transcription factor in S. mansoni. PMID:19901992

Estrogen receptor alpha and nuclear factor Y coordinately regulate the transcription of the SUMO-conjugating UBC9 gene in MCF-7 breast cancer cells.

PubMed

Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute

2013-01-01

UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER-positive breast cancer and be useful for the development of cancer therapies targeting UBC9.

HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis.

PubMed

Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

2017-01-02

Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis.

HSF1 stress response pathway regulates autophagy receptor SQSTM1/p62-associated proteostasis

PubMed Central

Watanabe, Yoshihisa; Tsujimura, Atsushi; Taguchi, Katsutoshi; Tanaka, Masaki

2017-01-01

ABSTRACT Proteostasis is important for protecting cells from harmful proteins and is mainly controlled by the HSF1 (heat shock transcription factor 1) stress response pathway. This pathway facilitates protein refolding by molecular chaperones; however, it is unclear whether it functions in autophagy or inclusion formation. The autophagy receptor SQSTM1/p62 is involved in selective autophagic clearance and inclusion formation by harmful proteins, and its phosphorylation at S349, S403, and S407 is required for binding to substrates. Here, we demonstrate that casein kinase 1 phosphorylates the SQSTM1 S349 residue when harmful proteins accumulate. Investigation of upstream factors showed that both SQSTM1 S349 and SQSTM1 S403 residues were phosphorylated in an HSF1 dependent manner. Inhibition of SQSTM1 phosphorylation suppressed inclusion formation by ubiquitinated proteins and prevented colocalization of SQSTM1 with aggregation-prone proteins. Moreover, HSF1 inhibition impaired aggregate-induced autophagosome formation and elimination of protein aggregates. Our findings indicate that HSF1 triggers SQSTM1-mediated proteostasis. PMID:27846364

A genetic screen for terminator function in yeast identifies a role for a new functional domain in termination factor Nab3

PubMed Central

Loya, Travis J.; O’Rourke, Thomas W.; Reines, Daniel

2012-01-01

The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 ‘tail’ forms an α-helical multimerization domain that helps assemble it onto an RNA substrate. PMID:22564898

Activity of the Rhodopseudomonas palustris p-Coumaroyl-Homoserine Lactone-Responsive Transcription Factor RpaR ▿ †

PubMed Central

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter

2011-01-01

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182

RNA chaperone activity of human La protein is mediated by variant RNA recognition motif.

PubMed

Naeeni, Amir R; Conte, Maria R; Bayfield, Mark A

2012-02-17

La proteins are conserved factors in eukaryotes that bind and protect the 3' trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3'OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3'OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets.

Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish.

PubMed

Tchoudakova, A; Kishida, M; Wood, E; Callard, G V

2001-11-01

Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.

Coordination of the recruitment of the FANCD2 and PALB2 Fanconi anemia proteins by an ubiquitin signaling network.

PubMed

Bick, Gregory; Zhang, Fan; Meetei, A Ruhikanta; Andreassen, Paul R

2017-06-01

Fanconi anemia (FA) is a chromosome instability syndrome and the 20 identified FA proteins are organized into two main arms which are thought to function at distinct steps in the repair of DNA interstrand crosslinks (ICLs). These two arms include the upstream FA pathway, which culminates in the monoubiquitination of FANCD2 and FANCI, and downstream breast cancer (BRCA)-associated proteins that interact in protein complexes. How, and whether, these two groups of FA proteins are integrated is unclear. Here, we show that FANCD2 and PALB2, as indicators of the upstream and downstream arms, respectively, colocalize independently of each other in response to DNA damage induced by mitomycin C (MMC). We also show that ubiquitin chains are induced by MMC and colocalize with both FANCD2 and PALB2. Our finding that the RNF8 E3 ligase has a role in recruiting FANCD2 and PALB2 also provides support for the hypothesis that the two branches of the FA-BRCA pathway are coordinated by ubiquitin signaling. Interestingly, we find that the RNF8 partner, MDC1, as well as the ubiquitin-binding protein, RAP80, specifically recruit PALB2, while a different ubiquitin-binding protein, FAAP20, functions only in the recruitment of FANCD2. Thus, FANCD2 and PALB2 are not recruited in a single linear pathway, rather we define how their localization is coordinated and integrated by a network of ubiquitin-related proteins. We propose that such regulation may enable upstream and downstream FA proteins to act at distinct steps in the repair of ICLs.

Differential Penicillin-Binding Protein 5 (PBP5) Levels in the Enterococcus faecium Clades with Different Levels of Ampicillin Resistance.

PubMed

Montealegre, Maria Camila; Roh, Jung Hyeob; Rae, Meredith; Davlieva, Milya G; Singh, Kavindra V; Shamoo, Yousif; Murray, Barbara E

2017-01-01

Ampicillin resistance in Enterococcus faecium is a serious concern worldwide, complicating the treatment of E. faecium infections. Penicillin-binding protein 5 (PBP5) is considered the main ampicillin resistance determinant in E. faecium The three known E. faecium clades showed sequence variations in the pbp5 gene that are associated with their ampicillin resistance phenotype; however, these changes alone do not explain the array of resistance levels observed among E. faecium clinical strains. We aimed to determine if the levels of PBP5 are differentially regulated between the E. faecium clades, with the hypothesis that variations in PBP5 levels could help account for the spectrum of ampicillin MICs seen in E. faecium We studied pbp5 mRNA levels and PBP5 protein levels as well as the genetic environment upstream of pbp5 in 16 E. faecium strains that belong to the different E. faecium clades and for which the ampicillin MICs covered a wide range. Our results found that pbp5 and PBP5 levels are increased in subclade A1 and A2 ampicillin-resistant strains compared to those in clade B and subclade A2 ampicillin-susceptible strains. Furthermore, we found evidence of major clade-associated rearrangements in the region upstream of pbp5, including large DNA fragment insertions, deletions, and single nucleotide polymorphisms, that may be associated with the differential regulation of PBP5 levels between the E. faecium clades. Overall, these findings highlight the contribution of the clade background to the regulation of PBP5 abundance and point to differences in the region upstream of pbp5 as likely contributors to the differential expression of ampicillin resistance. Copyright © 2016 American Society for Microbiology.

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

PubMed Central

Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

2010-01-01

POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

Impact of resistance exercise on ribosome biogenesis is acutely regulated by post-exercise recovery strategies.

PubMed

Figueiredo, Vandré C; Roberts, Llion A; Markworth, James F; Barnett, Matthew P G; Coombes, Jeff S; Raastad, Truls; Peake, Jonathan M; Cameron-Smith, David

2016-02-01

Muscle hypertrophy occurs following increased protein synthesis, which requires activation of the ribosomal complex. Additionally, increased translational capacity via elevated ribosomal RNA (rRNA) synthesis has also been implicated in resistance training-induced skeletal muscle hypertrophy. The time course of ribosome biogenesis following resistance exercise (RE) and the impact exerted by differing recovery strategies remains unknown. In the present study, the activation of transcriptional regulators, the expression levels of pre-rRNA, and mature rRNA components were measured through 48 h after a single-bout RE. In addition, the effects of either low-intensity cycling (active recovery, ACT) or a cold-water immersion (CWI) recovery strategy were compared. Nine male subjects performed two bouts of high-load RE randomized to be followed by 10 min of either ACT or CWI. Muscle biopsies were collected before RE and at 2, 24, and 48 h after RE. RE increased the phosphorylation of the p38-MNK1-eIF4E axis, an effect only evident with ACT recovery. Downstream, cyclin D1 protein, total eIF4E, upstream binding factor 1 (UBF1), and c-Myc proteins were all increased only after RE with ACT. This corresponded with elevated abundance of the pre-rRNAs (45S, ITS-28S, ITS-5.8S, and ETS-18S) from 24 h after RE with ACT. In conclusion, coordinated upstream signaling and activation of transcriptional factors stimulated pre-rRNA expression after RE. CWI, as a recovery strategy, markedly blunted these events, suggesting that suppressed ribosome biogenesis may be one factor contributing to the impaired hypertrophic response observed when CWI is used regularly after exercise. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Transcription factor AP-2γ induces early Cdx2 expression and represses HIPPO signaling to specify the trophectoderm lineage.

PubMed

Cao, Zubing; Carey, Timothy S; Ganguly, Avishek; Wilson, Catherine A; Paul, Soumen; Knott, Jason G

2015-05-01

Cell fate decisions are fundamental to the development of multicellular organisms. In mammals the first cell fate decision involves segregation of the pluripotent inner cell mass and the trophectoderm, a process regulated by cell polarity proteins, HIPPO signaling and lineage-specific transcription factors such as CDX2. However, the regulatory mechanisms that operate upstream to specify the trophectoderm lineage have not been established. Here we report that transcription factor AP-2γ (TFAP2C) functions as a novel upstream regulator of Cdx2 expression and position-dependent HIPPO signaling in mice. Loss- and gain-of-function studies and promoter analysis revealed that TFAP2C binding to an intronic enhancer is required for activation of Cdx2 expression during early development. During the 8-cell to morula transition TFAP2C potentiates cell polarity to suppress HIPPO signaling in the outside blastomeres. TFAP2C depletion triggered downregulation of PARD6B, loss of apical cell polarity, disorganization of F-actin, and activation of HIPPO signaling in the outside blastomeres. Rescue experiments using Pard6b mRNA restored cell polarity but only partially corrected position-dependent HIPPO signaling, suggesting that TFAP2C negatively regulates HIPPO signaling via multiple pathways. Several genes involved in regulation of the actin cytoskeleton (including Rock1, Rock2) were downregulated in TFAP2C-depleted embryos. Inhibition of ROCK1 and ROCK2 activity during the 8-cell to morula transition phenocopied TFAP2C knockdown, triggering a loss of position-dependent HIPPO signaling and decrease in Cdx2 expression. Altogether, these results demonstrate that TFAP2C facilitates trophectoderm lineage specification by functioning as a key regulator of Cdx2 transcription, cell polarity and position-dependent HIPPO signaling. © 2015. Published by The Company of Biologists Ltd.

REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION

PubMed Central

KIM, J. Y.; YENARI, M. A.; LEE, J. E.

2018-01-01

Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Characterization of a spliced variant of human IRF-3 promoter and its regulation by the transcription factor Sp1.

PubMed

Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping

2012-06-01

Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.

Structural and biophysical investigation of the interaction of a mutant Grb2 SH2 domain (W121G) with its cognate phosphopeptide.

PubMed

Papaioannou, Danai; Geibel, Sebastian; Kunze, Micha B A; Kay, Christopher W M; Waksman, Gabriel

2016-03-01

The adaptor protein Grb2 is a key element of mitogenetically important signaling pathways. With its SH2 domain it binds to upstream targets while its SH3 domains bind to downstream proteins thereby relaying signals from the cell membranes to the nucleus. The Grb2 SH2 domain binds to its targets by recognizing a phosphotyrosine (pY) in a pYxNx peptide motif, requiring an Asn at the +2 position C-terminal to the pY with the residue either side of this Asn being hydrophobic. Structural analysis of the Grb2 SH2 domain in complex with its cognate peptide has shown that the peptide adopts a unique β-turn conformation, unlike the extended conformation that phosphopeptides adopt when bound to other SH2 domains. TrpEF1 (W121) is believed to force the peptide into this unusual conformation conferring this unique specificity to the Grb2 SH2 domain. Using X-ray crystallography, electron paramagnetic resonance (EPR) spectroscopy, and isothermal titration calorimetry (ITC), we describe here a series of experiments that explore the role of TrpEF1 in determining the specificity of the Grb2 SH2 domain. Our results demonstrate that the ligand does not adopt a pre-organized structure before binding to the SH2 domain, rather it is the interaction between the two that imposes the hairpin loop to the peptide. Furthermore, we find that the peptide adopts a similar structure when bound to both the wild-type Grb2 SH2 domain and a TrpEF1Gly mutant. This suggests that TrpEF1 is not the determining factor for the conformation of the phosphopeptide. © 2015 The Protein Society.

Transforming Growth Factor-β/SMAD Target Gene SKIL Is Negatively Regulated by the Transcriptional Cofactor Complex SNON-SMAD4*

PubMed Central

Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

2012-01-01

The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574

A distinct class of homeodomain proteins is encoded by two sequentially expressed Drosophila genes from the 93D/E cluster.

PubMed Central

Jagla, K; Stanceva, I; Dretzen, G; Bellard, F; Bellard, M

1994-01-01

Homeodomains appear to be one of the most frequently employed DNA-binding domains in a superfamily of transacting factors. It is likely that during evolution several sub-types of homeodomain have evolved from a common ancestral domain, resulting in distinct but closely related DNA-binding preferences. Here we describe the conservation of a distinct type of homeodomain encoded by the Drosophila lady-bird-late (lbl) gene, previously named nkch4 (1). Using degenerate PCR primers corresponding to the most divergent regions of the first and third helix of the Lbl homeodomain we have amplified, from genomic DNA of the fly, a lady-bird-like homeobox fragment. The Drosophila PCR products contained both the lbl (1) and a highly related homeobox sequence, which we named lady-bird-early (lbe). This new Drosophila gene resides directly upstream to lbl and together with tinman/NK4 (2, 3, 4, 5), bagpipe/NK3 (2, 4) S59/NK1 (4, 6) and 93Bal (7) compose the 93D/E homeobox gene cluster. Ibe and lbl are transcribed from the same strand and in a temporal order corresponding to their 5'-3' chromosomal location. Transcripts of both genes are found in the epiderm of Drosophila embryos, in cells known to express a segment polarity gene wingless (8), and their spatial and temporal colinearity of expression strongly suggests that they cooperate during segmentation. The amino-acid composition of both Lady-bird homeodomains differ from that of Antp-type at several positions involved in DNA recognition. These substitutions appear to modify DNA-binding preferences since Lbl homeodomain is unable to recognize the most common homeodomain binding TAAT motif in gel retardation experiments. Images PMID:7909370

Immortalization-susceptible elements and their binding factors mediate rejuvenation of regulation of the type I collagenase gene in simian virus 40 large T antigen-transformed immortal human fibroblasts.

PubMed Central

Imai, S; Fujino, T; Nishibayashi, S; Manabe, T; Takano, T

1994-01-01

Dramatic changes occur in expression of the type I collagenase gene during the process of immortalization in simian virus 40 large T antigen-transformed human fibroblasts (S. Imai and T. Takano, Biochem. Biophys. Res. Commun. 189:148-153, 1992). From transient transfection assays, it was determined that these changes involved the functions of two immortalization-susceptible cis-acting elements, ISE1 and ISE2, located in a 100-bp region about 1.7 kb upstream. The profiles of binding of an activator, Proserpine, to the enhancer ISE1 were similar in the extracts of young, senescent preimmortalized and immortalized cells. ISE2 contained both negative and positive regulatory elements located adjacent to each other. The positive regulatory element consisted of a tandem array of putative Ets family- and AP-1-binding sites. An activator, Pluto, interacted with this positive regulatory element and had an AP-1-related component as a complex. The binding activity of Pluto was predominantly detected only in the extract from senescent preimmortalized cells. In contrast, a repressor, Orpheus, which bound to the ATG-rich negative regulatory element of ISE2, was prominently detected in extracts from both young preimmortalized and immortalized cells and appeared to suppress transcription in an orientation-dependent manner. Thus, the interplay of Pluto and Orpheus was suggested to be crucial for regulation of the collagenase gene accompanying in vitro aging and immortalization. Proserpine seemed to interact with Pluto to mediate strong expression of the collagenase gene in cellular senescence. On the basis of these results, we propose a model for regulation of the collagenase gene during in vitro aging and immortalization. Images PMID:7935433

Transforming growth factor-β/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4.

PubMed

Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

2012-08-03

The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.

Circuitry linking the global Csr and σE-dependent cell envelope stress response systems.

PubMed

Yakhnin, Helen; Aichele, Robert; Ades, Sarah E; Romeo, Tony; Babitzke, Paul

2017-09-18

CsrA of Escherichia coli is an RNA-binding protein that globally regulates a wide variety of cellular processes and behaviors including carbon metabolism, motility, biofilm formation, and the stringent response. CsrB and CsrC are sRNAs that sequester CsrA, thereby preventing CsrA-mRNA interaction. RpoE (σ E ) is the extracytoplasmic stress response sigma factor of E. coli Previous RNA-seq studies identified rpoE mRNA as a CsrA target. Here we explored the regulation of rpoE by CsrA and found that CsrA represses rpoE translation. Gel mobility shift, footprint and toeprint studies identified three CsrA binding sites in the rpoE leader transcript, one of which overlaps the rpoE Shine-Dalgarno (SD) sequence, while another overlaps the rpoE translation initiation codon. Coupled in vitro transcription-translation experiments showed that CsrA represses rpoE translation by binding to these sites. We further demonstrate that σ E indirectly activates transcription of csrB and csrC , leading to increased sequestration of CsrA such that repression of rpoE by CsrA is reduced. We propose that the Csr system fine-tunes the σ E -dependent cell envelope stress response. We also identified a 51 amino acid coding sequence whose stop codon overlaps the rpoE start codon, and demonstrate that rpoE is translationally coupled with this upstream open reading frame (ORF51). Loss of coupling reduces rpoE translation by more than 50%. Identification of a translationally coupled ORF upstream of rpoE suggests that this previously unannotated protein may participate in the cell envelope stress response. In keeping with existing nomenclature, we name ORF51 as rseD , resulting in an operon arrangement of rseD-rpoE-rseA-rseB-rseC IMPORTANCE CsrA posttranscriptionally represses genes required for bacterial stress responses, including the stringent response, catabolite repression, and the RpoS (σ S )-mediated general stress response. We show that CsrA represses translation of rpoE , encoding the extracytoplasmic stress response sigma factor and that σ E indirectly activates transcription of csrB and csrC , resulting in reciprocal regulation of these two global regulatory systems. These findings suggest that extracytoplasmic stress leads to derepression of rpoE translation by CsrA, and CsrA-mediated repression helps to reset RpoE abundance to pre-stress levels once envelope damage is repaired. The discovery of an ORF, RseD, translationally coupled with rpoE adds further complexity to translational control of rpoE . Copyright © 2017 American Society for Microbiology.

Single-molecule force measurement via optical tweezers reveals different kinetic features of two BRaf mutants responsible for cardio-facial-cutaneous (CFC) syndrome

PubMed Central

Wen, Cheng; Ye, Anpei

2013-01-01

BRaf (B- Rapid Accelerated Fibrosarcoma) protein is an important serine/threonine-protein kinase. Two domains on BRaf can independently bind its upstream kinase, Ras (Rat Sarcoma) protein. These are the Ras binding domain (RBD) and cysteine-rich-domain (CRD). Herein we use customized optical tweezers to compare the Ras binding process in two pathological mutants of BRaf responsible for CFC syndrome, abbreviated BRaf (A246P) and BRaf (Q257R). The two mutants differ in their kinetics of Ras-binding, though both bind Ras with similar increased overall affinity. BRaf (A246P) exhibits a slightly higher Ras/CRD unbinding force and a significantly higher Ras/RBD unbinding force versus the wild type. The contrary phenomenon is observed in the Q257R mutation. Simulations of the unstressed-off rate, koff(0), yield results in accordance with the changes revealed by the mean unbinding force. Our approach can be applied to rapidly assess other mutated proteins to deduce the effects of mutation on their kinetics compared to wild type proteins and to each other. PMID:24409384

Co-option of the bZIP transcription factor Vrille as the activator of Doublesex1 in environmental sex determination of the crustacean Daphnia magna.

PubMed

Mohamad Ishak, Nur Syafiqah; Nong, Quang Dang; Matsuura, Tomoaki; Kato, Yasuhiko; Watanabe, Hajime

2017-11-01

Divergence of upstream regulatory pathways of the transcription factor Doublesex (Dsx) serves as a basis for evolution of sex-determining mechanisms in animals. However, little is known about the regulation of Dsx in environmental sex determination. In the crustacean Daphnia magna, environmental sex determination is implemented by male-specific expression of the Dsx ortholog, Dsx1. Transcriptional regulation of Dsx1 comprises at least three phases during embryogenesis: non-sex-specific initiation, male-specific up-regulation, and its maintenance. Herein, we demonstrate that the male-specific up-regulation is controlled by the bZIP transcription factor, Vrille (Vri), an ortholog of the circadian clock genes-Drosophila Vri and mammalian E4BP4/NFIL3. Sequence analysis of the Dsx1 promoter/enhancer revealed a conserved element among two Daphnia species (D. magna and D. pulex), which contains a potential enhancer harboring a consensus Vri binding site overlapped with a consensus Dsx binding site. Besides non-sex-specific expression of Vri in late embryos, we found male-specific expression in early gastrula before the Dsx1 up-regulation phase begins. Knockdown of Vri in male embryos showed reduction of Dsx1 expression. In addition, transient overexpression of Vri in early female embryos up-regulated the expression of Dsx1 and induced male-specific trait. Targeted mutagenesis using CRISPR/Cas9 disrupted the enhancer on genome in males, which led to the reduction of Dsx1 expression. These results indicate that Vri was co-opted as a transcriptional activator of Dsx1 in environmental sex determination of D. magna. The data suggests the remarkably plastic nature of gene regulatory network in sex determination.

Polyubiquitination events mediate polymethylmethacrylate (PMMA) particle activation of NF-kappaB pathway.

PubMed

Yamanaka, Yasuhiro; Karuppaiah, Kannan; Abu-Amer, Yousef

2011-07-08

The pathologic response to implant wear-debris constitutes a major component of inflammatory osteolysis and remains under intense investigation. Polymethylmethacrylate (PMMA) particles, which are released during implant wear and loosening, constitute a major culprit by virtue of inducing inflammatory and osteolytic responses by macrophages and osteoclasts, respectively. Recent work by several groups has identified important cellular entities and secreted factors that contribute to inflammatory osteolysis. In previous work, we have shown that PMMA particles contribute to inflammatory osteolysis through stimulation of major pathways in monocytes/macrophages, primarily NF-κB and MAP kinases. The former pathway requires assembly of large IKK complex encompassing IKK1, IKK2, and IKKγ/NEMO. We have shown recently that interfering with the NF-κB and MAPK activation pathways, through introduction of inhibitors and decoy molecules, impedes PMMA-induced inflammation and osteolysis in mouse models of experimental calvarial osteolysis and inflammatory arthritis. In this study, we report that PMMA particles activate the upstream transforming growth factor β-activated kinase-1 (TAK1), which is a key regulator of signal transduction cascades leading to activation of NF-κB and AP-1 factors. More importantly, we found that PMMA particles induce TAK1 binding to NEMO and UBC13. In addition, we show that PMMA particles induce TRAF6 and UBC13 binding to NEMO and that lack of TRAF6 significantly attenuates NEMO ubiquitination. Altogether, these observations suggest that PMMA particles induce ubiquitination of NEMO, an event likely mediated by TRAF6, TAK1, and UBC13. Our findings provide important information for better understanding of the mechanisms underlying PMMA particle-induced inflammatory responses.

Transcriptional Regulation of Brain-Derived Neurotrophic Factor (BDNF) by Methyl CpG Binding Protein 2 (MeCP2): a Novel Mechanism for Re-Myelination and/or Myelin Repair Involved in the Treatment of Multiple Sclerosis (MS).

PubMed

KhorshidAhmad, Tina; Acosta, Crystal; Cortes, Claudia; Lakowski, Ted M; Gangadaran, Surendiran; Namaka, Michael

2016-03-01

Multiple sclerosis (MS) is a chronic progressive, neurological disease characterized by the targeted immune system-mediated destruction of central nervous system (CNS) myelin. Autoreactive CD4+ T helper cells have a key role in orchestrating MS-induced myelin damage. Once activated, circulating Th1-cells secrete a variety of inflammatory cytokines that foster the breakdown of blood-brain barrier (BBB) eventually infiltrating into the CNS. Inside the CNS, they become reactivated upon exposure to the myelin structural proteins and continue to produce inflammatory cytokines such as tumor necrosis factor α (TNFα) that leads to direct activation of antibodies and macrophages that are involved in the phagocytosis of myelin. Proliferating oligodendrocyte precursors (OPs) migrating to the lesion sites are capable of acute remyelination but unable to completely repair or restore the immune system-mediated myelin damage. This results in various permanent clinical neurological disabilities such as cognitive dysfunction, fatigue, bowel/bladder abnormalities, and neuropathic pain. At present, there is no cure for MS. Recent remyelination and/or myelin repair strategies have focused on the role of the neurotrophin brain-derived neurotrophic factor (BDNF) and its upstream transcriptional repressor methyl CpG binding protein (MeCP2). Research in the field of epigenetic therapeutics involving histone deacetylase (HDAC) inhibitors and lysine acetyl transferase (KAT) inhibitors is being explored to repress the detrimental effects of MeCP2. This review will address the role of MeCP2 and BDNF in remyelination and/or myelin repair and the potential of HDAC and KAT inhibitors as novel therapeutic interventions for MS.

NTL8 Regulates Trichome Formation in Arabidopsis by Directly Activating R3 MYB Genes TRY and TCL11[OPEN

PubMed Central

Tian, Hainan; Wang, Xianling; Guo, Hongyan; Cheng, Yuxin; Hou, Chunjiang

2017-01-01

The NAM, ATAF1/2, and CUC (NAC) are plant-specific transcription factors that regulate multiple aspects of plant growth and development and plant response to environmental stimuli. We report here the identification of NTM1-LIKE8 (NTL8), a membrane-associated NAC transcription factor, as a novel regulator of trichome formation in Arabidopsis (Arabidopsis thaliana). From an activation-tagged Arabidopsis population, we identified a dominant, gain-of-function mutant with glabrous inflorescence stem. By using plasmid rescue and RT-PCR analyses, we found that NTL8 was tagged; thus, the mutant was named ntl8-1 Dominant (ntl8-1D). Recapitulation experiment further confirmed that the phenotype observed in the ntl8-1D mutant was caused by elevated expression of NTL8. Quantitative RT-PCR results showed that the expression level of the single-repeat R3 MYB genes TRIPTYCHON (TRY) and TRICHOMELESS1 (TCL1) was elevated in the ntl8-1D mutant. Genetic analyses demonstrated that NTL8 acts upstream of TRY and TCL1 in the regulation of trichome formation. When recruited to the promoter region of the reporter gene Gal4:GUS by a fused GAL4 DNA-binding domain, NTL8 activated the expression of the reporter gene. Chromatin immunoprecipitation results indicated that TRY and TCL1 are direct targets of NTL8. However, NTL8 did not interact with SQUAMOSA PROMOTER BINDING PROTEIN LIKE9, another transcription factor that regulates the expression of TRY and TCL1, in yeast and plant cells. Taken together, our results suggest that NTL8 negatively regulates trichome formation in Arabidopsis by directly activating the expression of TRY and TCL1. PMID:28649093

Co-option of the bZIP transcription factor Vrille as the activator of Doublesex1 in environmental sex determination of the crustacean Daphnia magna

PubMed Central

Nong, Quang Dang; Matsuura, Tomoaki; Watanabe, Hajime

2017-01-01

Divergence of upstream regulatory pathways of the transcription factor Doublesex (Dsx) serves as a basis for evolution of sex-determining mechanisms in animals. However, little is known about the regulation of Dsx in environmental sex determination. In the crustacean Daphnia magna, environmental sex determination is implemented by male-specific expression of the Dsx ortholog, Dsx1. Transcriptional regulation of Dsx1 comprises at least three phases during embryogenesis: non-sex-specific initiation, male-specific up-regulation, and its maintenance. Herein, we demonstrate that the male-specific up-regulation is controlled by the bZIP transcription factor, Vrille (Vri), an ortholog of the circadian clock genes—Drosophila Vri and mammalian E4BP4/NFIL3. Sequence analysis of the Dsx1 promoter/enhancer revealed a conserved element among two Daphnia species (D. magna and D. pulex), which contains a potential enhancer harboring a consensus Vri binding site overlapped with a consensus Dsx binding site. Besides non-sex-specific expression of Vri in late embryos, we found male-specific expression in early gastrula before the Dsx1 up-regulation phase begins. Knockdown of Vri in male embryos showed reduction of Dsx1 expression. In addition, transient overexpression of Vri in early female embryos up-regulated the expression of Dsx1 and induced male-specific trait. Targeted mutagenesis using CRISPR/Cas9 disrupted the enhancer on genome in males, which led to the reduction of Dsx1 expression. These results indicate that Vri was co-opted as a transcriptional activator of Dsx1 in environmental sex determination of D. magna. The data suggests the remarkably plastic nature of gene regulatory network in sex determination. PMID:29095827

Metalloproteinase-dependent transforming growth factor-alpha release mediates neurotensin-stimulated MAP kinase activation in human colonic epithelial cells.

PubMed

Zhao, Dezheng; Zhan, Yanai; Koon, Hon Wai; Zeng, Huiyan; Keates, Sarah; Moyer, Mary P; Pothoulakis, Charalabos

2004-10-15

Expression of the neuropeptide neurotensin (NT) and its high affinity receptor (NTR1) is increased during the course of Clostridium difficile toxin A-induced acute colitis, and NTR1 antagonism attenuates the severity of toxin A-induced inflammation. We recently demonstrated in non-transformed human colonic epithelial NCM460 cells that NT treatment caused activation of a Ras-mediated MAP kinase pathway that significantly contributes to NT-induced interleukin-8 (IL-8) secretion. Here we used NCM460 cells, which normally express low levels of NTR1, and NCM460 cells stably transfected with NTR1 to identify the upstream signaling molecules involved in NT-NTR1-mediated MAP kinase activation. We found that inhibition of the epidermal growth factor receptor (EGFR) by either an EGFR neutralizing antibody or by its specific inhibitor AG1478 (0.2 microm) blocked NT-induced MAP kinase activation. Moreover, NT stimulated tyrosine phosphorylation of the EGFR, and pretreatment with a broad spectrum metalloproteinase inhibitor batimastat reduced NT-induced MAP kinase activation. Using neutralizing antibodies against the EGFR ligands EGF, heparin-binding-EGF, transforming growth factor-alpha (TGFalpha), or amphiregulin we have shown that only the anti-TGFalpha antibody significantly decreases NT-induced phosphorylation of EGFR and MAP kinases. Furthermore, inhibition of the EGF receptor by AG1478 significantly reduced NT-induced IL-8 promoter activity and IL-8 secretion. This is the first report demonstrating that NT binding to NTR1 transactivates the EGFR and that this response is linked to NT-mediated proinflammatory signaling. Our findings indicate that matrix metalloproteinase-mediated release of TGFalpha and subsequent EGFR transactivation triggers a NT-mediated MAP kinase pathway that leads to IL-8 gene expression in human colonic epithelial cells.

Neuronal Protein 3.1 Deficiency Leads to Reduced Cutaneous Scar Collagen Deposition and Tensile Strength due to Impaired Transforming Growth Factor-β1 to -β3 Translation.

PubMed

Cheng, Tao; Yue, Michael; Aslam, Muhammad Nadeem; Wang, Xin; Shekhawat, Gajendra; Varani, James; Schuger, Lucia

2017-02-01

Neuronal protein 3.1 (P311), a conserved RNA-binding protein, represents the first documented protein known to stimulate transforming growth factor (TGF)-β1 to -β3 translation in vitro and in vivo. Because TGF-βs play critical roles in fibrogenesis, we initiated efforts to define the role of P311 in skin scar formation. Here, we show that P311 is up-regulated in skin wounds and in normal and hypertrophic scars. Genetic ablation of p311 resulted in a significant decrease in skin scar collagen deposition. Lentiviral transfer of P311 corrected the deficits, whereas down-regulation of P311 levels by lentiviral RNA interference reproduced the deficits seen in P311 -/- mice. The decrease in collagen deposition resulted in scars with reduced stiffness but also reduced scar tensile strength. In vitro studies using murine and human dermal fibroblasts showed that P311 stimulated TGF-β1 to -β3 translation, a process that involved eukaryotic translation initiation factor 3 subunit b as a P311 binding partner. This resulted in increased TGF-β levels/activity and increased collagen production. In addition, P311 induced dermal fibroblast activation and proliferation. Finally, exogenous TGF-β1 to -β3, each restituted the normal scar phenotype. These studies demonstrate that P311 is required for the production of normal cutaneous scars and place P311 immediately up-stream of TGF-βs in the process of fibrogenesis. Conditions that decrease P311 levels could result in less tensile scars, which could potentially lead to higher incidence of dehiscence after surgery. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

PubMed

González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

2014-05-01

Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. © 2013 Wiley Periodicals, Inc.

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

The Arabidopsis RCC1 Family Protein TCF1 Regulates Freezing Tolerance and Cold Acclimation through Modulating Lignin Biosynthesis

PubMed Central

Jenkins, Gareth I.; Wang, Shuangfeng; Shang, Zhonglin; Shi, Yiting; Yang, Shuhua; Li, Xia

2015-01-01

Abstract Cell water permeability and cell wall properties are critical to survival of plant cells during freezing, however the underlying molecular mechanisms remain elusive. Here, we report that a specifically cold-induced nuclear protein, Tolerant to Chilling and Freezing 1 (TCF1), interacts with histones H3 and H4 and associates with chromatin containing a target gene, BLUE-COPPER-BINDING PROTEIN (BCB), encoding a glycosylphosphatidylinositol-anchored protein that regulates lignin biosynthesis. Loss of TCF1 function leads to reduced BCB transcription through affecting H3K4me2 and H3K27me3 levels within the BCB gene, resulting in reduced lignin content and enhanced freezing tolerance. Furthermore, plants with knocked-down BCB expression (amiRNA-BCB) under cold acclimation had reduced lignin accumulation and increased freezing tolerance. The pal1pal2 double mutant (lignin content reduced by 30% compared with WT) also showed the freezing tolerant phenotype, and TCF1 and BCB act upstream of PALs to regulate lignin content. In addition, TCF1 acts independently of the CBF (C-repeat binding factor) pathway. Our findings delineate a novel molecular pathway linking the TCF1-mediated cold-specific transcriptional program to lignin biosynthesis, thus achieving cell wall remodeling with increased freezing tolerance. PMID:26393916

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kyoung Mi; Cho, Hana; Kim, Yoon Ki, E-mail: yk-kim@korea.ac.kr

Highlights: Black-Right-Pointing-Pointer CDKN1A mRNA is a bona fide NMD substrate. Black-Right-Pointing-Pointer The uORF of CDKN1A mRNA is efficiently translated. Black-Right-Pointing-Pointer Translation of downstream main ORF is negatively regulated by translation of uORF in CDKN1A mRNA. -- Abstract: The first round of translation occurs on mRNAs bound by nuclear cap-binding complex (CBC), which is composed of nuclear cap-binding protein 80 and 20 (CBP80/20). During this round of translation, aberrant mRNAs are recognized and downregulated in abundance by nonsense-mediated mRNA decay (NMD), which is one of the mRNA quality control mechanisms. Here, our microarray analysis reveals that the level of cyclin-dependent kinasemore » inhibitor 1A (CDKN1A; also known as Waf1/p21) mRNAs increases in cells depleted of cellular NMD factors. Intriguingly, CDKN1A mRNA contains an upstream open reading frame (uORF), which is a NMD-inducing feature. Using chimeric reporter constructs, we find that the uORF of CDKN1A mRNA negatively modulates translation of the main downstream ORF. These findings provide biological insights into the possible role of NMD in diverse biological pathways mediated by CDKN1A.« less

Molecular mechanisms of the mammalian Hippo signaling pathway.

PubMed

Ji, Xin-yan; Zhong, Guoxuan; Zhao, Bin

2017-07-20

The Hippo pathway plays an evolutionarily conserved fundamental role in controlling organ size in multicellular organisms. Importantly, evidence from studies of patient samples and mouse models clearly indicates that deregulation of the Hippo signaling pathway plays a crucial role in the initiation and progression of many different types of human cancers. The Hippo signaling pathway is regulated by various stimuli, such as mechanical stress, G-protein coupled receptor signaling, and cellular energy status. When activated, the Hippo kinase cascade phosphorylates and inhibits the transcription co-activator YAP (Yes-associated protein), and its paralog TAZ (transcriptional coactivator with PDZ-binding motif), resulting in their cytoplasmic retention and degradation. When the Hippo signaling pathway is inactive, dephosphorylated YAP/TAZ translocate into the nucleus and activate gene transcription through binding to TEAD (TEA domain) family and other transcription factors. Such changes in gene expression promote cell proliferation and stem cell/progenitor cell self-renewal but inhibit apoptosis, thereby coordinately promote increase in organ size, tissue regeneration, and tumorigenesis. In this review, we summarize the molecular mechanisms of the mammalian Hippo signaling pathway with special emphasis on the Hippo kinase cascade and its upstream signals, the Hippo signaling pathway regulation of YAP and the mechanisms of YAP in regulation of gene transcription.

The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

DOE PAGES

Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

2017-06-24

In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

The rcsA Promoter of Pantoea stewartii subsp. stewartii Features a Low-Level Constitutive Promoter and an EsaR Quorum-Sensing-Regulated Promoter

PubMed Central

Carlier, Aurelien L.; von Bodman, S. B.

2006-01-01

The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

PubMed

Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

2013-10-01

Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

Transcriptional regulation of the human Liver X Receptor α gene by Hepatocyte Nuclear Factor 4α

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theofilatos, Dimitris; Anestis, Aristomenis; Hashimoto, Koshi

Liver X Receptors (LXRs) are sterol-activated transcription factors that play major roles in cellular cholesterol homeostasis, HDL biogenesis and reverse cholesterol transport. The aim of the present study was to investigate the mechanisms that control the expression of the human LXRα gene in hepatic cells. A series of reporter plasmids containing consecutive 5′ deletions of the hLXRα promoter upstream of the luciferase gene were constructed and the activity of each construct was measured in HepG2 cells. This analysis showed that the activity of the human LXRα promoter was significantly reduced by deleting the −111 to −42 region suggesting the presence of positivemore » regulatory elements in this short proximal fragment. Bioinformatics data including motif search and ChIP-Seq revealed the presence of a potential binding motif for Hepatocyte Nuclear Factor 4 α (HNF-4α) in this area. Overexpression of HNF-4α in HEK 293T cells increased the expression of all LXRα promoter constructs except −42/+384. In line, silencing the expression of endogenous HNF-4α in HepG2 cells was associated with reduced LXRα protein levels and reduced activity of the −111/+384 LXRα promoter but not of the −42/+384 promoter. Using ChiP assays in HepG2 cells combined with DNAP assays we mapped the novel HNF-4α specific binding motif (H4-SBM) in the −50 to −40 region of the human LXRα promoter. A triple mutation in this H4-SBM abolished HNF-4α binding and reduced the activity of the promoter to 65% relative to the wild type. Furthermore, the mutant promoter could not be transactivated by HNF-4α. In conclusion, our data indicate that HNF-4α may have a wider role in cell and plasma cholesterol homeostasis by controlling the expression of LXRα in hepatic cells. - Highlights: • The human LXRα promoter contains a HNF-4α specific binding motif in the proximal −50/−40 region. • Mutations in this motif abolished HNF4α binding and transactivation of the hLXRα promoter. • Silencing of HNF-4α was associated with reduced LXRα protein levels and promoter activity. • The HNF-4α/LXRα axis may have a wide role in cell and plasma cholesterol homeostasis.« less

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

PubMed

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Insulin-like growth factor-mediated muscle differentiation: collaboration between phosphatidylinositol 3-kinase-Akt-signaling pathways and myogenin.

PubMed

Tureckova, J; Wilson, E M; Cappalonga, J L; Rotwein, P

2001-10-19

The differentiation and maturation of skeletal muscle require interactions between signaling pathways activated by hormones and growth factors and an intrinsic regulatory network controlled by myogenic transcription factors. Insulin-like growth factors (IGFs) play key roles in muscle development in the embryo and in regeneration in the adult. To study mechanisms of IGF action in muscle, we developed a myogenic cell line that overexpresses IGF-binding protein-5. C2BP5 cells remain quiescent in low serum differentiation medium until the addition of IGF-I. Here we use this cell line to identify signaling pathways controlling IGF-mediated differentiation. Induction of myogenin by IGF-I and myotube formation were prevented by the phosphatidylinositol (PI) 3-kinase inhibitor, LY294002, even when included 2 days after growth factor addition, whereas expression of active PI 3-kinase could promote differentiation in the absence of IGF-I. Differentiation also was induced by myogenin but was blocked by LY294002. The differentiation-promoting effects of IGF-I were mimicked by a modified membrane-targeted inducible Akt-1 (iAkt), and iAkt was able to stimulate differentiation of C2 myoblasts and primary mouse myoblasts incubated with otherwise inhibitory concentrations of LY294002. These results show that an IGF-regulated PI 3-kinase-Akt pathway controls muscle differentiation by mechanisms acting both upstream and downstream of myogenin.

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE PAGES

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.; ...

2015-04-08

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

PubMed Central

Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

2014-01-01

Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

Structural Basis of the Interaction of a Trypanosoma cruzi Surface Molecule Implicated in Oral Infection with Host Cells and Gastric Mucin

PubMed Central

Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.

2012-01-01

Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

PubMed Central

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

Duplication of an upstream silencer of FZP increases grain yield in rice.

PubMed

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF-beta/Smad signaling pathway.

Transactivation of involucrin, a marker of differentiation in keratinocytes, by lens epithelium-derived growth factor (LEDGF).

PubMed

Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P

2002-07-26

Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand the molecular mechanism of transcriptional regulation of this gene. LEDGF may play an important role in establishing an important barrier in corneal keratinocytes by maintaining epidermal turn-over rate, and protecting HCKs against stress.

Platelet-derived growth factor receptor mediates activation of ras through different signaling pathways in different cell types.

PubMed Central

Satoh, T; Fantl, W J; Escobedo, J A; Williams, L T; Kaziro, Y

1993-01-01

A series of pieces of evidence have shown that Ras protein acts as a transducer of the platelet-derived growth factor (PDGF) receptor-mediated signaling pathway: (i) formation of Ras.GTP is detected immediately on PDGF stimulation, and (ii) a dominant inhibitory mutant Ras, as well as a neutralizing anti-Ras antibody, can interfere with PDGF-induced responses. On the other hand, several signal transducing molecules including phosphatidylinositol 3-kinase (PI3-K), GTPase-activating protein (GAP), and phospholipase C gamma (PLC gamma) bind directly to the PDGF receptor and become tyrosine phosphorylated. Recently, it was shown that specific phosphorylated tyrosines of the PDGF receptor are responsible for interaction between the receptor and each signaling molecule. However, the roles of these signaling molecules have not been elucidated, and it remains unclear which molecules are implicated in the Ras pathway. In this study, we measured Ras activation in cell lines expressing mutant PDGF receptors that are deficient in coupling with specific molecules. In fibroblast CHO cells, a mutant receptor (Y708F/Y719F [PI3-K-binding sites]) was unable to stimulate Ras, whereas another mutant (Y739F [the GAP-binding site]) could do so, suggesting an indispensable role of PI3-K or a protein that binds to the same sites as PI3-K for PDGF-stimulated Ras activation. By contrast, both of the above mutants were capable of stimulating Ras protein in a pro-B-cell line, BaF3. Furthermore, a mutant receptor (Y977F/Y989F [PLC gamma-binding sites]) could fully activate Ras, and the direct activation of protein kinase C and calcium mobilization had almost no effect on the GDP/GTP state of Ras in this cell line. These results suggest that, in the pro-B-cell transfectants, each of the above pathways (PI3-K, GAP, and PLC gamma) can be eliminated without a loss of Ras activation. It remains unclear whether another unknown essential pathway which regulates Ras protein exists within BaF3 cells. Therefore, it is likely that several different PDGF receptor-mediated signaling pathways function upstream of Ras, and the extent of the contribution of each pathway for the regulation of Ras may differ among different cell types. Images PMID:8388543

Deletion of the distal Tnfsf11 RL-D2 enhancer that contributes to PTH-mediated RANKL expression in osteoblast lineage cells results in a high bone mass phenotype in mice

PubMed Central

Onal, M.; St John, H.C.; Danielson, A.L.; Pike, J.W.

2016-01-01

Receptor activator of nuclear factor-κB ligand (RANKL) is a TNF-like cytokine that is necessary for osteoclast formation and survival. Elevated RANKL synthesis is associated with both increased osteoclast number and bone resorption. Earlier studies identified an enhancer 76 kb upstream of the Tnfsf11 transcriptional start site (TSS) termed RL-D5 or the distal control region (DCR) that modulates RANKL expression in response to PTH, 1,25(OH)2D3, and an array of cytokines. Mice lacking RL-D5 exhibit high bone mass associated with decreased RANKL expression in bone, spleen, and thymus. In addition to RL-D5, genome-wide studies have identified 9 additional Tnfsf11 enhancers residing upstream of the gene’s TSS, which provide RANKL cell type-specificity and responsiveness to local and systemic factors. ChIP-chip analysis has revealed inducible VDR and CREB binding at an enhancer termed RL-D2 23 kb upstream of the Tnfsf11 TSS in osteoblastic ST2 cells. Herein, we use ChIP-seq analysis to confirm this finding and delete this enhancer from the mouse genome to determine its physiological role in vivo. RL-D2−/− primary stromal cells showed decreased RANKL-induction by both forskolin and 1,25(OH)2D3 ex vivo. Consistent with this, the PTH induction of RANKL expression was significantly blunted in RL-D2−/− mice in vivo. In contrast, lack of RL-D2 had no effect on 1,25(OH)2D3 induction of RANKL in vivo. Similar to the results seen in RL-D5−/− mice, lack of RL-D2 led to decreased skeletal RANKL expression, resulting in decreased osteoclast numbers and a progressive increase in bone mineral density. Lack of RL-D2 increased cancellous bone mass in femur and spine, but did not alter femoral cortical bone thickness. These results highlight the role of distal enhancers in the regulation of RANKL expression by PTH and perhaps 1,25(OH)2D3, and suggest that the RL-D2 and RL-D5 enhancers contribute in either an additive or synergistic manner to regulate bone remodeling. PMID:26332516

Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase by Ikaros, Histone Deacetylase 1 (HDAC1), and Casein Kinase 2 (CK2) in B-cell Acute Lymphoblastic Leukemia*

PubMed Central

Wang, Haijun; Song, Chunhua; Ding, Yali; Pan, Xiaokang; Ge, Zheng; Tan, Bi-Hua; Gowda, Chandrika; Sachdev, Mansi; Muthusami, Sunil; Ouyang, Hongsheng; Lai, Liangxue; Francis, Olivia L.; Morris, Christopher L.; Abdel-Azim, Hisham; Dorsam, Glenn; Xiang, Meixian; Payne, Kimberly J.; Dovat, Sinisa

2016-01-01

Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements of its target genes and regulates their transcription via chromatin remodeling. Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 trimethylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the upstream regulatory element of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed, and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic casein kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of trimethylated histone H3 lysine 27 and decreased histone H3 Lys-9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of JARID1B transcription. The presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL. PMID:26655717

The Global Redox Responding RegB/RegA Signal Transduction System Regulates the Genes Involved in Ferrous Iron and Inorganic Sulfur Compound Oxidation of the Acidophilic Acidithiobacillus ferrooxidans

PubMed Central

Moinier, Danielle; Byrne, Deborah; Amouric, Agnès; Bonnefoy, Violaine

2017-01-01

The chemical attack of ore by ferric iron and/or sulfuric acid releases valuable metals. The products of these reactions are recycled by iron and sulfur oxidizing microorganisms. These acidophilic chemolithotrophic prokaryotes, among which Acidithiobacillus ferrooxidans, grow at the expense of the energy released from the oxidation of ferrous iron and/or inorganic sulfur compounds (ISCs). In At. ferrooxidans, it has been shown that the expression of the genes encoding the proteins involved in these respiratory pathways is dependent on the electron donor and that the genes involved in iron oxidation are expressed before those responsible for ISCs oxidation when both iron and sulfur are present. Since the redox potential increases during iron oxidation but remains stable during sulfur oxidation, we have put forward the hypothesis that the global redox responding two components system RegB/RegA is involved in this regulation. To understand the mechanism of this system and its role in the regulation of the aerobic respiratory pathways in At. ferrooxidans, the binding of different forms of RegA (DNA binding domain, wild-type, unphosphorylated and phosphorylated-like forms of RegA) on the regulatory region of different genes/operons involved in ferrous iron and ISC oxidation has been analyzed. We have shown that the four RegA forms are able to bind specifically the upstream region of these genes. Interestingly, the phosphorylation of RegA did not change its affinity for its cognate DNA. The transcriptional start site of these genes/operons has been determined. In most cases, the RegA binding site(s) was (were) located upstream from the −35 (or −24) box suggesting that RegA does not interfere with the RNA polymerase binding. Based on the results presented in this report, the role of the RegB/RegA system in the regulation of the ferrous iron and ISC oxidation pathways in At. ferrooxidans is discussed. PMID:28747899

Enhanced B Cell Alloantigen Presentation and Its Epigenetic Dysregulation in Liver Transplant Rejection.

PubMed

Ningappa, M; Ashokkumar, C; Higgs, B W; Sun, Q; Jaffe, R; Mazariegos, G; Li, D; Weeks, D E; Subramaniam, S; Ferrell, R; Hakonarson, H; Sindhi, R

2016-02-01

T cell suppression prevents acute cellular rejection but causes life-threatening infections and malignancies. Previously, liver transplant (LTx) rejection in children was associated with the single-nucleotide polymorphism (SNP) rs9296068 upstream of the HLA-DOA gene. HLA-DOA inhibits B cell presentation of antigen, a potentially novel antirejection drug target. Using archived samples from 122 white pediatric LTx patients (including 77 described previously), we confirmed the association between rs9296068 and LTx rejection (p = 0.001, odds ratio [OR] 2.55). Next-generation sequencing revealed that the putative transcription factor (CCCTC binding factor [CTCF]) binding SNP locus rs2395304, in linkage disequilibrium with rs9296068 (D' 0.578, r(2) = 0.4), is also associated with LTx rejection (p = 0.008, OR 2.34). Furthermore, LTx rejection is associated with enhanced B cell presentation of donor antigen relative to HLA-nonidentical antigen in a novel cell-based assay and with a downregulated HLA-DOA gene in a subset of these children. In lymphoblastoid B (Raji) cells, rs2395304 coimmunoprecipitates with CTCF, and CTCF knockdown with morpholino antisense oligonucleotides enhances alloantigen presentation and downregulates the HLA-DOA gene, reproducing observations made with HLA-DOA knockdown and clinical rejection. Alloantigen presentation is suppressed by inhibitors of methylation and histone deacetylation, reproducing observations made during resolution of rejection. Enhanced donor antigen presentation by B cells and its epigenetic dysregulation via the HLA-DOA gene represent novel opportunities for surveillance and treatment of transplant rejection. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.

PubMed

Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram

2008-08-01

Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.

Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

PubMed

Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

2017-08-01

The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

Urinary miR-16 transactivated by C/EBPβ reduces kidney function after ischemia/reperfusion–induced injury

PubMed Central

Chen, Hsi-Hsien; Lan, Yi-Fan; Li, Hsiao-Fen; Cheng, Ching-Feng; Lai, Pei-Fang; Li, Wei-Hua; Lin, Heng

2016-01-01

Ischemia-reperfusion (I/R) induced acute kidney injury (AKI) is regulated by transcriptional factors and microRNAs (miRs). However, modulation of miRs by transcriptional factors has not been characterized in AKI. Here, we found that urinary miR-16 was 100-fold higher in AKI patients. MiR-16 was detected earlier than creatinine in mouse after I/R. Using TargetScan, the 3′UTR of B-cell lymphoma 2 (BCL-2) was found complementary to miR-16 to decrease the fluorescent reporter activity. Overexpression of miR-16 in mice significantly attenuated renal function and increased TUNEL activity in epithelium tubule cells. The CCAAT enhancer binding protein beta (C/EBP-β) increased the expression of miR-16 after I/R injury. The ChIP and luciferase promoter assay indicated that about −1.0 kb to −0.5 kb upstream of miR-16 genome promoter region containing C/EBP-β binding motif transcriptionally regulated miR-16 expression. Meanwhile, the level of pri-miR-16 was higher in mice infected with lentivirus containing C/EBP-β compared with wild-type (WT) mice and overexpression of C/EBP-β in the kidney of WT mice reduced kidney function, increased kidney apoptosis, and elevated urinary miR-16 level. Our results indicated that miR-16 was transactivated by C/EBP-β resulting in aggravated I/R induced AKI and that urinary miR-16 may serve as a potential biomarker for AKI. PMID:27297958

Integrating and Amplifying Signal from Riboswitch Biosensors

DTIC Science & Technology

2014-08-01

and the first 100-150 nucleotides of the downstream gene into mfold (Zuker, 2003) and forcing the aptamer region into configurations corresponding to...ligand to the aptamer . When the THY riboswitch is placed upstream of hrpR, the riboswitch basepairs well with the gene resulting in a conformation that...Ligand: energy provided by the ligand binding to the aptamers $: Jenison et al., 1994 *: Gilbert et al., 2006 2.1.3. Using Plasmid Backbones

Characterization of a Fluorescent Protein Reporter System

DTIC Science & Technology

2008-03-01

pathways are initiated with the binding of a small molecule to a catalytic ribonucleic acid molecule (RNA), called a ribozyme (Thodima et al., 2006). The... ribozyme is part of a larger RNA construct, called a riboswitch, which initiates translation of a specific genetic sequence on a plasmid (circular...protein gene. Yen et al. (2004) reported insertion of a self-cleaving ribozyme upstream of the reporter gene. In the absence of a regulator (“off

FGF-1-induced matrix metalloproteinase-9 expression in breast cancer cells is mediated by increased activities of NF-kappaB and activating protein-1.

PubMed

Lungu, Gina; Covaleda, Lina; Mendes, Odete; Martini-Stoica, Heidi; Stoica, George

2008-06-01

Matrix metalloproteinase-9 (MMP-9) plays a critical role in tumor invasion and metastasis. Here, we investigate the effect of fibroblast growth factor-1 (FGF-1) on the expression of MMP-9 in ENU1564, an ethyl-N-nitrosourea-induced rat mammary adenocarcinoma cell line. We observed that FGF-1 induces a dose-dependent increase in MMP-9 mRNA, protein, and activity in ENU1564 cells. To gain insight into the molecular mechanism of MMP-9 regulation by FGF-1, we investigated the role of components of PI3K-Akt and MEK1/2-ERK signaling pathways in our system since NF-kappaB and AP-1 transcription factor binding sites have been characterized in the upstream region of the MMP-9 gene. We demonstrated that FGF-1 increases Akt phosphorylation, triggers nuclear translocation of NF-kappaBp65, and enhances degradation of cytoplasmic IkappaBalpha. Pretreatment of cells with LY294002, a PI3K inhibitor, significantly inhibited MMP-9 protein expression in FGF-1-treated cells. Conversely, our data show that FGF-1 increases ERK phosphorylation in ENU1564 cells, increases c-jun and c-fos mRNA expression in a time-dependent manner, and triggers nuclear translocation of c-jun. Pretreatment of cells with PD98059, a MEK1/2 inhibitor significantly inhibited MMP-9 protein expression in FGF-1 treated cells. Finally, we observed increased DNA binding of NF-kappaB and AP-1 in FGF-1-treated cells and that mutation of either NF-kappaB or AP-1 response elements prevented MMP-9 promoter activation by FGF-1. Taken together, these results demonstrated that FGF-1-induced MMP-9 expression in ENU1564 cells is associated with increasing DNA binding activities of NF-kappaB and AP-1 and involve activation of a dual signaling pathway, PI3K-Akt and MEK1/2-ERK. (c) 2007 Wiley-Liss, Inc.

Arrangement of the Clostridium baratii F7 Toxin Gene Cluster with Identification of a σ Factor That Recognizes the Botulinum Toxin Gene Cluster Promoters

DOE PAGES

Dover, Nir; Barash, Jason R.; Burke, Julianne N.; ...

2014-05-22

Botulinum neurotoxin (BoNT) is the most poisonous substances known and its eight toxin types (A to H) are distinguished by the inability of polyclonal antibodies that neutralize one toxin type to neutralize any of the other seven toxin types. Infant botulism, an intestinal toxemia orphan disease, is the most common form of human botulism in the United States. It results from swallowed spores of Clostridium botulinum (or rarely, neurotoxigenic Clostridium butyricum or Clostridium baratii) that germinate and temporarily colonize the lumen of the large intestine, where, as vegetative cells, they produce botulinum toxin. Botulinum neurotoxin is encoded by the bontmore » gene that is part of a toxin gene cluster that includes several accessory genes. In this paper, we sequenced for the first time the complete botulinum neurotoxin gene cluster of nonproteolytic C. baratii type F7. Like the type E and the nonproteolytic type F6 botulinum toxin gene clusters, the C. baratii type F7 had an orfX toxin gene cluster that lacked the regulatory botR gene which is found in proteolytic C. botulinum strains and codes for an alternative σ factor. In the absence of botR, we identified a putative alternative regulatory gene located upstream of the C. baratii type F7 toxin gene cluster. This putative regulatory gene codes for a predicted σ factor that contains DNA-binding-domain homologues to the DNA-binding domains both of BotR and of other members of the TcdR-related group 5 of the σ 70 family that are involved in the regulation of toxin gene expression in clostridia. We showed that this TcdR-related protein in association with RNA polymerase core enzyme specifically binds to the C. baratii type F7 botulinum toxin gene cluster promoters. Finally, this TcdR-related protein may therefore be involved in regulating the expression of the genes of the botulinum toxin gene cluster in neurotoxigenic C. baratii.« less

Structure, function, and tethering of DNA-binding domains in σ 54 transcriptional activators

DOE PAGES

Vidangos, Natasha; Maris, Ann E.; Young, Anisa; ...

2013-07-02

In this paper, we compare the structure, activity, and linkage of DNA-binding domains (DBDs) from σ 54 transcriptional activators and discuss how the properties of the DBDs and the linker to the neighboring domain are affected by the overall properties and requirements of the full proteins. These transcriptional activators bind upstream of specific promoters that utilize σ 54-polymerase. Upon receiving a signal the activators assemble into hexamers, which then, through adenosine triphosphate (ATP) hydrolysis, drive a conformational change in polymerase that enables transcription initiation. We present structures of the DBDs of activators nitrogen regulatory protein C 1 (NtrC1) and Nif-likemore » homolog 2 (Nlh2) from the thermophile Aquifex aeolicus. The structures of these domains and their relationship to other parts of the activators are discussed. These structures are compared with previously determined structures of the DBDs of NtrC4, NtrC, ZraR, and factor for inversion stimulation. The N-terminal linkers that connect the DBDs to the central domains in NtrC1 and Nlh2 were studied and found to be unstructured. Additionally, a crystal structure of full-length NtrC1 was solved, but density of the DBDs was extremely weak, further indicating that the linker between ATPase and DBDs functions as a flexible tether. Flexible linking of ATPase and DBDs is likely necessary to allow assembly of the active hexameric ATPase ring. Finally, the comparison of this set of activators also shows clearly that strong dimerization of the DBD only occurs when other domains do not dimerize strongly.« less

Regulation of neural macroRNAs by the transcriptional repressor REST

PubMed Central

Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J.; Stanton, Lawrence W.; Lipovich, Leonard

2009-01-01

The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs (“macroRNAs”), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer. PMID:19050060

Regulation of neural macroRNAs by the transcriptional repressor REST.

PubMed

Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J; Stanton, Lawrence W; Lipovich, Leonard

2009-01-01

The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs ("macroRNAs"), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer.

Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites

PubMed Central

Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme

1998-01-01

ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779

RNA Chaperone Activity of Human La Protein Is Mediated by Variant RNA Recognition Motif*

PubMed Central

Naeeni, Amir R.; Conte, Maria R.; Bayfield, Mark A.

2012-01-01

La proteins are conserved factors in eukaryotes that bind and protect the 3′ trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3′OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3′OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets. PMID:22203678

TNFα- and IKKβ-mediated TANK/I-TRAF phosphorylation: implications for interaction with NEMO/IKKγ and NF-κB activation

PubMed Central

Bonif, Marianne; Meuwis, Marie-Alice; Close, Pierre; Benoit, Valérie; Heyninck, Karen; Chapelle, Jean-Paul; Bours, Vincent; Merville, Marie-Paule; Piette, Jacques; Beyaert, Rudi; Chariot, Alain

2005-01-01

Pro-inflammatory cytokines trigger signalling cascades leading to NF-κB (nuclear factor-κB)-dependent gene expression through IKK [IκB (inhibitory κB) kinase]-dependent phosphorylation and subsequent degradation of the IκB proteins and via induced phosphorylation of p65. These signalling pathways rely on sequentially activated kinases which are assembled by essential and non-enzymatic scaffold proteins into functional complexes. Here, we show that the pro-inflammatory cytokine TNFα (tumour necrosis factor α) promotes TANK [TRAF (TNF receptor-associated factor) family member associated NF-κB activator] recruitment to the IKK complex via a newly characterized C-terminal zinc finger. Moreover, we show that TANK is phosphorylated by IKKβ upon TNFα stimulation and that this modification negatively regulates TANK binding to NEMO (NF-κB essential modulator). Interestingly, reduced TANK expression by RNA interference attenuates TNFα-mediated induction of a subset of NF-κB target genes through decreased p65 transactivation potential. Therefore the scaffold protein TANK is required for the cellular response to TNFα by connecting upstream signalling molecules to the IKKs and p65, and its subsequent IKKβ-mediated phosphorylation may be a mechanism to terminate the TANK-dependent wave of NF-κB activation. PMID:16336209

Conditional Müllercell ablation causes independent neuronal and vascular pathologies in a novel transgenic model.

PubMed

Shen, Weiyong; Fruttiger, Marcus; Zhu, Ling; Chung, Sook H; Barnett, Nigel L; Kirk, Joshua K; Lee, SoRa; Coorey, Nathan J; Killingsworth, Murray; Sherman, Larry S; Gillies, Mark C

2012-11-07

Müller cells are the major glia of the retina that serve numerous functions essential to retinal homeostasis, yet the contribution of Müller glial dysfunction to retinal diseases remains largely unknown. We have developed a transgenic model using a portion of the regulatory region of the retinaldehyde binding protein 1 gene for conditional Müller cell ablation and the consequences of primary Müller cell dysfunction have been studied in adult mice. We found that selective ablation of Müller cells led to photoreceptor apoptosis, vascular telangiectasis, blood-retinal barrier breakdown and, later, intraretinal neovascularization. These changes were accompanied by impaired retinal function and an imbalance between vascular endothelial growth factor-A (VEGF-A) and pigment epithelium-derived factor. Intravitreal injection of ciliary neurotrophic factor inhibited photoreceptor injury but had no effect on the vasculopathy. Conversely, inhibition of VEGF-A activity attenuated vascular leak but did not protect photoreceptors. Our findings show that Müller glial deficiency may be an important upstream cause of retinal neuronal and vascular pathologies in retinal diseases. Combined neuroprotective and anti-angiogenic therapies may be required to treat Müller cell deficiency in retinal diseases and in other parts of the CNS associated with glial dysfunction.

Conditional Müller cell ablation causes independent neuronal and vascular pathologies in a novel transgenic model

PubMed Central

Shen, Weiyong; Fruttiger, Marcus; Zhu, Ling; Chung, Sook H.; Barnett, Nigel L.; Kirk, Joshua K.; Lee, SoRa; Coorey, Nathan J.; Killingsworth, Murray; Sherman, Larry S.; Gillies, Mark C.

2014-01-01

Müller cells are the major glia of the retina that serve numerous functions essential to retinal homeostasis, yet the contribution of Müller glial dysfunction to retinal diseases remains largely unknown. We have developed a transgenic model using a portion of the regulatory region of the retinaldehyde binding protein 1 gene for conditional Müller cell ablation and the consequences of primary Müller cell dysfunction have been studied in adult mice. We found that selective ablation of Müller cells led to photoreceptor apoptosis, vascular telangiectasis, blood-retinal barrier breakdown and, later, intraretinal neovascularization. These changes were accompanied by impaired retinal function and an imbalance between vascular endothelial growth factor-A (VEGF-A) and pigment epithelium derived factor. Intravitreal injection of cilliary neurotrophic factor inhibited photoreceptor injury but had no effect on the vasculopathy. Conversely, inhibition of VEGF-A activity attenuated vascular leak but did not protect photoreceptors. Our findings show that Müller glial deficiency may be an important upstream cause of retinal neuronal and vascular pathologies in retinal diseases. Combined neuroprotective and anti-angiogenic therapies may be required to treat Müller cell deficiency in retinal diseases and in other parts of the central nervous system associated with glial dysfunction. PMID:23136411

Neuregulin 1 transcripts are differentially expressed in schizophrenia and regulated by 5′ SNPs associated with the disease

PubMed Central

Law, Amanda J.; Lipska, Barbara K.; Weickert, Cynthia Shannon; Hyde, Thomas M.; Straub, Richard E.; Hashimoto, Ryota; Harrison, Paul J.; Kleinman, Joel E.; Weinberger, Daniel R.

2006-01-01

Genetic variation in neuregulin 1 (NRG1) is associated with schizophrenia. The disease-associated SNPs are noncoding, and their functional implications remain unknown. We hypothesized that differential expression of the NRG1 gene explains its association to the disease. We examined four of the disease-associated SNPs that make up the original risk haplotype in the 5′ upstream region of the gene for their effects on mRNA abundance of NRG1 types I–IV in human postmortem hippocampus. Diagnostic comparisons revealed a 34% increase in type I mRNA in schizophrenia and an interaction of diagnosis and genotype (SNP8NRG221132) on this transcript. Of potentially greater interest, a single SNP within the risk haplotype (SNP8NRG243177) and a 22-kb block of this core haplotype are associated with mRNA expression for the novel type IV isoform in patients and controls. Bioinformatic promoter analyses indicate that both SNPs lead to a gain/loss of putative binding sites for three transcription factors, serum response factor, myelin transcription factor-1, and High Mobility Group Box Protein-1. These data implicate variation in isoform expression as a molecular mechanism for the genetic association of NRG1 with schizophrenia. PMID:16618933

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

PubMed

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

PubMed Central

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-01-01

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267

Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

PubMed Central

Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

2013-01-01

Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

Integrated Transcriptomic and Epigenomic Analysis of Primary Human Lung Epithelial Cell Differentiation

PubMed Central

Marconett, Crystal N.; Zhou, Beiyun; Rieger, Megan E.; Selamat, Suhaida A.; Dubourd, Mickael; Fang, Xiaohui; Lynch, Sean K.; Stueve, Theresa Ryan; Siegmund, Kimberly D.; Berman, Benjamin P.

2013-01-01

Elucidation of the epigenetic basis for cell-type specific gene regulation is key to gaining a full understanding of how the distinct phenotypes of differentiated cells are achieved and maintained. Here we examined how epigenetic changes are integrated with transcriptional activation to determine cell phenotype during differentiation. We performed epigenomic profiling in conjunction with transcriptomic profiling using in vitro differentiation of human primary alveolar epithelial cells (AEC). This model recapitulates an in vivo process in which AEC transition from one differentiated cell type to another during regeneration following lung injury. Interrogation of histone marks over time revealed enrichment of specific transcription factor binding motifs within regions of changing chromatin structure. Cross-referencing of these motifs with pathways showing transcriptional changes revealed known regulatory pathways of distal alveolar differentiation, such as the WNT and transforming growth factor beta (TGFB) pathways, and putative novel regulators of adult AEC differentiation including hepatocyte nuclear factor 4 alpha (HNF4A), and the retinoid X receptor (RXR) signaling pathways. Inhibition of the RXR pathway confirmed its functional relevance for alveolar differentiation. Our incorporation of epigenetic data allowed specific identification of transcription factors that are potential direct upstream regulators of the differentiation process, demonstrating the power of this approach. Integration of epigenomic data with transcriptomic profiling has broad application for the identification of regulatory pathways in other models of differentiation. PMID:23818859

Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

PubMed Central

Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

2016-01-01

The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

hobo Induced rearrangements in the yellow locus influence the insulation effect of the gypsy su(Hw)-binding region in Drosophila melanogaster.

PubMed Central

Gause, M; Hovhannisyan, H; Kan, T; Kuhfittig, S; Mogila, V; Georgiev, P

1998-01-01

The su(Hw) protein is responsible for the insulation mediated by the su(Hw)-binding region present in the gypsy retrotransposon. In the y2 mutant, su(Hw) protein partially inhibits yellow transcription by repressing the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. y2 mutation derivatives have been induced by the insertion of two hobo copies on the both sides of gypsy: into the yellow intron and into the 5' regulatory region upstream of the wing and body enhancers. The hobo elements have the same structure and orientation, opposite to the direction of yellow transcription. In the sequence context, where two copies of hobo are separated by the su(Hw)-binding region, hobo-dependent rearrangements are frequently associated with duplications of the region between the hobo elements. Duplication of the su(Hw)-binding region strongly inhibits the insulation of the yellow promoter separated from the body and wing enhancers by gypsy. These results provide a better insight into mechanisms by which the su(Hw)-binding region affects the enhancer function. PMID:9649529

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

PubMed Central

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

2017-01-01

ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

PubMed

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

2017-07-01

Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

RNA Editing and Its Molecular Mechanism in Plant Organelles

PubMed Central

Ichinose, Mizuho; Sugita, Mamoru

2016-01-01

RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

bicaudal-C is required for the formation of anterior neurogenic ectoderm in the sea urchin embryo.

PubMed

Yaguchi, Shunsuke; Yaguchi, Junko; Inaba, Kazuo

2014-10-31

bicaudal-C (bicC) mRNA encodes a protein containing RNA-binding domains that is reported to be maternally present with deflection in the oocytes/eggs of some species. The translated protein plays a critical role in the regulation of cell fate specification along the body axis during early embryogenesis in flies and frogs. However, it is unclear how it functions in eggs in which bicC mRNA is uniformly distributed, for instance, sea urchin eggs. Here, we show the function of BicC in the formation of neurogenic ectoderm of the sea urchin embryo. Loss-of-function experiments reveal that BicC is required for serotonergic neurogenesis and for expression of ankAT-1 gene, which is essential for the formation of apical tuft cilia in the neurogenic ectoderm of the sea urchin embryo. In contrast, the expression of FoxQ2, the neurogenic ectoderm specification transcription factor, is invariant in BicC morphants. Because FoxQ2 is an upstream factor of serotonergic neurogenesis and ankAT-1 expression, these data indicate that BicC functions in regulating the events that are coordinated by FoxQ2 during sea urchin embryogenesis.

Integration host factor is necessary for lysogenization of Escherichia coli by bacteriophage P2.

PubMed

Saha, S; Haggård-Ljungquist, E; Nordström, K

1990-01-01

Whether infection by bacteriophage P2 results in lysogenization of the host or vegetative growth of the phage depends upon a race between transcription from the repressor promoter Pc and the early promoter Pe; transcription from these promoters is mutually exclusive, since the Pc repressor Cox is formed from the Pe transcript and the Pe repressor C from the Pc transcript. The involvement of integration host factor (IHF) in the lysogenization of Escherichia coli K12 by P2 was tested by comparing wild-type and IHF-deficient (himA and himD) mutants. No lysogenic clones were formed following infection of the mutant bacteria. A switch plasmid that contains Pc-C-cat and Pe-cox-kan was used to test the choice for expression of Pc versus Pe. In the wild-type K12 bacteria, 20% of the clones expressed Pe transcription and 80% Pc transcription, whereas all transformed IHF-defective clones expressed transcription from Pe only. The effects of IHF on the in vivo expression of the Pe and Pc promoters were only marginal. The IHF protein was found to bind upstream of the Pe promoter, where a potential ihf sequence is located.

Chromatin Accessibility Mapping Identifies Mediators of Basal Transcription and Retinoid-Induced Repression of OTX2 in Medulloblastoma

PubMed Central

Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping

2014-01-01

Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066

Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

PubMed Central

Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

2007-01-01

Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

PubMed

Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

2014-01-01

Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

Reconstruction of nuclear receptor network reveals that NR2E3 is a novel upstream regulator of ESR1 in breast cancer

PubMed Central

Park, Yun-Yong; Kim, Kyounghyun; Kim, Sang-Bae; Hennessy, Bryan T; Kim, Soo Mi; Park, Eun Sung; Lim, Jae Yun; Li, Jane; Lu, Yiling; Gonzalez-Angulo, Ana Maria; Jeong, Woojin; Mills, Gordon B; Safe, Stephen; Lee, Ju-Seog

2012-01-01

ESR1 is one of the most important transcription factors and therapeutic targets in breast cancer. By applying systems-level re-analysis of publicly available gene expression data, we uncovered a potential regulator of ESR1. We demonstrated that orphan nuclear receptor NR2E3 regulates ESR1 via direct binding to the ESR1 promoter with concomitant recruitment of PIAS3 to the promoter in breast cancer cells, and is essential for physiological cellular activity of ESR1 in estrogen receptor (ER)-positive breast cancer cells. Moreover, expression of NR2E3 was significantly associated with recurrence-free survival and a favourable response to tamoxifen treatment in women with ER-positive breast cancer. Our results provide mechanistic insights on the regulation of ESR1 by NR2E3 and the clinical relevance of NR2E3 in breast cancer. PMID:22174013

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

PubMed

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

2015-11-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

Cloning and functional characterization of the Xenopus orthologue of the Treacher Collins syndrome (TCOF1) gene product.

PubMed

Gonzales, Bianca; Yang, Hushan; Henning, Dale; Valdez, Benigno C

2005-10-10

Treacher Collins syndrome (TCS) is an autosomal dominant disorder of craniofacial development caused by mutations in the TCOF1 gene, which encodes the nucleolar phosphoprotein treacle. We previously reported a function for mammalian treacle in ribosomal DNA gene transcription by its interaction with upstream binding factor. As an initial step in the development of a TCS model for frog the cDNA that encodes the Xenopus laevis treacle was cloned. Although the derived amino acid sequence shows a poor homology with its mammalian orthologues, Xenopus treacle has 11 highly homologous direct repeats near the center of the protein molecule similar to those present in its human, dog and mouse orthologues. Comparison of their amino acid compositions indicates conservation of predominant specific amino acid residues. Antisense-mediated down-regulation of treacle expression in X. laevis oocytes resulted in inhibition of rDNA gene transcription. The results suggest evolutionary conservation of the function of treacle in ribosomal RNA biogenesis in higher eukaryotes.

Notch regulates BMP responsiveness and lateral branching in vessel networks via SMAD6

PubMed Central

Mouillesseaux, Kevin P.; Wiley, David S.; Saunders, Lauren M.; Wylie, Lyndsay A.; Kushner, Erich J.; Chong, Diana C.; Citrin, Kathryn M.; Barber, Andrew T.; Park, Youngsook; Kim, Jun-Dae; Samsa, Leigh Ann; Kim, Jongmin; Liu, Jiandong; Jin, Suk-Won; Bautch, Victoria L.

2016-01-01

Functional blood vessel growth depends on generation of distinct but coordinated responses from endothelial cells. Bone morphogenetic proteins (BMP), part of the TGFβ superfamily, bind receptors to induce phosphorylation and nuclear translocation of SMAD transcription factors (R-SMAD1/5/8) and regulate vessel growth. However, SMAD1/5/8 signalling results in both pro- and anti-angiogenic outputs, highlighting a poor understanding of the complexities of BMP signalling in the vasculature. Here we show that BMP6 and BMP2 ligands are pro-angiogenic in vitro and in vivo, and that lateral vessel branching requires threshold levels of R-SMAD phosphorylation. Endothelial cell responsiveness to these pro-angiogenic BMP ligands is regulated by Notch status and Notch sets responsiveness by regulating a cell-intrinsic BMP inhibitor, SMAD6, which affects BMP responses upstream of target gene expression. Thus, we reveal a paradigm for Notch-dependent regulation of angiogenesis: Notch regulates SMAD6 expression to affect BMP responsiveness of endothelial cells and new vessel branch formation. PMID:27834400

p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding.

PubMed

Itakura, Eisuke; Mizushima, Noboru

2011-01-10

Autophagy is an intracellular degradation process by which cytoplasmic contents are degraded in the lysosome. In addition to nonselective engulfment of cytoplasmic materials, the autophagosomal membrane can selectively recognize specific proteins and organelles. It is generally believed that the major selective substrate (or cargo receptor) p62 is recruited to the autophagosomal membrane through interaction with LC3. In this study, we analyzed loading of p62 and its related protein NBR1 and found that they localize to the endoplasmic reticulum (ER)-associated autophagosome formation site independently of LC3 localization to membranes. p62 colocalizes with upstream autophagy factors such as ULK1 and VMP1 even when autophagosome formation is blocked by wortmannin or FIP200 knockout. Self-oligomerization of p62 is essential for its localization to the autophagosome formation site. These results suggest that p62 localizes to the autophagosome formation site on the ER, where autophagosomes are nucleated. This process is similar to the yeast cytoplasm to vacuole targeting pathway.

Tau and spectraplakins promote synapse formation and maintenance through Jun kinase and neuronal trafficking

PubMed Central

Voelzmann, Andre; Okenve-Ramos, Pilar; Qu, Yue; Chojnowska-Monga, Monika; del Caño-Espinel, Manuela; Prokop, Andreas; Sanchez-Soriano, Natalia

2016-01-01

The mechanisms regulating synapse numbers during development and ageing are essential for normal brain function and closely linked to brain disorders including dementias. Using Drosophila, we demonstrate roles of the microtubule-associated protein Tau in regulating synapse numbers, thus unravelling an important cellular requirement of normal Tau. In this context, we find that Tau displays a strong functional overlap with microtubule-binding spectraplakins, establishing new links between two different neurodegenerative factors. Tau and the spectraplakin Short Stop act upstream of a three-step regulatory cascade ensuring adequate delivery of synaptic proteins. This cascade involves microtubule stability as the initial trigger, JNK signalling as the central mediator, and kinesin-3 mediated axonal transport as the key effector. This cascade acts during development (synapse formation) and ageing (synapse maintenance) alike. Therefore, our findings suggest novel explanations for intellectual disability in Tau deficient individuals, as well as early synapse loss in dementias including Alzheimer’s disease. DOI: http://dx.doi.org/10.7554/eLife.14694.001 PMID:27501441

Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

PubMed Central

Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

2008-01-01

SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

PubMed

Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

2008-04-11

The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

PubMed

Zhao, Xiaoyan; Sze, Sing-Hoi

2011-05-01

One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

DOE PAGES

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

2016-03-26

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

A 10-aa-long sequence in SLP-76 upstream of the Gads binding site is essential for T cell development and function.

PubMed

Kumar, Lalit; Feske, Stefan; Rao, Anjana; Geha, Raif S

2005-12-27

The adapter SLP-76 is essential for T cell development and function. SLP-76 binds to the src homology 3 domain of Lck in vitro. This interaction depends on amino acids 185-194 of SLP-76. To examine the role of the Lck-binding region of SLP-76 in T cell development and function, SLP-76(-/-) mice were reconstituted with an SLP-76 mutant that lacks amino acids 185-194. Double and single positive thymocytes from reconstituted mice were severely reduced in numbers and exhibited impaired positive selection and increased apoptosis. Peripheral T cells were also reduced in numbers, exhibited impaired phospholipase C-gamma1 and Erk phosphorylation, and failed to flux calcium, secrete IL-2, and proliferate in response to T cell antigen receptor ligation. Delayed cutaneous hypersensitivity responses and Ab responses to T cell-dependent antigen were severely impaired. These results indicate that the Lck binding region of SLP-76 is essential for T cell antigen receptor signaling and normal T cell development and function.

Tandem hnRNP A1 RNA recognition motifs act in concert to repress the splicing of survival motor neuron exon 7

PubMed Central

Beusch, Irene; Barraud, Pierre; Moursy, Ahmed; Cléry, Antoine; Allain, Frédéric Hai-Trieu

2017-01-01

HnRNP A1 regulates many alternative splicing events by the recognition of splicing silencer elements. Here, we provide the solution structures of its two RNA recognition motifs (RRMs) in complex with short RNA. In addition, we show by NMR that both RRMs of hnRNP A1 can bind simultaneously to a single bipartite motif of the human intronic splicing silencer ISS-N1, which controls survival of motor neuron exon 7 splicing. RRM2 binds to the upstream motif and RRM1 to the downstream motif. Combining the insights from the structure with in cell splicing assays we show that the architecture and organization of the two RRMs is essential to hnRNP A1 function. The disruption of the inter-RRM interaction or the loss of RNA binding capacity of either RRM impairs splicing repression by hnRNP A1. Furthermore, both binding sites within the ISS-N1 are important for splicing repression and their contributions are cumulative rather than synergistic. DOI: http://dx.doi.org/10.7554/eLife.25736.001 PMID:28650318

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

PubMed

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

PubMed

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

NASA Astrophysics Data System (ADS)

Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

2017-04-01

Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of 886 sub-basins are dependent on upstream water, while in the case of shortage (impacts from insufficient water availability per person), 79 (9%) sub-basins out of 886 sub-basins dependent on upstream water. Categorization of the upstream dependency of the sub-basins helps to differentiate between areas where i) there is currently no dependency on upstream water, ii) upstream water withdrawals are sufficiently high that they alter the scarcity and dependency status, and iii) which are always dependent on upstream water regardless of upstream water withdrawals. Our dependency assessment is expected to considerably support the studies and discussions of hydro-political power relations and management practices in transboundary basins.

Coupling between p210bcr-abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits growth factor receptor-independent link to ras activation pathway.

PubMed

Tauchi, T; Boswell, H S; Leibowitz, D; Broxmeyer, H E

1994-01-01

Enforced expression of p210bcr-abl transforms interleukin 3 (IL-3)-dependent hematopoietic cell lines to growth factor-independent proliferation. It has been demonstrated that nonreceptor tyrosine kinase oncogenes may couple to the p21ras pathway to exert their transforming effect. In particular, p210bcr-abl was recently found to effect p21ras activation in hematopoietic cells. In this context, experiments were performed to evaluate a protein signaling pathway by which p210bcr-abl might regulate p21ras. It was asked whether Shc p46/p52, a protein containing a src-homology region 2 (SH2) domain, and known to function upstream from p21ras, might form specific complexes with p210bcr-abl and thus, possibly alter p21ras activity by coupling to the guanine nucleotide exchange factor (Sos/CDC25) through the Grb2 protein-Sos complex. This latter complex has been previously demonstrated to occur ubiquitously. We found that p210bcr-abl formed a specific complex with Shc and with Grb2 in three different murine cell lines transfected with a p210bcr-abl expression vector. There appeared to be a higher order complex containing Shc, Grb2, and bcr-abl proteins. In contrast to p210bcr-abl transformed cells, in which there was constitutive tight association between Grb2 and Shc, binding between Grb2 and Shc was Steel factor (SLF)-dependent in a SLF-responsive, nontransformed parental cell line. The SLF-dependent association between Grb2 and Shc in nontransformed cells involved formation of a complex of Grb2 with c-kit receptor after SLF treatment. Thus, p210bcr-abl appears to function in a hematopoietic p21ras activation pathway to allow growth factor-independent coupling between Grb2, which exists in a complex with the guanine nucleotide exchange factor (Sos), and p21ras. Shc may not be required for Grb2-c-kit interaction, because it fails to bind strongly to c-kit.

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Expression of the alaE gene is positively regulated by the global regulator Lrp in response to intracellular accumulation of l-alanine in Escherichia coli.

PubMed

Ihara, Kohei; Sato, Kazuki; Hori, Hatsuhiro; Makino, Yumiko; Shigenobu, Shuji; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi

2017-04-01

The alaE gene in Escherichia coli encodes an l-alanine exporter that catalyzes the active export of l-alanine using proton electrochemical potential. In our previous study, alaE expression was shown to increase in the presence of l-alanyl-l-alanine (Ala-Ala). In this study, the global regulator leucine-responsive regulatory protein (Lrp) was identified as an activator of the alaE gene. A promoter less β-galactosidase gene was fused to an alaE upstream region (240 nucleotides). Cells that were lacZ-deficient and harbored this reporter plasmid showed significant induction of β-galactosidase activity (approximately 17-fold) in the presence of 6 mM l-alanine, l-leucine, and Ala-Ala. However, a reporter plasmid possessing a smaller alaE upstream region (180 nucleotides) yielded transformants with strikingly low enzyme activity under the same conditions. In contrast, lrp-deficient cells showed almost no β-galactosidase induction, indicating that Lrp positively regulates alaE expression. We next performed an electrophoretic mobility shift assay (EMSA) and a DNase I footprinting assay using purified hexahistidine-tagged Lrp (Lrp-His). Consequently, we found that Lrp-His binds to the alaE upstream region spanning nucleotide -161 to -83 with a physiologically relevant affinity (apparent K D , 288.7 ± 83.8 nM). Furthermore, the binding affinity of Lrp-His toward its cis-element was increased by l-alanine and l-leucine, but not by Ala-Ala and d-alanine. Based on these results, we concluded that the gene expression of the alaE is regulated by Lrp in response to intracellular levels of l-alanine, which eventually leads to intracellular homeostasis of l-alanine concentrations. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

PubMed Central

Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

1999-01-01

The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

RUNX3 is oncogenic in natural killer/T-cell lymphoma and is transcriptionally regulated by MYC

PubMed Central

Selvarajan, V; Osato, M; Nah, G S S; Yan, J; Chung, T-H; Voon, D C-C; Ito, Y; Ham, M F; Salto-Tellez, M; Shimizu, N; Choo, S-N; Fan, S; Chng, W-J; Ng, S-B

2017-01-01

RUNX3, runt-domain transcription factor, is a master regulator of gene expression in major developmental pathways. It acts as a tumor suppressor in many cancers but is oncogenic in certain tumors. We observed upregulation of RUNX3 mRNA and protein expression in nasal-type extranodal natural killer (NK)/T-cell lymphoma (NKTL) patient samples and NKTL cell lines compared to normal NK cells. RUNX3 silenced NKTL cells showed increased apoptosis and reduced cell proliferation. Potential binding sites for MYC were identified in the RUNX3 enhancer region. Chromatin immunoprecipitation–quantitative PCR revealed binding activity between MYC and RUNX3. Co-transfection of the MYC expression vector with RUNX3 enhancer reporter plasmid resulted in activation of RUNX3 enhancer indicating that MYC positively regulates RUNX3 transcription in NKTL cell lines. Treatment with a small-molecule MYC inhibitor (JQ1) caused significant downregulation of MYC and RUNX3, leading to apoptosis in NKTL cells. The growth inhibition resulting from depletion of MYC by JQ1 was rescued by ectopic MYC expression. In summary, our study identified RUNX3 overexpression in NKTL with functional oncogenic properties. We further delineate that MYC may be an important upstream driver of RUNX3 upregulation and since MYC is upregulated in NKTL, further study on the employment of MYC inhibition as a therapeutic strategy is warranted. PMID:28119527