Two novel translocation breakpoints upstream of SOX9 define borders of the proximal and distal breakpoint cluster region in campomelic dysplasia.

PubMed

Leipoldt, M; Erdel, M; Bien-Willner, G A; Smyk, M; Theurl, M; Yatsenko, S A; Lupski, J R; Lane, A H; Shanske, A L; Stankiewicz, P; Scherer, G

2007-01-01

The semilethal skeletal malformation syndrome campomelic dysplasia (CD) with or without XY sex reversal is caused by mutations within the SOX9 gene on 17q24.3 or by chromosomal aberrations (translocations, inversions or deletions) with breakpoints outside the SOX9 coding region. The previously published CD translocation breakpoints upstream of SOX9 fall into two clusters: a proximal cluster with breakpoints between 50-300 kb and a distal cluster with breakpoints between 899-932 kb. Here, we present clinical, cytogenetic and molecular data from two novel CD translocation cases. Case 1 with karyotype 46,XY,t(1;17)(q42.1;q24.3) has characteristic symptoms of CD, including mild tibial bowing, cryptorchidism and hypospadias. By standard fluorescence in situ hybridization (FISH) and by high-resolution fiber FISH, the 17q breakpoint was mapped 375 kb from SOX9, defining the centromeric border of the proximal breakpoint cluster region. Case 2 with karyotype 46,X,t(Y;17)(q11.2;q24.3) has the acampomelic form of CD and complete XY sex reversal. By FISH and somatic cell hybrid analysis, the 17q breakpoint was mapped 789 kb from SOX9, defining the telomeric border of the distal breakpoint cluster region. We discuss the structure of the 1 Mb cis-control region upstream of SOX9 and the correlation between the position of the 14 mapped translocation breakpoints with respect to disease severity and XY sex reversal.

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Hydraulic connectivity and evaporation control the water quality and sources of chromophoric dissolved organic matter in Lake Bosten in arid northwest China.

PubMed

Zhou, Lei; Zhou, Yongqiang; Hu, Yang; Cai, Jian; Bai, Chengrong; Shao, Keqiang; Gao, Guang; Zhang, Yunlin; Jeppesen, Erik; Tang, Xiangming

2017-12-01

Lake Bosten is the largest oligosaline lake in arid northwestern China, and water from its tributaries and evaporation control the water balance of the lake. In this study, water quality and chromophoric dissolved organic matter (CDOM) absorption and fluorescence were investigated in different seasons to elucidate how hydraulic connectivity and evaporation may affect the water quality and variability of CDOM in the lake. Mean suspended solids and turbidity were significantly higher in the upstream tributaries than in the lake, the difference being notably more pronounced in the wet than in the dry season. A markedly higher mean first principal component (PC1) score, which was significantly positively related to protein-like components, and a considerably lower fluorescence peak integration ratio - I C :I T , indicative of the terrestrial humic-like CDOM contribution percentage, were observed in the lake than in the upstream tributaries. Correspondingly, notably higher contribution percentages of terrestrial humic-like components were observed in the river mouth areas than in the remaining lake regions. Furthermore, significantly higher mean turbidity, and notably lower mean conductivity and salinity, were recorded in the southwestern Kaidu river mouth than in the remaining lake regions in the wet season. Notably higher mean salinity is recorded in Lake Bosten than in upstream tributaries. Autochthonous protein-like associated amino-acids and also PC1 scores increased significantly with increasing salinity. We conclude that the dynamics of water quality and CDOM composition in remote arid Lake Bosten are strongly driven by evaporation and also the hydraulic connectivity between the upstream tributaries and the downstream lake. Copyright © 2017 Elsevier Ltd. All rights reserved.

Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative).

PubMed

Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek

2015-10-01

Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1.

Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative)

PubMed Central

Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek

2015-01-01

Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1. PMID:26423656

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

PubMed

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

PubMed Central

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

Multiple enhancers located in a 1-Mb region upstream of POU3F4 promote expression during inner ear development and may be required for hearing

PubMed Central

Naranjo, Silvia; Voesenek, Krysta; de la Calle-Mustienes, Elisa; Robert-Moreno, Alex; Kokotas, Haris; Grigoriadou, Maria; Economides, John; Van Camp, Guy; Hilgert, Nele; Moreno, Felipe; Alsina, Berta; Petersen, Michael B.; Kremer, Hannie

2010-01-01

POU3F4 encodes a POU-domain transcription factor required for inner ear development. Defects in POU3F4 function are associated with X-linked deafness type 3 (DFN3). Multiple deletions affecting up to ~900-kb upstream of POU3F4 are found in DFN3 patients, suggesting the presence of essential POU3F4 enhancers in this region. Recently, an inner ear enhancer was reported that is absent in most DFN3 patients with upstream deletions. However, two indications suggest that additional enhancers in the POU3F4 upstream region are required for POU3F4 function during inner ear development. First, there is at least one DFN3 deletion that does not eliminate the reported enhancer. Second, the expression pattern driven by this enhancer does not fully recapitulate Pou3f4 expression in the inner ear. Here, we screened a 1-Mb region upstream of the POU3F4 gene for additional cis-regulatory elements and searched for novel DFN3 mutations in the identified POU3F4 enhancers. We found several novel enhancers for otic vesicle expression. Some of these also drive expression in kidney, pancreas and brain, tissues that are known to express Pou3f4. In addition, we report a new and smallest deletion identified so far in a DFN3 family which eliminates 3.9 kb, comprising almost exclusively the previous reported inner ear enhancer. We suggest that multiple enhancers control the expression of Pou3f4 in the inner ear and these may contribute to the phenotype observed in DFN3 patients. In addition, the novel deletion demonstrates that the previous reported enhancer, although not sufficient, is essential for POU3F4 function during inner ear development. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0864-x) contains supplementary material, which is available to authorized users. PMID:20668882

Enhancer elements upstream of the SHOX gene are active in the developing limb.

PubMed

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Enhancer elements upstream of the SHOX gene are active in the developing limb

PubMed Central

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-01-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

Flows, Fields, and Forces in the Mars-Solar Wind Interaction

NASA Astrophysics Data System (ADS)

Halekas, J. S.; Brain, D. A.; Luhmann, J. G.; DiBraccio, G. A.; Ruhunusiri, S.; Harada, Y.; Fowler, C. M.; Mitchell, D. L.; Connerney, J. E. P.; Espley, J. R.; Mazelle, C.; Jakosky, B. M.

2017-11-01

We utilize suprathermal ion and magnetic field measurements from the Mars Atmosphere and Volatile EvolutioN (MAVEN) mission, organized by the upstream magnetic field, to investigate the morphology and variability of flows, fields, and forces in the Mars-solar wind interaction. We employ a combination of case studies and statistical investigations to characterize the interaction in both quasi-parallel and quasi-perpendicular regions and under high and low solar wind Mach number conditions. For the first time, we include a detailed investigation of suprathermal ion temperature and anisotropy. We find that the observed magnetic fields and suprathermal ion moments in the magnetosheath, bow shock, and upstream regions have observable asymmetries controlled by the interplanetary magnetic field, with particularly large asymmetries found in the ion parallel temperature and anisotropy. The greatest temperature anisotropies occur in quasi-perpendicular regions of the magnetosheath and under low Mach number conditions. These results have implications for the growth and evolution of wave-particle instabilities and their role in energy transport and dissipation. We utilize the measured parameters to estimate the average ion pressure gradient, J × B, and v × B macroscopic force terms. The pressure gradient force maintains nearly cylindrical symmetry, while the J × B force has larger asymmetries and varies in magnitude in comparison to the pressure gradient force. The v × B force felt by newly produced planetary ions exceeds the other forces in magnitude in the magnetosheath and upstream regions for all solar wind conditions.

Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

PubMed

Lintas, Carla; Sacco, Roberto; Persico, Antonio M

2016-01-01

Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Waves and Instabilities in Collisionless Shocks

DTIC Science & Technology

1984-04-01

occur in the electron foreshock and are driven by suprathermal electrons escaping into the region upstream of the shock. Both the ion-acoustic and...ULF waves occur in the ion foreshock and are associated with ions streaming into the region upstream of 11 the shock. The region downstream of the...the discussion of these waves it is useful to distinguish two regions, called the electron foreshock and the ion foreshock . Because the particles

Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD

NASA Astrophysics Data System (ADS)

Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.

2016-12-01

The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

Whistler mode waves observed by MGF search coil magnetometer -Polarization and wave normal features of upstream waves near the bow-shock

NASA Astrophysics Data System (ADS)

Hayashi, K.; Matsui, H.; Kawano, H.; Yamamoto, T.; Kokubun, S.

1994-12-01

Whistler mode waves observed in the upstream region very close to the bow-shock is focused from the initial survey for magnetic fed data in a frequency range between 1Hz and 50Hz observed by the search coil magnetometer on board the Geotail satellite. Based on the three component wave form data polarization and wave-normal characteristics of foreshock waves is first shown as dynamic spectra for the whole Fourier components of the 50 Hz band width. Intense whistler mode waves generated in the foot region of the bow-shock are found strongly controlled in the observed polarization dependent on the angle between directions of the wave propagation and the solar wind flow but not very dependent on frequency. Our simple scheme to derive the ware characteristics which is effective to survey large amount of data continuously growing is also introduced.

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.

PubMed

Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd

2015-04-01

SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Whistler Waves Associated with Weak Interplanetary Shocks

NASA Technical Reports Server (NTRS)

Velez, J. C. Ramirez; Blanco-Cano, X.; Aguilar-Rodriguez, E.; Russell, C. T.; Kajdic, P.; Jian,, L. K.; Luhmann, J. G.

2012-01-01

We analyze the properties of 98 weak interplanetary shocks measured by the dual STEREO spacecraft over approximately 3 years during the past solar minimum. We study the occurrence of whistler waves associated with these shocks, which on average are high beta shocks (0.2 < Beta < 10). We have compared the waves properties upstream and downstream of the shocks. In the upstream region the waves are mainly circularly polarized, and in most of the cases (approx. 75%) they propagate almost parallel to the ambient magnetic field (<30 deg.). In contrast, the propagation angle with respect to the shock normal varies in a broad range of values (20 deg. to 90 deg.), suggesting that they are not phase standing. We find that the whistler waves can extend up to 100,000 km in the upstream region but in most cases (88%) are contained in a distance within 30,000 km from the shock. This corresponds to a larger region with upstream whistlers associated with IP shocks than previously reported in the literature. The maximum amplitudes of the waves are observed next to the shock interface, and they decrease as the distance to the shock increases. In most cases the wave propagation direction becomes more aligned with the magnetic field as the distance to the shock increases. These two facts suggest that most of the waves in the upstream region are Landau damping as they move away from the shock. From the analysis we also conclude that it is likely that the generation mechanism of the upstream whistler waves is taking place at the shock interface. In the downstream region, the waves are irregularly polarized, and the fluctuations are very compressive; that is, the compressive component of the wave clearly dominates over the transverse one. The majority of waves in the downstream region (95%) propagate at oblique angles with respect to the ambient magnetic field (>60 deg.). The wave propagation with respect to the shock-normal direction has no preferred direction and varies similarly to the upstream case. It is possible that downstream fluctuations are generated by ion relaxation as suggested in previous hybrid simulation shocks.

Understanding Satellite-based Monthly-to-Seasonal Reservoir Outflow Estimation as a function of Hydrologic Controls

NASA Astrophysics Data System (ADS)

Bonnema, M.; Sikder, M. S.; Hossain, F.; Chen, X.; Miao, Y.; Lee, H.

2015-12-01

Growing population and increased demand for water in developing nations is causing an increase in dam construction in these regions. Entities and stakeholders downstream of dams experience drastically altered river flows. When rivers cross international boundaries, these downstream stakeholders often have little knowledge of upstream reservoir operation practices. Satellite remote sensing in the form of radar altimetry and multi-sensor precipitation products can be used as a way to provide downstream stakeholders with the upstream information needed to make important water management decisions. This study uses a mass balance between three hydraulic controls, precipitation induced inflow, evaporation, and reservoir storage change, to estimate reservoir outflow at a monthly time scale. Two reservoirs were examined in differing regions of the world, the Hungry Horse Reservoir in a mountainous region in northwest U.S. and the Kaptai Reservoir in a low-lying, forested region of Bangladesh. It was found that this mass balance method estimated the outflow of Kaptai Reservoir with reasonable skill when compared with observed flows. The estimation of outflow from Hungry Horse Reservoir was similarly skillful for outflows in winter and fall months, but summer and spring outflow estimates had high errors due to snowmelt effects. Furthermore, it was found that the important hydrologic controls for reservoir outflow estimation at the monthly time scale differs between the two reservoirs, with precipitation induced inflow being the most important control for the Kaptai Reservoir and storage change being the most important for Hungry Horse Reservoir. In both cases, a standard energy balance approach of evaporation estimation appeared to have little effect on the accuracy of outflow estimation.

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study.

PubMed

Alings, M; Smit, M D; Moes, M L; Crijns, H J G M; Tijssen, J G P; Brügemann, J; Hillege, H L; Lane, D A; Lip, G Y H; Smeets, J R L M; Tieleman, R G; Tukkie, R; Willems, F F; Vermond, R A; Van Veldhuisen, D J; Van Gelder, I C

2013-07-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control for prevention of Early AF in heart failure (RACE 3) study hypothesises that aggressive upstream rhythm control increases persistence of sinus rhythm compared with conventional rhythm control in patients with early AF and mild-to-moderate early systolic or diastolic heart failure undergoing electrical cardioversion. RACE 3 is a prospective, randomised, open, multinational, multicenter trial. Upstream rhythm control consists of angiotensin converting enzyme inhibitors and/or angiotensin receptor blockers, mineralocorticoid receptor antagonists, statins, cardiac rehabilitation therapy, and intensive counselling on dietary restrictions, exercise maintenance, and drug adherence. Conventional rhythm control consists of routine rhythm control therapy without cardiac rehabilitation therapy and intensive counselling. In both arms, every effort is made to keep patients in the rhythm control strategy, and ion channel antiarrhythmic drugs or pulmonary vein ablation may be instituted if AF relapses. Total inclusion will be 250 patients. If upstream therapy proves to be effective in improving maintenance of sinus rhythm, it could become a new approach to rhythm control supporting conventional pharmacological and non-pharmacological rhythm control.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Fine Spectral Properties of Langmuir Waves Observed Upstream of the Saturn's Bowshock by the Cassini Wideband Receiver

NASA Astrophysics Data System (ADS)

Hospodarsky, G. B.; Pisa, D.; Santolik, O.; Kurth, W. S.; Soucek, J.; Basovnik, M.; Gurnett, D. A.; Arridge, C. S.

2015-12-01

Langmuir waves are commonly observed in the upstream regions of planetary and interplanetary shock. Solar wind electrons accelerated at the shock front are reflected back into the solar wind and can form electron beams. In regions with beams, the electron distribution becomes unstable and electrostatic waves can be generated. The process of generation and the evolution of electrostatic waves strongly depends on the solar wind electron distribution and generally exhibits complex behavior. Langmuir waves can be identified as intense narrowband emission at a frequency very close to the local plasma frequency and weaker broadband waves below and above the plasma frequency deeper in the downstream region. We present a detailed study of Langmuir waves detected upstream of the Saturnian bowshock by the Cassini spacecraft. Using data from the Radio and Plasma Wave Science (RPWS), Magnetometer (MAG) and Cassini Plasma Spectrometer (CAPS) instruments we have analyzed several periods containing the extended waveform captures by the Wideband Receiver. Langmuir waves are a bursty emission highly controlled by variations in solar wind conditions. Unfortunately due to a combination of instrumental field of view and sampling period, it is often difficult to identify the electron distribution function that is unstable and able to generate Langmuir waves. We used an electrostatic version of particle-in-cell simulation of the Langmuir wave generation process to reproduce some of the more subtle observed spectral features and help understand the late stages of the instability and interactions in the solar wind plasma.

DYNAMICS OF HIGH ENERGY IONS AT A STRUCTURED COLLISIONLESS SHOCK FRONT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gedalin, M.; Dröge, W.; Kartavykh, Y. Y., E-mail: gedalin@bgu.ac.il

2016-07-10

Ions undergoing first-order Fermi acceleration at a shock are scattered in the upstream and downstream regions by magnetic inhomogeneities. For high energy ions this scattering is efficient at spatial scales substantially larger than the gyroradius of the ions. The transition from one diffusive region to the other occurs via crossing the shock, and the ion dynamics during this crossing is mainly affected by the global magnetic field change between the upstream and downstream region. We study the effects of the fine structure of the shock front, such as the foot-ramp-overshoot profile and the phase-standing upstream and downstream magnetic oscillations. Wemore » also consider time dependent features, including reformation and large amplitude coherent waves. We show that the influence of the spatial and temporal structure of the shock front on the dependence of the transition and reflection on the pitch angle of the ions is already weak at ion speeds five times the speed of the upstream flow.« less

Synthetic Promoters Functional in Francisella novicida and Escherichia coli

PubMed Central

McWhinnie, Ralph L.

2014-01-01

In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126

Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

PubMed

Schwank, S; Hoffmann, B; Sch-uller, H J

1997-06-01

Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

Experimental testing of axial induction based control strategies for wake control and wind farm optimization

NASA Astrophysics Data System (ADS)

Bartl, J.; Sætran, L.

2016-09-01

In state-of-the-art wind farms each turbine is controlled individually aiming for optimum turbine power not considering wake effects on downstream turbines. Wind farm control concepts aim for optimizing the overall power output of the farm taking wake interactions between the individual turbines into account. This experimental wind tunnel study investigates axial induction based control concepts. It is examined how the total array efficiency of two in-line model turbines is affected when the upstream turbine's tip speed ratio (λcontrol) or blade pitch angle (β-control) is modified. The focus is particularly directed on how the wake flow behind the upstream rotor is affected when its axial induction is reduced in order to leave more kinetic energy in the wake to be recovered by a downstream turbine. It is shown that the radial distribution of kinetic energy in the wake area can be controlled by modifying the upstream turbine's tip speed ratio. By pitching out the upstream turbine's blades, however, the available kinetic energy in the wake is increased at an equal rate over the entire blade span. Furthermore, the total array efficiency of the two turbine setup is mapped depending on the upstream turbines tip speed ratio and pitch angle. For a small turbine separation distance of x/D=3 the downstream turbine is able to recover the major part of the power lost on the upstream turbine. However, no significant increase in the two-turbine array efficiency is achieved by altering the upstream turbine's operation point away from its optimum.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Transition control of Mach to regular reflection induced interaction using an array of micro ramp vane-type vortex generators

NASA Astrophysics Data System (ADS)

Verma, Shashi B.; Chidambaranathan, Manisankar

2015-10-01

An experimental investigation has been conducted to favorably control/modify a Mach reflection induced interaction in a Mach 2.05 flow on a flat plate using an array of single row mechanical micro vane-type vortex generators (VGs). The objective was to study the variation in (i) control device configuration (trapezoidal and the split-trapezoidal or ramp vane-type), (ii) control device height (h/δ = 0.3, 0.5), and (iii) control location (X/δ = 9, 15 upstream of the interaction) in controlling the overall interaction. The primary aim was to investigate a control location and VG configuration which is able to effectively initiate a transition from Mach reflection to regular reflection with minimum changes to the separation characteristics for no control. While the trapezoidal configuration is seen to move the separation location upstream only slightly, the split-trapezoidal configurations result in a considerable upstream movement that is associated with significant reduction in separation shock strength. The latter flow modification causes the Mach stem to completely disappear resulting in a transition from Mach to regular reflection. The control location of X/δ = 15 seems to be most effective for all control device configurations tested. It is further observed that whilst the effectiveness of the split-trapezoidal configuration of h/δ = 0.3 in controlling the transition improves with increasing X/δ, increasing its height to h/δ = 0.5 not only controls the transition process but is also able to control the extent of separation. All the control devices, however, are seen to increase the flow unsteadiness in the intermittent region of separation for both control locations. From this perspective, increasing the height of the control device seems favorable for the closer control location as it not only completely modifies the Mach reflection but also keeps the peak rms value similar to the baseline case.

B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

PubMed Central

Selinger, David A.; Chandler, Vicki L.

2001-01-01

The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

A Numerical Study of the Effect of Wake Passing on Turbine Blade Film Cooling

NASA Technical Reports Server (NTRS)

Heidmann, James D.

1995-01-01

Time-accurate and steady three-dimensional viscous turbulent numerical simulations were performed to study the effect of upstream blade wake passing unsteadiness on the performance of film cooling on a downstream axial turbine blade. The simulations modeled the blade as spanwise periodic and of infinite span. Both aerodynamic and heat transfer quantities were explored. A showerhead film cooling arrangement typical of modern gas turbine engines was employed. Showerhead cooling was studied because of its anticipated strong sensitivity to upstream flow fluctuations. The wake was modeled as a region of zero axial velocity on the upstream computational boundary which translated with each iteration. This model is compatible with a planned companion experiment in which the wakes will be produced by a rotating row of cylindrical rods upstream of an annular turbine cascade. It was determined that a steady solution with appropriate upstream swirl and stagnation pressure predicted the span-average film effectiveness quite well. The major difference is a 2 to 3 percent overprediction of span-average film effectiveness by the steady simulation on the pressure surface and in the showerhead region. Local overpredictions of up to 8 percent were observed in the showerhead region. These differences can be explained by the periodic relative lifting of the boundary layer and enhanced mixing in the unsteady simulations.

Performance Enhancement by Threshold Level Control of a Receiver in WDM-PON System with Manchester Coded Downstream and NRZ Upstream Re-Modulation

NASA Astrophysics Data System (ADS)

Kim, Bong Kyu; Chung, Hwan Seok; Chang, Sun Hyok; Park, Sangjo

We propose and demonstrate a scheme enhancing the performance of optical access networks with Manchester coded downstream and re-modulated NRZ coded upstream. It is achieved by threshold level control of a limiting amplifier at a receiver, and the minimum sensitivity of upstream is significantly improved for the re-modulation scheme with 5Gb/s Manchester coded downstream and 2.488Gb/s NRZ upstream data rates.

Increased upstream ionization due to formation of a double layer.

PubMed

Thakur, S Chakraborty; Harvey, Z; Biloiu, I A; Hansen, A; Hardin, R A; Przybysz, W S; Scime, E E

2009-01-23

We report observations that confirm a theoretical prediction that formation of a current-free double layer in a plasma expanding into a chamber of larger diameter is accompanied by an increase in ionization upstream of the double layer. The theoretical model argues that the increased ionization is needed to balance the difference in diffusive losses upstream and downstream of the expansion region. In our expanding helicon source experiments, we find that the upstream plasma density increases sharply at the same antenna frequency at which the double layer appears.

Short wavelength ion waves upstream of the earth's bow shock

NASA Technical Reports Server (NTRS)

Fuselier, S. A.; Gurnett, D. A.

1984-01-01

The identification and explanation of short wavelength antenna interference effects observed in spacecraft plasma wave data have provided an important new method of determining limits on the wavelength, direction of propagation, and Doppler shift of short wavelength electrostatic waves. Using the ISEE-1 wideband electric field data, antenna interference effects have been identified in the ion waves upstream of the earth's bow shock. This identification implies that wavelengths of the upstream ion waves are shorter than the antenna length. The interference effects also provide new measurements of the direction of propagation of the ion waves. The new measurements show that the wave vectors of the ion waves are not parallel to the interplanetary magnetic field (IMF) as previously reported. The direction of propagation does not appear to be controlled by the IMF. In addition, analysis of the Doppler shift of the short wavelength ion waves has provided a measurement of the dispersion relation. The upper limit of the rest frame frequency was found to be on the order of the ion plasma frequency. At this frequency, the wavelength is on the order of a few times the Debye length. The results of this study now provide strong evidence that the ion waves in the upstream region are Doppler-shifted ion acoustic waves. Previously announced in STAR as N83-36328

Effects of climate change on streamflow extremes and implications for reservoir inflow in the United States

NASA Astrophysics Data System (ADS)

Naz, Bibi S.; Kao, Shih-Chieh; Ashfaq, Moetasim; Gao, Huilin; Rastogi, Deeksha; Gangrade, Sudershan

2018-01-01

The magnitude and frequency of hydrometeorological extremes are expected to increase in the conterminous United States (CONUS) over the rest of this century, and their increase will significantly impact water resource management. In this study, we evaluated the large-scale climate change effects on extreme hydrological events and their implications for reservoir inflows in 138 headwater subbasins located upstream of reservoirs across CONUS using the Variable Infiltration Capacity (VIC) hydrologic model. The VIC model was forced with a 10-member ensemble of global circulation models under the Representative Concentration Pathway 8.5 that were dynamically downscaled using a regional climate model (RegCM4) and bias-corrected to 1/24° grid cell resolution. Four commonly used indices, including mean annual flow, annual center timing, 100-year daily high streamflow, and 10-year 7-day average low streamflow were used for evaluation. The results projected an increase in the high streamflow by 44% for a majority of subbasins upstream of flood control reservoirs in the central United States (US) and a decrease in the low streamflow by 11% for subbasins upstream of hydropower reservoirs across the western US. In the eastern US, frequencies of both high and low streamflow were projected to increase in the majority of subbasins upstream of both hydropower and flood control reservoirs. Increased frequencies of both high and low streamflow events can potentially make reservoirs across CONUS more vulnerable to future climate conditions. This study estimates reservoir inflow changes over the next several decades, which can be used to optimize water supply management downstream.

Understanding satellite-based monthly-to-seasonal reservoir outflow estimation as a function of hydrologic controls

NASA Astrophysics Data System (ADS)

Bonnema, Matthew; Sikder, Safat; Miao, Yabin; Chen, Xiaodong; Hossain, Faisal; Ara Pervin, Ismat; Mahbubur Rahman, S. M.; Lee, Hyongki

2016-05-01

Growing population and increased demand for water is causing an increase in dam and reservoir construction in developing nations. When rivers cross international boundaries, the downstream stakeholders often have little knowledge of upstream reservoir operation practices. Satellite remote sensing in the form of radar altimetry and multisensor precipitation products can be used as a practical way to provide downstream stakeholders with the fundamentally elusive upstream information on reservoir outflow needed to make important and proactive water management decisions. This study uses a mass balance approach of three hydrologic controls to estimate reservoir outflow from satellite data at monthly and annual time scales: precipitation-induced inflow, evaporation, and reservoir storage change. Furthermore, this study explores the importance of each of these hydrologic controls to the accuracy of outflow estimation. The hydrologic controls found to be unimportant could potentially be neglected from similar future studies. Two reservoirs were examined in contrasting regions of the world, the Hungry Horse Reservoir in a mountainous region in northwest U.S. and the Kaptai Reservoir in a low-lying, forested region of Bangladesh. It was found that this mass balance method estimated the annual outflow of both reservoirs with reasonable skill. The estimation of monthly outflow from both reservoirs was however less accurate. The Kaptai basin exhibited a shift in basin behavior resulting in variable accuracy across the 9 year study period. Monthly outflow estimation from Hungry Horse Reservoir was compounded by snow accumulation and melt processes, reflected by relatively low accuracy in summer and fall, when snow processes control runoff. Furthermore, it was found that the important hydrologic controls for reservoir outflow estimation at the monthly time scale differs between the two reservoirs, with precipitation-induced inflow being the most important control for the Kaptai Reservoir and storage change being the most important for Hungry Horse Reservoir.

ION ACCELERATION AT THE QUASI-PARALLEL BOW SHOCK: DECODING THE SIGNATURE OF INJECTION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sundberg, Torbjörn; Haynes, Christopher T.; Burgess, D.

Collisionless shocks are efficient particle accelerators. At Earth, ions with energies exceeding 100 keV are seen upstream of the bow shock when the magnetic geometry is quasi-parallel, and large-scale supernova remnant shocks can accelerate ions into cosmic-ray energies. This energization is attributed to diffusive shock acceleration; however, for this process to become active, the ions must first be sufficiently energized. How and where this initial acceleration takes place has been one of the key unresolved issues in shock acceleration theory. Using Cluster spacecraft observations, we study the signatures of ion reflection events in the turbulent transition layer upstream of the terrestrial bowmore » shock, and with the support of a hybrid simulation of the shock, we show that these reflection signatures are characteristic of the first step in the ion injection process. These reflection events develop in particular in the region where the trailing edge of large-amplitude upstream waves intercept the local shock ramp and the upstream magnetic field changes from quasi-perpendicular to quasi-parallel. The dispersed ion velocity signature observed can be attributed to a rapid succession of ion reflections at this wave boundary. After the ions’ initial interaction with the shock, they flow upstream along the quasi-parallel magnetic field. Each subsequent wavefront in the upstream region will sweep the ions back toward the shock, where they gain energy with each transition between the upstream and the shock wave frames. Within three to five gyroperiods, some ions have gained enough parallel velocity to escape upstream, thus completing the injection process.« less

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Unsteady loading of a vertical-axis turbine in the interaction with an upstream deflector

NASA Astrophysics Data System (ADS)

Kim, Daegyoum; Gharib, Morteza

2014-01-01

Torque generation and flow distribution of a lift-based vertical-axis turbine with an upstream deflecting plate are investigated in water tunnel experiments. The deployment of a deflector in front of a lift-based turbine is a promising approach to increase local flow velocity and enhance energy conversion efficiency without consideration for complicated control. For the turbine with the deflector, the phase during which the blade passes near the front end of the turbine has a major contribution to torque increase from the case without the deflector. Meanwhile, the deflector can have a negative effect in torque generation at the phase when the blade moves upstream against free stream if the turbine is placed close to the deflector in a crosswise direction. The change of nearby flow distribution by the deflector is also examined to find its correlation with torque generation. When the blade rotates through the near-wake region of the deflector, the blade can collides with the vortical structure shed from the deflector. This interaction causes significant torque fluctuation.

Analysis by oxygen atom number density measurement of high-speed hydrophilic treatment of polyimide using atmospheric pressure microwave plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ono, S.

2015-03-30

This paper describes the fundamental experimental data of the plasma surface modification of the polyimide using atmospheric pressure microwave plasma source. The experimental results were discussed from the point of view of the radical’s behavior, which significantly affects the modification mechanism. The purpose of the study is to examine how the value of the oxygen atom density will affect the hydrophilic treatment in the upstream region of the plasma where gas temperature is very high. The surface modification experiments were performed by setting the polyimide film sample in the downstream region of the plasma. The degree of the modification wasmore » measured by a water contact angle measurement. The water contact angle decreased less than 30 degrees within 1 second treatment time in the upstream region. Very high speed modification was observed. The reason of this high speed modification seems that the high density radical which contributes the surface modification exist in the upstream region of the plasma. This tendency is supposed to the measured relatively high electron density (~10{sup 15}cm{sup −3}) at the center of the plasma. We used the electric heating catalytic probe method for oxygen radical measurement. An absolute value of oxygen radical density was determined by catalytic probe measurement and the results show that ~10{sup 15}cm{sup −3} of the oxygen radical density in the upstream region and decreases toward downstream region. The experimental results of the relation of the oxygen radical density and hydrophilic modification of polyimide was discussed.« less

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes along Different Microtubule Tracks.

PubMed

Guardia, Carlos M; Farías, Ginny G; Jia, Rui; Pu, Jing; Bonifacino, Juan S

2016-11-15

The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multi-subunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here, we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. Published by Elsevier Inc.

BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes Along Different Microtubule Tracks

PubMed Central

Guardia, Carlos M.; Farías, Ginny G.; Jia, Rui; Pu, Jing; Bonifacino, Juan S.

2016-01-01

Summary The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multisubunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. PMID:27851960

Two-stage bulk electron heating in the diffusion region of anti-parallel symmetric reconnection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le, Ari Yitzchak; Egedal, Jan; Daughton, William Scott

2016-10-13

Electron bulk energization in the diffusion region during anti-parallel symmetric reconnection entails two stages. First, the inflowing electrons are adiabatically trapped and energized by an ambipolar parallel electric field. Next, the electrons gain energy from the reconnection electric field as they undergo meandering motion. These collisionless mechanisms have been described previously, and they lead to highly structured electron velocity distributions. Furthermore, a simplified control-volume analysis gives estimates for how the net effective heating scales with the upstream plasma conditions in agreement with fully kinetic simulations and spacecraft observations.

An experimental and numerical study of wave motion and upstream influence in a stratified fluid

NASA Technical Reports Server (NTRS)

Hurdis, D. A.

1974-01-01

A system consisting of two superimposed layers of liquid of different densities, with a thin transition layer at the interface, provides a good laboratory model of an ocean thermocline or of an atmospheric inversion layer. This research was to gain knowledge about the propagation of disturbances within these two geophysical systems. The technique used was to observe the propagation of internal waves and of upstream influence within the density-gradient region between the two layers of liquid. The disturbances created by the motion of a vertical flat plate, which was moved longitudinally through this region, were examined both experimentally and numerically. An upstream influence, which resulted from a balance of inertial and gravitational forces, was observed, and it was possible to predict the behavior of this influence with the numerical model. The prediction included a description of the propagation of the upstream influence to steadily increasing distances from the flat plate and the shapes and magnitudes of the velocity profiles.

Assessing selenium contamination in the irrigated stream-aquifer system of the Arkansas River, Colorado.

PubMed

Gates, Timothy K; Cody, Brent M; Donnelly, Joseph P; Herting, Alexander W; Bailey, Ryan T; Mueller Price, Jennifer

2009-01-01

Prudent interventions for reducing selenium (Se) in groundwater and streams within an irrigated river valley must be guided by a sound understanding of current field conditions. An emerging picture of the nature of Se contamination within the Lower Arkansas River Valley in Colorado is provided by data from a large number of groundwater and surface water sampling locations within two study regions along the river. Measurements show that dissolved Se concentrations in the river are about double the current Colorado Department of Public Health and Environment (CDPHE) chronic standard of 4.6 microg L(-1) for aquatic habitat in the upstream region and exceed the standard by a factor of 2 to 4 in the downstream region. Groundwater concentrations average about 57.7 microg L(-1) upstream and 33.0 microg L(-1) downstream, indicating a large subsurface source for irrigation-induced dissolution and mobilization of Se loads to the river and its tributaries. Inverse correlation was found between Se concentration and the distance to the closest identified shale in the direction upstream along the principal groundwater flow gradient. The data also exhibited, among other relationships, a moderate to strong correlation between dissolved Se and total dissolved solids in groundwater and surface water, a strong correlation with uranium in groundwater, and power relationships with nitrate in groundwater. The relationship to nitrate, derived primarily from N fertilizers, reveals the degree to which dissolved Se depends on oxidation and inhibited reduction due to denitrification and suggests that there are prospects for reducing dissolved Se through nitrate control. Current and future results from these ongoing studies will help provide a foundation for modeling and for the discovery of best management practices (BMPs) in irrigated agriculture that can diminish Se contamination.

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Duplication of SOX9 associated with 46,XX ovotesticular disorder of sex development.

PubMed

López-Hernández, Berenice; Méndez, Juan Pablo; Coral-Vázquez, Ramón Mauricio; Benítez-Granados, Jesús; Zenteno, Juan Carlos; Villegas-Ruiz, Vanessa; Calzada-León, Raúl; Soderlund, Daniela; Canto, Patricia

2018-04-04

The purpose of the present study was to investigate whether ten unrelated SRY-negative individuals with this sex differentiation disorder presented a double dose of SOX9 as the cause of their disease. Ten unrelated SRY-negative 46,XX ovotesticular disorder of sexual development (DSD) subjects were molecularly studied. Multiplex-ligation dependent probe amplification (MLPA) and quantitative real-time PCR analysis (qRT-PCR) for SOX9 were performed. The MLPA analysis demonstrated that one patient presented a heterozygous duplication of the entire SOX9 coding region (above 1.3 value of peak ratio), as well as at least a ~ 483 kb upstream duplication. Moreover, no duplication of other SOX9 probes was observed corresponding to the region between -1007 and -1500 kb upstream. A qRT-PCR analysis showed a duplication of at least -581 kb upstream and ~1.63 kb of the coding region that encompasses exon 3. The limits of the duplication were mapped approximately from ~71539762 to 72122741 of Chr17. No molecular abnormalities were found in the remaining nine patients. This study is thought to be the first report regarding a duplication of SOX9 that is associated with the presence of 46,XX ovotesticular DSD, encompassing at least -581 kb upstream, and the almost entire coding region of the gene. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

ENERGETIC PARTICLE PRESSURE AT INTERPLANETARY SHOCKS: STEREO-A OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lario, D.; Decker, R. B.; Roelof, E. C.

2015-11-10

We study periods of elevated energetic particle intensities observed by STEREO-A when the partial pressure exerted by energetic (≥83 keV) protons (P{sub EP}) is larger than the pressure exerted by the interplanetary magnetic field (P{sub B}). In the majority of cases, these periods are associated with the passage of interplanetary shocks. Periods when P{sub EP} exceeds P{sub B} by more than one order of magnitude are observed in the upstream region of fast interplanetary shocks where depressed magnetic field regions coincide with increases of energetic particle intensities. When solar wind parameters are available, P{sub EP} also exceeds the pressure exertedmore » by the solar wind thermal population (P{sub TH}). Prolonged periods (>12 hr) with both P{sub EP} > P{sub B} and P{sub EP} > P{sub TH} may also occur when energetic particles accelerated by an approaching shock encounter a region well upstream of the shock characterized by low magnetic field magnitude and tenuous solar wind density. Quasi-exponential increases of the sum P{sub SUM} = P{sub B} + P{sub TH} + P{sub EP} are observed in the immediate upstream region of the shocks regardless of individual changes in P{sub EP}, P{sub B}, and P{sub TH}, indicating a coupling between P{sub EP} and the pressure of the background medium characterized by P{sub B} and P{sub TH}. The quasi-exponential increase of P{sub SUM} implies a radial gradient ∂P{sub SUM}/∂r > 0 that is quasi-stationary in the shock frame and results in an outward force applied to the plasma upstream of the shock. This force can be maintained by the mobile energetic particles streaming upstream of the shocks that, in the most intense events, drive electric currents able to generate diamagnetic cavities and depressed solar wind density regions.« less

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Lunar Surface Electric Potential Changes Associated with Traversals through the Earth's Foreshock

NASA Technical Reports Server (NTRS)

Collier, Michael R.; Hills, H. Kent; Stubbs, Timothy J.; Halekas, Jasper S.; Delory, Gregory T.; Espley, Jared; Farrell, William M.; Freeman, John W.; Vondrak, Richard

2011-01-01

We report an analysis of one year of Suprathermal Ion Detector Experiment (SIDE) Total Ion Detector (TID) resonance events observed between January 1972 and January 1973. The study includes only those events during which upstream solar wind conditions were readily available. The analysis shows that these events are associated with lunar traversals through the dawn flank of the terrestrial magnetospheric bow shock. We propose that the events result from an increase in lunar surface electric potential effected by secondary electron emission due to primary electrons in the Earth's foreshock region (although primary ions may play a role as well). This work establishes (1) the lunar surface potential changes as the Moon moves through the terrestrial bow shock, (2) the lunar surface achieves potentials in the upstream foreshock region that differ from those in the downstream magnetosheath region, (3) these differences can be explained by the presence of energetic electron beams in the upstream foreshock region and (4) if this explanation is correct, the location of the Moon with respect to the terrestrial bow shock influences lunar surface potential.

An Experimental Study of the Near Field Region of a Free Jet with Passive Mixing Tabs

NASA Technical Reports Server (NTRS)

Bohl, D. G.; Foss, J. F.

1997-01-01

An experimental study was performed to determine the flow characteristics of a tabbed free jet. Results were acquired in the near field (nominally 2 tab widths upstream to 2 tab widths downstream of the exit plane) of a tabbed jet. Upstream pressure results showed static pressure distributions in both the x-and y-directions along the top surface of the tunnel. Hot-wire measurements showed rapid expansion of the core fluid into the ambient region. Two counter rotating regions of streamwise vorticity were shown on each side of the primary tab. An enhancement of the tabbed jet concept was proposed and tested. Specifically, two tabs, half the scale of the primary tab, were added to the primary tab to provide attachment surfaces for the normally occurring ejection of fluid. The secondary tabs caused a slight increase in the streamwise vorticity created from the upstream static pressure gradient while significantly increasing the re-oriented boundary layer vorticity. The combined pumping effect of the two counter rotating regions of vorticity caused a significant increase in the transport of the jet core fluid into the surrounding region.

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

PubMed

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

CHST6 mutations in North American subjects with macular corneal dystrophy: a comprehensive molecular genetic review.

PubMed

Klintworth, Gordon K; Smith, Clayton F; Bowling, Brandy L

2006-03-10

To evaluate mutations in the carbohydrate sulfotransferase-6 (CHST6) gene in American subjects with macular corneal dystrophy (MCD). We analyzed CHST6 in 57 patients from 31 families with MCD from the United States, 57 carriers (parents or children), and 27 unaffected blood relatives of affected subjects. We compared the observed nucleotide sequences with those found by numerous investigators in other populations with MCD and in controls. In 24 families, the corneal disorder could be explained by mutations in the coding region of CHST6 or in the region upstream of this gene in both the maternal and paternal chromosome. In most instances of MCD a homozygous or heterozygous missense mutation in exon 3 of CHST6 was found. Six cases resulted from a deletion upstream of CHST6. Nucleotide changes within the coding region of CHST6 are predicted to alter the encoded protein significantly within evolutionary conserved parts of the encoded sulfotransferase. Our findings support the hypothesis that CHST6 mutations are cardinal to the pathogenesis of MCD. Moreover, the observation that some cases of MCD cannot be explained by mutations in CHST6 suggests that MCD may result from other subtle changes in CHST6 or from genetic heterogeneity.

Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.

PubMed

Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa

2015-01-01

Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.

INJECTION TO RAPID DIFFUSIVE SHOCK ACCELERATION AT PERPENDICULAR SHOCKS IN PARTIALLY IONIZED PLASMAS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohira, Yutaka, E-mail: ohira@phys.aoyama.ac.jp

2016-08-10

We present a three-dimensional hybrid simulation of a collisionless perpendicular shock in a partially ionized plasma for the first time. In this simulation, the shock velocity and upstream ionization fraction are v {sub sh} ≈ 1333 km s{sup −1} and f {sub i} ∼ 0.5, which are typical values for isolated young supernova remnants (SNRs) in the interstellar medium. We confirm previous two-dimensional simulation results showing that downstream hydrogen atoms leak into the upstream region and are accelerated by the pickup process in the upstream region, and large magnetic field fluctuations are generated both in the upstream and downstream regions.more » In addition, we find that the magnetic field fluctuations have three-dimensional structures and the leaking hydrogen atoms are injected into the diffusive shock acceleration (DSA) at the perpendicular shock after the pickup process. The observed DSA can be interpreted as shock drift acceleration with scattering. In this simulation, particles are accelerated to v ∼ 100 v {sub sh} ∼ 0.3 c within ∼100 gyroperiods. The acceleration timescale is faster than that of DSA in parallel shocks. Our simulation results suggest that SNRs can accelerate cosmic rays to 10{sup 15.5} eV (the knee) during the Sedov phase.« less

Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture

NASA Technical Reports Server (NTRS)

Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.

1983-01-01

Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.

22. UPSTREAM VIEW OF THE OUTLET CONTROL STRUCTURE AND THE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

22. UPSTREAM VIEW OF THE OUTLET CONTROL STRUCTURE AND THE PIER FOR THE SERVICE BRIDGE.... Volume XVIII, No. 12, January 29, 1940. - Prado Dam, Outlet Works, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

Alteration of ROS Homeostasis and Decreased Lifespan in S. cerevisiae Elicited by Deletion of the Mitochondrial Translocator FLX1

PubMed Central

Giancaspero, Teresa Anna; Dipalo, Emilia; Miccolis, Angelica; Boles, Eckhard; Caselle, Michele; Barile, Maria

2014-01-01

This paper deals with the control exerted by the mitochondrial translocator FLX1, which catalyzes the movement of the redox cofactor FAD across the mitochondrial membrane, on the efficiency of ATP production, ROS homeostasis, and lifespan of S. cerevisiae. The deletion of the FLX1 gene resulted in respiration-deficient and small-colony phenotype accompanied by a significant ATP shortage and ROS unbalance in glycerol-grown cells. Moreover, the flx1Δ strain showed H2O2 hypersensitivity and decreased lifespan. The impaired biochemical phenotype found in the flx1Δ strain might be justified by an altered expression of the flavoprotein subunit of succinate dehydrogenase, a key enzyme in bioenergetics and cell regulation. A search for possible cis-acting consensus motifs in the regulatory region upstream SDH1-ORF revealed a dozen of upstream motifs that might respond to induced metabolic changes by altering the expression of Flx1p. Among these motifs, two are present in the regulatory region of genes encoding proteins involved in flavin homeostasis. This is the first evidence that the mitochondrial flavin cofactor status is involved in controlling the lifespan of yeasts, maybe by changing the cellular succinate level. This is not the only case in which the homeostasis of redox cofactors underlies complex phenotypical behaviours, as lifespan in yeasts. PMID:24895546

The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

PubMed Central

Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

2015-01-01

Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

Turbine exhaust diffuser with a gas jet producing a coanda effect flow control

DOEpatents

Orosa, John; Montgomery, Matthew

2014-02-11

An exhaust diffuser system and method for a turbine engine includes an inner boundary and an outer boundary with a flow path defined therebetween. The inner boundary is defined at least in part by a hub structure that has an upstream end and a downstream end. The outer boundary may include a region in which the outer boundary extends radially inward toward the hub structure and may direct at least a portion of an exhaust flow in the diffuser toward the hub structure. The hub structure includes at least one jet exit located on the hub structure adjacent to the upstream end of the tail cone. The jet exit discharges a flow of gas substantially tangential to an outer surface of the tail cone to produce a Coanda effect and direct a portion of the exhaust flow in the diffuser toward the inner boundary.

Topological Principles of Control in Dynamical Networks

NASA Astrophysics Data System (ADS)

Kim, Jason; Pasqualetti, Fabio; Bassett, Danielle

Networked biological systems, such as the brain, feature complex patterns of interactions. To predict and correct the dynamic behavior of such systems, it is imperative to understand how the underlying topological structure affects and limits the function of the system. Here, we use network control theory to extract topological features that favor or prevent network controllability, and to understand the network-wide effect of external stimuli on large-scale brain systems. Specifically, we treat each brain region as a dynamic entity with real-valued state, and model the time evolution of all interconnected regions using linear, time-invariant dynamics. We propose a simplified feed-forward scheme where the effect of upstream regions (drivers) on the connected downstream regions (non-drivers) is characterized in closed-form. Leveraging this characterization of the simplified model, we derive topological features that predict the controllability properties of non-simplified networks. We show analytically and numerically that these predictors are accurate across a large range of parameters. Among other contributions, our analysis shows that heterogeneity in the network weights facilitate controllability, and allows us to implement targeted interventions that profoundly improve controllability. By assuming an underlying dynamical mechanism, we are able to understand the complex topology of networked biological systems in a functionally meaningful way.

VIEW OF UPSTREAM (EAST) SIDES OF UPPER (EAST) END OF ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

VIEW OF UPSTREAM (EAST) SIDES OF UPPER (EAST) END OF LOCK, SOUTHEAST AND NORTHEAST CONTROL HOUSES, LOCK UNDER REPAIR, BUILDING NOS. 51, 52 AND SOUTHWEST CONTROL HOUSE IN BACKGROUND, VIEW TOWARDS WEST-NORTHWEST - Ortona Lock, Lock No. 2, Machinery and Control Houses, Caloosahatchee River, Cross-State Canal, Okeechobee Intracoastal Waterway, Ortona, Glades County, FL

Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

PubMed

Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

2002-04-24

The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

Auditory cortex stimulation to suppress tinnitus: mechanisms and strategies.

PubMed

Zhang, Jinsheng

2013-01-01

Brain stimulation is an important method used to modulate neural activity and suppress tinnitus. Several auditory and non-auditory brain regions have been targeted for stimulation. This paper reviews recent progress on auditory cortex (AC) stimulation to suppress tinnitus and its underlying neural mechanisms and stimulation strategies. At the same time, the author provides his opinions and hypotheses on both animal and human models. The author also proposes a medial geniculate body (MGB)-thalamic reticular nucleus (TRN)-Gating mechanism to reflect tinnitus-related neural information coming from upstream and downstream projection structures. The upstream structures include the lower auditory brainstem and midbrain structures. The downstream structures include the AC and certain limbic centers. Both upstream and downstream information is involved in a dynamic gating mechanism in the MGB together with the TRN. When abnormal gating occurs at the thalamic level, the spilled-out information interacts with the AC to generate tinnitus. The tinnitus signals at the MGB-TRN-Gating may be modulated by different forms of stimulations including brain stimulation. Each stimulation acts as a gain modulator to control the level of tinnitus signals at the MGB-TRN-Gate. This hypothesis may explain why different types of stimulation can induce tinnitus suppression. Depending on the tinnitus etiology, MGB-TRN-Gating may be different in levels and dynamics, which cause variability in tinnitus suppression induced by different gain controllers. This may explain why the induced suppression of tinnitus by one type of stimulation varies across individual patients. Copyright © 2012. Published by Elsevier B.V.

Full equations utilities (FEQUTL) model for the approximation of hydraulic characteristics of open channels and control structures during unsteady flow

USGS Publications Warehouse

Franz, Delbert D.; Melching, Charles S.

1997-01-01

The Full EQuations UTiLities (FEQUTL) model is a computer program for computation of tables that list the hydraulic characteristics of open channels and control structures as a function of upstream and downstream depths; these tables facilitate the simulation of unsteady flow in a stream system with the Full Equations (FEQ) model. Simulation of unsteady flow requires many iterations for each time period computed. Thus, computation of hydraulic characteristics during the simulations is impractical, and preparation of function tables and application of table look-up procedures facilitates simulation of unsteady flow. Three general types of function tables are computed: one-dimensional tables that relate hydraulic characteristics to upstream flow depth, two-dimensional tables that relate flow through control structures to upstream and downstream flow depth, and three-dimensional tables that relate flow through gated structures to upstream and downstream flow depth and gate setting. For open-channel reaches, six types of one-dimensional function tables contain different combinations of the top width of flow, area, first moment of area with respect to the water surface, conveyance, flux coefficients, and correction coefficients for channel curvilinearity. For hydraulic control structures, one type of one-dimensional function table contains relations between flow and upstream depth, and two types of two-dimensional function tables contain relations among flow and upstream and downstream flow depths. For hydraulic control structures with gates, a three-dimensional function table lists the system of two-dimensional tables that contain the relations among flow and upstream and downstream flow depths that correspond to different gate openings. Hydraulic control structures for which function tables containing flow relations are prepared in FEQUTL include expansions, contractions, bridges, culverts, embankments, weirs, closed conduits (circular, rectangular, and pipe-arch shapes), dam failures, floodways, and underflow gates (sluice and tainter gates). The theory for computation of the hydraulic characteristics is presented for open channels and for each hydraulic control structure. For the hydraulic control structures, the theory is developed from the results of experimental tests of flow through the structure for different upstream and downstream flow depths. These tests were done to describe flow hydraulics for a single, steady-flow design condition and, thus, do not provide complete information on flow transitions (for example, between free- and submerged-weir flow) that may result in simulation of unsteady flow. Therefore, new procedures are developed to approximate the hydraulics of flow transitions for culverts, embankments, weirs, and underflow gates.

Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5' region

PubMed Central

Steshina, Ekaterina Y; Carr, Michael S; Glick, Elena A; Yevtodiyenko, Aleksey; Appelbe, Oliver K; Schmidt, Jennifer V

2006-01-01

Background The Dlk1 and Gtl2 genes define a region of mouse chromosome 12 that is subject to genomic imprinting, the parental allele-specific expression of a gene. Although imprinted genes play important roles in growth and development, the mechanisms by which imprinting is established and maintained are poorly understood. Differentially methylated regions (DMRs), which carry methylation on only one parental allele, are involved in imprinting control at many loci. The Dlk1-Gtl2 region contains three known DMRs, the Dlk1 DMR in the 3' region of Dlk1, the intergenic DMR 15 kb upstream of Gtl2, and the Gtl2 DMR at the Gtl2 promoter. Three mouse models are analyzed here that provide new information about the regulation of Dlk1-Gtl2 imprinting. Results A previously existing insertional mutation (Gtl2lacZ), and a targeted deletion in which the Gtl2 upstream region was replaced by a Neo cassette (Gtl2Δ5'Neo), display partial lethality and dwarfism upon paternal inheritance. Molecular characterization shows that both mutations cause loss of imprinting and changes in expression of the Dlk1, Gtl2 and Meg8/Rian genes. Dlk1 levels are decreased upon paternal inheritance of either mutation, suggesting Dlk1 may be causative for the lethality and dwarfism. Loss of imprinting on the paternal chromosome in both Gtl2lacZ and Gtl2Δ5'Neo mice is accompanied by the loss of paternal-specific Gtl2 DMR methylation, while maternal loss of imprinting suggests a previously unknown regulatory role for the maternal Gtl2 DMR. Unexpectedly, when the Neo gene is excised, Gtl2Δ5' animals are of normal size, imprinting is unchanged and the Gtl2 DMR is properly methylated. The exogenous DNA sequences integrated upstream of Gtl2 are therefore responsible for the growth and imprinting effects. Conclusion These data provide further evidence for the coregulation of the imprinted Dlk1 and Gtl2 genes, and support a role for Dlk1 as an important neonatal growth factor. The ability of the Gtl2lacZ and Gtl2Δ5'Neo mutations to cause long-range changes in imprinting and gene expression suggest that regional imprinting regulatory elements may lie in proximity to the integration site. PMID:17014736

Staged electrostatic precipitator

DOEpatents

Miller, Stanley J.; Almlie, Jay C.; Zhuang, Ye

2016-03-01

A device includes a chamber having an air inlet and an air outlet. The device includes a plurality of stages including at least a first stage adjacent a second stage. The plurality of stages are disposed in the chamber and each stage has a plurality of discharge electrodes disposed in an interior region and is bounded by an upstream baffle on an end proximate the air inlet and bounded by a downstream baffle on an end proximate the air outlet. Each stage has at least one sidewall between the upstream baffle and the downstream baffle. The sidewall is configured as a collection electrode and has a plurality of apertures disposed along a length between the upstream baffle and the downstream baffle. The upstream baffle of the first stage is positioned in staggered alignment relative to the upstream baffle of the second stage and the downstream baffle of the first stage are positioned in staggered alignment relative to the downstream baffle of the second stage.

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Interplanetary fast shock diagnosis with the radio receiver on Ulysses

NASA Technical Reports Server (NTRS)

Hoang, S.; Pantellini, F.; Harvey, C. C.; Lacombe, C.; Mangeney, A.; Meuer-Vernet, N.; Perche, C.; Steinberg, J.-L.; Lengyel-Frey, D.; Macdowall, R. J.

1992-01-01

The radio receiver on Ulysses records the quasi-thermal noise which allows a determination of the density and temperature of the cold (core) electrons of the solar wind. Seven interplanetary fast forward or reverse shocks are identified from the density and temperature profiles, together with the magnetic field profile from the Magnetometer experiment. Upstream of the three strongest shocks, bursts of nonthermal waves are observed at the electron plasma frequency f(peu). The more perpendicular the shock, the longer the time interval during which these upstream bursts are observed. For one of the strongest shocks we also observe two kinds of upstream electromagnetic radiation: radiation at 2 f(peu), and radiation at the downstream electron plasma frequency, which propagates into the less dense upstream regions.

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

PubMed

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

PubMed Central

Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

2014-01-01

Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

PubMed Central

Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

2010-01-01

The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

Extracting Uplift Rate Histories From Longitudinal River Profiles: Examples From North America and Africa

NASA Astrophysics Data System (ADS)

Roberts, Gareth G.; White, Nicky; Paul, Jonathan

2013-04-01

The physiography of the Earth's surface is a manifestation of vertical motions, erosion, and deposition of sediment. We show that a history of uplift rate of the continents during the last ~ 100 million years can be determined by jointly inverting the longitudinal profiles of rivers. We assume that the shape of a river profile is controlled by the history of uplift rate and moderated by the erosional process. We have parameterized fluvial erosion using a nonlinear advective-diffusive formulation. A river profile per se contains no information about the erosional timescale; values of erosional parameters must be calibrated. If either vertical incision rate or knickzone retreat rate is known independently, for example when palaeo-river profiles are preserved, we can calibrate the erosional model directly. Independent spot measurements of uplift offer another way to calibrate a regional model. In our inverse model, uplift rate is allowed to vary smoothly as a function of space and time, and upstream drainage area is invariant. Using this inverse methodology, we show that there exist time-correlative commonalities in the shapes of river profiles draining uplifted regions. We find that the rate at which knickzones propagate upstream is linearly dependent on slope in nearly all cases (i.e. n = 1 in the detachment-limited erosional model for ~ 600 North American and African rivers). The exponent on upstream drainage, m, which controls knickzone retreat rate, is typically < 0.5. Calculated retreat rates are therefore insensitive to large changes in upstream drainage area. Simultaneous inversion of profiles from the Colorado, Columbia, Mississippi and Rio Grande catchments shows that western North America experienced three regional phases of uplift during the last 100 Ma. The first phase of uplift occurred between 80-50 Ma, which generated ~ 1 km of topography at a rate of ~ 0.03 mm/yr. A second phase of uplift generated ~ 1.5 km of topography between 35-15 Ma at a rate of ~ 0.06 mm/yr. A final and smaller phase of uplift commenced ~ 5 Ma. These distinct phases of uplift are corroborated by spot estimates of palaeoaltimetry, timed growth of relief, thermochronometric data and by stratigraphic evidence of pulsed clastic efflux delivered to the Gulf of Mexico. An episodic uplift history is consistent with punctuated dynamic support of a large region, which is currently centred on Yellowstone. Inversion of the Congo, Nile, Niger, Ogooue, Orange, Zambezi rivers and their major tributaries indicates that domal swells in Africa have experienced a staged uplift history. The West African margin has experienced at least two phases of uplift during the last 30 Ma. Uplift in Afar began ~ 35 Ma. The Hoggar and Tibesti swells, in central North Africa, have an older history of uplift. These results are consistent with a staged magmatic history, delivery of sediment to the continental margins and stratigraphic observations, which suggest that the African landscape is responding to convection in the mantle.

Austenite Grain Size Control in Upstream Processing of Niobium Microalloyed Steels by Nano-Scale Precipitate Engineering of TiN-NbC Composite

NASA Astrophysics Data System (ADS)

Subramanian, S. V.; Ma, Xiaoping; Rehman, Kashif

There is a growing demand for thicker gage pipes particularly for off-shore projects. Austenite grain size control in upstream processing before pancaking is essential to obtain excellent DBTT and DWTT properties in thicker gage product. This paper examines the basic science aspects of austenite grain size control by nano-scale precipitate engineering.

A genome-wide association study of psoriasis and psoriatic arthritis identifies new disease loci.

PubMed

Liu, Ying; Helms, Cynthia; Liao, Wilson; Zaba, Lisa C; Duan, Shenghui; Gardner, Jennifer; Wise, Carol; Miner, Andrew; Malloy, M J; Pullinger, Clive R; Kane, John P; Saccone, Scott; Worthington, Jane; Bruce, Ian; Kwok, Pui-Yan; Menter, Alan; Krueger, James; Barton, Anne; Saccone, Nancy L; Bowcock, Anne M

2008-03-28

A genome-wide association study was performed to identify genetic factors involved in susceptibility to psoriasis (PS) and psoriatic arthritis (PSA), inflammatory diseases of the skin and joints in humans. 223 PS cases (including 91 with PSA) were genotyped with 311,398 single nucleotide polymorphisms (SNPs), and results were compared with those from 519 Northern European controls. Replications were performed with an independent cohort of 577 PS cases and 737 controls from the U.S., and 576 PSA patients and 480 controls from the U.K.. Strongest associations were with the class I region of the major histocompatibility complex (MHC). The most highly associated SNP was rs10484554, which lies 34.7 kb upstream from HLA-C (P = 7.8x10(-11), GWA scan; P = 1.8x10(-30), replication; P = 1.8x10(-39), combined; U.K. PSA: P = 6.9x10(-11)). However, rs2395029 encoding the G2V polymorphism within the class I gene HCP5 (combined P = 2.13x10(-26) in U.S. cases) yielded the highest ORs with both PS and PSA (4.1 and 3.2 respectively). This variant is associated with low viral set point following HIV infection and its effect is independent of rs10484554. We replicated the previously reported association with interleukin 23 receptor and interleukin 12B (IL12B) polymorphisms in PS and PSA cohorts (IL23R: rs11209026, U.S. PS, P = 1.4x10(-4); U.K. PSA: P = 8.0x10(-4); IL12B:rs6887695, U.S. PS, P = 5x10(-5) and U.K. PSA, P = 1.3x10(-3)) and detected an independent association in the IL23R region with a SNP 4 kb upstream from IL12RB2 (P = 0.001). Novel associations replicated in the U.S. PS cohort included the region harboring lipoma HMGIC fusion partner (LHFP) and conserved oligomeric golgi complex component 6 (COG6) genes on chromosome 13q13 (combined P = 2x10(-6) for rs7993214; OR = 0.71), the late cornified envelope gene cluster (LCE) from the Epidermal Differentiation Complex (PSORS4) (combined P = 6.2x10(-5) for rs6701216; OR 1.45) and a region of LD at 15q21 (combined P = 2.9x10(-5) for rs3803369; OR = 1.43). This region is of interest because it harbors ubiquitin-specific protease-8 whose processed pseudogene lies upstream from HLA-C. This region of 15q21 also harbors the gene for SPPL2A (signal peptide peptidase like 2a) which activates tumor necrosis factor alpha by cleavage, triggering the expression of IL12 in human dendritic cells. We also identified a novel PSA (and potentially PS) locus on chromosome 4q27. This region harbors the interleukin 2 (IL2) and interleukin 21 (IL21) genes and was recently shown to be associated with four autoimmune diseases (Celiac disease, Type 1 diabetes, Grave's disease and Rheumatoid Arthritis).

Dramatic undercutting of piedmont rivers after the 2008 Wenchuan Ms 8.0 Earthquake

PubMed Central

Fan, Niannian; Nie, Ruihua; Wang, Qiang; Liu, Xingnian

2016-01-01

Changes in river channel erosion or deposition affect the geomorphic evolution, aquatic ecosystems, and river regulation strategies. Fluvial processes are determined by the flow, sediment and boundary conditions, and it has long been expected that increasing sediment supply will induce aggradation. Here, based on thorough field surveys, we show the unexpected undercutting of the piedmont rivers influenced by the 2008 Wenchuan (Ms 8.0) Earthquake. The rivers flow from the Longmen Mountain with significant topographic relief to the flat Chengdu plain. In the upstreams, sediment supply increased because of the landslides triggered by the earthquake, causing deposition in the upstream mountain reaches. However, the downstream plain reaches suffered undercutting instead of deposition, and among those rivers, Shiting River was the most seriously affected, with the largest undercutting depth exceeding 20 m. The reasons for this unexpected undercutting are proposed herein and relate to both natural and anthropogenic causes. In addition, we also demonstrate, at least for certain conditions, such as rivers flowing from large-gradient mountain regions to low-gradient plain regions, that upstream sediment pulses may induce aggradation in upstream and degradation in downstream, causing the longitudinal profile to steepen to accommodate the increasing sediment flux. PMID:27857220

A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons

PubMed Central

Tian, Tian; Salis, Howard M.

2015-01-01

Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Atmospheric mercury footprints of nations.

PubMed

Liang, Sai; Wang, Yafei; Cinnirella, Sergio; Pirrone, Nicola

2015-03-17

The Minamata Convention was established to protect humans and the natural environment from the adverse effects of mercury emissions. A cogent assessment of mercury emissions is required to help implement the Minamata Convention. Here, we use an environmentally extended multi-regional input-output model to calculate atmospheric mercury footprints of nations based on upstream production (meaning direct emissions from the production activities of a nation), downstream production (meaning both direct and indirect emissions caused by the production activities of a nation), and consumption (meaning both direct and indirect emissions caused by final consumption of goods and services in a nation). Results show that nations function differently within global supply chains. Developed nations usually have larger consumption-based emissions than up- and downstream production-based emissions. India, South Korea, and Taiwan have larger downstream production-based emissions than their upstream production- and consumption-based emissions. Developed nations (e.g., United States, Japan, and Germany) are in part responsible for mercury emissions of developing nations (e.g., China, India, and Indonesia). Our findings indicate that global mercury abatement should focus on multiple stages of global supply chains. We propose three initiatives for global mercury abatement, comprising the establishment of mercury control technologies of upstream producers, productivity improvement of downstream producers, and behavior optimization of final consumers.

Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

PubMed

Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

2011-09-23

Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

PubMed

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-12-01

Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

PubMed Central

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-01-01

Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-03-01

MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

Telemetry narrows the search for sea lamprey spawning locations in the St. Clair-Detroit River System

USGS Publications Warehouse

Holbrook, Christopher; Jubar, Aaron K.; Barber, Jessica M.; Tallon, Kevin; Hondorp, Darryl W.

2016-01-01

Adult sea lamprey (Petromyzon marinus) abundance in Lake Erie has remained above targets set by fishery managers since 2005, possibly due to increased recruitment in the St. Clair-Detroit River System (SCDRS). Sea lamprey recruitment in the SCDRS poses an enormous challenge to sea lamprey control and assessment in Lake Erie because the SCDRS contains no dams to facilitate capture and discharge is at least an order of magnitude larger in the SCDRS than most other sea lamprey-producing tributaries in the Great Lakes. As a first step toward understanding population size, spatial distribution, and spawning habitat of adult sea lampreys in the SCDRS, we used acoustic telemetry to determine where sea lampreys ceased migration (due to spawning, death, or both) among major regions of the SCDRS. All tagged sea lampreys released in the lower Detroit River (N = 27) moved upstream through the Detroit River and entered Lake St. Clair. After entering Lake St. Clair, sea lampreys entered the St. Clair River (N = 22), Thames River (N = 1), or were not detected again (N = 4). Many sea lampreys (10 of 27) were last observed moving downstream (“fallback”) but we were unable to determine if those movements occurred before or after spawning, or while sea lampreys were dead or alive. Regardless of whether estimates of locations where sea lampreys ceased migration were based on the most upstream region occupied or final region occupied, most sea lampreys ceased migration in the St. Clair River or Lake St. Clair. Results suggest that spawning and rearing in the St. Clair River could be an important determinant of sea lamprey recruitment in the SCDRS and may direct future assessment and control activities in that system.

Attenuating reaches and the regional flood response of an urbanizing drainage basin

NASA Astrophysics Data System (ADS)

Turner-Gillespie, Daniel F.; Smith, James A.; Bates, Paul D.

The Charlotte, North Carolina metropolitan area has experienced extensive urban and suburban growth and sharply increasing trends in the magnitude and frequency of flooding. The hydraulics and hydrology of flood response in the region are examined through a combination of numerical modeling studies and diagnostic analyses of paired discharge observations from upstream-downstream gaging stations. The regional flood response is shown to strongly reflect urbanization effects, which increase flood peaks and decrease response times, and geologically controlled attenuating reaches, which decrease flood peaks and increase lag times. Attenuating reaches are characterized by systematic changes in valley bottom geometry and longitudinal profile. The morphology of the fluvial system is controlled by the bedrock geology, with pronounced changes occurring at or near contacts between intrusive igneous and metamorphic rocks. Analyses of wave celerity and flood peak attenuation over a range of discharge values for an 8.3 km valley bottom section of Little Sugar Creek are consistent with Knight and Shiono's characterization of the variation of flood wave velocity from in-channel conditions to valley bottom full conditions. The cumulative effect of variation in longitudinal profile, expansions and contractions of the valley bottom, floodplain roughness and sub-basin flood response is investigated using a two-dimensional, depth-averaged, finite element hydrodynamic model coupled with a distributed hydrologic model. For a 10.1 km stream reach of Briar Creek, with drainage area ranging from 13 km 2 at the upstream end of the reach to 49 km 2 at the downstream end, it is shown that flood response reflects a complex interplay of hydrologic and hydraulic processes on hillslopes and valley bottoms.

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing's syndrome.

PubMed

Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A

2004-07-01

Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.

Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

PubMed

Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

2010-07-01

Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

Putative carotenoid genes expressed under the regulation of Shine-Dalgarno regions in Escherichia coli for efficient lycopene production.

PubMed

Jin, Weiyue; Xu, Xian; Jiang, Ling; Zhang, Zhidong; Li, Shuang; Huang, He

2015-11-01

Putative genes crtE, crtB, and crtI from Deinococcus wulumiqiensis R12, a novel species, were identified by genome mining and were co-expressed using the optimized Shine-Dalgarno (SD) regions to improve lycopene yield. A lycopene biosynthesis pathway was constructed by co-expressing these three genes in Escherichia coli. After optimizing the upstream SD regions and the culture medium, the recombinant strain EDW11 produced 88 mg lycopene g(-1) dry cell wt (780 mg lycopene l(-1)) after 40 h fermentation without IPTG induction, while the strain EDW without optimized SD regions only produced 49 mg lycopene g(-1) dry cell wt (417 mg lycopene l(-1)). Based on the optimization of the upstream SD regions and culture medium, the yield of the strain EDW11 reached a high level during microbial lycopene production until now.

Dopamine D2 Receptors Act Upstream of AVP in the Latero-Anterior Hypothalamus to Modulate Adolescent Anabolic/Androgenic Steroid-Induced Aggression in Syrian Hamsters

PubMed Central

Morrison, Thomas R.; Ricci, Lesley A.; Melloni, Richard H.

2015-01-01

In pubertal male Syrian hamsters, exposure to anabolic/androgenic steroids (AAS) during adolescence facilitates a high level of offensive aggression modulated by the enhanced development and activity of the vasopressin (AVP) and dopamine (DA) neural systems within the latero-anterior hypothalamus (LAH), i.e., a brain region implicated in the control of aggression. The present studies provide a detailed report of the pharmacologic interactions between AVP and DA D2 receptor signaling within the LAH in the control of adolescent AAS-induced offensive aggression. Male Syrian hamsters were treated with AAS throughout adolescence and tested for aggression after local infusion of the DA D2 receptor antagonist eticlopride (ETIC) alone, or in combination with AVP in the LAH in an effort to determine the influence of DA D2 receptors relative to AVP-receptor mediated aggression mechanisms. As previously shown, ETIC infusion into the LAH suppressed adolescent AAS-induced aggressive responding; however, the AAS-induced aggressive phenotype was rescued by the co-infusion of AVP into the LAH. These behavioral data indicate that interactions between AVP and DA neural systems within the LAH modulate the control of aggression following adolescent exposure to AAS and that DA D2 receptor signaling functions upstream of AVP in the LAH to control this behavioral response. PMID:25798632

Portable Dew Point Mass Spectrometry System for Real-Time Gas and Moisture Analysis

NASA Technical Reports Server (NTRS)

Arkin, C.; Gillespie, Stacey; Ratzel, Christopher

2010-01-01

A portable instrument incorporates both mass spectrometry and dew point measurement to provide real-time, quantitative gas measurements of helium, nitrogen, oxygen, argon, and carbon dioxide, along with real-time, quantitative moisture analysis. The Portable Dew Point Mass Spectrometry (PDP-MS) system comprises a single quadrupole mass spectrometer and a high vacuum system consisting of a turbopump and a diaphragm-backing pump. A capacitive membrane dew point sensor was placed upstream of the MS, but still within the pressure-flow control pneumatic region. Pressure-flow control was achieved with an upstream precision metering valve, a capacitance diaphragm gauge, and a downstream mass flow controller. User configurable LabVIEW software was developed to provide real-time concentration data for the MS, dew point monitor, and sample delivery system pressure control, pressure and flow monitoring, and recording. The system has been designed to include in situ, NIST-traceable calibration. Certain sample tubing retains sufficient water that even if the sample is dry, the sample tube will desorb water to an amount resulting in moisture concentration errors up to 500 ppm for as long as 10 minutes. It was determined that Bev-A-Line IV was the best sample line to use. As a result of this issue, it is prudent to add a high-level humidity sensor to PDP-MS so such events can be prevented in the future.

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

PubMed Central

Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

2010-01-01

POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

Gene expression regulation by upstream open reading frames and human disease.

PubMed

Barbosa, Cristina; Peixeiro, Isabel; Romão, Luísa

2013-01-01

Upstream open reading frames (uORFs) are major gene expression regulatory elements. In many eukaryotic mRNAs, one or more uORFs precede the initiation codon of the main coding region. Indeed, several studies have revealed that almost half of human transcripts present uORFs. Very interesting examples have shown that these uORFs can impact gene expression of the downstream main ORF by triggering mRNA decay or by regulating translation. Also, evidence from recent genetic and bioinformatic studies implicates disturbed uORF-mediated translational control in the etiology of many human diseases, including malignancies, metabolic or neurologic disorders, and inherited syndromes. In this review, we will briefly present the mechanisms through which uORFs regulate gene expression and how they can impact on the organism's response to different cell stress conditions. Then, we will emphasize the importance of these structures by illustrating, with specific examples, how disturbed uORF-mediated translational control can be involved in the etiology of human diseases, giving special importance to genotype-phenotype correlations. Identifying and studying more cases of uORF-altering mutations will help us to understand and establish genotype-phenotype associations, leading to advancements in diagnosis, prognosis, and treatment of many human disorders.

Magnetosphere on May 11, 1999, the day the solar wind almost disappeared: II. Magnetic pulsations in space and on the ground

NASA Astrophysics Data System (ADS)

Le, G.; Chi, P. J.; Goedecke, W.; Russell, C. T.; Szabo, A.; Petrinec, S. M.; Angelopoulos, V.; Reeves, G. D.; Chun, F. K.

2000-08-01

Simultaneous observations by Wind and IMP-8 in the upstream region on May 11, 1999, when the solar wind density was well below its usual values and the IMF was generally weakly northward, indicate there were upstream waves present in the foreshock, but wave power was an order of magnitude weaker than usual due to an extremely weak bow shock and tenuous solar wind plasma. Magnetic pulsations in the magnetosphere have been observed in the magnetic field data from Polar and at mid-latitude ground stations. By comparing May 11 with a control day under normal solar wind conditions and with a similar foreshock geometry, we find that the magnetosphere was much quieter than usual. The Pc 3-4 waves were nearly absent in the dayside magnetosphere both at Polar and as seen at mid-latitude ground stations even through the foreshock geometry was favorable for the generation of these waves. Since the solar wind speed was not unusual on this day, these observations suggest that it is the Mach number of the solar wind flow relative to the magnetosphere that controls the amplitude of Pc 3-4 waves in the magnetosphere.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

PubMed

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

UPSTREAM LOCK GATE DETAIL AND DOG HOUSE. NOTE ARM AND ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

UPSTREAM LOCK GATE DETAIL AND DOG HOUSE. NOTE ARM AND GEARING FOR CONTROLLING LOCK GATE. LOOKING WEST SOUTHWEST. - Illinois Waterway, Brandon Road Lock and Dam , 1100 Brandon Road, Joliet, Will County, IL

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

NASA Technical Reports Server (NTRS)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

Investigation of passive shock wave-boundary layer control for transonic airfoil drag reduction

NASA Technical Reports Server (NTRS)

Nagamatsu, H. T.; Brower, W. B., Jr.; Bahi, L.; Ross, J.

1982-01-01

The passive drag control concept, consisting of a porous surface with a cavity beneath it, was investigated with a 12-percent-thick circular arc and a 14-percent-thick supercritical airfoil mounted on the test section bottom wall. The porous surface was positioned in the shock wave/boundary layer interaction region. The flow circulating through the porous surface, from the downstream to the upstream of the terminating shock wave location, produced a lambda shock wave system and a pressure decrease in the downstream region minimizing the flow separation. The wake impact pressure data show an appreciably drag reduction with the porous surface at transonic speeds. To determine the optimum size of porosity and cavity, tunnel tests were conducted with different airfoil porosities, cavities and flow Mach numbers. A higher drag reduction was obtained by the 2.5 percent porosity and the 1/4-inch deep cavity.

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Grant management procedure for energy saving TDM-PONs

NASA Astrophysics Data System (ADS)

Alaelddin, Fuad Yousif Mohammed; Newaz, S. H. Shah; AL-Hazemi, Fawaz; Choi, Jun Kyun

2018-01-01

In order to minimize energy consumption in Time Division Multiplexing-Passive Optical Network (TDM-PON), IEEE and ITU-T have mandated sleep mode mechanism for Optical Network Units (ONUs) in the latest TDM-PON standards (e.g. IEEE P1904.1 SIEPON, ITU-T G.sup45). The sleep mode mechanism is a promising mean for maximizing energy saving in an ONU. An ONU in sleep mode flips between sleep and active state depending on the presence or absent of upstream and downstream frames. To ensure Quality of Service (QoS) of upstream frames, the recent TDM-PON standards introduced an early wake-up mechanism, in which an ONU is forced to leave the sleep state on upstream frame arrival. When the Optical Line Terminal (OLT) of a TDM-PON allows early wake-up of its connected ONUs, it allocates gratuitous grants for the sleeping ONUs along with allocating upstream grants for the ONUs in active state. Note that, the gratuitous grants control message sent periodically by the OLT on Inter-Gratuitous grant Interval (IGI) time. After leaving sleep state due to the arrival of upstream frame, the ONU uses its allocated gratuitous grant to send a control message mentioning the amount of upstream bandwidth (upstream grant) required in order to forward the remaining frames in its buffer. However, the existing early wake-up process of ONU can lead to increase the energy consumption of an ONU. It is because of the ONU wakes-up immediately from the sleep state on arrival of the upstream frame, but even so, it needs to wait for forwarding the frame until its allocated gratuitous grant period, resulting in spending energy unnecessarily. In addition, current energy saving solution for TDM-PONs do not provide a clear solution on how to manage different types of grants (e.g. listening grant, upstream transmission grant) within a Dynamic Bandwidth Allocation (DBA) polling cycle. To address this problem, we propose a state-of-art Grant Management Procedure (GMP) in order to maximize energy saving in a TDM-PON with sleep mode enabled ONUs. GMP contributes in defining the location of the different types of grants during a DBA polling cycle. Furthermore, GMP devises a mechanism so as to allow an ONU to predict its assigned gratuitous grant control message arrival time, thereby allowing an ONU to remain its transceiver unit powered off until the arrival period of the next gratuitous grant control message, increasing the energy saving of the ONU. Results show that, with the increment of IGI, the energy saving performance of an ONU with GMP increases noticeably in compare to a conventional ONU (an ONU that does not use GMP) without imposing any additional upstream frame delay.

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

The importance of lake-specific characteristics for water quality across the continental United States.

PubMed

Read, Emily K; Patil, Vijay P; Oliver, Samantha K; Hetherington, Amy L; Brentrup, Jennifer A; Zwart, Jacob A; Winters, Kirsten M; Corman, Jessica R; Nodine, Emily R; Woolway, R Iestyn; Dugan, Hilary A; Jaimes, Aline; Santoso, Arianto B; Hong, Grace S; Winslow, Luke A; Hanson, Paul C; Weathers, Kathleen C

2015-06-01

Lake water quality is affected by local and regional drivers, including lake physical characteristics, hydrology, landscape position, land cover, land use, geology, and climate. Here, we demonstrate the utility of hypothesis testing within the landscape limnology framework using a random forest algorithm on a national-scale, spatially explicit data set, the United States Environmental Protection Agency's 2007 National Lakes Assessment. For 1026 lakes, we tested the relative importance of water quality drivers across spatial scales, the importance of hydrologic connectivity in mediating water quality drivers, and how the importance of both spatial scale and connectivity differ across response variables for five important in-lake water quality metrics (total phosphorus, total nitrogen, dissolved organic carbon, turbidity, and conductivity). By modeling the effect of water quality predictors at different spatial scales, we found that lake-specific characteristics (e.g., depth, sediment area-to-volume ratio) were important for explaining water quality (54-60% variance explained), and that regionalization schemes were much less effective than lake specific metrics (28-39% variance explained). Basin-scale land use and land cover explained between 45-62% of variance, and forest cover and agricultural land uses were among the most important basin-scale predictors. Water quality drivers did not operate independently; in some cases, hydrologic connectivity (the presence of upstream surface water features) mediated the effect of regional-scale drivers. For example, for water quality in lakes with upstream lakes, regional classification schemes were much less effective predictors than lake-specific variables, in contrast to lakes with no upstream lakes or with no surface inflows. At the scale of the continental United States, conductivity was explained by drivers operating at larger spatial scales than for other water quality responses. The current regulatory practice of using regionalization schemes to guide water quality criteria could be improved by consideration of lake-specific characteristics, which were the most important predictors of water quality at the scale of the continental United States. The spatial extent and high quality of contextual data available for this analysis makes this work an unprecedented application of landscape limnology theory to water quality data. Further, the demonstrated importance of lake morphology over other controls on water quality is relevant to both aquatic scientists and managers.

Retrogressive thaw slumps temper dissolved organic carbon delivery to streams of the Peel Plateau, NWT, Canada

NASA Astrophysics Data System (ADS)

Littlefair, Cara A.; Tank, Suzanne E.; Kokelj, Steven V.

2017-12-01

In Siberia and Alaska, permafrost thaw has been associated with significant increases in the delivery of dissolved organic carbon (DOC) to recipient stream ecosystems. Here, we examine the effect of retrogressive thaw slumps (RTSs) on DOC concentration and transport, using data from eight RTS features on the Peel Plateau, NWT, Canada. Like extensive regions of northwestern Canada, the Peel Plateau is comprised of thick, ice-rich tills that were deposited at the margins of the Laurentide Ice Sheet. RTS features are now widespread in this region, with headwall exposures up to 30 m high and total disturbed areas often exceeding 20 ha. We find that intensive slumping on the Peel Plateau is universally associated with decreasing DOC concentrations downstream of slumps, even though the composition of slump-derived dissolved organic matter (DOM; assessed using specific UV absorbance and slope ratios) is similar to permafrost-derived DOM from other regions. Comparisons of upstream and downstream DOC flux relative to fluxes of total suspended solids suggest that the substantial fine-grained sediments released by RTS features may sequester DOC. Runoff obtained directly from slump rill water, above entry into recipient streams, indicates that the deepest RTS features, which thaw the greatest extent of buried, Pleistocene-aged glacial tills, release low-concentration DOC when compared to paired upstream, undisturbed locations, while shallower features, with exposures that are more limited to a relict Holocene active layer, have within-slump DOC concentrations more similar to upstream sites. Finally, fine-scale work at a single RTS site indicates that temperature and precipitation serve as primary environmental controls on above-slump and below-slump DOC flux, but it also shows that the relationship between climatic parameters and DOC flux is complex for these dynamic thermokarst features. These results demonstrate that we should expect clear variation in thermokarst-associated DOC mobilization across Arctic regions. However, they also show that within-region variation in thermokarst intensity and landscape composition is critical for determining the biogeochemical response. Geological and climate legacy shape the physical and chemical composition of permafrost and thermokarst potential. As such, these factors must be considered in predictions of land-to-water carbon mobilization in a warming Arctic.

Multi-Proxy Evidence for Decoupled Monsoon Intensity and Southeast Asian Precipitation on Orbital and Millennial Timescales

NASA Astrophysics Data System (ADS)

Johnson, K. R.; Griffiths, M. L.; Borsato, A.; Frisia, S.; Bhattacharya, T.; Tierney, J. E.; LeGrande, A. N.; Henderson, G. M.

2017-12-01

Despite significant advances in our understanding of Asian monsoon variability on orbital to millennial timescales, we still know very little about the range and mechanisms of variability in the Southeast Asian monsoon region. To address this need, we have developed a decadally-resolved and replicated speleothem δ18O and δ13C record from Tham Doun Mai Cave in Northern Laos. The record spans the period from 37.7 kyr BP to the present and the age model is constrained by 35 U-Th dates. The orbital and millennial scale δ18O variability is remarkably similar to other Asian speleothem records, with the lowest values observed during the early Holocene summer insolation maxima and clear δ18O increases observed during Heinrich Stadials (HS) 1-3, the Younger Dryas, and the 8.2 kyr event. The strong similarity with Chinese speleothem δ18O records suggests that variations in upstream rainout over the Indian Ocean, Bay of Bengal, and Indian Monsoon region are the dominant control on orbital and millennial scale precipitation δ18O variability across Southeast and East Asia. In contrast to δ18O, TM speleothem δ13C is reflective of local hydroclimate. The δ13C record shows large positive excursions during HS 1-3, suggesting dry conditions during these events. Positive δ13C values during the early Holocene indicate dry conditions in SE Asia were synchronous with increased upstream rainout. This interpretation is further supported by crystal fabric and greyscale analyses, which reflect internal porosity changes likely related to infiltration variability. Compact columnar, translucent calcite is associated with decreased infiltration, and typifies HS events and the early Holocene. The positive δ13C excursions during these periods may then be enhanced by the prolonged degassing associated with slower drip rates. Time-slice simulations conducted with the isotope-enabled GISS Model E further support a dry early Holocene in this region. Model analyses suggest dry conditions in SE Asia during insolation maxima may arise from decreased low-level moisture convergence over the Indo-China Peninsula as precipitation over India and East Asia increases, effectively drawing away moisture from our study site. Nevertheless, the impacts of upstream rainout lead to regionally coherent δ18O decreases across the broad Asian monsoon region.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Strong plume fluxes at Mars observed by MAVEN: An important planetary ion escape channel

NASA Astrophysics Data System (ADS)

Dong, Y.; Fang, X.; Brain, D. A.; McFadden, J. P.; Halekas, J. S.; Connerney, J. E.; Curry, S. M.; Harada, Y.; Luhmann, J. G.; Jakosky, B. M.

2015-11-01

We present observations by the Mars Atmosphere and Volatile EvolutioN (MAVEN) mission of a substantial plume-like distribution of escaping ions from the Martian atmosphere, organized by the upstream solar wind convection electric field. From a case study of MAVEN particle-and-field data during one spacecraft orbit, we identified three escaping planetary ion populations: plume fluxes mainly along the upstream electric field over the north pole region of the Mars-Sun-Electric field (MSE) coordinate system, antisunward ion fluxes in the tail region, and much weaker upstream pickup ion fluxes. A statistical study of O+ fluxes using 3 month MAVEN data shows that the plume is a constant structure with strong fluxes widely distributed in the MSE northern hemisphere, which constitutes an important planetary ion escape channel. The escape rate through the plume is estimated to be ~30% of the tailward escape and ~23% of the total escape for > 25 eV O+ ions.

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Electron velocity distributions near the earth's bow shock

NASA Technical Reports Server (NTRS)

Feldman, W. C.; Anderson, R. C.; Bame, S. J.; Gary, S. P.; Gosling, J. T.; Mccomas, D. J.; Thomsen, M. F.; Paschmann, G.; Hoppe, M. M.

1983-01-01

New information is presented on the general characteristics of electron distribution functions upstream, within, and downstream of the earth's bow shock, thereby providing new insights into the instabilities in collisionless shocks. The results presented are from a survey of electron velocity distributions measured near the earth's bow shock between October 1977 and December 1978 using the Los Alamos/Garching plasma instrumentation aboard ISEE 2. A wide variety of distribution shapes is found within the different plasma regions in close proximity to the bow shock. It is found that these shapes can be classified into general types that are characteristic of three different plasma regions, namely the upstream region or electron foreshock, the shock proper where most of the heating occurs, and the downstream region or the magnetosheath. Evidence is provided that field-aligned, rather than cross-field, instabilities are the major source of electron dissipation in the earth's bow shock.

Turbine exhaust diffuser flow path with region of reduced total flow area

DOEpatents

Orosa, John A.

2012-12-25

An exhaust diffuser system and method for a turbine engine includes an inner boundary and an outer boundary with a flow path defined therebetween. The inner boundary is defined at least in part by a hub that has an upstream end and a downstream end. The outer boundary has a region in which the outer boundary extends radially inward toward the hub. The region can begin at a point that is substantially aligned with the downstream end of the hub or, alternatively, at a point that is proximately upstream of the downstream end of the hub. The region directs at least a portion of an exhaust flow in the diffuser toward the hub. As a result, the exhaust diffuser system and method can achieve the performance of a long hub system while enjoying the costs of a short hub system.

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

The mouse that roared: neural mechanisms of social hierarchy.

PubMed

Wang, Fei; Kessels, Helmut W; Hu, Hailan

2014-11-01

Hierarchical social status greatly influences behavior and health. Human and animal studies have begun to identify the brain regions that are activated during the formation of social hierarchies. They point towards the prefrontal cortex (PFC) as a central regulator, with brain areas upstream of the PFC conveying information about social status, and downstream brain regions executing dominance behavior. This review summarizes our current knowledge on the neural circuits that control social status. We discuss how the neural mechanisms for various types of dominance behavior can be studied in laboratory rodents by selective manipulation of neuronal activity or synaptic plasticity. These studies may help in finding the cause of social stress-related mental and physical health problems. Copyright © 2014 Elsevier Ltd. All rights reserved.

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

PubMed

Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

2004-11-01

RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

A Genome-Wide Association Study of Psoriasis and Psoriatic Arthritis Identifies New Disease Loci

PubMed Central

Liu, Ying; Helms, Cynthia; Liao, Wilson; Zaba, Lisa C.; Duan, Shenghui; Gardner, Jennifer; Wise, Carol; Miner, Andrew; Malloy, M. J.; Pullinger, Clive R.; Kane, John P.; Saccone, Scott; Worthington, Jane; Bruce, Ian; Kwok, Pui–Yan; Menter, Alan; Krueger, James; Barton, Anne; Saccone, Nancy L.; Bowcock, Anne M.

2008-01-01

A genome-wide association study was performed to identify genetic factors involved in susceptibility to psoriasis (PS) and psoriatic arthritis (PSA), inflammatory diseases of the skin and joints in humans. 223 PS cases (including 91 with PSA) were genotyped with 311,398 single nucleotide polymorphisms (SNPs), and results were compared with those from 519 Northern European controls. Replications were performed with an independent cohort of 577 PS cases and 737 controls from the U.S., and 576 PSA patients and 480 controls from the U.K.. Strongest associations were with the class I region of the major histocompatibility complex (MHC). The most highly associated SNP was rs10484554, which lies 34.7 kb upstream from HLA-C (P = 7.8×10−11, GWA scan; P = 1.8×10−30, replication; P = 1.8×10−39, combined; U.K. PSA: P = 6.9×10−11). However, rs2395029 encoding the G2V polymorphism within the class I gene HCP5 (combined P = 2.13×10−26 in U.S. cases) yielded the highest ORs with both PS and PSA (4.1 and 3.2 respectively). This variant is associated with low viral set point following HIV infection and its effect is independent of rs10484554. We replicated the previously reported association with interleukin 23 receptor and interleukin 12B (IL12B) polymorphisms in PS and PSA cohorts (IL23R: rs11209026, U.S. PS, P = 1.4×10−4; U.K. PSA: P = 8.0×10−4; IL12B:rs6887695, U.S. PS, P = 5×10−5 and U.K. PSA, P = 1.3×10−3) and detected an independent association in the IL23R region with a SNP 4 kb upstream from IL12RB2 (P = 0.001). Novel associations replicated in the U.S. PS cohort included the region harboring lipoma HMGIC fusion partner (LHFP) and conserved oligomeric golgi complex component 6 (COG6) genes on chromosome 13q13 (combined P = 2×10−6 for rs7993214; OR = 0.71), the late cornified envelope gene cluster (LCE) from the Epidermal Differentiation Complex (PSORS4) (combined P = 6.2×10−5 for rs6701216; OR 1.45) and a region of LD at 15q21 (combined P = 2.9×10−5 for rs3803369; OR = 1.43). This region is of interest because it harbors ubiquitin-specific protease-8 whose processed pseudogene lies upstream from HLA-C. This region of 15q21 also harbors the gene for SPPL2A (signal peptide peptidase like 2a) which activates tumor necrosis factor alpha by cleavage, triggering the expression of IL12 in human dendritic cells. We also identified a novel PSA (and potentially PS) locus on chromosome 4q27. This region harbors the interleukin 2 (IL2) and interleukin 21 (IL21) genes and was recently shown to be associated with four autoimmune diseases (Celiac disease, Type 1 diabetes, Grave's disease and Rheumatoid Arthritis). PMID:18369459

ASYMMETRIC MAGNETIC RECONNECTION IN WEAKLY IONIZED CHROMOSPHERIC PLASMAS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Nicholas A.; Lukin, Vyacheslav S., E-mail: namurphy@cfa.harvard.edu

2015-06-01

Realistic models of magnetic reconnection in the solar chromosphere must take into account that the plasma is partially ionized and that plasma conditions within any two magnetic flux bundles undergoing reconnection may not be the same. Asymmetric reconnection in the chromosphere may occur when newly emerged flux interacts with pre-existing, overlying flux. We present 2.5D simulations of asymmetric reconnection in weakly ionized, reacting plasmas where the magnetic field strengths, ion and neutral densities, and temperatures are different in each upstream region. The plasma and neutral components are evolved separately to allow non-equilibrium ionization. As in previous simulations of chromospheric reconnection,more » the current sheet thins to the scale of the neutral–ion mean free path and the ion and neutral outflows are strongly coupled. However, the ion and neutral inflows are asymmetrically decoupled. In cases with magnetic asymmetry, a net flow of neutrals through the current sheet from the weak-field (high-density) upstream region into the strong-field upstream region results from a neutral pressure gradient. Consequently, neutrals dragged along with the outflow are more likely to originate from the weak-field region. The Hall effect leads to the development of a characteristic quadrupole magnetic field modified by asymmetry, but the X-point geometry expected during Hall reconnection does not occur. All simulations show the development of plasmoids after an initial laminar phase.« less

Evolving force balance at Columbia Glacier, Alaska, during its rapid retreat

USGS Publications Warehouse

O'Neel, S.; Pfeffer, W.T.; Krimmel, R.; Meier, M.

2005-01-01

Changes in driving and resistive stresses play an essential role in governing the buoyancy forces that are important controls on the speed and irreversibility of tidewater glacier retreats. We describe changes in geometry, velocity, and strain rate and present a top-down force balance analysis performed over the lower reach of Columbia Glacier. Our analysis uses new measurements and estimates of basal topography and photogrammetric surface velocity measurements made between 1977 and 2001, while assuming depth-independent strain. Sensitivity tests show that the method is robust and insensitive to small changes in the calculation parameters. Spatial distributions of ice speed show little correspondence with driving stress. Instead, spatial patterns of ice speed exhibit a nonlinear correspondence with basal drag. Primary resistance to flow comes from basal drag, but lateral drag becomes increasingly more important throughout the retreat, which may account for observed increases in speed. Maximum basal drag is always located in a prominent constriction located ~12 km upstream from the preretreat terminus. Once the terminus retreated into deep water off the terminal moraine marking the modern maximum extent, the upstream location of this maximum basal drag helped to promote thinning and decrease effective pressure in the lower region by limiting replenishing ice flow from upstream. An increase in both ice velocity and calving resulted, initiating what appears to be an irreversible retreat. Copyright 2005 by the American Geophysical Union.

Effects of climate change on streamflow extremes and implications for reservoir inflow in the United States

DOE PAGES

Naz, Bibi S.; Kao, Shih -Chieh; Ashfaq, Moetasim; ...

2017-11-15

The magnitude and frequency of hydrometeorological extremes are expected to increase in the conterminous United States (CONUS) over the rest of this century, and their increase will significantly impact water resource management. While previous efforts focused on the effects of reservoirs on downstream discharge, the effects of climate change on reservoir inflows in upstream areas are not well understood. We evaluated the large-scale climate change effects on extreme hydrological events and their implications for reservoir inflows in 178 headwater basins across CONUS using the Variable Infiltration Capacity (VIC) hydrologic model. The VIC model was forced with a 10-member ensemble ofmore » global circulation models under the Representative Concentration Pathway 8.5 that were dynamically downscaled using a regional climate model (RegCM4) and bias-corrected to 1/24° grid cell resolution. The results projected an increase in the likelihood of flood risk by 44% for a majority of subbasins upstream of flood control reservoirs in the central United States and increased drought risk by 11% for subbasins upstream of hydropower reservoirs across the western United States. Increased risk of both floods and droughts can potentially make reservoirs across CONUS more vulnerable to future climate conditions. In conclusion, this study estimates reservoir inflow changes over the next several decades, which can be used to optimize water supply management downstream.« less

Effects of climate change on streamflow extremes and implications for reservoir inflow in the United States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Naz, Bibi S.; Kao, Shih -Chieh; Ashfaq, Moetasim

The magnitude and frequency of hydrometeorological extremes are expected to increase in the conterminous United States (CONUS) over the rest of this century, and their increase will significantly impact water resource management. While previous efforts focused on the effects of reservoirs on downstream discharge, the effects of climate change on reservoir inflows in upstream areas are not well understood. We evaluated the large-scale climate change effects on extreme hydrological events and their implications for reservoir inflows in 178 headwater basins across CONUS using the Variable Infiltration Capacity (VIC) hydrologic model. The VIC model was forced with a 10-member ensemble ofmore » global circulation models under the Representative Concentration Pathway 8.5 that were dynamically downscaled using a regional climate model (RegCM4) and bias-corrected to 1/24° grid cell resolution. The results projected an increase in the likelihood of flood risk by 44% for a majority of subbasins upstream of flood control reservoirs in the central United States and increased drought risk by 11% for subbasins upstream of hydropower reservoirs across the western United States. Increased risk of both floods and droughts can potentially make reservoirs across CONUS more vulnerable to future climate conditions. In conclusion, this study estimates reservoir inflow changes over the next several decades, which can be used to optimize water supply management downstream.« less

Upstream electron oscillations and ion overshoot at an interplanetary shock wave

NASA Technical Reports Server (NTRS)

Potter, D. W.; Parks, G. K.

1983-01-01

During the passage of a large interplanetary shock on Oct. 13, 1981, the ISEE-1 and -2 spacecraft were in the solar wind outside of the upstream region of the bow shock. The high time resolution data of the University of California particle instruments allow pinpointing the expected electron spike as occurring just before the magnetic ramp. In addition, two features that occur at this shock have not been observed before: electron oscillations associated with low frequency waves upstream of the shock and sharp 'overshoot' (about 1 sec) in the ion fluxes that occur right after the magnetic ramp. This interplanetary shock exhibits many of the same characteristics that are observed at the earth's bow shock.

Rapid analysis of colipase gene variants by multicapillary electrophoresis.

PubMed

Jaczó, Zsuzsanna; Pál, Eszter; Dénes, Réka; Somogyi, Anikó; Sasvári-Székely, Mária; Guttman, András; Rónai, Zsolt

2015-06-01

Despite of the fact that the Human Genome Project was completed more than a decade ago, identification of the genetic background of polygenic diseases is still challenging. Several somewhat different approaches are available to investigate inheritable factors of complex phenotypes, all require, however efficient, high-throughput techniques for SNP genotyping. In this paper, we report a robust and reliable multiplex PCR-RFLP for genotype and haplotype analysis of six SNPs (rs41270082, rs3748051, rs142027015, rs3748048, rs73404011, and rs72925892) of the colipase (CLPS) gene. A multicapillary (12 capillaries) electrophoresis unit was used for high throughput and sensitive analysis of the digestion fragments. A Microsoft Excel-based spreadsheet was designed for the flexible visualization and evaluation of the electrophoretic separations, which is readily adaptable for any kind of electrophoresis application. Haplotype analysis of the two loci localized in close proximity of each other was carried out by molecular method, extended haplotypes including all five SNPs in the 5' upstream region were calculated. The techniques were applied in a case-control association study of type 2 diabetes mellitus. Although, single marker analysis did not reveal any significant association, it was observed that the rare GGCCG haplotype of the five 5' upstream region SNPs was about three times more frequent among patients compared to healthy control population. Our results demonstrated the applicability of multicapillary CGE in large-scale, high-throughput SNP analysis, and suggested that the CLPS gene polymorphisms might be considered as genetic risk factor for type 2 diabetes mellitus. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

One-Dimensional Hydraulic Theory Applied to Experimental Subaqueous Fans with Supercritical Distributaries

NASA Astrophysics Data System (ADS)

Hamilton, P.; Strom, K.; Hoyal, D. C. J. D.

2015-12-01

Subaqueous fans are distributive channel systems that form in a variety of settings including offshore marine, sub-lacustrine, and reservoirs. These distributive systems create complex sedimentation patterns through repeated avulsion to fill in a basin. Here we ran a series of experiments to explore the intrinsic controls on avulsion cycles on subaqueous fans. Experiments are a convenient way to study these systems since the time-scale of fan development is dramatically shortened compared to natural settings, all boundary conditions can be controlled, and the experimental domain can be instrumented to monitor the pertinent hydraulic and morphologic variables. Experiments in this study used saline underflows and crushed plastic sediment fed down an imposed slope covered in the sediment. Avulsion cycles are a central feature in these experiments which are characterized by: (1) channel extension and stagnation; (2) bar aggradation and hydraulic jump initiation; (3) upstream retreat; and (4) flow avulsion. Looking at and analyzing these cycles yield the following conclusions: (1) distributive channels cease progradation due to a drop in sediment transport capacity in an expanded region ahead of the channel; (2) mouth bar aggradation leads to a large flow obstacle to cause the hydraulic jump feedback; (3) hydraulic jump regions are a significant locus of deposition; and (4) the upstream retreat rate is a function of sediment supply and the strength of the jump. We found that simple one-dimensional hydraulic principles such as the choked flow condition and the sequent depth ratio help to explain hydraulic jump initiation and emplaced lobe thickness respectively.

Exhaust emission control and diagnostics

DOEpatents

Mazur, Christopher John; Upadhyay, Devesh

2006-11-14

A diesel engine emission control system uses an upstream oxidation catalyst and a downstream SCR catalyst to reduce NOx in a lean exhaust gas environment. The engine and upstream oxidation catalyst are configured to provide approximately a 1:1 ratio of NO to NO2 entering the downstream catalyst. In this way, the downstream catalyst is insensitive to sulfur contamination, and also has improved overall catalyst NOx conversion efficiency. Degradation of the system is determined when the ratio provided is no longer near the desired 1:1 ratio. This condition is detected using measurements of engine operating conditions such as from a NOx sensor located downstream of the catalysts. Finally, control action to adjust an injected amount of reductant in the exhaust gas based on the actual NO to NO2 ratio upstream of the SCR catalyst and downstream of the oxidation catalyst.

[Phylogenetic analysis of CO I gene of Oncomelania snails from project of afforestation for schistosomiasis control in marshland endemic regions].

PubMed

Xu, Yu-Mei; Zhang, Shi-Qing; Zhu, Chuan-Gang

2012-04-01

To investigate the genetic difference of cytochrome oxidase I (CO I ) of Oncomelania snails from the project of afforestation for schistosomiasis control in marshland regions, so as to explore the effects of different ecological environments. The snails were collected from 3 different areas, Anqing, Tongling, Wuwei, i.e. the upstream, midstream and downstream regions along the Yangtz River in Anhui Province. Genomic DNA was extracted from the snails, and CO I gene fragments were amplified by PCR, then purified and sequenced. The sequences were edited by using Blast. The CO I genes of O. h. minima and Biomphalaria glabrata were used as the reference of exogenous gene. The genetic distances of the various regions were calculated by the Kimura method and phylogenetic trees were constructed with UPGMA and the NJ method of MEGA (3.1) software. The amplified CO I gene of the snail was a fragment about 700 bp including 2 primers in length. There were little genetic diversity among the different areas, the identities were higher than or equal to 98%. The genetic distances indicated that the distance between the projects of afforestation and woodland in Anqing was 0.003, while Tongling was 0.019, Wuwei was 0.007. The distances among the three projects of afforestation were 0.003-0.012. The two phylogenetic trees were constructed by the methods of UPGMA and NJ respectively, which took on very similar topo-structure in which isolates of Biomphalaria glabrata located in one clade and all the others in the other one. In the other one clade, O. H. minima located in one clade. There was little genetic diversity among Anqing, Tongling, Wuwei clusters. The afforestations of Anqing and Wuwei clustered into one group, while the woodlands of Anqing and Wuwei appeared as another group. There is a little genetic diversity of the snail cytochrome oxidase I (CO I ) in different ecological environments among the upstream, midstream and downstream regions along the Yangtz River in Anhui Province.

Mapping of Human FOXP2 Enhancers Reveals Complex Regulation.

PubMed

Becker, Martin; Devanna, Paolo; Fisher, Simon E; Vernes, Sonja C

2018-01-01

Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2 . Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders.

Mapping of Human FOXP2 Enhancers Reveals Complex Regulation

PubMed Central

Becker, Martin; Devanna, Paolo; Fisher, Simon E.; Vernes, Sonja C.

2018-01-01

Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators – FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2. Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders. PMID:29515369

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

NASA Astrophysics Data System (ADS)

Simley, Eric; Y Pao, Lucy; Gebraad, Pieter; Churchfield, Matthew

2014-06-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone.

Red-Green Color Vision Impairment in Duchenne Muscular Dystrophy

PubMed Central

Costa, Marcelo Fernandes ; Oliveira, Andre Gustavo Fernandes ; Feitosa-Santana, Claudia ; Zatz, Mayana ; Ventura, Dora Fix 

2007-01-01

The present study evaluated the color vision of 44 patients with Duchenne muscular dystrophy (DMD) (mean age 14.8 years; SD 4.9) who were submitted to a battery of four different color tests: Cambridge Colour Test (CCT), Neitz Anomaloscope, Ishihara, and American Optical Hardy-Rand-Rittler (AO H-R-R). Patients were divided into two groups according to the region of deletion in the dystrophin gene: upstream of exon 30 (n=12) and downstream of exon 30 (n=32). The control group was composed of 70 age-matched healthy male subjects with no ophthalmological complaints. Of the patients with DMD, 47% (21/44) had a red-green color vision defect in the CCT, confirmed by the Neitz Anomaloscope with statistical agreement (P<.001). The Ishihara and the AO H-R-R had a lower capacity to detect color defects—5% and 7%, respectively, with no statistical similarity between the results of these two tests nor between CCT and Anomaloscope results (P>.05). Of the patients with deletion downstream of exon 30, 66% had a red-green color defect. No color defect was found in the patients with deletion upstream of exon 30. A negative correlation between the color thresholds and age was found for the controls and patients with DMD, suggesting a nonprogressive color defect. The percentage (66%) of patients with a red-green defect was significantly higher than the expected <10% for the normal male population (P<.001). In contrast, patients with DMD with deletion upstream of exon 30 had normal color vision. This color defect might be partially explained by a retina impairment related to dystrophin isoform Dp260. PMID:17503325

9. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: REINFORCEMENT DETAILS OF ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: REINFORCEMENT DETAILS OF VALVE CONTROL STRUCTURE. Sheet A-20, July, 1939. File no. SA 342/29. - Prado Dam, Embankment, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

Diurnal cycles control the fate of contaminants at an Andean river confluence impacted by legacy mining

NASA Astrophysics Data System (ADS)

Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.

2014-12-01

The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".

Generation of long waves in a fluid flowing over a localized topography at a periodically varying velocity

NASA Astrophysics Data System (ADS)

Ohsugi, Yasuo; Funakoshi, Mitsuaki

2000-05-01

The generation of long waves in a fluid flowing over a localized topography is examined numerically using the forced KdV equation under the assumption that the velocity U of the fluid far from the topography is close to the phase speed of a linear long wave and varies periodically with period T. For T within a few regions, we observe the 1: n entrainment of the wave motion near the topography to period T, in which n upstream-advancing waves are generated in period T. These regions extend and shift to larger T as the average value or amplitude of the variation of U increases. Furthermore, when the entrainment occurs, the spatial region where time-periodic evolution is almost attained extends toward both upstream and downstream directions with increasing time.

Heads, Shoulders, Elbows, Knees, and Toes: Modular Gdf5 Enhancers Control Different Joints in the Vertebrate Skeleton

PubMed Central

Schoor, Michael; Mortlock, Doug P.; Reddi, A. Hari; Kingsley, David M.

2016-01-01

Synovial joints are crucial for support and locomotion in vertebrates, and are the frequent site of serious skeletal defects and degenerative diseases in humans. Growth and differentiation factor 5 (Gdf5) is one of the earliest markers of joint formation, is required for normal joint development in both mice and humans, and has been genetically linked to risk of common osteoarthritis in Eurasian populations. Here, we systematically survey the mouse Gdf5 gene for regulatory elements controlling expression in synovial joints. We identify separate regions of the locus that control expression in axial tissues, in proximal versus distal joints in the limbs, and in remarkably specific sub-sets of composite joints like the elbow. Predicted transcription factor binding sites within Gdf5 regulatory enhancers are required for expression in particular joints. The multiple enhancers that control Gdf5 expression in different joints are distributed over a hundred kilobases of DNA, including regions both upstream and downstream of Gdf5 coding exons. Functional rescue tests in mice confirm that the large flanking regions are required to restore normal joint formation and patterning. Orthologs of these enhancers are located throughout the large genomic region previously associated with common osteoarthritis risk in humans. The large array of modular enhancers for Gdf5 provide a new foundation for studying the spatial specificity of joint patterning in vertebrates, as well as new candidates for regulatory regions that may also influence osteoarthritis risk in human populations. PMID:27902701

Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

PubMed

Yoshino, M; Tsutsumi, K; Kanazawa, A

2015-01-01

β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Sweep and Compressibility Effects on Active Separation Control at High Reynolds Numbers

NASA Technical Reports Server (NTRS)

Seifert, Avi; Pack, LaTunia G.

2000-01-01

This paper explores the effects of compressibility, sweep and excitation location on active separation control at high Reynolds numbers. The model, which was tested in a cryogenic pressurized wind tunnel, simulates the upper surface of a 20% thick GlauertGoldschmied type airfoil at zero angle of attack. The flow is fully turbulent since the tunnel sidewall boundary layer flows over the model. Without control, the flow separates at the highly convex area and a large turbulent separation bubble is formed. Periodic excitation is applied to gradually eliminate the separation bubble. Two alternative blowing slot locations as well as the effect of compressibility, sweep and steady suction or blowing were studied. During the test the Reynolds numbers ranged from 2 to 40 million and Mach numbers ranged from 0.2 to 0.7. Sweep angles were 0 and 30 deg. It was found that excitation must be introduced slightly upstream of the separation region regardless of the sweep angle at low Mach number. Introduction of excitation upstream of the shock wave is more effective than at its foot. Compressibility reduces the ability of steady mass transfer and periodic excitation to control the separation bubble but excitation has an effect on the integral parameters, which is similar to that observed in low Mach numbers. The conventional swept flow scaling is valid for fully and even partially attached flow, but different scaling is required for the separated 3D flow. The effectiveness of the active control is not reduced by sweep. Detailed flow field dynamics are described in the accompanying paper.

Sweep and Compressibility Effects on Active Separation Control at High Reynolds Numbers

NASA Technical Reports Server (NTRS)

Seifert, Avi; Pack, LaTunia G.

2000-01-01

This paper explores the effects of compressibility, sweep and excitation location on active separation control at high Reynolds numbers. The model, which was tested in a cryogenic pressurized wind tunnel, simulates the upper surface of a 20% thick Glauert Goldschmied type airfoil at zero angle of attack. The flow is fully turbulent since the tunnel sidewall boundary layer flows over the model. Without control, the flow separates at the highly convex area and a large turbulent separation bubble is formed. Periodic excitation is applied to gradually eliminate the separation bubble. Two alternative blowing slot locations as well as the effect of compressibility, sweep and steady suction or blowing were studied. During the test the Reynolds numbers ranged from 2 to 40 million and Mach numbers ranged from 0.2 to 0.7. Sweep angles were 0 and 30 deg. It was found that excitation must be introduced slightly upstream of the separation region regardless of the sweep angle at low Mach number. Introduction of excitation upstream of the shock wave is more effective than at its foot. Compressibility reduces the ability of steady mass transfer and periodic excitation to control the separation bubble but excitation has an effect on the integral parameters, which is similar to that observed in low Mach numbers. The conventional swept flow scaling is valid for fully and even partially attached flow, but different scaling is required for the separated 3D flow. The effectiveness of the active control is not reduced by sweep. Detailed flow field dynamics are described in the accompanying paper.

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

Upstream capacity upgrade in TDM-PON using RSOA based tunable fiber ring laser.

PubMed

Yi, Lilin; Li, Zhengxuan; Dong, Yi; Xiao, Shilin; Chen, Jian; Hu, Weisheng

2012-04-23

An upstream multi-wavelength shared (UMWS) time division multiplexing passive optical network (TDM-PON) is presented by using a reflective semiconductor amplifier (RSOA) and tunable optical filter (TOF) based directly modulated fiber ring laser as upstream laser source. The stable laser operation is easily achieved no matter what the bandwidth and shape of the TOF is and it can be directly modulated when the RSOA is driven at its saturation region. In this UMWS TDM-PON system, an individual wavelength can be assigned to the user who has a high bandwidth demand by tuning the central wavelength of the TOF in its upgraded optical network unit (ONU), while others maintain their traditional ONU structure and share the bandwidth via time slots, which greatly and dynamically upgrades the upstream capacity. We experimentally demonstrated the bidirectional transmission of downstream data at 10-Gb/s and upstream data at 1.25-Gb/s per wavelength over 25-km single mode fiber (SMF) with almost no power penalty at both ends. A stable performance is observed for the upstream wavelength tuned from 1530 nm to 1595 nm. Moreover, due to the high extinction ratio (ER) of the upstream signal, the burst-mode transmitting is successfully presented and a better time-division multiplexing performance can be obtained by turning off the unused lasers thanks to the rapid formation of the laser in the fiber ring. © 2012 Optical Society of America

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Control of shock-wave boundary-layer interactions by bleed in supersonic mixed compression inlets

NASA Technical Reports Server (NTRS)

Fukuda, M. K.; Reshotko, E.; Hingst, W. R.

1975-01-01

An experimental investigation has been conducted to determine the effect of bleed region geometry and bleed rate on shock wave-boundary layer interactions in an axisymmetric, mixed-compression inlet at a Mach number of 2.5. The full realizable reduction in transformed form factor is obtained by bleeding off about half the incident boundary layer mass flow. Bleeding upstream or downstream of the shock-induced pressure rise is preferable to bleeding across the shock-induced pressure rise. Slanted holes are more effective than normal holes. Two different bleed hole sizes were tested without detectable difference in performance.

40 CFR 1065.659 - Removed water correction.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 34 2013-07-01 2013-07-01 false Removed water correction. 1065.659... CONTROLS ENGINE-TESTING PROCEDURES Calculations and Data Requirements § 1065.659 Removed water correction. (a) If you remove water upstream of a concentration measurement, x, or upstream of a flow measurement...

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Upstream waves and particles /Tutorial Lecture/. [from shocks in interplanetary space

NASA Technical Reports Server (NTRS)

Russell, C. T.; Hoppe, M. M.

1983-01-01

The plasma waves, MHD waves, energetic electrons and ions associated with the proximity of the region upstream from terrestrial, planetary and interplanetary shocks are discussed in view of observations and current theories concerning their origin. These waves cannot be separated from the study of shock structure. Since the shocks are supersonic, they continually overtake any ULF waves created in the plasma in front of the shock. The upstream particles and waves are also of intrinsic interest because they provide a plasma laboratory for the study of wave-particle interactions in a plasma which, at least at the earth, is accessible to sophisticated probing. Insight may be gained into interstellar medium cosmic ray acceleration through the study of these phenomena.

Landscape-based upstream-downstream prevalence of land-use/cover change drivers in southeastern rift escarpment of Ethiopia.

PubMed

Temesgen, Habtamu; Wu, Wei; Legesse, Abiyot; Yirsaw, Eshetu; Bekele, Belew

2018-02-23

Characterized by high population density on a rugged topography, the Gedeo-Abaya landscape dominantly contains a multi-strata traditional agroforests showing the insight of Gedeo farmers on natural resource management practices. Currently, this area has been losing its resilience and is becoming unable to sustain its inhabitants. Based on both RS-derived and GIS-computed land-use/cover changes (LUCC) as well as socioeconomic validations, this article explored the LUCC and agroecological-based driver patterns in Gedeo-Abaya landscape from 1986 to 2015. A combination of geo-spatial technology and cross-sectional survey design were employed to detect the drivers behind these changes. The article discussed that LUCC and the prevalence of drivers are highly diverse and vary throughout agroecological zones. Except for the population, most downstream top drivers are perceived as insignificant in the upstream region and vice versa. In the downstream, land-use/cover (LUC) classes are more dynamic, diverse, and challenged by nearly all anticipated drivers than are upstream ones. Agroforestry LUC has been increasing (by 25% of its initial cover) and is becoming the predominant cover type, although socioeconomic analysis and related findings show its rapid LUC modification. A rapid reduction of woodland/shrubland (63%) occurred in the downstream, while wetland/marshy land increased threefold (158%), from 1986 to 2015 with annual change rates of - 3.7 and + 6%, respectively. Land degradation induced by changes in land use is a serious problem in Africa, especially in the densely populated sub-Saharan regions such as Ethiopia (FAO 2015). Throughout the landscape, LUCC is prominently affecting land-use system of the study landscape due to population pressure in the upstream region and drought/rainfall variability, agribusiness investment, and charcoaling in the downstream that necessitate urgent action.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

PubMed Central

2012-01-01

Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

PubMed

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

Multipoint study of interplanetary shocks

NASA Astrophysics Data System (ADS)

Blanco-Cano, Xochitl; Kajdic, Primoz; Russell, Christopher T.; Aguilar-Rodriguez, Ernesto; Jian, Lan K.; Luhmann, Janet G.

2016-04-01

Interplanetary (IP) shocks are driven in the heliosphere by Interplanetary Coronal Mass Ejections (ICMEs) and Stream Interaction Regions (SIRs). These shocks perturb the solar wind plasma, and play an active role in the acceleration of ions to suprathermal energies. Shock fronts evolve as they move from the Sun. Their surfaces can be far from uniform and be modulated by changes in the ambient solar wind (magnetic field orientation, flow velocity), shocks rippling, and perturbations upstream and downstream from the shocks, i.e., electromagnetic waves. In this work we use multipoint observations from STEREO, WIND, and MESSENGER missions to study shock characteristics at different helio-longitudes and determine the properties of the waves near them. We also determine shock longitudinal extensions and foreshock sizes. The variations of geometry along the shock surface can result in different extensions of the wave and ion foreshocks ahead of the shocks, and in different wave modes upstream and downtream of the shocks. We find that the ion foreshock can extend up to 0.2 AU ahead of the shock, and that the upstream region with modified solar wind/waves can be very asymmetric.

Enhancing the aggressive intensity of hydrodynamic cavitation through a Venturi tube by increasing the pressure in the region where the bubbles collapse

NASA Astrophysics Data System (ADS)

Soyama, H.; Hoshino, J.

2016-04-01

In this paper, we used a Venturi tube for generating hydrodynamic cavitation, and in order to obtain the optimum conditions for this to be used in chemical processes, the relationship between the aggressive intensity of the cavitation and the downstream pressure where the cavitation bubbles collapse was investigated. The acoustic power and the luminescence induced by the bubbles collapsing were investigated under various cavitating conditions, and the relationships between these and the cavitation number, which depends on the upstream pressure, the downstream pressure at the throat of the tube and the vapor pressure of the test water, was found. It was shown that the optimum downstream pressure, i.e., the pressure in the region where the bubbles collapse, increased the aggressive intensity by a factor of about 100 compared to atmospheric pressure without the need to increase the input power. Although the optimum downstream pressure varied with the upstream pressure, the cavitation number giving the optimum conditions was constant for all upstream pressures.

Computer analysis of flow perturbations generated by placement of choke bumps in a wind tunnel

NASA Technical Reports Server (NTRS)

Campbell, R. L.

1981-01-01

An inviscid analytical study was conducted to determine the upstream flow perturbations caused by placing choke bumps in a wind tunnel. A computer program based on the stream-tube curvature method was used to calculate the resulting flow fields for a nominal free-stream Mach number range of 0.6 to 0.9. The choke bump geometry was also varied to investigate the effect of bump shape on the disturbance produced. Results from the study indicate that a region of significant variation from the free-stream conditions exists upstream of the throat of the tunnel. The extent of the disturbance region was, as a rule, dependent on Mach number and the geometry of the choke bump. In general, the upstream disturbance distance decreased for increasing nominal free-stream Mach number and for decreasing length-to-height ratio of the bump. A polynomial-curve choke bump usually produced less of a disturbance than did a circular-arc bump and going to an axisymmetric configuration (modeling choke bumps on all the tunnel walls) generally resulted in a lower disturbance than with the corresponding two dimensional case.

Paleogeomorphology of the early Colorado River inferred from relationships in Mohave and Cottonwood Valleys, Arizona, California and Nevada

USGS Publications Warehouse

Pearthree, Philip; House, P. Kyle

2014-01-01

Geologic investigations of late Miocene–early Pliocene deposits in Mohave and Cottonwood valleys provide important insights into the early evolution of the lower Colorado River system. In the latest Miocene these valleys were separate depocenters; the floor of Cottonwood Valley was ∼200 m higher than the floor of Mohave Valley. When Colorado River water arrived from the north after 5.6 Ma, a shallow lake in Cottonwood Valley spilled into Mohave Valley, and the river then filled both valleys to ∼560 m above sea level (asl) and overtopped the bedrock divide at the southern end of Mohave Valley. Sediment-starved water spilling to the south gradually eroded the outlet as siliciclastic Bouse deposits filled the lake upstream. When sediment accumulation reached the elevation of the lowering outlet, continued erosion of the outlet resulted in recycling of stored lacustrine sediment into downstream basins; depth of erosion of the outlet and upstream basins was limited by the water levels in downstream basins. The water level in the southern Bouse basin was ∼300 m asl (modern elevation) at 4.8 Ma. It must have drained and been eroded to a level <150 m asl soon after that to allow for deep erosion of bedrock divides and basins upstream, leading to removal of large volumes of Bouse sediment prior to massive early Pliocene Colorado River aggradation. Abrupt lowering of regional base level due to spilling of a southern Bouse lake to the Gulf of California could have driven observed upstream river incision without uplift. Rapid uplift of the entire region immediately after 4.8 Ma would have been required to drive upstream incision if the southern Bouse was an estuary.

Adaptive upstream optical power adjustment depending on required power budget in PON access

NASA Astrophysics Data System (ADS)

Yeh, C. H.; Chow, C. W.; Liu, Y. L.

2012-11-01

According to the present passive optical network (PON) standard, the fiber transmission lengths are from 500 m to 20 km between the optical line terminal (OLT) and different optical network units (ONUs). It will result in difference power losses (ΔPloss) from 4 to 5 dB. Hence, we propose to adjust adaptively the output optical power of the upstream laser diode (LD) depending on the different fiber lengths. With the different fiber transmission lengths, we can properly adjust the bias current and modulation index of upstream LD for energy-saving. We characterize and analyze experimentally the relationship of output optical power and modulation amplitude Vamp under different fiber transmissions in PON access. Moreover, due to the adaptive power control of upstream signal, the optical upstream equalization also can be retrieved with power variation of 1.1 dB in this experiment.

The development of a microprocessor-controlled linearly-actuated valve assembly

NASA Technical Reports Server (NTRS)

Wall, R. H.

1984-01-01

The development of a proportional fluid control valve assembly is presented. This electromechanical system is needed for space applications to replace the current proportional flow controllers. The flow is controlled by a microprocessor system that monitors the control parameters of upstream pressure and requested volumetric flow rate. The microprocessor achieves the proper valve stem displacement by means of a digital linear actuator. A linear displacement sensor is used to measure the valve stem position. This displacement is monitored by the microprocessor system as a feedback signal to close the control loop. With an upstream pressure between 15 and 47 psig, the developed system operates between 779 standard CU cm/sec (SCCS) and 1543 SCCS.

Strategy to Conduct Quantitative Ecohydrologic Analysis of a UNESCO World Heritage Site: the Peace-Athabasca Delta, Canada

NASA Astrophysics Data System (ADS)

Ward, E. M.; Gorelick, S.; Hadly, E. A.

2016-12-01

The 6000 km2 Peace-Athabasca Delta ("Delta") in northeastern Alberta, Canada, is a Ramsar Convention Wetland and UNESCO World Heritage Site ("in Danger" status pending) where hydropower development and climate change are creating ecological impacts through desiccation and reduction in Delta shoreline habitat. We focus on ecohydrologic changes and mitigation and adaptation options to advance the field of ecohydrology using interdisciplinary technology by combining, for the first time, satellite remote sensing and hydrologic simulation with individual-based population modeling of muskrat (Ondatra zibethicus), a species native to the Delta whose population dynamics are strongly controlled by the hydrology of floodplain lakes. We are building a conceptual and quantitative modeling framework linking climate change, upstream water demand, and hydrologic change in the floodplain to muskrat population dynamics with the objective of exploring the impacts of these stressors on this ecosystem. We explicitly account for cultural and humanistic influences and are committed to effective communication with the regional subsistence community that depends on muskrat for food and income. Our modeling framework can ultimately serve as the basis for improved stewardship and sustainable development upstream of stressed freshwater deltaic, coastal and lake systems worldwide affected by climate change, providing a predictive tool to quantify population changes of animals relevant to regional subsistence food security and commercial trapping.

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1.

PubMed

Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian

2012-05-06

Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.

Sedimentation and erosion in Lake Diefenbaker, Canada: solutions for shoreline retreat monitoring.

PubMed

Sadeghian, Amir; de Boer, Dirk; Lindenschmidt, Karl-Erich

2017-09-15

This study looks into sedimentation and erosion rates in Lake Diefenbaker, a prairie reservoir, in Saskatchewan, Canada, which has been in operation since 1968. First, we looked at the historical data in all different formats over the last 70 years, which includes data from more than 20 years before the formation of the lake. The field observations indicate high rates of shoreline erosion, especially in the upstream portion as a potential region for shoreline retreat. Because of the great importance of this waterbody to the province, monitoring sedimentation and erosion rates is necessary for maintaining the quality of water especially after severe floods which are more common due to climate change effects. Second, we used Google Maps Elevation API, a new tool from Google that provides elevation data for cross sections drawn between two points, by drawing 24 cross sections in the upstream area extending 250 m from each bank. This feature from Google can be used as an easy and fast monitoring tool, is free of charge, and provides excellent control capabilities for monitoring changes in cross-sectional profiles.

The impact of an underground cut-off wall on nutrient dynamics in groundwater in the lower Wang River watershed, China.

PubMed

Kang, Pingping; Xu, Shiguo

2017-03-01

Underground cut-off walls in coastal regions are mainly used to prevent saltwater intrusion, but their impact on nutrient dynamics in groundwater is not clear. In this study, a combined analysis of multiple isotopes ([Formula: see text]) and nitrogen and phosphorus concentrations is used in order to assess the impact of the underground cut-off walls on the nutrient dynamics in groundwater in the lower Wang River watershed, China. Compared with the nitrogen and phosphorus concentrations in groundwater downstream of the underground cut-off walls, high [Formula: see text] and total dissolved nitrogen concentrations and similar concentration levels of [Formula: see text] and total dissolved phosphorus are found in groundwater upstream of the underground cut-off walls. The isotopic data indicated the probable occurrence of denitrification and nitrification processes in groundwater upstream, whereas the fingerprint of these processes was not shown in groundwater downstream. The management of fertilizer application is critical to control nitrogen concentrations in groundwater restricted by the underground cut-off walls.

Development of Semi-Span Model Test Techniques

NASA Technical Reports Server (NTRS)

Pulnam, L. Elwood (Technical Monitor); Milholen, William E., II; Chokani, Ndaona; McGhee, Robert J.

1996-01-01

A computational investigation was performed to support the development of a semi-span model test capability in the NASA Langley Research Center's National Transonic Facility. This capability is desirable for the testing of advanced subsonic transport aircraft at full-scale Reynolds numbers. A state-of-the-art three-dimensional Navier-Stokes solver was used to examine methods to improve the flow over a semi-span configuration. First, a parametric study is conducted to examine the influence of the stand-off height on the flow over the semi-span model. It is found that decreasing the stand-off height, below the maximum fuselage radius, improves the aerodynamic characteristics of the semi-span model. Next, active sidewall boundary layer control techniques are examined. Juncture region blowing jets, upstream tangential blowing, and sidewall suction are found to improve the flow over the aft portion of the semi-span model. Both upstream blowing and suction are found to reduce the sidewall boundary layer separation. The resulting near surface streamline patterns are improved, and found to be quite similar to the full-span results. Both techniques however adversely affect the pitching moment coefficient.

Development of Semi-Span Model Test Techniques

NASA Technical Reports Server (NTRS)

Milholen, William E., II; Chokani, Ndaona; McGhee, Robert J.

1996-01-01

A computational investigation was performed to support the development of a semispan model test capability in the NASA Langley Research Center's National Transonic Facility. This capability is desirable for the testing of advanced subsonic transport aircraft at full-scale Reynolds numbers. A state-of-the-art three-dimensional Navier-Stokes solver was used to examine methods to improve the flow over a semi-span configuration. First, a parametric study is conducted to examine the influence of the stand-off height on the flow over the semispan model. It is found that decreasing the stand-off height, below the maximum fuselage radius, improves the aerodynamic characteristics of the semi-span model. Next, active sidewall boundary layer control techniques are examined. Juncture region blowing jets, upstream tangential blowing, and sidewall suction are found to improve the flow over the aft portion of the semispan model. Both upstream blowing and suction are found to reduce the sidewall boundary layer separation. The resulting near surface streamline patterns are improved, and found to be quite similar to the full-span results. Both techniques however adversely affect the pitching moment coefficient.

The exposure of the Great Barrier Reef to ocean acidification

PubMed Central

Mongin, Mathieu; Baird, Mark E.; Tilbrook, Bronte; Matear, Richard J.; Lenton, Andrew; Herzfeld, Mike; Wild-Allen, Karen; Skerratt, Jenny; Margvelashvili, Nugzar; Robson, Barbara J.; Duarte, Carlos M.; Gustafsson, Malin S. M.; Ralph, Peter J.; Steven, Andrew D. L.

2016-01-01

The Great Barrier Reef (GBR) is founded on reef-building corals. Corals build their exoskeleton with aragonite, but ocean acidification is lowering the aragonite saturation state of seawater (Ωa). The downscaling of ocean acidification projections from global to GBR scales requires the set of regional drivers controlling Ωa to be resolved. Here we use a regional coupled circulation–biogeochemical model and observations to estimate the Ωa experienced by the 3,581 reefs of the GBR, and to apportion the contributions of the hydrological cycle, regional hydrodynamics and metabolism on Ωa variability. We find more detail, and a greater range (1.43), than previously compiled coarse maps of Ωa of the region (0.4), or in observations (1.0). Most of the variability in Ωa is due to processes upstream of the reef in question. As a result, future decline in Ωa is likely to be steeper on the GBR than currently projected by the IPCC assessment report. PMID:26907171

The exposure of the Great Barrier Reef to ocean acidification.

PubMed

Mongin, Mathieu; Baird, Mark E; Tilbrook, Bronte; Matear, Richard J; Lenton, Andrew; Herzfeld, Mike; Wild-Allen, Karen; Skerratt, Jenny; Margvelashvili, Nugzar; Robson, Barbara J; Duarte, Carlos M; Gustafsson, Malin S M; Ralph, Peter J; Steven, Andrew D L

2016-02-23

The Great Barrier Reef (GBR) is founded on reef-building corals. Corals build their exoskeleton with aragonite, but ocean acidification is lowering the aragonite saturation state of seawater (Ωa). The downscaling of ocean acidification projections from global to GBR scales requires the set of regional drivers controlling Ωa to be resolved. Here we use a regional coupled circulation-biogeochemical model and observations to estimate the Ωa experienced by the 3,581 reefs of the GBR, and to apportion the contributions of the hydrological cycle, regional hydrodynamics and metabolism on Ωa variability. We find more detail, and a greater range (1.43), than previously compiled coarse maps of Ωa of the region (0.4), or in observations (1.0). Most of the variability in Ωa is due to processes upstream of the reef in question. As a result, future decline in Ωa is likely to be steeper on the GBR than currently projected by the IPCC assessment report.

Comparative analysis of Histone modifications and DNA methylation at OsBZ8 locus under salinity stress in IR64 and Nonabokra rice varieties.

PubMed

Paul, Amit; Dasgupta, Pratiti; Roy, Dipan; Chaudhuri, Shubho

2017-09-01

Rice being an important cereal crop is highly sensitive to salinity stress causing growth retardation and loss in productivity. However, certain rice genotypes like Nonabokra and Pokkali show a high level of tolerance towards salinity stress compared to IR64 variety. This differential response of tolerant varieties towards salinity stress may be a cumulative effect of genetic and epigenetic factors. In this study, we have compared the salinity-induced changes in chromatin modifications at the OsBZ8 locus in salt-tolerant Nonabokra and salt-sensitive IR64 rice varieties. Expression analysis indicates that the OsBZ8 gene is highly induced in Nonabokra plants even in the absence of salt stress, whereas in IR64, the expression significantly increases only during salt stress. Sequence analysis and nucleosomal arrangement within the region -2000 to +1000 of OsBZ8 gene show no difference between the two rice varieties. However, there was a considerable difference in histone modifications and DNA methylation at the locus between these varieties. In Nonabokra, the upstream region was hyperacetylated at H3K9 and H3K27, and this acetylation did not change during salt stress. However, in IR64, histone acetylation was observed only during salt stress. Moreover, the upstream region of OsBZ8 gene has highly dynamic nucleosome arrangement in Nonabokra, compared to IR64. Furthermore, loss of DNA methylation was observed at OsBZ8 locus in Nonabokra control plants along with low H3K27me3 and high H3K4me3. Control IR64 plants show high DNA methylation and enriched H3K27me3. Collectively these results indicate a significant difference in chromatin modifications between the rice varieties that regulates differential expression of OsBZ8 gene during salt stress.

Computational modeling of the EGFR network elucidates control mechanisms regulating signal dynamics

PubMed Central

2009-01-01

Background The epidermal growth factor receptor (EGFR) signaling pathway plays a key role in regulation of cellular growth and development. While highly studied, it is still not fully understood how the signal is orchestrated. One of the reasons for the complexity of this pathway is the extensive network of inter-connected components involved in the signaling. In the aim of identifying critical mechanisms controlling signal transduction we have performed extensive analysis of an executable model of the EGFR pathway using the stochastic pi-calculus as a modeling language. Results Our analysis, done through simulation of various perturbations, suggests that the EGFR pathway contains regions of functional redundancy in the upstream parts; in the event of low EGF stimulus or partial system failure, this redundancy helps to maintain functional robustness. Downstream parts, like the parts controlling Ras and ERK, have fewer redundancies, and more than 50% inhibition of specific reactions in those parts greatly attenuates signal response. In addition, we suggest an abstract model that captures the main control mechanisms in the pathway. Simulation of this abstract model suggests that without redundancies in the upstream modules, signal transduction through the entire pathway could be attenuated. In terms of specific control mechanisms, we have identified positive feedback loops whose role is to prolong the active state of key components (e.g., MEK-PP, Ras-GTP), and negative feedback loops that help promote signal adaptation and stabilization. Conclusions The insights gained from simulating this executable model facilitate the formulation of specific hypotheses regarding the control mechanisms of the EGFR signaling, and further substantiate the benefit to construct abstract executable models of large complex biological networks. PMID:20028552

Effects of land use, climate, topography and soil properties on regional soil organic carbon and total nitrogen in the upstream watershed of Miyun Reservoir, North China.

PubMed

Wang, Shufang; Wang, Xiaoke; Ouyang, Zhiyun

2012-01-01

Soil organic carbon (SOC) and total nitrogen (TN) contents as well as their relationships with site characteristics are of profound importance in assessing current regional, continental and global soil C and N stocks and potentials for C sequestration and N conservation to offset anthropogenic emissions of greenhouse gases. This study investigated contents and distribution of SOC and TN under different land uses, and the quantitative relationships between SOC or TN and site characteristics in the Upstream Watershed of Miyun Reservoir, North China. Overall, both SOC and TN contents in natural secondary forests and grasslands were much higher than in plantations and croplands. Land use alone explained 37.2% and 38.4% of variations in SOC and TN contents, respectively. The optimal models for SOC and TN, achieved by multiple regression analysis combined with principal component analysis (PCA) to remove the multicollinearity among site variables, showed that elevation, slope, soil clay and water contents were the most significant factors controlling SOC and TN contents, jointly explaining 70.3% of SOC and 67.1% of TN contents variability. Only does additional 1.9% and 3% increase in the interpretations of SOC and TN contents variability respectively when land use was added to regressions, probably due to environment factors determine land use. Therefore, environmental variables were more important for SOC and TN variability than land use in the study area, and should be taken into consideration in properly evaluating effects of future land use changes on SOC and TN on a regional scale.

Structure and regulation of the Yersinia pestis yscBCDEF operon.

PubMed Central

Haddix, P L; Straley, S C

1992-01-01

We have investigated the physical and genetic structure and regulation of the Yersinia pestis yscBCDEF region, previously called lcrC. DNA sequence analysis showed that this region is homologous to the corresponding part of the ysc locus of Yersinia enterocolitica and suggested that the yscBCDEF cistrons belong to a single operon on the low-calcium response virulence plasmid pCD1. Promoter activity measurements of ysc subclones indicated that yscBCDEF constitutes a suboperon of the larger ysc region by revealing promoter activity in a clone containing the 3' end of yscD, intact yscE and yscF, and part of yscG. These experiments also revealed an additional weak promoter upstream of yscD. Northern (RNA) analysis with a yscD probe showed that operon transcription is thermally induced and downregulated in the presence of Ca2+. Primer extension of operon transcripts suggested that two promoters, a moderate-level constitutive one and a stronger, calcium-downregulated one, control full-length operon transcription at 37 degrees C. Primer extension provided additional support for the proposed designation of a yscBCDEF suboperon by identifying a 5' end within yscF, for which relative abundances in the presence and absence of Ca2+ revealed regulation that is distinct from that for transcripts initiating farther upstream. YscB and YscC were expressed in Escherichia coli by using a high-level transcription system. Attempts to express YscD were only partially successful, but they revealed interesting regulation at the translational level. Images PMID:1624469

Plasma flow in peripheral region of detached plasma in linear plasma device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hayashi, Y., E-mail: hayashi-yuki13@ees.nagoya-u.ac.jp; Ohno, N.; Kajita, S.

2016-01-15

A plasma flow structure is investigated using a Mach probe under detached plasma condition in a linear plasma device NAGDIS-II. A reverse flow along the magnetic field is observed in a steady-state at far-peripheral region of the plasma column in the upstream side from the recombination front. These experimental results indicate that plasma near the recombination front should strongly diffuse across the magnetic field, and it should be transported along the magnetic field in the reverse flow direction. Furthermore, bursty plasma density fluctuations associated with intermittent convective plasma transport are observed in the far-peripheral region of the plasma column inmore » both upstream and downstream sides from the recombination front. Such a nondiffusive transport can contribute to the intermittent reverse plasma flow, and the experimental results indicate that intermittent transports are frequently produced near the recombination front.« less

A laboratory study of ion energization by EIC waves and subsequent upstreaming along diverging magnetic field lines

NASA Technical Reports Server (NTRS)

Cartier, S. L.; Dangelo, N.; Merlino, R. L.

1986-01-01

A laboratory study related to energetic upstreaming ions in the ionosphere-magnetosphere system is described. The experiment was carried out in a cesium Q machine plasma with a region of nonuniform magnetic field. Electrostatic ion cyclotron waves were excited by drawing an electron current to a small biased exciter electrode. In the presence of the instability, ions are heated in the direction perpendicular to B. Using a gridded retarding potential ion energy analyzer, the evolution of the ion velocity distribution was followed as the ions passed through the heating region and subsequently flowed out along the diverging B field lines. As expected, the heated ions transfer their energy from perpendicular to parallel motion as they move through the region of diverging B field. Both their parallel thermal energy and the parallel drift energy increase at the expense of the perpendicular energy.

Methods for freshwater riverine input into regional ocean models

NASA Astrophysics Data System (ADS)

Herzfeld, M.

2015-06-01

The input of freshwater at the coast in regional models is a non-trivial exercise that has been studied extensively in the past. Several issues are of relevance; firstly, estuaries process water properties along their length, so that while freshwater may enter at the estuary head, it is no longer fresh at the mouth. Secondly, models create a numerical response that results in excessive upstream or offshore transport compared to what is typically observed. The cause of this has been traced to the lack of landward flow at the coast where freshwater is input. In this study we assess the performance of various methods of freshwater input in coarse resolution regional models where the estuary cannot be explicitly resolved, and present a formulation that attempts to account for upstream flow in the salt wedge and in-estuary mixing that elevates salinity at the mouth.

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

Energies of backstreaming protons in the foreshock

NASA Technical Reports Server (NTRS)

Greenstadt, E. W.

1976-01-01

A predicted pattern of energy vs detector location in the cislunar region is displayed for protons of zero pitch angle traveling upstream away from the quasi-parallel bow shock. The pattern is implied by upstream wave boundary properties. In the solar ecliptic, protons are estimated to have a minimum of 1.1 times the solar wind bulk energy E sub SW when the wave boundary is in the early morning sector and a maximum of 8.2 E sub SW when the boundary is near the predawn flank.

Blade-to-Blade Variations in Shocks Upstream of Both a Forward-Swept and an Aft-Swept Fan

NASA Technical Reports Server (NTRS)

Podboy, Gary G.; Krupar, Martin J.

2006-01-01

Detailed laser Doppler velocimeter (LDV) flow field measurements were made upstream of two fans, one forward-swept and one aft-swept, in order to learn more about the shocks which propagate upstream of these rotors when they are operated at supersonic tip speeds. The blade-to-blade variations in the flows associated with these shocks are thought to be responsible for generating Multiple Pure Tone (MPT) noise. The measured blade-to-blade variations are documented in this report through a series of slideshows which show relative Mach number contours computed from the velocity measurements. Data are presented for the forward-swept fan operating at three speeds (corresponding to tip relative Mach numbers of 0.817, 1.074, and 1.189), and for the aft-swept fan operating at two (tip relative Mach numbers of 1.074 and 1.189). These LDV data illustrate how the perturbations in the upstream flow field created by the rotating blades vary with axial position, radial position and rotor speed. As expected, at the highest tested speed the forward-swept fan swallowed the shocks which occur in the tip region, whereas the aftswept fan did not. This resulted in a much smaller flow disturbance just upstream of the tip of the forward-swept fan. Nevertheless, further upstream the two fan flows were much more similar.

Predicting the Inflow Distortion Tone Noise of the NASA Glenn Advanced Noise Control Fan with a Combined Quadrupole-Dipole Model

NASA Technical Reports Server (NTRS)

Koch, L. Danielle

2012-01-01

A combined quadrupole-dipole model of fan inflow distortion tone noise has been extended to calculate tone sound power levels generated by obstructions arranged in circumferentially asymmetric locations upstream of a rotor. Trends in calculated sound power level agreed well with measurements from tests conducted in 2007 in the NASA Glenn Advanced Noise Control Fan. Calculated values of sound power levels radiated upstream were demonstrated to be sensitive to the accuracy of the modeled wakes from the cylindrical rods that were placed upstream of the fan to distort the inflow. Results indicate a continued need to obtain accurate aerodynamic predictions and measurements at the fan inlet plane as engineers work towards developing fan inflow distortion tone noise prediction tools.

Discrete modelling of front propagation in backward piping erosion

NASA Astrophysics Data System (ADS)

Tran, Duc-Kien; Prime, Noémie; Froiio, Francesco; Callari, Carlo; Vincens, Eric

2017-06-01

A preliminary discrete numerical model of a REV at the front region of an erosion pipe in a cohesive granular soil is briefly presented. The results reported herein refer to a simulation carried out by coupling the Discrete Element Method (DEM) with the Lattice Boltzmann Method (LBM) for the representation of the granular and fluid phases, respectively. The numerical specimen, consisiting of bonded grains, is tested under fully-saturated conditions and increasing pressure difference between the inlet (confined) and the outlet (unconfined) flow regions. The key role of compression arches of force chains that transversely cross the sample and carry most part of the hydrodynamic actions is pointed out. These arches partition the REV into an upstream region that remains almost intact and a downstream region that gradually degrades and is subsequently eroded in the form of a cluster. Eventually, the collapse of the compression arches causes the upstream region to be also eroded, abruptly, as a whole. A complete presentation of the numerical model and of the results of the simulation can be found in [12].

Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

PubMed

Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

2012-12-01

Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

The effect of artificial selection on phenotypic plasticity in maize.

PubMed

Gage, Joseph L; Jarquin, Diego; Romay, Cinta; Lorenz, Aaron; Buckler, Edward S; Kaeppler, Shawn; Alkhalifah, Naser; Bohn, Martin; Campbell, Darwin A; Edwards, Jode; Ertl, David; Flint-Garcia, Sherry; Gardiner, Jack; Good, Byron; Hirsch, Candice N; Holland, Jim; Hooker, David C; Knoll, Joseph; Kolkman, Judith; Kruger, Greg; Lauter, Nick; Lawrence-Dill, Carolyn J; Lee, Elizabeth; Lynch, Jonathan; Murray, Seth C; Nelson, Rebecca; Petzoldt, Jane; Rocheford, Torbert; Schnable, James; Schnable, Patrick S; Scully, Brian; Smith, Margaret; Springer, Nathan M; Srinivasan, Srikant; Walton, Renee; Weldekidan, Teclemariam; Wisser, Randall J; Xu, Wenwei; Yu, Jianming; de Leon, Natalia

2017-11-07

Remarkable productivity has been achieved in crop species through artificial selection and adaptation to modern agronomic practices. Whether intensive selection has changed the ability of improved cultivars to maintain high productivity across variable environments is unknown. Understanding the genetic control of phenotypic plasticity and genotype by environment (G × E) interaction will enhance crop performance predictions across diverse environments. Here we use data generated from the Genomes to Fields (G2F) Maize G × E project to assess the effect of selection on G × E variation and characterize polymorphisms associated with plasticity. Genomic regions putatively selected during modern temperate maize breeding explain less variability for yield G × E than unselected regions, indicating that improvement by breeding may have reduced G × E of modern temperate cultivars. Trends in genomic position of variants associated with stability reveal fewer genic associations and enrichment of variants 0-5000 base pairs upstream of genes, hypothetically due to control of plasticity by short-range regulatory elements.

Cis- and trans-regulation of luteovirus gene expression by the 3’ end of the viral genome

PubMed Central

Miller, W. Allen; Jackson, Jacquelyn; Feng, Ying

2016-01-01

Translation of the 5.7 kb luteovirus genome is controlled by the 3’ untranslated region (UTR). Base pairing between regions of the 3’ UTR and sequences kilobases upstream is required for cap-independent translation and ribosomal frameshifting needed to synthesize the viral replicase. Luteoviruses produce subgenomic RNAs, which can serve as mRNA, but one sgRNA also regulates translation initiation in trans. As on all viruses, the 3’ and 5’ ends contain structures that are presumed to facilitate RNA synthesis. This review describes the structures and interactions of Barley yellow dwarf virus RNA that facilitate the complex interplay between the above events and result in a successful virus infection. We also present surprising results on the apparent lack of need for some subgenomic RNAs for the virus to infect cells or whole plants. In summary, the UTRs of luteoviruses are highly complex entities that control and fine-tune many key events of the virus replication cycle. PMID:25858272

Shock Characteristics Measured Upstream of Both a Forward-Swept and an Aft-Swept Fan

NASA Technical Reports Server (NTRS)

Podboy, Gary G.; Krupar, Martin J.; Sutliff, Daniel L.; Horvath, Csaba

2007-01-01

Three different types of diagnostic data-blade surface flow visualization, shroud unsteady pressure, and laser Doppler velocimeter (LDV)--were obtained on two fans, one forward-swept and one aft-swept, in order to learn more about the shocks which propagate upstream of these rotors when they are operated at transonic tip speeds. Flow visualization data are presented for the forward-swept fan operating at 13831 rpm(sub c), and for the aft-swept fan operating at 12500 and 13831 rpm(sub c) (corresponding to tip rotational Mach numbers of 1.07 and 1.19, respectively). The flow visualization data identify where the shocks occur on the suction side of the rotor blades. These data show that at the takeoff speed, 13831 rpm(sub c), the shocks occurring in the tip region of the forward-swept fan are further downstream in the blade passage than with the aft-swept fan. Shroud unsteady pressure measurements were acquired using a linear array of 15 equally-spaced pressure transducers extending from two tip axial chords upstream to 0.8 tip axial chords downstream of the static position of the tip leading edge of each rotor. Such data are presented for each fan operating at one subsonic and five transonic tip speeds. The unsteady pressure data show relatively strong detached shocks propagating upstream of the aft-swept rotor at the three lowest transonic tip speeds, and weak, oblique pressure disturbances attached to the tip of the aft-swept fan at the two highest transonic tip speeds. The unsteady pressure measurements made with the forward-swept fan do not show strong shocks propagating upstream of that rotor at any of the tested speeds. A comparison of the forward-swept and aft-swept shroud unsteady pressure measurements indicates that at any given transonic speed the pressure disturbance just upstream of the tip of the forward-swept fan is much weaker than that of the aft-swept fan. The LDV data suggest that at 12500 and 13831 rpm(sub c), the forward-swept fan swallowed the passage shocks occurring in the tip region of the blades, whereas the aft-swept fan did not. Due to this difference, the flows just upstream of the two fans were found to be quite different at both of these transonic speeds. Nevertheless, despite distinct differences just upstream of the two rotors, the two fan flows were much more alike about one axial blade chord further upstream. As a result, the LDV data suggest that it is unwise to attempt to determine the effect that the shocks have on far field noise by focusing only on measurements (or CFD predictions) made very near the rotor. Instead, these data suggest that it is important to track the shocks throughout the inlet.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Temporal variation and regional transfer of heavy metals in the Pearl (Zhujiang) River, China.

PubMed

Zhen, Gengchong; Li, Ying; Tong, Yindong; Yang, Lei; Zhu, Yan; Zhang, Wei

2016-05-01

Heavy metals are highly persistent in water and have a particular significance in ecotoxicology. Heavy metals loading from the Pearl River are likely to cause significant impacts on the environment in the South China Sea and the West Pacific. In this study, using monthly monitoring data from a water quality monitoring campaign during 2006-2012, the temporal variation and spatial transfer of six heavy metals (lead (Pb), copper (Cu), cadmium (Cd), zinc (Zn), arsenic (As), and mercury (Hg)) in the Pearl River were analyzed, and the heavy metal fluxes into the sea were calculated. During this period, the annual heavy metal loads discharged from the Pearl River into the South China Sea were 5.8 (Hg), 471.7 (Pb), 1524.6 (Cu), 3819.6 (Zn), 43.9 (Cd), and 621.9 (As) tons, respectively. The metal fluxes showed a seasonal variation with the maximum fluxes occurring from June to July. There is a close association between metal fluxes and runoff. The analysis of the heavy metal transfer from the upstream to the downstream revealed that the transfer from the upstream accounted for a major portion of the heavy metals in the Pearl River Delta. Therefore, earlier industry relocation efforts in the Pearl River watershed may have limited effect on the water quality improvement in surrounding areas. It is suggested that watershed-based pollution control measures focusing on wastewater discharge in both upstream and downstream areas should be developed and implemented in the future.

Identification of a genetic variant associated with abdominal aortic aneurysms on chromosome 3p12.3 by genome wide association.

PubMed

Elmore, James R; Obmann, Melissa A; Kuivaniemi, Helena; Tromp, Gerard; Gerhard, Glenn S; Franklin, David P; Boddy, Amy M; Carey, David J

2009-06-01

The goal of this project was to identify genetic variants associated with abdominal aortic aneurysms (AAAs). A genome wide association study was carried out using pooled DNA samples from 123 AAA cases and 112 controls matched for age, gender, and smoking history using Affymetrix 500K single nucleotide polymorphism (SNP) arrays (Affymetrix, Inc, Santa Clara, Calif). The difference in mean allele frequency between cases and controls was calculated for each SNP and used to identify candidate genomic regions. Association of candidate SNPs with AAA was confirmed by individual TaqMan genotype assays in a total of 2096 cases and controls that included an independent replication sample set. A genome wide association study of AAA cases and controls identified a candidate AAA-associated haplotype on chromosome 3p12.3. By individual genotype analysis, four SNPs in this region were significantly associated with AAA in cases and controls from the original study population. One SNP in this region (rs7635818) was genotyped in a total of 502 cases and 736 controls from the original study population (P = .017) and 448 cases and 410 controls from an independent replication sample (P = .013; combined P value = .0028; combined odds ratio [OR] = 1.33). An even stronger association with AAA was observed in a subset of smokers (391 cases, 241 controls, P = .00041, OR = 1.80), which represent the highest risk group for AAA. The AAA-associated haplotype is located approximately 200 kbp upstream of the CNTN3 gene transcription start site. This study identifies a region on chromosome 3 that is significantly associated with AAA in 2 distinct study populations.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Bed Surface Adjustments to Spatially Variable Flow in Low Relative Submergence Regimes

NASA Astrophysics Data System (ADS)

Monsalve, A.; Yager, E. M.

2017-11-01

In mountainous rivers, large relatively immobile grains partly control the local and reach-averaged flow hydraulics and sediment fluxes. When the flow depth is similar to the size of these grains (low relative submergence), heterogeneous flow structures and plunging flow cause spatial distributions of bed surface elevations, textures, and sedimentation rates. To explore how the bed surface responds to these flow variations we conducted a set of experiments in which we varied the relative submergence of staggered hemispheres (simulated large boulders) between runs. All experiments had the same average sediment transport capacity, upstream sediment supply, and initial bed thickness and grain size distribution. We combined our laboratory measurements with a 3-D flow model to obtain the detailed flow structure around the hemispheres. The local bed shear stress field displayed substantial variability and controlled the bed load transport rates and direction in which sediment moved. The divergence in bed shear stress caused by the hemispheres promoted size-selective bed load deposition, which formed patches of coarse sediment upstream of the hemisphere. Sediment deposition caused a decrease in local bed shear stress, which combined with the coarser grain size, enhanced the stability of this patch. The region downstream of the hemispheres was largely controlled by a recirculation zone and had little to no change in grain size, bed elevation, and bed shear stress. The formation, development, and stability of sediment patches in mountain streams is controlled by the bed shear stress divergence and magnitude and direction of the local bed shear stress field.

On using TRMM data and rainfall forecasts from meteorological models in data-scarce transboundary catchments - an example of Bangladesh

NASA Astrophysics Data System (ADS)

Bhattacharya, Biswa; Tohidul Islam, Md.

2014-05-01

This research focuses on the flood risk of the Haor region in the north-eastern part of Bangladesh. The prediction of the hydrological variables at different spatial and temporal scales in the Haor region is dependent on the influence of several upstream rivers in the Meghalaya catchment in India. Limitation in hydro-meteorological data collection and data sharing issues between the two countries dominate the feasibility of hydrological studies, particularly for near-realtime predictions. One of the possible solutions seems to be in making use of the variety of satellite based and meteorological model products for rainfall. The abundance of a variety of rainfall products provides a good basis of hydrological modelling of a part of the Ganges and Brahmaputra basin. In this research the TRMM data and rainfall forecasts from ECMWF have been compared with the scarce rain gauge data from the upstream Meghalaya catchment. Subsequently, the TRMM data and rainfall forecasts from ECMWF have been used as the meteorological input to a rainfall-runoff model of the Meghalaya catchment. The rainfall-runoff model of Meghalaya has been developed using the DEM data from SRTM. The generated runoff at the outlet of Meghalaya has been used as the upstream boundary condition in the existing rainfall-runoff model of the Haor region. The simulation results have been compared with the existing results based on simulations without any information of the rainfall-runoff in the upstream Meghalaya catchment. The comparison showed that the forecasting lead time has been substantially increased. As per the existing results the forecasting lead time at a number of locations in the catchment was about 6 to 8 hours. With the new results the forecasting lead time has gone up, with different levels of accuracy, to about 24 hours. This additional lead time will be highly beneficial in managing flood risk of the Haor region of Bangladesh. The research shows that satellite based rainfall products and rainfall forecasts from meteorological models can be very useful in flood risk management, particularly for data scarce regions and/or transboundary regions with data sharing issues. Keywords: flood risk management, TRMM, ECMWF, flood forecasting, Haor, Bangladesh. Abbreviations: TRMM: Tropical Rainfall Measuring Mission ECMWF: European Centre for Medium-Range Weather Forecasts DEM: Digital Elevation Model SRTM: Shuttle Radar Topography Mission

Experimental study to control the upstream migration of invasive alien fish species by submerged weir

NASA Astrophysics Data System (ADS)

Sakuma, Masami; Kunimatsu, Fumihiro; Tsuchiya, Taku; Kawamura, Makiko; Fujita, Hiroshi

Largemouth bass and Bluegill, major invasive alien fish species in Japan, have been extending their habitat ranges over not only Lake Biwa and the lagoons but also surrounding waters connected to them through small rivers and canals. Their increasing number is bringing about the reduction in the number of native fish species. To prevent the spread of these alien species through small rivers and canals during breeding season of the native fish (crucian carp), this study experimentally examined the effect of a submerged weir on controlling upstream migration of the alien species and the native fish. As a result of the experiment, the ratio of the alien species migrating upstream decreased as the weir height rose, whereas the ratio did not show the same trend in the case of the native fish. The ratio of the alien species also decreased as the overflow velocity over the weir rose. On the other hand, the ratio of the native fish increased as the overflow velocity rose up to 1.0m/s and decreased thereafter. These results suggest that the submerged weir may control upstream migration of the alien species to surrounding waters through small rivers and canals without interfering with the reproductive migration of the native fish.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

The control of the upstream movement of fish with pulsated direct current

USGS Publications Warehouse

McLain, Alberton L.

1957-01-01

In the Silver River, 78,648 fish comprising 21 species were taken from the trap of the direct-current diversion device. The total kill of fish moving upstream, including 289 sea lampreys, was 1,016, or 1.3 percent. This river had presented a serious problem in the operation of an alternating-current control device during previous seasons. In 1955, 85.5 percent of three important species of fish were killed at the control structure. During 1956, this mortality was reduced to 8.1 percent by the operation of the direct-current equipment.

Abundance and Source Population of Suprathermal Heavy Ions in Corotating Interaction Regions

NASA Astrophysics Data System (ADS)

Jensema, R. J.; Desai, M. I.; Broiles, T. W.; Dayeh, M. A.

2015-12-01

In this study we analyze the abundances of suprathermal heavy ions in 75 Corotating Interaction Region (CIR) events between January 1st 1995 and December 31st 2008. We correlate the heavy ion abundances in these CIRs with those measured in the solar wind and suprathermal populations upstream of these events. Our analysis reveals that the CIR suprathermal heavy ion abundances vary by nearly two orders of magnitude over the solar activity cycle, with higher abundances (e.g., Fe/O) occurring during solar maximum and depleted values occurring during solar minimum. The abundances are also energy dependent, with larger abundances at higher energies, particularly during solar maximum. Following the method used by Mason et al. 2008, we correlate the CIR abundances with the corresponding solar wind and suprathermal values measured during 6-hour intervals for upstream periods spanning 10 days prior to the start of each CIR event. This correlation reveals that suprathermal heavy ions are better correlated with upstream suprathermal abundances measured at the same energy compared with the solar wind heavy ion abundances. Using the 6-hour averaging method, we also identified timeframes of maximum correlation between the CIR and the upstream suprathermal abundances, and find that the time of maximum correlation depends on the energy of the suprathermal ions. We discuss the implications of these results in terms of previous studies of CIR and suprathermal particles, and CIR seed populations and acceleration mechanisms.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Multi-scalar interactions between infrastructure, smallholder water management, and coastal dynamics in the Bengal Delta, Bangladesh

NASA Astrophysics Data System (ADS)

Rogers, K. G.; Brondizio, E.; Roy, K.; Syvitski, J. P.

2016-12-01

Because of their low-lying elevations and large number of inhabitants and infrastructure, river deltas are ground zero for climate change impacts, particularly from sea-level rise and storm surges. The increased vulnerability of downstream delta communities to coastal flooding as a result of upstream engineering has been acknowledged for decades. What has received less attention is the sensitivity of deltas to the interactions of these processes and increasing intensity of cultivation and irrigation in their coastal regions. Beyond basin-scale damming, regional infrastructure affects the movement of sediment and water on deltas, and combined with upstream modifications may exacerbate the risk of expanded tidal flooding, erosion of arable land, and salinization of soils and groundwater associated with sea level rise. To examine the social-biophysical feedbacks associated with regional-scale infrastructure, smallholder water management practices and coastal dynamics, a nested framework was applied to two districts of the coastal southwest region of Bangladesh. The two districts vary in tidal range, salinity, freshwater availability and socioeconomic structures, and are spatially varied in farmer's adaptations. Both districts contain numerous large embankment systems initially designed to protect cropland from tidal flooding, but that have been poorly maintained since their construction in the 1960's. The framework was co-produced using local-level stakeholder input collected during group interviews with rural farmers in 8 villages within the two districts, and explicitly accounts for engineered and natural biophysical variables as well as governance and institutional structures at 3 levels of analysis. Household survey results indicate that the presence or absence of embankments as a result of poor management and dynamic coastal processes is the primary control on freshwater availability and thus influences farming strategies, socioeconomic conditions and social positions in both districts. Local-scale interactions with the embankments are spatially heterogeneous, but geospatial analyses show the potential for these to collectively impact physical and social stability across a region already vulnerable to coastal flooding.

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Road crossing designs and their impact on fish assemblages of Great Plains streams

USGS Publications Warehouse

Bouska, Wesley W.; Paukert, Craig P.

2010-01-01

A mark-recapture field study was conducted to determine fish passage at 5 concrete box culverts and 5 low-water crossings (concrete slabs vented by culverts) as well as 10 control sites (below a natural riffle) in Flint Hills streams of northeastern Kansas. Additionally, we tested the upstream passage of four fish species native to Great Plains streams (Topeka shiner Notropis topeka, green sunfish Lepomis cyanellus, red shiner Cyprinella lutrensis, and southern redbelly dace Phoxinus erythrogaster) through three simulated crossing designs (box culverts, round corrugated culverts, and natural rock riffles) at water velocities of 0.1 to 1.1 m/s in an experimental stream. The field study indicated that cyprinids were twice as likely to move upstream of box culverts than low-water crossings and 1.4 times as likely to move upstream of control reaches than any crossing type. The best models indicated that the proportion of cyprinids that moved upstream increased with decreased culvert slope and length, perching, and increased culvert width. Our controlled experiment indicated that fish can move through velocities up to 1.1 m/s in a 1.86-m simulated stream and that the proportion of fish that moved upstream did not differ among crossing designs for southern redbelly dace, green sunfish, or Topeka shiner; however, natural rock riffles had lower proportional movements (mean = 0.19) than the box (0.38) or corrugated culvert designs (0.43) for red shiners. Water velocity did not affect the proportional upstream movement of any species except that of Topeka shiners, which increased with water velocity. Crossing design alone may not determine fish passage, and water velocities up to 1.1 m/s may not affect the passage of many Great Plains fishes. Barriers to fish movement may be the result of other factors (e.g., perching, slope, and crossing length). The use of properly designed and installed crossings has promise in conserving Great Plains stream fishes.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

PubMed

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

On judgement of electron transfer between two regions divided by the separatrix of confronting divergent magnetic fields applied to an inductively coupled plasma

NASA Astrophysics Data System (ADS)

Sugawara, Hirotake; Yamamoto, Tappei

2016-09-01

In order to quantitatively evaluate the electron confinement effect of the confronting divergent magnetic fields (CDMFs) applied to an inductively coupled plasma, we analyzed the electron transfer between two regions divided by the separatrix of the CDMFs in Ar at 0.67 Pa at 300 K using a Monte Carlo method. A conventional transfer judgement was simply based on the electron passage across the separatrix from the upstream source region to the downstream diffusion region. An issue was an overestimation of the transfer due to temporary stay of electrons in the downstream region. Electrons may pass the downstream region during their gyration even in case they are effectively bound to the upstream region, where their guiding magnetic flux lines run. More than half of the transfers were temporary ones and such seeming transfers were relevantly excluded from the statistics by introducing a newly chosen criterion based on the passage of electron gyrocenters across the separatrix and collisional events in the downstream region. Simulation results showed a tendency that the ratio of the temporary transfers excluded was higher under stronger magnetic fields because of higher cyclotron frequency. Work supported by JSPS Kakenhi Grant Number 16K05626.

Suggestions on water sources protection for the Gan River of Jiangxi, People's Republic of China

NASA Astrophysics Data System (ADS)

Fu, C.; Jiang, Z.

2007-05-01

The Gan River is the largest river in Jiangxi Province, which is located in the southeast of China and is the second branch of the Yangtze River. The Gan River flows through Jiangxi Province from the South to the North and plays an important role in the economic development for 14 counties or cities with a population of 22 million. Currently, there are 5 drinking water sources, such as the capital city, Nanchang, with a daily capacity of 0.72 million cubic meters. With the rapid economic development and increasing population in the Gan River basin, water pollution has become more serious. The water quality of the river has serious pollution on both side reaches and slight pollution on the middle reach. In the upstream, the main pollution problems come from the industrial wastewater and soil erosion, with industrial and sewage wastewater affecitng the downstream region. Based on the Provincial Environmental Quality Report of 2005, of 39 monitoring sections, the ones which reach a favorable rating of a National Standard are 71.8 per cent. The water quality in the upstream region had a good situation with 80 percent of locations meeting standards, but the water quality downstream of the capital city deteriorates and only 45.4 percent of this region can meet the standard. Standards are frequently exceeded for BOD5, TP, TN, fecal coliform, and petrolueum oil in the downstream portion. The industrial wastewater drained into the river was 139 million tons in 2005, of which Nanchang city is the largest contributor with 214 million tons of wastewater composed of 75 million tons of industrial wastewater and 139 million tons of domestic sewage. The largest COD contributor was from Ganzhou in the upstream of the river with a total of 83,800 tons in 2005. Currently, there are only two wastewater treatment facilities with daily treatment capacity of 402,000 tons along the river, which are located in the capital city. Some parameters in the treated water stil exceed the drainage standard. Based on the characteristic of soil erosion in the mountain areas in the upstream portion of the Gan River, Jiangxi Province has carried out a strategy of comprehensive treatment of small river basins since 1983. A total of 374 small basins in Ganzhou city have been treated and 0.5 million hectare of soil erosion area have been treated which is 78.2 percent of the whole soil erosion in this region. Some suggestions on protection of water sources have been proposed as: to continue the comprehensive treatment of soil erosion, to enhance the treatment capacity of domestic sewage, to optimize the treatment technology and control sewage in the cities along the river, to formulate a plan for the basin water resources utilization, and to enhance the performance capacity of environmental protection laws and regulations.

Use of a Fish Transportation Barge for Increasing Returns of Steelhead Imprinted for Homing, Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harmon, Jerrel R.

1989-08-01

The objective of this 7-year National Fisheries Service study, which began is 1982, was to determine if transporting juvenile steelhead (Oncorhynchus mykiss) by truck and barge from Dworshak National Fish Hatchery (NFH), on the Clearwater River, to a release site on the Columbia River below Bonneville Dam would result in increased returns of adults to the various fisheries and to the hatchery homing site. During 1982 and 1983, over 500,000 marked juvenile steelhead were serially released as controls from the hatchery or barged as test fish to below Bonneville Dam. Recoveries of marked adults to various recovery sites are complete.more » Fish released in 1983 showed a stronger homing ability and more rapid upstream migration than test fish released in 1982. Most adults from both control and test releases in 1983 and control releases in 1982 migrated a considerable distance upstream and overwintered in the Snake and Clearwater Rivers--behavior similar to Clearwater River fish previously transported from Lower Granite Dam. In contrast, many of the adults from test releases in 1982 failed to migrate upstream during the fall, overwintered in the Columbia River, and migrated upstream the following spring. Survival of control fish released at Dworshak NFH in late April 1982 was substantially higher than survival of those released in mid-May. Survival and homing of control fish released in late April and early May 1983 were over 10 times that for fish released in late May. Return of adults from normal hatchery releases in 1982 was the highest ever observed at Dworshak NFH.« less

Distributed flow estimation and closed-loop control of an underwater vehicle with a multi-modal artificial lateral line.

PubMed

DeVries, Levi; Lagor, Francis D; Lei, Hong; Tan, Xiaobo; Paley, Derek A

2015-03-25

Bio-inspired sensing modalities enhance the ability of autonomous vehicles to characterize and respond to their environment. This paper concerns the lateral line of cartilaginous and bony fish, which is sensitive to fluid motion and allows fish to sense oncoming flow and the presence of walls or obstacles. The lateral line consists of two types of sensing modalities: canal neuromasts measure approximate pressure gradients, whereas superficial neuromasts measure local flow velocities. By employing an artificial lateral line, the performance of underwater sensing and navigation strategies is improved in dark, cluttered, or murky environments where traditional sensing modalities may be hindered. This paper presents estimation and control strategies enabling an airfoil-shaped unmanned underwater vehicle to assimilate measurements from a bio-inspired, multi-modal artificial lateral line and estimate flow properties for feedback control. We utilize potential flow theory to model the fluid flow past a foil in a uniform flow and in the presence of an upstream obstacle. We derive theoretically justified nonlinear estimation strategies to estimate the free stream flowspeed, angle of attack, and the relative position of an upstream obstacle. The feedback control strategy uses the estimated flow properties to execute bio-inspired behaviors including rheotaxis (the tendency of fish to orient upstream) and station-holding (the tendency of fish to position behind an upstream obstacle). A robotic prototype outfitted with a multi-modal artificial lateral line composed of ionic polymer metal composite and embedded pressure sensors experimentally demonstrates the distributed flow sensing and closed-loop control strategies.

Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India

NASA Astrophysics Data System (ADS)

Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti

2017-09-01

Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.

Coronal mass ejection hits mercury: A.I.K.E.F. hybrid-code results compared to MESSENGER data

NASA Astrophysics Data System (ADS)

Exner, W.; Heyner, D.; Liuzzo, L.; Motschmann, U.; Shiota, D.; Kusano, K.; Shibayama, T.

2018-04-01

Mercury is the closest orbiting planet around the sun and is therefore embedded in an intensive and highly varying solar wind. In-situ data from the MESSENGER spacecraft of the plasma environment near Mercury indicates that a coronal mass ejection (CME) passed the planet on 23 November 2011 over the span of the 12 h MESSENGER orbit. Slavin et al. (2014) derived the upstream parameters of the solar wind at the time of that orbit, and were able to explain the observed MESSENGER data in the cusp and magnetopause segments of MESSENGER's trajectory. These upstream parameters will be used for our first simulation run. We use the hybrid code A.I.K.E.F. which treats ions as individual particles and electrons as a mass-less fluid, to conduct hybrid simulations of Mercury's magnetospheric response to the impact of the CME on ion gyro time scales. Results from the simulation are in agreement with magnetic field measurements from the inner day-side magnetosphere and the bow-shock region. However, at the planet's nightside, Mercury's plasma environment seemed to be governed by different solar wind conditions, in conclusion, Mercury's interaction with the CME is not sufficiently describable by only one set of upstream parameters. Therefore, to simulate the magnetospheric response while MESSENGER was located in the tail region, we use parameters obtained from the MHD solar wind simulation code SUSANOO (Shiota et al. (2014)) for our second simulation run. The parameters of the SUSANOO model achieve a good agreement of the data concerning the plasma tail crossing and the night-side approach to Mercury. However, the polar and closest approach are hardly described by both upstream parameters, namely, neither upstream dataset is able to reproduce the MESSENGER crossing of Mercury's magnetospheric cusp. We conclude that the respective CME was too variable on the timescale of the MESSENGER orbit to be described by only two sets of upstream conditions. Our results suggest locally strong and highly variable dynamics of the CME on timescales of 15 min while MESSENGER was near closest approach.

Ion distributions in the Earth's foreshock upstream from the bow shock

NASA Technical Reports Server (NTRS)

Fuselier, S. A.

1995-01-01

A variety of suprathermal and energetic ion distributions are found upstream from shocks. Some distributions, such as field-aligned beams, are generated directly at the shock either through reflection processes or through leakage from the hotter downstream region. Other distributions, such as intermediate distributions, evolve from these parent distributions through wave-particle interactions. This paper reviews our current understanding of the creation and evolution of suprathermal distributions at shocks. Examples of suprathermal ion distributions are taken from observations at the Earth's bow shock. Particular emphasis is placed on the creation of field-aligned beams and specularly reflected ion distributions and on the evolution of these distributions in the Earth's ion foreshock. However, the results from this heavily studied region are applicable to interplanetary shocks, bow shocks at other planets, and comets.

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

The evolution of the Danube gateway between Central and Eastern Paratethys (SE Europe): Insight from numerical modelling of the causes and effects of connectivity between basins and its expression in the sedimentary record

NASA Astrophysics Data System (ADS)

Leever, K. A.; Matenco, L.; Garcia-Castellanos, D.; Cloetingh, S. A. P. L.

2011-04-01

The Pannonian and Dacic Basins in SE Europe are presently connected by the Danube River across the South Carpathians, to which they are in a back-arc and foreland position respectively. Part of the Paratethys realm during the Neogene, open water communication between the basins was interrupted by the Late Miocene uplift of the Carpathians. Different mechanisms have been proposed for the formation of the Danube gateway: capture of the upstream lake or an upstream river or incision of an antecedent river. Estimates on its age range from Late Miocene to Quaternary. A related issue is the effect of the large Mediterranean sea level fall related to the Messinian Salinity Crisis on the Paratethys subbasins, specifically the "isolated" Pannonian Basin. In a synthetic numerical modelling study, using a pseudo-3D code integrating tectonics, surface processes and isostasy, we addressed the causes and effects of changes in connectivity between two large sedimentary basins separated by an elevated barrier. Specifically, we aimed to find the expression of connectivity events in the sedimentary record in general and the consequences for the evolution of the Pannonian-Dacic area in particular. We studied a range of parameters including the geometry and uplift rate of the barrier, downstream sea level change and lithosphere rigidity. We found that changes in connectivity are expressed in the sedimentary record through their effect on base level in the upstream basin and supply in the downstream basin. The most important factors controlling the response are the elevation difference between the basins and the upstream accommodation space at the time of reconnection. The most pronounced effect of reconnection through lake capture is predicted for a large elevation difference and limited upstream accommodation space. Downstream increase in sediment supply is dependent on the latter rather than the reconnection event itself. Of the parameters we tested, the rigidity of the lithosphere was found to be of major importance by its control on sediment loaded subsidence and generation of accommodation space. A downstream sea level change is unlikely to induce capture, but may affect the upstream lake level by enhancing incision in a pre-existing gateway. In the Pannonian-Dacic region, the mechanically weak, continuously subsiding Pannonian lithosphere allowed accommodation of significant volumes of continental sedimentation and as a consequence, transfer of excess sediment to the downstream Dacic Basin was only gradual. The Messinian sea level fall in the Dacic Basin could have been recorded in the Pannonian Basin only if a connection between the basins already existed. More detailed modelling of river incision taking into account lateral differences in erodibility in the South Carpathians will be required to give better time constraints on the formation of the Danube Gateway.

Flowfield dynamics in blunt fin-induced shock wave/turbulent boundary layer interactions

NASA Technical Reports Server (NTRS)

Dolling, David S.; Brusniak, Leon

1994-01-01

Fluctuating wall pressure measurements have been made on centerline upstream of a blunt fin in a Mach 5 turbulent boundary layer. By examining the ensemble averaged wall pressure distributions for different separation shock foot positions, it has been shown that local fluctuating wall pressure measurements are due to a distinct pressure distribution, Rho(sub i), which undergoes a stretching and flattening effect as its upstream boundary translates aperiodically between the upstream influence and separation lines. The locations of the maxima and minima in the wall pressure standard deviation can be accurately predicted using this distribution, providing quantitative confirmation of the model. This model also explains the observed cross-correlations and ensemble average measurements within the interaction. Using the Rho(sub i) model, wall pressure signals from under the separated flow region were used to reproduce the position-time history of the separation shock foot. Further, the negative time delay peak in the cross-correlation between the predicted and actual shock foot histories suggests that the separated region fluctuations precede shock foot motion. The unsteady behavior of the primary horseshoe vortex and its relation to the unsteady separation shock are described.

A barrier to upstream migration in the fish passage of Itaipu Dam (Canal da Piracema), Paraná River basin

USGS Publications Warehouse

,; Fontes Júnior, Hélio Martins; Makrakis, Sergio; Gomes, Luiz Carlos; Latini, João Dirço

2012-01-01

The majority of the fish passages built in the Neotropical region are characterised by low efficiency and high selectivity; in many cases, the benefits to fish populations are uncertain. Studies conducted in the Canal da Piracema at Itaipu dam on the Parana River indicate that the system component designated as the Discharge channel in the Bela Vista River (herein named Canal de deságue no rio Bela Vista or CABV), a 200 m long technical section, was the main barrier to the upstream migration. The aim of this study was to evaluate the degree of restriction imposed by the CABV on upstream movements of Prochilodus lineatus and Leporinus elongatus, Characiformes. Fish were tagged with passive integrated transponders (PIT tags) and released both downstream and upstream of this critical section. Individuals of both species released downstream of the CABV took much more time to reach the upper end of the system (43.6 days vs. 15.9 days), and passed in much lower proportions (18% vs. 60.8%) than those tagged upstream of this component. Although more work is needed to differentiate between fishway effects and natural variation in migratory motivation, the results clearly demonstrate passage problems at the CABV.

Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.

PubMed

Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li

2017-05-20

TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.

Remote radio observations of solar wind parameters upstream of planetary bow shocks

NASA Technical Reports Server (NTRS)

Macdowall, R. J.; Stone, R. G.; Gaffey, J. D., Jr.

1992-01-01

Radio emission is frequently produced at twice the electron plasma frequency 2fp in the foreshock region upstream of the terrestrial bow shock. Observations of this emission provide a remote diagnostic of solar wind parameters in the foreshock. Using ISEE-3 radio data, we present the first evidence that the radio intensity is proportional to the kinetic energy flux and to other parameters correlated with solar wind density. We provide a qualitative explanation of this intensity behavior and predict the detection of similar emission at Jupiter by the Ulysses spacecraft.

Plasma Waves Associated with Energetic Particles Streaming into the Solar Wind from the Earth’s Bow Shock.

DTIC Science & Technology

1980-12-08

when the magnetic field changed in such a way that the ISEE spacecraft were brought into the ion foreshock region. The lower panels of Figures 1 and 2...electrons in the absence of ions usually occurs when the spacecraft is downstream from the electron foreshock boundary but upstream of the ion... foreshock boundary. Two well-defined upstream ion events occur in the following hour as shown in Figure 5. The top panel shows that a moderately intense ion

Velocity-Field Measurements of an Axisymmetric Separated Flow Subjected to Amplitude-Modulated Excitation

NASA Technical Reports Server (NTRS)

Trosin, Barry James

2007-01-01

Active flow control was applied at the point of separation of an axisymmetric, backward-facing-step flow. The control was implemented by employing a Helmholtz resonator that was externally driven by an amplitude-modulated, acoustic disturbance from a speaker located upstream of the wind tunnel. The velocity field of the separating/reattaching flow region downstream of the step was characterized using hotwire velocity measurements with and without flow control. Conventional statistics of the data reveal that the separating/reattaching flow is affected by the imposed forcing. Triple decomposition along with conditional averaging was used to distinguish periodic disturbances from random turbulence in the fluctuating velocity component. A significant outcome of the present study is that it demonstrates that amplitude-modulated forcing of the separated flow alters the flow in the same manner as the more conventional method of periodic excitation.

Pluto-Charon solar wind interaction dynamics

NASA Astrophysics Data System (ADS)

Hale, J. P. M.; Paty, C. S.

2017-05-01

This work studies Charon's effects on the Pluto-solar wind interaction using a multifluid MHD model which simulates the interactions of Pluto and Charon with the solar wind as well as with each other. Specifically, it investigates the ionospheric dynamics of a two body system in which either one or both bodies possess an ionosphere. Configurations in which Charon is directly upstream and directly downstream of Pluto are considered. Depending on ionospheric and solar wind conditions, Charon could periodically pass into the solar wind flow upstream of Pluto. The results of this study demonstrate that in these circumstances Charon modifies the upstream flow, both in the case in which Charon possesses an ionosphere, and in the case in which Charon is without an ionosphere. This modification amounts to a change in the gross structure of the interaction region when Charon possesses an ionosphere but is more localized when Charon lacks an ionosphere. Furthermore, evidence is shown that supports Charon acting to partially shield Pluto from the solar wind when it is upstream of Pluto, resulting in a decrease in ionospheric loss by Pluto.

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

Test of a non-physical barrier consisting of light, sound, and bubble screen to block upstream movement of sea lamprey in an experimental raceway

USGS Publications Warehouse

Miehls, Scott M.; Johnson, Nicholas S.; Hrodey, Pete J.

2017-01-01

Control of the invasive Sea Lamprey Petromyzon marinus is critical for management of commercial and recreational fisheries in the Laurentian Great Lakes. Use of physical barriers to block Sea Lampreys from spawning habitat is a major component of the control program. However, the resulting interruption of natural streamflow and blockage of nontarget species present substantial challenges. Development of an effective nonphysical barrier would aid the control of Sea Lampreys by eliminating their access to spawning locations while maintaining natural streamflow. We tested the effect of a nonphysical barrier consisting of strobe lights, low-frequency sound, and a bubble screen on the movement of Sea Lampreys in an experimental raceway designed as a two-choice maze with a single main channel fed by two identical inflow channels (one control and one blocked). Sea Lampreys were more likely to move upstream during trials when the strobe light and low-frequency sound were active compared with control trials and trials using the bubble screen alone. For those Sea Lampreys that did move upstream to the confluence of inflow channels, no combination of stimuli or any individual stimulus significantly influenced the likelihood that Sea Lampreys would enter the blocked inflow channel, enter the control channel, or return downstream.

Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells

PubMed Central

Attema, Joanne L.; Bert, Andrew G.; Lim, Yat-Yuen; Kolesnikoff, Natasha; Lawrence, David M.; Pillman, Katherine A.; Smith, Eric; Drew, Paul A.; Khew-Goodall, Yeesim; Shannon, Frances; Goodall, Gregory J.

2013-01-01

The miR-200b~200a~429 gene cluster is a key regulator of EMT and cancer metastasis, however the transcription-based mechanisms controlling its expression during this process are not well understood. We have analyzed the miR-200b~200a~429 locus for epigenetic modifications in breast epithelial and mesenchymal cell lines using chromatin immunoprecipitation assays and DNA methylation analysis. We discovered a novel enhancer located approximately 5.1kb upstream of the miR-200b~200a~429 transcriptional start site. This region was associated with the active enhancer chromatin signature comprising H3K4me1, H3K27ac, RNA polymerase II and CpG dinucleotide hypomethylation. Luciferase reporter assays revealed the upstream enhancer stimulated the transcription of the miR-200b~200a~429 minimal promoter region approximately 27-fold in breast epithelial cells. Furthermore, we found that a region of the enhancer was transcribed, producing a short, GC-rich, mainly nuclear, non-polyadenylated RNA transcript designated miR-200b eRNA. Over-expression of miR-200b eRNA had little effect on miR-200b~200a~429 promoter activity and its production did not correlate with miR-200b~200a~429 gene expression. While additional investigations of miR-200b eRNA function will be necessary, it is possible that miR-200b eRNA may be involved in the regulation of miR-200b~200a~429 gene expression and silencing. Taken together, these findings reveal the presence of a novel enhancer, which contributes to miR-200b~200a~429 transcriptional regulation in epithelial cells. PMID:24086551

Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

PubMed

Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

2017-06-29

Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

Fungicide-induced transposon movement in Monilinia fructicola.

PubMed

Chen, Fengping; Everhart, Sydney E; Bryson, P Karen; Luo, Chaoxi; Song, Xi; Liu, Xili; Schnabel, Guido

2015-12-01

Repeated applications of fungicides with a single mode of action are believed to select for pre-existing resistant strains in a pathogen population, while the impact of sub-lethal doses of such fungicides on sensitive members of the population is unknown. In this study, in vitro evidence is presented that continuous exposure of Monilinia fructicola mycelium to some fungicides can induce genetic change in form of transposon transposition. Three fungicide-sensitive M. fructicola isolates were exposed in 12 weekly transfers of mycelia to a dose gradient of demethylation inhibitor fungicide (DMI) SYP-Z048 and quinone outside inhibitor fungicide (QoI) azoxystrobin in solo or mixture treatments. Evidence of mutagenesis was assessed by monitoring Mftc1, a multicopy transposable element of M. fructicola, by PCR and Southern blot analysis. Movement of Mftc1 was observed following azoxystrobin and azoxystrobin plus SYP-Z048 treatments in two of the three isolates, but not in the non-fungicide-treated controls. Interestingly, the upstream promoter region of MfCYP51 was a prime target for Mftc1 transposition in these isolates. Transposition of Mftc1 was verified by Southern blot in two of three isolates from another, similar experiment following prolonged, sublethal azoxystrobin exposure, although in these isolates movement of Mftc1 in the upstream MfCYP51 promoter region was not observed. More research is warranted to determine whether fungicide-induced mutagenesis may also happen under field conditions. Copyright © 2015 Elsevier Inc. All rights reserved.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Impact of Shock Front Rippling and Self-reformation on the Electron Dynamics at Low-Mach-number Shocks

NASA Astrophysics Data System (ADS)

Yang, Zhongwei; Lu, Quanming; Liu, Ying D.; Wang, Rui

2018-04-01

Electron dynamics at low-Mach-number collisionless shocks are investigated by using two-dimensional electromagnetic particle-in-cell simulations with various shock normal angles. We found: (1) The reflected ions and incident electrons at the shock front provide an effective mechanism for the quasi-electrostatic wave generation due to the charge-separation. A fraction of incident electrons can be effectively trapped and accelerated at the leading edge of the shock foot. (2) At quasi-perpendicular shocks, the electron trapping and reflection is nonuniform due to the shock rippling along the shock surface and is more likely to take place at some locations accompanied by intense reflected ion-beams. The electron trapping process has a periodical evolution over time due to the shock front self-reformation, which is controlled by ion dynamics. Thus, this is a cross-scale coupling phenomenon. (3) At quasi-parallel shocks, reflected ions can travel far back upstream. Consequently, quasi-electrostatic waves can be excited in the shock transition and the foreshock region. The electron trajectory analysis shows these waves can trap electrons at the foot region and reflect a fraction of them far back upstream. Simulation runs in this paper indicate that the micro-turbulence at the shock foot can provide a possible scenario for producing the reflected electron beam, which is a basic condition for the type II radio burst emission at low-Mach-number interplanetary shocks driven by Coronal Mass Ejections (CMEs).

Consumption‐Based Conservation Targeting: Linking Biodiversity Loss to Upstream Demand through a Global Wildlife Footprint

PubMed Central

Berlow, Eric; Conlisk, Erin; Erb, Karlheinz; Iha, Katsunori; Martinez, Neo; Newman, Erica A.; Plutzar, Christoph; Smith, Adam B.; Harte, John

2016-01-01

Abstract Although most conservation efforts address the direct, local causes of biodiversity loss, effective long‐term conservation will require complementary efforts to reduce the upstream economic pressures, such as demands for food and forest products, which ultimately drive these downstream losses. Here, we present a wildlife footprint analysis that links global losses of wild birds to consumer purchases across 57 economic sectors in 129 regions. The United States, India, China, and Brazil have the largest regional wildlife footprints, while per‐person footprints are highest in Mongolia, Australia, Botswana, and the United Arab Emirates. A US$100 purchase of bovine meat or rice products occupies approximately 0.1 km2 of wild bird ranges, displacing 1–2 individual birds, for 1 year. Globally significant importer regions, including Japan, the United Kingdom, Germany, Italy, and France, have large footprints that drive wildlife losses elsewhere in the world and represent important targets for consumption‐focused conservation attention. PMID:29104616

Ion pickup, scattering, and stochastic acceleration in the cometary environment of P/Giacobini-Zinner

NASA Technical Reports Server (NTRS)

Barbosa, D. D.

1991-01-01

Observations and theory related to the scattering and acceleration of cometary pickup ions are reviewed with emphasis on Comet P/Giacobini-Zinner. A comparison of the regions upstream and downstream of the bow shock is made to assess the relative merits of each as a site for stochastic acceleration of ions above the pickup energy through interaction with low-frequency MHD waves. In the far upstream region the data are most consistent with a model where pickup ions generate a low level of MHD waves but remain relatively scatter-free. In the downstream region intense magnetic fluctuations gives rise to rapid isotropization of the ions and a second-order stochastic acceleration. The properties of the MHD power spectrum are related to the energetic ion spectrum in the framework of a leaky box model where the bulk of the acceleration occurs downstream of the shock throughout the cometosheath. Good agreement of the observations with theory is evident for both P/Giacobini-Zinner and P/Halley.

Characterizing the Severe Turbulence Environments Associated With Commercial Aviation Accidents. Part 1; 44 Case Study Synoptic Observational Analyses

NASA Technical Reports Server (NTRS)

Kaplan, Michael L.; Huffman, Allan W.; Lux, Kevin M.; Charney, Joseph J.; Riordan, Allan J.; Lin, Yuh-Lang; Proctor, Fred H. (Technical Monitor)

2002-01-01

A 44 case study analysis of the large-scale atmospheric structure associated with development of accident-producing aircraft turbulence is described. Categorization is a function of the accident location, altitude, time of year, time of day, and the turbulence category, which classifies disturbances. National Centers for Environmental Prediction Reanalyses data sets and satellite imagery are employed to diagnose synoptic scale predictor fields associated with the large-scale environment preceding severe turbulence. These analyses indicate a predominance of severe accident-producing turbulence within the entrance region of a jet stream at the synoptic scale. Typically, a flow curvature region is just upstream within the jet entrance region, convection is within 100 km of the accident, vertical motion is upward, absolute vorticity is low, vertical wind shear is increasing, and horizontal cold advection is substantial. The most consistent predictor is upstream flow curvature and nearby convection is the second most frequent predictor.

Localization of TFIIB binding regions using serial analysis of chromatin occupancy

PubMed Central

Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon

2007-01-01

Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859

On-line soft sensing in upstream bioprocessing.

PubMed

Randek, Judit; Mandenius, Carl-Fredrik

2018-02-01

This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

Control of unsteadiness of a shock wave/turbulent boundary layer interaction by using a pulsed-plasma-jet actuator

NASA Astrophysics Data System (ADS)

Narayanaswamy, Venkateswaran; Raja, Laxminarayan L.; Clemens, Noel T.

2012-07-01

A pulsed-plasma jet actuator is used to control the unsteady motion of the separation shock of a shock wave/boundary layer interaction formed by a compression ramp in a Mach 3 flow. The actuator is based on a plasma-generated synthetic jet and is configured as an array of three jets that can be injected normal to the cross-flow, pitched, or pitched and skewed. The typical peak jet exit velocity of the actuators is about 300 m/s and the pulsing frequencies are a few kilohertz. A study of the interaction between the pulsed-plasma jets and the shock/boundary layer interaction was performed in a time-resolved manner using 10 kHz schlieren imaging. When the actuator, pulsed at StL ≈ 0.04 (f = 2 kHz), was injected into the upstream boundary layer, the separation shock responded to the plasma jet by executing a rapid upstream motion followed by a gradual downstream recovery motion. Schlieren movies of the interaction showed that the separation shock unsteadiness was locked to the pulsing frequency of the actuator, with amplitude of about one boundary layer thickness. Wall-pressure measurements made under the intermittent region showed about a 30% decrease in the overall magnitude of the pressure fluctuations in the low-frequency band associated with unsteady large-scale motion of the separated flow. Furthermore, by increasing the pulsing frequency to 3.3 kHz, the amplitude of the separation shock oscillation was reduced to less than half the boundary layer thickness. Investigation into the effect of the actuator location on the shock wave/boundary layer interaction (SWBLI) showed qualitatively and quantitatively that the actuator placed upstream of the separation shock caused significant modification to the SWBLI unsteadiness, whereas injection from inside the separation bubble did not cause a noticeable effect.

The fluvial sediment budget of a dammed river (upper Muga, southern Pyrenees)

NASA Astrophysics Data System (ADS)

Piqué, G.; Batalla, R. J.; López, R.; Sabater, S.

2017-09-01

Many rivers in the Mediterranean region are regulated for urban and agricultural purposes. Reservoir presence and operation results in flow alteration and sediment discontinuity, altering the longitudinal structure of the fluvial system. This study presents a 3-year sediment budget of a highly dammed Mediterranean river (the Muga, southern Pyrenees), which has experienced flow regulation since the 1969 owing to a 61-hm3 reservoir. Flow discharge and suspended sediment concentration were monitored immediately upstream and downstream from the reservoir, whereas bedload transport was estimated by means of bedload formulae and estimated from regional data. Results show how the dam modifies river flow, reducing the magnitude of floods and shortening its duration. At the same time, duration of low flows increases. The downstream flow regime follows reservoir releases that are mostly driven by the irrigation needs in the lowlands. Likewise, suspended sediment and bedload transport are shown to be notably affected by the dam. Sediment transport upstream was mainly associated with floods and was therefore concentrated in short periods of time (i.e., > 90% of the sediment load occurred in < 1% of the time). Downstream from the dam, sediments were transported more constantly (i.e., 90% of the load was carried during 50% of the time). Total sediment load upstream from the dam equalled 23,074 t, while downstream it was < 1000 t. Upstream, sediment load was equally distributed between suspension and bedload (i.e., 10,278 and 12,796 t respectively), whereas suspension dominated sediment transport downstream. More than 95% of the sediments transported from the upstream basins were trapped in the reservoir, a fact that explains the sediment deficit and the river bed armouring observed downstream. Overall, the dam disrupted the natural water and sediment fluxes, generating a highly modified environment downstream. Below the dam, the whole ecosystem shifted to stable conditions owing to the reduction of water and sediment loads.

Geographic variability in elevation and topographic constraints on the distribution of native and nonnative trout in the Great Basin

USGS Publications Warehouse

Warren, Dana R.; Dunham, Jason B.; Hockman-Wert, David

2014-01-01

Understanding local and geographic factors influencing species distributions is a prerequisite for conservation planning. Our objective in this study was to model local and geographic variability in elevations occupied by native and nonnative trout in the northwestern Great Basin, USA. To this end, we analyzed a large existing data set of trout presence (5,156 observations) to evaluate two fundamental factors influencing occupied elevations: climate-related gradients in geography and local constraints imposed by topography. We applied quantile regression to model upstream and downstream distribution elevation limits for each trout species commonly found in the region (two native and two nonnative species). With these models in hand, we simulated an upstream shift in elevation limits of trout distributions to evaluate potential consequences of habitat loss. Downstream elevation limits were inversely associated with latitude, reflecting regional gradients in temperature. Upstream limits were positively related to maximum stream elevation as expected. Downstream elevation limits were constrained topographically by valley bottom elevations in northern streams but not in southern streams, where limits began well above valley bottoms. Elevation limits were similar among species. Upstream shifts in elevation limits for trout would lead to more habitat loss in the north than in the south, a result attributable to differences in topography. Because downstream distributions of trout in the north extend into valley bottoms with reduced topographic relief, trout in more northerly latitudes are more likely to experience habitat loss associated with an upstream shift in lower elevation limits. By applying quantile regression to relatively simple information (species presence, elevation, geography, topography), we were able to identify elevation limits for trout in the Great Basin and explore the effects of potential shifts in these limits that could occur in response to changing climate conditions that alter streams directly (e.g., through changes in temperature and precipitation) or indirectly (e.g., through changing water use).

40 CFR 1066.125 - Data updating, recording, and control.

Code of Federal Regulations, 2014 CFR

2014-07-01

... minimum recording frequency, such as for sample flow rates from a CVS that does not have a heat exchanger... exhaust flow rate from a CVS with a heat exchanger upstream of the flow measurement 1 Hz. 40 CFR 1065.545§ 1066.425 Diluted exhaust flow rate from a CVS without a heat exchanger upstream of the flow measurement...

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

NO formation in the burnout region of a partially premixed methane-air flame with upstream heat loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mokhov, A.V.; Levinsky, H.B.

Measurements of temperature and NO concentration in laminar, partially premixed methane-air flames stabilized on a ceramic burner in coflow are reported. The NO concentration and temperature were determined by laser-induced fluorescence (LIF) and coherent anti-Stokes Raman scattering (CARS), respectively. Upstream heat loss to the burner was varied by changing the exit velocity of the fuel-air mixture at a constant equivalence ratio of 1,3; this alters the structure of the flame from an axisymmetric Bunsen-type to a strongly stabilized flat flame. To facilitate analysis of the results, a method is derived for separating the effects of dilution from those of chemicalmore » reaction based on the relation between the measured temperature and the local mixture fraction, including the effects of upstream heat loss. Using this method, the amount of NO formed during burnout of the hot, fuel-rich combustion products can be ascertained. In the Bunsen-type flame, it is seen that {approximately}40 ppm of NO are produced in this burnout region, at temperatures between {approximately}2,100 K and {approximately}1,900 K, probably via the Zeldovich mechanism. Reducing the exit velocity of 12 cm/s reduces the flame temperature substantially, and effectively eliminates this contribution. At velocities of 12 and 8 cm/s, {approximately}10 ppm of NO are formed in the burnout region, even though the gas temperatures are too low for Zeldovich NO to be significant. Although the mechanism responsible for these observations is as yet unclear, the results are consistent with the idea that the low temperatures in the fuel-rich gases caused by upstream heat loss retard the conversion of HCN (formed via the Fenimore mechanism) to NO, with this residual HCN then being converted to NO during burnout.« less

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle.

PubMed

Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu

2017-12-06

Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.

Assessment of sediment yield in a sloping Mediterranean watershed in Cyprus

NASA Astrophysics Data System (ADS)

Djuma, Hakan; Bruggeman, Adriana; Camera, Corrado

2014-05-01

In the Mediterranean region, water catchment sediment yield as a result of erosion is higher than in many other regions in Europe due to the climatic conditions, topography, lithology and land-use. Modelling sediment transport is difficult due to intermittent stream flow and highly irregular rainfall conditions in this region. The objective of this study is to quantify sediment yield of a highly sloping Mediterranean environment. This study is conducted in the Peristerona Watershed in Cyprus, which has ephemeral water flow. In the downstream area a series of check dams have been placed across the stream to slow the flow and increase groundwater recharge. The surface area of the watershed, upstream of the check dams, is 103 km2 with elevation changing between 1540 m and 280 m and a mean local slope higher than 40% for the mountainous part and lower than 8% for the plain. The long-term average annual precipitation ranges from 755 mm in the upstream area to 276 mm in the plain. The surface extent of the sediment that was deposited at the most upstream check dam during two seasons was measured with a Differential Global Positioning System. The depth of the sediment was measured with utility poles and bulk density samples from the sediment profile were collected. The sediment had a surface area of 12600 m2 and an average depth of 0.23 m. The mean of the sediment dry bulk density samples was 1.05 t m-3 with a standard deviation of 0.11. Based on these values, area specific sediment yield was computed as 1 t ha-1 per year for the entire catchment area upstream of the check dam, assuming a check dam sediment trap efficiency of 15%. Erosion in the watershed is currently modeled with PESERA using detailed watershed data.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Gross rearrangements within the 5'-untranslated region of the picornaviral genomes.

PubMed

Pilipenko, E V; Blinov, V M; Agol, V I

1990-06-11

An analysis of reported nucleotide sequences revealed several cases of gross rearrangements in the 5'-untranslated region (5-UTR) of picornaviral genomes. A large (greater than 100 nt) duplication was discovered in a downstream region of poliovirus 5-UTR involved in the translational control. Properties of the poliovirus mutants with large deletions [Kuge and Nomoto (1987) J. Virol. 61, 1478-1487] show that a single copy of the appropriate repeating unit is compatible with a wild type phenotype of the virus. In contrast to poliovirus and another enterovirus genomes, human rhinovirus RNAs contain only a single copy of this repeating unit. Another similarly large repeat was found in an upstream segment of the bovine enterovirus 5-UTR. A comparison of the primary and secondary structures of cardio- and aphthovirus 5-UTRs demonstrated the existence of a large (ca. 250 nucleotides) insertion/deletion in a region preceding the poly(C) tract. The two latter rearrangements appear to involve elements of the viral genome replication machinery. Possible origin as well as evolutionary and functional implications of these structural peculiarities are discussed.

Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

PubMed

Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

2014-02-01

Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

PubMed

Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

1990-03-25

The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

Visualization by discharge illumination technique and modification by plasma actuator of rarefied Mach 2 airflow around a cylinder

NASA Astrophysics Data System (ADS)

Leger, L.; Sellam, M.; Barbosa, E.; Depussay, E.

2013-06-01

The use of plasma actuators for flow control has received considerable attention in recent years. This kind of device seems to be an appropriate means of raising abilities in flow control thanks to total electric control, no moving parts and a fast response time. The experimental work presented here shows, firstly, the non-intrusive character of the visualization of the density field of an airflow around a cylinder obtained using a plasma luminescence technique. Experiments are made in a continuous supersonic wind tunnel. The static pressure in the flow is 8 Pa, the mean free path is about 0.3 mm and the airflow velocity is 510 m s-1. Pressure measurements obtained by means of glass Pitot tube without the visualization discharge are proposed. Measured and simulated pressure profiles are in good agreement in the region near the cylinder. There is good correlation between numerical simulations of the supersonic flow field, analytical model predictions and experimental flow visualizations obtained by a plasma luminescence technique. Consequently, we show that the plasma luminescence technique is non-intrusive. Secondly, the effect of a dc discharge on a supersonic rarefied air flow around a cylinder is studied. An electrode is flush mounted on the cylinder. Stagnation pressure profiles are examined for different electrode positions on the cylinder. A shock wave modification depending on the electrode location is observed. The discharge placed at the upstream stagnation point induces an upstream shift of the bow shock, whereas a modification of the shock wave shape is observed when it is placed at 45° or 90°.

Mammalian monogamy is not controlled by a single gene

PubMed Central

Fink, Sabine; Excoffier, Laurent; Heckel, Gerald

2006-01-01

Complex social behavior in Microtus voles and other mammals has been postulated to be under the direct genetic control of a single locus: the arginine vasopressin 1a receptor (avpr1a) gene. Using a phylogenetic approach, we show that a repetitive element in the promoter region of avpr1a, which reportedly causes social monogamy, is actually widespread in nonmonogamous Microtus and other rodents. There was no evidence for intraspecific polymorphism in regard to the presence or absence of the repetitive element. Among 25 rodent species studied, the element was absent in only two closely related nonmonogamous species, indicating that this absence is certainly the result of an evolutionarily recent loss. Our analyses further demonstrate that the repetitive structures upstream of the avpr1a gene in humans and primates, which have been associated with social bonding, are evolutionarily distinct from those in rodents. Our evolutionary approach reveals that monogamy in rodents is not controlled by a single polymorphism in the promoter region of the avpr1a gene. We thus resolve the contradiction between the claims for an evolutionarily conserved genetic programming of social behavior in mammals and the vast evidence for highly complex and flexible mating systems. PMID:16832060

Upstream structural management measures for an urban area flooding in Turkey

NASA Astrophysics Data System (ADS)

Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.

2015-06-01

In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

Effect of Temperature and Fluid Flow on Dendrite Growth During Solidification of Al-3 Wt Pct Cu Alloy by the Two-Dimensional Cellular Automaton Method

NASA Astrophysics Data System (ADS)

Gu, Cheng; Wei, Yanhong; Liu, Renpei; Yu, Fengyi

2017-12-01

A two-dimensional cellular automaton-finite volume model was developed to simulate dendrite growth of Al-3 wt pct Cu alloy during solidification to investigate the effect of temperature and fluid flow on dendrite morphology, solute concentration distribution, and dendrite growth velocity. Different calculation conditions that may influence the results of the simulation, including temperature and flow, were considered. The model was also employed to study the effect of different undercoolings, applied temperature fields, and forced flow velocities on solute segregation and dendrite growth. The initial temperature and fluid flow have a significant impact on the dendrite morphologies and solute profiles during solidification. The release of energy is operated with solidification and results in the increase of temperature. A larger undercooling leads to larger solute concentration near the solid/liquid interface and solute concentration gradient at the same time-step. Solute concentration in the solid region tends to increase with the increase of undercooling. Four vortexes appear under the condition when natural flow exists: the two on the right of the dendrite rotate clockwise, and those on the left of the dendrite rotate counterclockwise. With the increase of forced flow velocity, the rejected solute in the upstream region becomes easier to be washed away and enriched in the downstream region, resulting in acceleration of the growth of the dendrite in the upstream and inhibiting the downstream dendrite growth. The dendrite perpendicular to fluid flow shows a coarser morphology in the upstream region than that of the downstream. Almost no secondary dendrite appears during the calculation process.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Identification of American shad spawning sites and habitat use in the Pee Dee River, North Carolina and South Carolina

USGS Publications Warehouse

Harris, Julianne E.; Hightower, Joseph E.

2011-01-01

We examined spawning site selection and habitat use by American shad Alosa sapidissima in the Pee Dee River, North Carolina and South Carolina, to inform future management in this flow-regulated river. American shad eggs were collected in plankton tows, and the origin (spawning site) of each egg was estimated; relocations of radio-tagged adults on spawning grounds illustrated habitat use and movement in relation to changes in water discharge rates. Most spawning was estimated to occur in the Piedmont physiographic region within a 25-river-kilometer (rkm) section just below the lowermost dam in the system; however, some spawning also occurred downstream in the Coastal Plain. The Piedmont region has a higher gradient and is predicted to have slightly higher current velocities and shallower depths, on average, than the Coastal Plain. The Piedmont region is dominated by large substrates (e.g., boulders and gravel), whereas the Coastal Plain is dominated by sand. Sampling at night (the primary spawning period) resulted in the collection of young eggs (≤1.5 h old) that more precisely identified the spawning sites. In the Piedmont region, most radio-tagged American shad remained in discrete areas (average linear range = 3.6 rkm) during the spawning season and generally occupied water velocities between 0.20 and 0.69 m/s, depths between 1.0 and 2.9 m, and substrates dominated by boulder or bedrock and gravel. Tagged adults made only small-scale movements with changes in water discharge rates. Our results demonstrate that the upstream extent of migration and an area of concentrated spawning occur just below the lowermost dam. If upstream areas have similar habitat, facilitating upstream access for American shad could increase the spawning habitat available and increase the population's size.

Control of boundary layer transition location and plate vibration in the presence of an external acoustic field

NASA Technical Reports Server (NTRS)

Maestrello, L.; Grosveld, F. W.

1991-01-01

The experiment is aimed at controlling the boundary layer transition location and the plate vibration when excited by a flow and an upstream sound source. Sound has been found to affect the flow at the leading edge and the response of a flexible plate in a boundary layer. Because the sound induces early transition, the panel vibration is acoustically coupled to the turbulent boundary layer by the upstream radiation. Localized surface heating at the leading edge delays the transition location downstream of the flexible plate. The response of the plate excited by a turbulent boundary layer (without sound) shows that the plate is forced to vibrate at different frequencies and with different amplitudes as the flow velocity changes indicating that the plate is driven by the convective waves of the boundary layer. The acoustic disturbances induced by the upstream sound dominate the response of the plate when the boundary layer is either turbulent or laminar. Active vibration control was used to reduce the sound induced displacement amplitude of the plate.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

PubMed

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2015-09-01

An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

Effects of a floodwater-retarding structure on the hydrology and ecology of Trout Creek in southwestern Wisconsin

USGS Publications Warehouse

Wentz, Dennis A.; Graczyk, David J.

1982-01-01

From 1960 to 1979, winter floods seem to have had the greatest adverse effect on the survival of brown trout eggs and sac fry. Although construction of the FRS has eliminated some spawning gravels in the flood pool owing to sedimentation, the wild trout have adapted by using spawning grounds above the flood pool more extensively and intensively. The FRS has not blocked the upstream migration of spawning trout, but it has eliminated similar migrations of fish that compete with and prey on the trout. Controlled streamflows downstream from the FRS have had a stabilizing influence on the limited trout reproduction in this region.

Application of finite element approach to transonic flow problems

NASA Technical Reports Server (NTRS)

Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.

1976-01-01

A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.

Four-phase or two-phase signal plan? A study on four-leg intersection by cellular automaton simulations

NASA Astrophysics Data System (ADS)

Jin, Cheng-Jie; Wang, Wei; Jiang, Rui

2016-08-01

The proper setting of traffic signals at signalized intersections is one of the most important tasks in traffic control and management. This paper has evaluated the four-phase traffic signal plans at a four-leg intersection via cellular automaton simulations. Each leg consists of three lanes, an exclusive left-turn lane, a through lane, and a through/right-turn lane. For a comparison, we also evaluate the two-phase signal plan. The diagram of the intersection states in the space of inflow rate versus turning ratio has been presented, which exhibits four regions: In region I/II/III, congestion will propagate upstream and laterally and result in queue spillover with both signal plans/two-phase signal plan/four-phase signal plan, respectively. Therefore, neither signal plan works in region I, and only the four-phase signal plan/two-phase signal plan works in region II/III. In region IV, both signal plans work, but two-phase signal plan performs better in terms of average delays of vehicles. Finally, we study the diagram of the intersection states and average delays in the asymmetrical configurations.

Greig syndrome: Analysis of the GL13 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grzeschik, K.H.; Gessler, M.; Heid, C.

1994-09-01

Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

Hydrological network and classification of lakes on the Third Pole

NASA Astrophysics Data System (ADS)

Gao, Yang; Wang, Weicai; Yao, Tandong; Lu, Ning; Lu, Anxin

2018-05-01

The intensity and form of changes in closed lakes, upstream lakes and outflow lakes on the Third Pole (TP) differ based on their drainage mode. Researchers' insufficient understanding of the hydrological networks associated with lakes hampers studies of the relationship between lakes and climate. In this study, we establish a comprehensive hydrological network for each lake (>1 km2) on the TP using 106 Landsat images, 236 Chinese topographic maps, and SRTM DEM. Three-hundred-ninety-seven closed lakes, 488 upstream lakes and 317 outflow lakes totaling 3,5498.49 km2, 7,378.82 km2, and 3,382.29 km2, respectively, were identified on the TP using 2010 data. Two-hundred-thirty-four closed lakes were found to not be linked to upstream lakes. The remaining 163 closed lakes were connected to and fed by the 488 upstream lakes. The object-oriented analyses within this study indicated that more rapid changes occurred in the surface extent of closed lakes than in upstream lakes or outflow lakes on the TP from 1970 s to 2010. Furthermore, the water volume of the examined closed lakes was almost nine times greater than that of the upstream lakes from 2003 to 2009. All the examined closed lakes exhibited an obvious water volume change compared to the corresponding upstream lakes in the same basin. Furthermore, two case studies illustrate that the annual and seasonal dynamics associated with the changes in closed lakes may reflect climate change patterns, while the upstream lake dynamics may be more controlled by the lakeshore terrain and drainage characteristics. The lake inventory and hydrological network catalogued in this study provide a basis for developing a better understanding of lake response to climate change on the TP.

Closed-loop Separation Control Using Oscillatory Flow Excitation

NASA Technical Reports Server (NTRS)

Allan, Brian G.; Juang, Jer-Nan; Raney, David L.; Seifert, Avi; Pack, latunia G.; Brown, Donald E.

2000-01-01

Design and implementation of a digital feedback controller for a flow control experiment was performed. The experiment was conducted in a cryogenic pressurized wind tunnel on a generic separated configuration at a chord Reynolds number of 16 million and a Mach number of 0.25. The model simulates the upper surface of a 20% thick airfoil at zero angle-of-attack. A moderate favorable pressure gradient, up to 55% of the chord, is followed by a severe adverse pressure gradient which is relaxed towards the trailing edge. The turbulent separation bubble, behind the adverse pressure gradient, is then reduced by introducing oscillatory flow excitation just upstream of the point of flow separation. The degree of reduction in the separation region can be controlled by the amplitude of the oscillatory excitation. A feedback controller was designed to track a given trajectory for the desired degree of flow reattachment and to improve the transient behavior of the flow system. Closed-loop experiments demonstrated that the feedback controller was able to track step input commands and improve the transient behavior of the open-loop response.

Wave structure in the radial film flow with a circular hydraulic jump

NASA Astrophysics Data System (ADS)

Rao, A.; Arakeri, J. H.

A circular hydraulic jump is commonly seen when a circular liquid jet impinges on a horizontal plate. Measurements of the film thickness, jump radius and the wave structure for various jet Reynolds numbers are reported. Film thickness measurements are made using an electrical contact method for regions both upstream and downstream of the jump over circular plates without a barrier at the edge. The jump radius and the separation bubble length are measured for various flow rates, plate edge conditions, and radii. Flow visualization using high-speed photography is used to study wave structure and transition. Waves on the jet amplify in the film region upstream of the jump. At high flow rates, the waves amplify enough to cause three-dimensional breakdown and what seems like transition to turbulence. This surface wave induced transition is different from the traditional route and can be exploited to enhance heat and mass transfer rates.

Concentric tube support assembly

DOEpatents

Rubio, Mark F.; Glessner, John C.

2012-09-04

An assembly (45) includes a plurality of separate pie-shaped segments (72) forming a disk (70) around a central region (48) for retaining a plurality of tubes (46) in a concentrically spaced apart configuration. Each segment includes a support member (94) radially extending along an upstream face (96) of the segment and a plurality of annularly curved support arms (98) transversely attached to the support member and radially spaced apart from one another away from the central region for receiving respective upstream end portions of the tubes in arc-shaped spaces (100) between the arms. Each segment also includes a radial passageway (102) formed in the support member for receiving a fluid segment portion (106) and a plurality of annular passageways (104) formed in the support arms for receiving respective arm portions (108) of the fluid segment portion from the radial passageway and for conducting the respective arm portions into corresponding annular spaces (47) formed between the tubes retained by the disk.

Magnetic resonance imaging of living systems by remote detection

DOEpatents

Wemmer, David; Pines, Alexander; Bouchard, Louis; Xu, Shoujun; Harel, Elad; Budker, Dmitry; Lowery, Thomas; Ledbetter, Micah

2013-10-29

A novel approach to magnetic resonance imaging is disclosed. Blood flowing through a living system is prepolarized, and then encoded. The polarization can be achieved using permanent or superconducting magnets. The polarization may be carried out upstream of the region to be encoded or at the place of encoding. In the case of an MRI of a brain, polarization of flowing blood can be effected by placing a magnet over a section of the body such as the heart upstream of the head. Alternatively, polarization and encoding can be effected at the same location. Detection occurs at a remote location, using a separate detection device such as an optical atomic magnetometer, or an inductive Faraday coil. The detector may be placed on the surface of the skin next to a blood vessel such as a jugular vein carrying blood away from the encoded region.

Flow separation in a computational oscillating vocal fold model

NASA Astrophysics Data System (ADS)

Alipour, Fariborz; Scherer, Ronald C.

2004-09-01

A finite-volume computational model that solves the time-dependent glottal airflow within a forced-oscillation model of the glottis was employed to study glottal flow separation. Tracheal input velocity was independently controlled with a sinusoidally varying parabolic velocity profile. Control parameters included flow rate (Reynolds number), oscillation frequency and amplitude of the vocal folds, and the phase difference between the superior and inferior glottal margins. Results for static divergent glottal shapes suggest that velocity increase caused glottal separation to move downstream, but reduction in velocity increase and velocity decrease moved the separation upstream. At the fixed frequency, an increase of amplitude of the glottal walls moved the separation further downstream during glottal closing. Increase of Reynolds number caused the flow separation to move upstream in the glottis. The flow separation cross-sectional ratio ranged from approximately 1.1 to 1.9 (average of 1.47) for the divergent shapes. Results suggest that there may be a strong interaction of rate of change of airflow, inertia, and wall movement. Flow separation appeared to be ``delayed'' during the vibratory cycle, leading to movement of the separation point upstream of the glottal end only after a significant divergent angle was reached, and to persist upstream into the convergent phase of the cycle.

Life-stage-specific physiology defines invasion extent of a riverine fish

USGS Publications Warehouse

Lawrence, David J.; Beauchamp, David A.; Olden, Julian D.

2015-01-01

Many ecologists have called for mechanism-based investigations to identify the underlying controls on species distributions. Understanding these controls can be especially useful to construct robust predictions of how a species range may change in response to climate change or the extent to which a non-native species may spread in novel environments.Here, we link spatially intensive observations with mechanistic models to illustrate how physiology determines the upstream extent of the aquatic ectotherm smallmouth bass (Micropterus dolomieu) in two headwater rivers.Our results demonstrate that as temperatures become increasingly cold across a downstream to upstream gradient, food consumption in age 0 bass becomes increasingly constrained, and as a result, these fish become growth limited. Sufficient first summer growth of age 0 bass is essential for overwinter survival because young bass must persist from energy reserves accumulated during the summer, and those reserves are determined by body size.Our field data reveal the upstream extent of adult bass reproduction corresponds to a point in the downstream/upstream gradient where cold temperatures impair growth opportunities in young bass. This pattern was repeated in both study streams and explained why bass positioned nests twice as far upstream in the warm compared to the cold stream in the same basin. Placement of spawning nests by adult bass is likely subject to strong evolutionary selection in temperate systems: if bass spawn too far upstream, their young are unlikely to grow large enough to survive the winter. Consumption and growth in older bass (age 3–4) was far less sensitive to temperature. Based on these data, we suggest that temperature-sensitive age 0 bass constrain the upstream distribution limits of bass within temperate streams.In this study, we investigated how temperature-dependent physiology changed through the life history of a species and, in doing so, identified a climate-sensitive life-history stage that likely sets the distributional limits of all other life-history stages. We anticipate the framework developed here could be employed to identify how similar stage-specific environmental sensitivity determines distribution in many other ectothermic species.

Detecting the Upstream Extent of Fish in the Redwood Region of Northern California

Treesearch

Aaron K. Bliesner; E. George Robison

2007-01-01

The point at which fish use ends represents a key ecological and regulatory demarcation on state and private forest land in the Redwood region. Currently, the end of fish use and other key demarcations with stream classification are measured or estimated based on judgments of Registered Professional Foresters and aquatic biologists with little guidance from empirical...

Severe Flooding and Malaria Transmission in the Western Ugandan Highlands: Implications for Disease Control in an Era of Global Climate Change.

PubMed

Boyce, Ross; Reyes, Raquel; Matte, Michael; Ntaro, Moses; Mulogo, Edgar; Metlay, Joshua P; Band, Lawrence; Siedner, Mark J

2016-11-01

 There are several mechanisms by which global climate change may impact malaria transmission. We sought to assess how the increased frequency of extreme precipitation events associated with global climate change will influence malaria transmission in highland areas of East Africa.  We used a differences-in-differences, quasi-experimental design to examine spatial variability in the incidence rate of laboratory-confirmed malaria cases and malaria-related hospitalizations between villages (1) at high versus low elevations, (2) with versus without rivers, and (3) upstream versus downstream before and after severe flooding that occurred in Kasese District, Western Region, Uganda, in May 2013.  During the study period, 7596 diagnostic tests were performed, and 1285 patients were admitted with a diagnosis of malaria. We observed that extreme flooding resulted in an increase of approximately 30% in the risk of an individual having a positive result of a malaria diagnostic test in the postflood period in villages bordering a flood-affected river, compared with villages farther from a river, with a larger relative impact on upstream versus downstream villages (adjusted rate ratio, 1.91 vs 1.33).  Extreme precipitation such as the flooding described here may pose significant challenges to malaria control programs and will demand timely responses to mitigate deleterious impacts on human health. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The dicistronic RNA from the mouse LINE-1 retrotransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition

PubMed Central

2006-01-01

Most eukaryotic mRNAs are monocistronic and translated by cap-dependent initiation. LINE-1 RNA is exceptional because it is naturally dicistronic, encoding two proteins essential for retrotransposition, ORF1p and ORF2p. Here, we show that sequences upstream of ORF1 and ORF2 in mouse L1 function as internal ribosome entry sites (IRESes). Deletion analysis of the ORF1 IRES indicates that RNA structure is critical for its function. Conversely, the ORF2 IRES localizes to 53 nt near the 3′ end of ORF1, and appears to depend upon sequence rather than structure. The 40 nt intergenic region (IGR) is not essential for ORF2 IRES function or retrotransposition. Because of strong cis-preference for both proteins during L1 retrotransposition, correct stoichiometry of the two proteins can only be achieved post-transcriptionally. Although the precise stoichiometry is unknown, the retrotransposition intermediate likely contains hundreds of ORF1ps for every ORF2p, together with one L1 RNA. IRES-mediated translation initiation is a well-established mechanism of message-specific regulation, hence, unique mechanisms for the recognition and control of these two IRESes in the L1 RNA could explain differences in translational efficiency of ORF1 and ORF2. In addition, translational regulation may provide an additional layer of control on L1 retrotransposition efficiency, thereby protecting the integrity of the genome. PMID:16464823

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

MESSENGER Observations of ULF Waves in Mercury's Foreshock Region

NASA Technical Reports Server (NTRS)

Le, Guan; Chi, Peter J.; Bardsen, Scott; Blanco-Cano, Xochitl; Slavin, James A.; Korth, Haje

2012-01-01

The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth s is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury s bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury s foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury s foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the 1-Hz waves in the Earth s foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth s foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

The "WFD-effect" on upstream-downstream relations in international river basins - insights from the Rhine and the Elbe basins

NASA Astrophysics Data System (ADS)

Moellenkamp, S.

2007-06-01

The upstream-downstream relationship in international river basins is a traditional challenge in water management. Water use in upstream countries often has a negative impact on water use in downstream countries. This is most evident in the classical example of industrial pollution in upstream countries hindering drinking water production downstream. The European Water Framework Directive (WFD) gives new impetus to the river basin approach and to international co-operation in European catchments. It aims at transforming a mainly water quality oriented management into a more integrated approach of ecosystem management. After discussing the traditional upstream-downstream relationship, this article shows that the WFD has a balancing effect on upstream-downstream problems and that it enhances river basin solidarity in international basins. While it lifts the downstream countries to the same level as the upstream countries, it also leads to new duties for the downstream states. Following the ecosystem approach, measures taken by downstream countries become increasingly more important. For example, downstream countries need to take measures to allow for migrating fish species to reach upstream stretches of river systems. With the WFD, fish populations receive increased attention, as they are an important indicator for the ecological status. The European Commission acquires a new role of inspection and control in river basin management, which finally also leads to enhanced cooperation and solidarity among the states in a basin. In order to achieve better water quality and to mitigate upstream-downstream problems, also economic instruments can be applied and the WFD does not exclude the possibility of making use of financial compensations, if at the same time the polluter pays principle is taken into account. The results presented in this article originate from a broader study on integrated water resources management conducted at Bonn University and refer to the Rhine and Elbe basins (Moellenkamp, 2006).

Fish passage in a western Iowa stream modified by grade control structures

USGS Publications Warehouse

Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

2008-01-01

Grade control structures (GCSs) are commonly used in streams of western Iowa to control bank erosion and channel headcutting but may be barriers to fish passage. From May 2002 to May 2006, we used mark-recapture methods to evaluate fish passage over a total of five GCSs, ranging in slope (run : rise) from 13:1 to 18:1 in Turkey Creek, Cass County, Iowa. Three structures, over which limited fish movement was documented from 2002 to 2004, were modified in the winter of 2004-2005 to facilitate fish passage. Before modification, the majority of recaptured fish were recaptured at the station where they were originally marked; only 1% displayed movement between sites and either upstream or downstream over a GCS. After modification fish passage improved, 14% of recaptured fish displayed movement either upstream or downstream over a GCS. Individuals of four target species - channel catfish Ictalurus punctatus, yellow bullhead Ameiurus natalis, black bullhead A. melas, and creek chub Semotilus atromaculatus - passed over at least one modified structure. The majority of documented movements over GCSs were in the upstream direction and occurred in late spring and early summer, when streamflow was relatively high. Although we documented low numbers of fish passing both upstream and downstream over GCSs, these structures are probably barriers to fish movement during periods of low flow and when there is a structural failure, such as in-channel movement of riprap. Grade control structures are pervasive in western Iowa streams; nearly every low-order stream contains at least one instream structure. To sustain fish populations, management efforts should focus on constructing or modifying GCSs to allow fish passage. ?? Copyright by the American Fisheries Society 2008.

How do blockings relate to heavy precipitation events in Europe?

NASA Astrophysics Data System (ADS)

Lenggenhager, Sina; Romppainen, Olivia; Brönnimann, Stefan; Croci-Maspoli, Mischa

2017-04-01

Atmospheric blockings are quasi-stationary high pressure systems that persist for several days. Due to their longevity, blockings can be key features for extreme weather events. While several studies have shown their relevant role for temperatures extremes, the link between blockings and extreme precipitation and floods is still poorly understood. A case study of a Swiss lake flood event in the year 2000 reveals how different processes connected to blockings can favour the development of a flood. First upstream blocks helped to form strongly elongated troughs that are known to be associated with heavy precipitation events south of the Alps. Second recurrent precipitation events upstream of a block led to a moistening of the catchment and an increase of the lake level. Third the progression of the upstream weather systems was slowed and thereby the precipitation period over a catchment prolonged. Additionally, cloud diabatic processes in the flood region contributed to the establishment and maintenance of blocking anticyclones. Based on this case study we extend our analysis to all of Europe. Focusing on flood relevant precipitation events, i.e. extreme precipitation events that last for several days and affect larger areas, we show that different regions in Europe have very distinct seasonal precipitation patterns. Hence there is a strong seasonality in the occurrence of extreme events, depending on the geographical region. We further suggest that for different precipitation regimes, the preferred location of blockings varies strongly. Heavy precipitation events in southern France, for example, are often observed during Scandinavian blockings, while heavy precipitation events in south-eastern Europe coincide more often with eastern North-Atlantic blockings.

Food poisoning associated with ingestion of wild wasp broods in the upstream region of the Lancang river valley, Yunnan province, China.

PubMed

Jiang, Li; Huang, Tian

2018-04-01

Food poisoning due to wild wasp broods ingestion has long been noted in the upstream region of the Lancang river valley, Yunnan province, China. This study describes the epidemiological and clinical features of the poisoning and possible causes. Surveillance data collected between 2008 and 2016 were analyzed to produce demographic data on patients, information on clinical presentations, wasp species identification, and estimations of possible risk factors for symptomatic cases. Eleven poisoning events were associated with the ingestion of wild wasp broods, including 46 exposed persons with 31 symptomatic living cases and 8 deceased cases that were reported in the Yunnan province between 2008 and 2016. Poisoning cases were only detected in the upstream region of the Lancang river valley in the autumn. The severity of the symptoms was correlated with an evident dose-effect relationship regarding the quantity ingested. The mean latent period from wild wasp broods ingestion to the onset of the symptoms was 10 h for symptomatic living cases and 7 h for deceased cases, respectively. Both gastrointestinal and neurological symptoms were commonly observed in the poisoning cases. The toxin source may be indirectly caused by the wasp broods due to the prevalence of local poisonous plants, such as Tripterygium wilfordii Hook F, Tripterygium hypoglaucum Hutch and Vaccinium bracteatum Thunb. Educational programs at the start of wasp harvest season in September in the high-risk area should be carried out to reduce the incidence of poisonings. Copyright © 2018 Elsevier Ltd. All rights reserved.

An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

PubMed Central

Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

2015-01-01

Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

Characterization of human mitochondrial ferritin promoter: identification of transcription factors and evidences of epigenetic control

NASA Astrophysics Data System (ADS)

Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia

2016-09-01

Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5‧ flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors.

Effects of highway construction on stream water quality and macroinvertebrate condition in a mid-atlantic highlands watershed, USA.

PubMed

Chen, Yushun; Viadero, Roger C; Wei, Xinchao; Fortney, Ronald; Hedrick, Lara B; Welsh, Stuart A; Anderson, James T; Lin, Lian-Shin

2009-01-01

Refining best management practices (BMPs) for future highway construction depends on a comprehensive understanding of environmental impacts from current construction methods. Based on a before-after-control impact (BACI) experimental design, long-term stream monitoring (1997-2006) was conducted at upstream (as control, n = 3) and downstream (as impact, n = 6) sites in the Lost River watershed of the Mid-Atlantic Highlands region, West Virginia. Monitoring data were analyzed to assess impacts of during and after highway construction on 15 water quality parameters and macroinvertebrate condition using the West Virginia stream condition index (WVSCI). Principal components analysis (PCA) identified regional primary water quality variances, and paired t tests and time series analysis detected seven highway construction-impacted water quality parameters which were mainly associated with the second principal component. In particular, impacts on turbidity, total suspended solids, and total iron during construction, impacts on chloride and sulfate during and after construction, and impacts on acidity and nitrate after construction were observed at the downstream sites. The construction had statistically significant impacts on macroinvertebrate index scores (i.e., WVSCI) after construction, but did not change the overall good biological condition. Implementing BMPs that address those construction-impacted water quality parameters can be an effective mitigation strategy for future highway construction in this highlands region.

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Spatiotemporal variations of hydrogeochemistry and its controlling factors in the Gandaki River Basin, Central Himalaya Nepal.

PubMed

Pant, Ramesh Raj; Zhang, Fan; Rehman, Faizan Ur; Wang, Guanxing; Ye, Ming; Zeng, Chen; Tang, Handuo

2018-05-01

The characterization and assessment of water quality in the head water region of Himalaya is necessary, given the immense importance of this region in sustaining livelihoods of people and maintaining ecological balance. A total of 165 water samples were collected from 55 sites during pre-monsoon, monsoon and post-monsoon seasons in 2016 from the Gandaki River Basin of the Central Himalaya, Nepal. The pH, EC values and TDS concentrations were measured in-situ and the concentrations of major ions (Ca 2+ , Mg 2+ , K + , Na + , Cl - , SO 4 2- , NO 3 - ) and Si were analyzed in laboratory. Correlation matrices, paired t-test, cluster analysis, principal component analysis (PCA), the Piper, Gibbs, and Mixing plots, and saturation index were applied to the measurements for evaluating spatiotemporal variation of the major ions. The results reveal mildly alkaline pH values and the following pattern of average ionic dominance: Ca 2+ >Mg 2+ >Na + >K + for cations and HCO 3 - >SO 4 2 - >Cl - >NO 3 - for anions. The results of PCA, Gibbs plot and the ionic relationships displayed the predominance of geogenic weathering processes in areas with carbonate dominant lithology. This conclusion is supported by geochemically different water facies identified in the Piper plot as Ca-HCO 3 (83.03%), mixed Ca-Mg-Cl (12.73.0%) and Ca-Cl (4.24%). Pronounced spatiotemporal heterogeneity demonstrates the influence of climatic, geogenic and anthropogenic conditions. For instance, the Ca 2+ -SO 4 2- , Mg 2+ -SO 4 2- and Na + -Cl - pairs exhibit strong positive correlation with each other in the upstream region, whereas relatively weak correlation in the downstream region, likely indicating the influence of evapo-crystallization processes in the upstream region. Analyses of the suitability of the water supply for drinking and irrigation reveal that the river has mostly retained its natural water quality but poses safety concern at a few locations. Knowledge obtained through this study can contribute to the sustainable management of water quality in the climatically and lithologically distinct segments of the Himalayan river basins. Copyright © 2017 Elsevier B.V. All rights reserved.

Non-modal linear stability analysis of thin film spreading by Marangoni stresses

NASA Astrophysics Data System (ADS)

Fischer, Benjamin John

The spontaneous spreading and stability characteristics of a thin Newtonian liquid film partially coated by an insoluble surfactant monolayer are investigated in this thesis. Thin films sheared by Marangoni stresses ire characterized by film thinning in the upstream region near the terminating edge of the initial monolayer and an advancing ridge further downstream. For sufficiently thin films, experiments have shown there develops dendritic fingering patterns upstream of the ridge. To probe the mechanisms responsible for unstable flow, a non-modal linear stability analysis is required because the base-states describing these flows are space and time-dependent. A new measure of disturbance amplification is introduced, based on the relative kinetic energy of the perturbations to the base-states, to analyze surfactant monolayers spreading either from a finite or infinite source. These studies reveal that disturbance amplification is most significant in highly curved regions of the film characterized by a large: change in the shear stress, which can develop at the advancing ridge and at the edge of the initial monolayer. For spreading from both a finite and infinite source, disturbances that convect through the ridge undergo transient amplification but eventually decay to restore film stability. By contrast, disturbances that localize to the thinned region undergo sustained amplification when surfactant is continuously supplied to the liquid film thereby promoting film instability. By focusing on these susceptible regions, the relevant evolution equations are simplified to extract more information about the mechanism leading to instability. The length-scale controlling these "inner" regions represents the balance of viscous, capillary and Marangoni stresses. Simplification of these equations allows identification of steady travelling wave solutions whose linearized stability behavior shows that a flat film subject to a jump increase in shear stress is asymptotically unstable. This thesis concludes by comparing recent experiments in our laboratory of a droplet of low surface tension liquid (oleic acid) spreading on a thin Newtonian film (glycerol) before the onset of instability with numerical simulations. Similar power law behavior for the ridge advance and qualitatively similar film profiles shapes occur when the simulations utilize a non-linear equation of state for the surfactant monolayer.

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti.

PubMed

D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C

2017-01-01

Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms.

Application of Control Method on a West Antarctic Glacier

NASA Astrophysics Data System (ADS)

Schmeltz, M.; Rignot, E. J.; Macayeal, D. R.

2002-12-01

We use surface velocity inferred with Interferometric synthetic-aperture radar and a control method to estimate unknown basal characteristics of a fast-moving glacier in West Antarctica, Pine Island Glacier. Previous modelling experiments on Pine Island Glacier have shown that using a coupled ice-stream/ice-shelf flow model in a forward approach (trial and error method) we were able to reproduce fairly well the surface velocity. Some discrepancies remained, however, that are partly due to uncertainties in the thickness map and incertainty in our chosen basal stress distribution (because of the non-unicity of the solution). The control method allow us to take the basal stress (or basal friction, since they are related through the velocity), as an unknown parameter. Results given by the control method should provide better reliable inputs for further modelling experiments. We investigate the results' sensitivity to the initial value of the basal stress. The inferred ratio basal drag/driving stress seems to be always low upstream, 60 to 80 km upstream of the grounding line, as if the ice stream was behaving like an ice shelf, and also reveals the presence of a snake shape channel of low ratio basal drag/driving stress, surrounded by a higher ratio, in the main flow of increasing velocity, from 20 to 40 km upstream of the grounding line.

Effects of Nonconvective Electric Fields on Magnetospheric Plasma Dynamics.

DTIC Science & Technology

1983-01-31

I.S.E.E. data (June, 1981 issue J. Geophys. Res.) has made a large contribution toward describing the structure of the foreshock region just upstream from...narrow layer on the most sunward region of the foreshock [Bonifazi and Moreno, 1981a,b] and form the distribution which is classified as "reflected...the foreshock region toughes the quasi perpendicular bow shock [Eastman et. al., 1981]. Therefore, ions reflected at this point may run along the

New Observation of Wave Excitation and Inverse Cascade in the Foreshock Region

NASA Astrophysics Data System (ADS)

He, Jiansen; Duan, Die; Yan, Limei; Huang, Shiyong; Tu, Chuanyi; Marsch, Eckart; Wang, Linghua; Tian, Hui

2016-04-01

Foreshock with nascent plasma turbulence is regarded as a fascinating region to understand the basic plasma physical processes, e.g., wave-particle interactions as well as wave-wave couplings. Although there have been a bunch of intensive studies on this topic, some key clues about the chain of the physical processes still lacks from observations, e.g., the co-existence of upstream energetic particles as the free energy source, excited pump waves as the wave seed, inverse cascaded daughter waves, and scattered energetic particles as the end of nonlinear processes. A relatively comprehensive case study with some new observations is presented in this work. In our case, upstream energetic protons drifting at tens of Alfvén speed with respect to the background plasma protons is observed from 3DP/PESA-High onboard the WIND spacecraft. When looking at the wave magnetic activities, we are surprised to find the co-existence of high-frequency (0.1-0.5 Hz) large-amplitude right-hand polarized (RHP) waves and low-frequency (0.02-0.1 Hz) small-amplitude left-hand polarized (LHP) waves in the spacecraft (SC) frame. The anti-correlation between magnetic and velocity fluctuations along with the sunward magnetic field direction indicates the low-frequency LHP waves in the SC frame is in fact the sunward upstream RHP waves in the solar wind frame. This new observation lays solid foundation for the applicability of plasma non-resonance instability theory and inverse cascade theory to the foreshock region, in which the downstream high-frequency RHP pump waves are excited by the upstream reflected energetic protons through non-resonance instability and low-frequency RHP daughter waves are generated by the pump waves due to nonlinear parametric decay. The weak signal of alpha particle flux in the foreshock region concerned is also favorable to the occurrence of nonlinear decay process. Furthermore, enhanced downstream energetic proton fluxes are found and inferred to be scattered by the nascent turbulent fluctuations. Therefore, some key clues about the newborn turbulence in the foreshock are supplemented in this work. Nevertheless, the more complete scenario about the fundamental plasma physical processes in the foreshock is left for the newly launched MMS project and the proposed THOR mission.

Wind-induced interannual variability of sea level slope, along-shelf flow, and surface salinity on the Northwest Atlantic shelf

NASA Astrophysics Data System (ADS)

Li, Yun; Ji, Rubao; Fratantoni, Paula S.; Chen, Changsheng; Hare, Jonathan A.; Davis, Cabell S.; Beardsley, Robert C.

2014-04-01

In this study, we examine the importance of regional wind forcing in modulating advective processes and hydrographic properties along the Northwest Atlantic shelf, with a focus on the Nova Scotian Shelf (NSS)-Gulf of Maine (GoM) region. Long-term observational data of alongshore wind stress, sea level slope, and along-shelf flow are analyzed to quantify the relationship between wind forcing and hydrodynamic responses on interannual time scales. Additionally, a simplified momentum balance model is used to examine the underlying mechanisms. Our results show significant correlation among the observed interannual variability of sea level slope, along-shelf flow, and alongshore wind stress in the NSS-GoM region. A mechanism is suggested to elucidate the role of wind in modulating the sea level slope and along-shelf flow: stronger southwesterly (northeastward) winds tend to weaken the prevailing southwestward flow over the shelf, building sea level in the upstream Newfoundland Shelf region, whereas weaker southwesterly winds allow stronger southwestward flow to develop, raising sea level in the GoM region. The wind-induced flow variability can influence the transport of low-salinity water from the Gulf of St. Lawrence to the GoM, explaining interannual variations in surface salinity distributions within the region. Hence, our results offer a viable mechanism, besides the freshening of remote upstream sources, to explain interannual patterns of freshening in the GoM.

Reconstructing Sediment Supply, Transport and Deposition Behind the Elwha River Dams

NASA Astrophysics Data System (ADS)

Beveridge, C.

2017-12-01

The Elwha River watershed in Olympic National Park of Washington State, USA is predominantly a steep, mountainous landscape where dominant geomorphic processes include landslides, debris flows and gullying. The river is characterized by substantial variability of channel morphology and fluvial processes, and alternates between narrow bedrock canyons and wider alluvial reaches for much of its length. Literature suggests that the Elwha watershed is topographically and tectonically in steady state. The removal of the two massive hydropower dams along the river in 2013 marked the largest dam removal in history. Over the century long lifespan of the dams, approximately 21 million cubic meters of sediment was impounded behind them. Long term erosion rates documented in this region and reservoir sedimentation data give unprecedented opportunities to test watershed sediment yield models and examine dominant processes that control sediment yield over human time scales. In this study, we aim to reconstruct sediment supply, transport and deposition behind the Glines Canyon Dam (most upstream dam) over its lifespan using a watershed modeling approach. We developed alternative models of varying complexity for sediment production and transport at the network scale driven by hydrologic forcing. We simulate sediment supply and transport in tributaries upstream of the dam. The modeled sediment supply and transport dynamics are based on calibrated formulae (e.g., bedload transport is simulated using Wilcock-Crowe 2003 with modification based on observed bedload transport in the Elwha River). Observational data that aid in our approach include DEM, channel morphology, meteorology, and streamflow and sediment (bedload and suspended load) discharge. We aim to demonstrate how the observed sediment yield behind the dams was influenced by upstream transport supply and capacity limitations, thereby demonstrating the scale effects of flow and sediment transport processes in the Elwha River watershed.

Genetic and morphological consequences of Quaternary glaciations: A relic barbel lineage (Luciobarbus pallaryi, Cyprinidae) of Guir Basin (Algeria).

PubMed

Brahimi, Amina; Tarai, Nacer; Benhassane, Abdelkrim; Henrard, Arnaud; Libois, Roland

2016-02-01

Climatic variations during the Quaternary period had a considerable impact on landscapes and habitat fragmentation (rivers) in North Africa. These historical events can have significant consequences on the genetic structure of the populations. Indeed, geographically separated and genetically isolated populations tend to differentiate themselves through time, eventually becoming distinct lineages, allowing new species to emerge in later generations. The aim of the present study is to use genetic and morphological techniques to evaluate the major role of the Saalian glaciation (Middle Quaternary) in the establishment of the geographic space and in the evolution of the intraspecific genetic diversity, by tracing the demographic history of barbels belonging to the Luciobarbus pallaryi (Cyprinidae) species in the Guir Basin (Algeria). In this context, two populations, from two distinct and isolated sites, were studied. Analysis of the cytochrome b (cyt b) mitochondrial markers and of the "D-loop" control region has shown that the "upstream" and "downstream" Guir populations are genetically differentiated. The molecular analyses suggest that the upstream population was disconnected from this hydrographic system during the Saalian glaciation period of the Quaternary. Subsequently, it was isolated in the foggaras underground waters in the Great Western Erg, at approximately 320 000 years BP, creating, through a bottleneck effect, a new allopatric lineage referred to as "Adrar". Conversely, the high genetic diversity in the upstream Guir (Bechar) population suggests that the stock is globally in expansion. These barbels (n=52) were also examined with meristic, morphometric, osteological, and biological features. These data also reveal a complete discrimination between the two populations, with a remarkable and distinctive behavioural adaptation for the Adrar specimens: neoteny. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

The external amino acid signaling pathway promotes activation of Stp1 and Uga35/Dal81 transcription factors for induction of the AGP1 gene in Saccharomyces cerevisiae.

PubMed Central

Abdel-Sater, Fadi; Iraqui, Ismaïl; Urrestarazu, Antonio; André, Bruno

2004-01-01

Yeast cells respond to the presence of amino acids in their environment by inducing transcription of several amino acid permease genes including AGP1, BAP2, and BAP3. The signaling pathway responsible for this induction involves Ssy1, a permease-like sensor of external amino acids, and culminates with proteolytic cleavage and translocation to the nucleus of the zinc-finger proteins Stp1 and Stp2, the lack of which abolishes induction of BAP2 and BAP3. Here we show that Stp1-but not Stp2-plays an important role in AGP1 induction, although significant induction of AGP1 by amino acids persists in stp1 and stp1 stp2 mutants. This residual induction depends on the Uga35/Dal81 transcription factor, indicating that the external amino acid signaling pathway activates not only Stp1 and Stp2, but also another Uga35/Dal81-dependent transcriptional circuit. Analysis of the AGP1 gene's upstream region revealed that Stp1 and Uga35/Dal81 act synergistically through a 21-bp cis-acting sequence similar to the UAS(AA) element previously found in the BAP2 and BAP3 upstream regions. Although cells growing under poor nitrogen-supply conditions display much higher induction of AGP1 expression than cells growing under good nitrogen-supply conditions, the UAS(AA) itself is totally insensitive to nitrogen availability. Nitrogen-source control of AGP1 induction is mediated by the GATA factor Gln3, likely acting through adjacent 5'-GATA-3' sequences, to amplify the positive effect of UAS(AA). Our data indicate that Stp1 may act in combination with distinct sets of transcription factors, according to the gene context, to promote induction of transcription in response to external amino acids. The data also suggest that Uga35/Dal81 is yet another transcription factor under the control of the external amino acid sensing pathway. Finally, the data show that the TOR pathway mediating global nitrogen control of transcription does not interfere with the external amino acid signaling pathway. PMID:15126393

Electrically heated particulate filter enhanced ignition strategy

DOEpatents

Gonze, Eugene V; Paratore, Jr., Michael J

2012-10-23

An exhaust system that processes exhaust generated by an engine is provided. The system generally includes a particulate filter (PF) that filters particulates from the exhaust wherein an upstream end of the PF receives exhaust from the engine. A grid of electrically resistive material is applied to an exterior upstream surface of the PF and selectively heats exhaust passing through the grid to initiate combustion of particulates within the PF. A catalyst coating applied to at least one of the PF and the grid. A control module estimates a temperature of the grid and controls the engine to produce a desired exhaust product to increase the temperature of the grid.

Simulation Comparison of Wake Mitigation Control Strategies for a Two-Turbine Case

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fleming, Paul; Gebraad, Pieter M. O.; Lee, Sang

2015-12-01

Wind turbines arranged in a wind plant impact each other through their wakes. Wind plant control is an active research field that attempts to improve wind plant performance by coordinating control of individual turbines to take into account these turbine–wake interactions. High-fidelity simulations of a two-turbine fully waked scenario are used to investigate several wake mitigation strategies, in this paper, including modification of yaw and tilt angles of an upstream turbine to induce wake skew, as well as repositioning of the downstream turbine. The simulation results are compared through change relative to a baseline operation in terms of overall powermore » capture and loading on the upstream and downstream turbine. Results demonstrated improved power production for all methods. Moreover, analysis of control options, including individual pitch control, shows potential to minimize the increase of, or even reduce, turbine loads.« less

Rankine cycle condenser pressure control using an energy conversion device bypass valve

DOEpatents

Ernst, Timothy C; Nelson, Christopher R; Zigan, James A

2014-04-01

The disclosure provides a waste heat recovery system and method in which pressure in a Rankine cycle (RC) system of the WHR system is regulated by diverting working fluid from entering an inlet of an energy conversion device of the RC system. In the system, an inlet of a controllable bypass valve is fluidly coupled to a working fluid path upstream of an energy conversion device of the RC system, and an outlet of the bypass valve is fluidly coupled to the working fluid path upstream of the condenser of the RC system such that working fluid passing through the bypass valve bypasses the energy conversion device and increases the pressure in a condenser. A controller determines the temperature and pressure of the working fluid and controls the bypass valve to regulate pressure in the condenser.

Local and Cumulative Impervious Cover of Massachusetts Stream Basins

USGS Publications Warehouse

Brandt, Sara L.; Steeves, Peter A.

2009-01-01

Impervious surfaces such as paved roads, parking lots, and building roofs can affect the natural streamflow patterns and ecosystems of nearby streams. This dataset summarizes the percentage of impervious area for watersheds across Massachusetts by using a newly available statewide 1-m binary raster dataset of impervious surface for 2005. In order to accurately capture the wide spatial variability of impervious surface, it was necessary to delineate a new set of finely discretized basin boundaries for Massachusetts. This new set of basins was delineated at a scale finer than that of the existing 12-digit Hydrologic Unit Code basins (HUC-12s) of the national Watershed Boundary Dataset. The dataset consists of three GIS shapefiles. The Massachusetts nested subbasins and the hydrologic units data layers consist of topographically delineated boundaries and their associated percentage of impervious cover for all of Massachusetts except Cape Cod, the Islands, and the Plymouth-Carver region. The Massachusetts groundwater-contributing areas data layer consists of groundwater contributing-area boundaries for streams and coastal areas of Cape Cod and the Plymouth-Carver region. These boundaries were delineated by using groundwater-flow models previously published by the U.S. Geological Survey. Subbasin and hydrologic unit boundaries were delineated statewide with the exception of Cape Cod and the Plymouth-Carver Region. For the purpose of this study, a subbasin is defined as the entire drainage area upstream of an outlet point. Subbasins draining to multiple outlet points on the same stream are nested. That is, a large downstream subbasin polygon comprises all of the smaller upstream subbasin polygons. A hydrologic unit is the intervening drainage area between a given outlet point and the outlet point of the next upstream unit (Fig. 1). Hydrologic units divide subbasins into discrete, nonoverlapping areas. Each hydrologic unit corresponds to a subbasin delineated from the same outlet point; the hydrologic unit and the subbasin share the same unique identifier attribute. Because the same set of outlet points was used for the delineation of subbasins and hydrologic units, the linework for both data layers is identical; however, polygon attributes differ because for a given outlet point, the subbasin polygon area is the sum of all the upstream hydrologic units. Impervious surface summarized for a subbasin represents the percentage of impervious surface area of the entire upstream watershed, whereas the impervious surface for a hydrologic unit represents the percentage of impervious surface area for the intervening drainage area between two outlet points.

Improving upstream transmission performance using a receiver with decision threshold level adjustment in a loopback WDM-PON

NASA Astrophysics Data System (ADS)

Cho, Seung-Hyun; Lee, Sang-Soo; Shin, Dong-Wook

2010-06-01

We have experimentally demonstrated that the use of an optical receiver with decision threshold level adjustment (DTLA) improved the performance of an upstream transmission in reflective semiconductor optical amplifier (RSOA)-based loopback wavelength division multiplexing-passive optical network (WDM-PON). Even though the extinction ratio (ER) of the downstream signal was as much as 9 dB and the injection power into the RSOA at the optical network unit was about -24 dBm, we successfully obtained error-free transmission results for the upstream signal through careful control of the decision threshold value in the optical receiver located at optical line terminal (OLT). Using an optical receiver with DTLA for upstream signal detection overcame significant obstacles related to the injection power into the RSOA and the ER of the downstream signal, which were previously considered limitations of the wavelength remodulation scheme. This technique is expected to provide flexibility for the optical link design in the practical deployment of a WDM-PON.

Channel adjustments in a Mediterranean river over the last 150 years in the context of anthropic and natural controls

NASA Astrophysics Data System (ADS)

Scorpio, Vittoria; Rosskopf, Carmen M.

2016-12-01

Evolutionary trajectories and related control factors of the Fortore River (southern Italy) are analyzed over a 150-year period as to assess channel modifications. A multitemporal GIS analysis of topographic maps and aerial photographs together with topographic and geomorphological field surveys were performed. Attention was focused on the impact caused by human disturbance, above all the presence of the Occhito dam at only 40 km upstream of the Fortore mouth (central Adriatic coast). Results show that channel adjustments occurred in three distinct phases and were primarily driven by human disturbance that diversely affected reaches located upstream and downstream of the dam. From the last decades of the nineteenth century to the 1950s (phase 1), channel widening prevailed along upstream reaches whilst narrowing along downstream reaches. Major channel adjustments occurred from the 1950s until the end of the 1990s (phase 2), especially channel narrowing of up to 81% in upstream reaches and 98% in downstream reaches. Narrowing was accompanied by channel-bed lowering of 1 to 5 m and by pattern changes in prevalence from multithread to largely prevailing single-thread channel configurations. In-channel mining, channel works, and hydraulic interventions are considered key driving factors of observed channel adjustments. The closure of the Occhito dam in 1966 had significant and permanent effects on downstream reaches through overall discharge regulation and permanent sediment trapping as also proved by the progressive retreat of the Fortore river mouth area. From 2000 to 2015 (phase 3), a substantial trend inversion was observed with overall channel widening and partial aggradation of upstream reaches and total stabilization of downstream reaches. As highlighted by an integrated multitemporal analysis of recent channel changes and flood events, the latter have played an important role in channel recovery of upstream reaches. Comparison between the Fortore River and other rivers in southern Italy has allowed us to ascertain that the reconstructed evolutionary trajectories are quite similar and that control factors are essentially the same. In particular, it confirms the role of major hydraulic structures as to the amount of channel adjustments of downstream reaches and the ensuing scarce to nil potential to channel recovery of regulated reaches.

Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

PubMed Central

Zheng, Zhaoqing; Keifer, Joyce

2014-01-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

A dual switch controls bacterial enhancer-dependent transcription

PubMed Central

Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

2012-01-01

Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

A study of the solar wind deceleration in the Earth's foreshock region

NASA Technical Reports Server (NTRS)

Zhang, T.-L.; Schwingenschuh, K.; Russell, C. T.

1995-01-01

Previous observations have shown that the solar wind is decelerated and deflected in the earth's upstream region populated by long-period waves. This deceleration is corelated with the 'diffuse' but not with the 'reflected' ion population. The speed of the solar wind may decrease tens of km/s in the foreshock region. The solar wind dynamic pressure exerted on the magnetopause may vary due to the fluctuation of the solar wind speed and density in the foreshock region. In this study, we examine this solar wind deceleration and determine how the solar wind deceleration varies in the foreshock region.

Asymmetric Magnetic Reconnection in the Solar Atmosphere

NASA Astrophysics Data System (ADS)

Murphy, N. A.; Miralles, M. P.; Ranquist, D. A.; Pope, C. L.; Raymond, J. C.; Lukin, V. S.; McKillop, S.; Shen, C.; Winter, H. D.; Reeves, K. K.; Lin, J.

2013-12-01

Models of solar flares and coronal mass ejections typically predict the development of an elongated current sheet in the wake behind the rising flux rope. In reality, reconnection in these current sheets will be asymmetric along the inflow, outflow, and out-of-plane directions. We perform resistive MHD simulations to investigate the consequences of asymmetry during solar reconnection. We predict several observational signatures of asymmetric reconnection, including flare loops with a skewed candle flame shape, slow drifting of the current sheet into the strong field upstream region, asymmetric footpoint speeds and hard X-ray emission, and rolling motions within the erupting flux rope. There is net plasma flow across the magnetic field null along both the inflow and outflow directions. We compare simulations to SDO/AIA, Hinode/XRT, and STEREO observations of flare loop shapes, current sheet drifting, and rolling motions during prominence eruptions. Simulations of the plasmoid instability with different upstream magnetic fields show that the reconnection rate remains enhanced even during the asymmetric case. The islands preferentially grow into the weak field upstream region. The islands develop net vorticity because the outflow jets impact them obliquely rather than directly. Asymmetric reconnection in the chromosphere occurs when emerging flux interacts with pre-existing overlying flux. We present initial results on asymmetric reconnection in partially ionized chromospheric plasmas. Finally, we discuss how comparisons to observations are necessary to understand the role of three-dimensional effects.

Asymmetric Magnetic Reconnection in the Solar Atmosphere

NASA Astrophysics Data System (ADS)

Murphy, N. A.; Miralles, M. P.; Ranquist, D. A.; Pope, C. L.; Raymond, J. C.; Lukin, V. S.; McKillop, S. C.; Shen, C.; Winter, H. D.; Reeves, K. K.; Lin, J.

2013-12-01

Models of solar flares and coronal mass ejections typically predict the development of an elongated current sheet in the wake behind the rising flux rope. In reality, reconnection in these current sheets will be asymmetric along the inflow, outflow, and out-of-plane directions. We perform resistive MHD simulations to investigate the consequences of asymmetry during solar reconnection. We predict several observational signatures of asymmetric reconnection, including flare loops with a skewed candle flame shape, slow drifting of the current sheet into the strong field upstream region, asymmetric footpoint speeds and hard X-ray emission, and rolling motions within the erupting flux rope. There is net plasma flow across the magnetic field null along both the inflow and outflow directions. We compare simulations to SDO/AIA, Hinode/XRT, and STEREO observations of flare loop shapes, current sheet drifting, and rolling motions during prominence eruptions. Simulations of the plasm! oid instability with different upstream magnetic fields show that the reconnection rate remains enhanced even during the asymmetric case. The islands preferentially grow into the weak field upstream region. The islands develop net vorticity because the outflow jets impact them obliquely rather than directly. Asymmetric reconnection in the chromosphere occurs when emerging flux interacts with pre-existing overlying flux. We present initial results on asymmetric reconnection in partially ionized chromospheric plasmas. Finally, we discuss how comparisons to observations are necessary to understand the role of three-dimensional effects.

Ascent of neotropical migratory fish in the Itaipu Reservoir fish pass

USGS Publications Warehouse

Makrakis, S.; Miranda, L.E.; Gomes, L.C.; Makrakis, M.C.; Junior, H.M.F.

2011-01-01

The Piracema Canal is a complex 10-km fish pass system that climbs 120m to connect the Paran?? River to the Itaipu Reservoir along the Brazil-Paraguay border. The canal was constructed to allow migratory fishes to reach suitable habitats for reproduction and feeding in tributaries upstream from the reservoir. The Piracema Canal attracted 17 of the 19 long-distance migratory species that have been recorded in the Paran?? River Basin and Paraguay-Paran?? Basin. However, the incidence of migratory fish decreased from downstream to upstream, with the pattern of decrease depending on species. Overall, 0.5% of the migratory fish that entered the Piracema Canal and segment 1, eventually were able to reach segment 5 and potentially Itaipu Reservoir. Ascension rate was examined relative to various physical attributes of canal segments; maximum water velocity emerged as the most influential variable affecting fish passage. Water velocity may be manipulated by controlling water discharge, and by re-engineering critical sections of the canal. Because the Itaipu Reservoir flooded a set of falls that separated two distinct biogeographical regions, facilitating fish movements through the Piracema Canal into the Itaipu Reservoir presents a management dilemma that requires deliberation in the context of the fish assemblages rather than on selected migratory species. ?? 2010 John Wiley & Sons, Ltd.

Distributional Impacts of Large Dams in China

NASA Astrophysics Data System (ADS)

Bao, X.

2010-12-01

Dams on a river are believed to have heterogeneous impacts to the upstream, local and downstream areas. Generally, irrigation dams will bring benefits to the downstream by facilitating more irrigation, while it will bring negative impacts to upstream due to inundation or no impact to local area as a combination result of population dislocation and economic benefits. This paper checked the impacts of large dams (above 100 meters) on the upstream, downstream and local area, using 2000-2008 county level data in China. Robust heterogeneous impacts of different categories of dams (mainly dams serving for irrigation, hydropower, or other purposes) were found on different areas, using IV regression approaches. Dams higher than 100 meters are significantly and heterogeneously impacting agricultural production, urban employment and rural per capita income. Its beneficial impact on agriculture production is significant for downstream especially in continuous drought years. But its impacts on social welfare indicators, such as primary school enrollment and hospital beds, are not heterogeneously different across regions.

Method for creating an aeronautic sound shield having gas distributors arranged on the engines, wings, and nose of an aircraft

NASA Technical Reports Server (NTRS)

Corda, Stephen (Inventor); Smith, Mark Stephen (Inventor); Myre, David Daniel (Inventor)

2008-01-01

The present invention blocks and/or attenuates the upstream travel of acoustic disturbances or sound waves from a flight vehicle or components of a flight vehicle traveling at subsonic speed using a local injection of a high molecular weight gas. Additional benefit may also be obtained by lowering the temperature of the gas. Preferably, the invention has a means of distributing the high molecular weight gas from the nose, wing, component, or other structure of the flight vehicle into the upstream or surrounding air flow. Two techniques for distribution are direct gas injection and sublimation of the high molecular weight solid material from the vehicle surface. The high molecular weight and low temperature of the gas significantly decreases the local speed of sound such that a localized region of supersonic flow and possibly shock waves are formed, preventing the upstream travel of sound waves from the flight vehicle.

Shock-turbulence interaction in core-collapse supernovae

NASA Astrophysics Data System (ADS)

Abdikamalov, Ernazar; Zhaksylykov, Azamat; Radice, David; Berdibek, Shapagat

2016-10-01

Nuclear shell burning in the final stages of the lives of massive stars is accompanied by strong turbulent convection. The resulting fluctuations aid supernova explosion by amplifying the non-radial flow in the post-shock region. In this work, we investigate the physical mechanism behind this amplification using a linear perturbation theory. We model the shock wave as a one-dimensional planar discontinuity and consider its interaction with vorticity and entropy perturbations in the upstream flow. We find that, as the perturbations cross the shock, their total turbulent kinetic energy is amplified by a factor of ˜2, while the average linear size of turbulent eddies decreases by about the same factor. These values are not sensitive to the parameters of the upstream turbulence and the nuclear dissociation efficiency at the shock. Finally, we discuss the implication of our results for the supernova explosion mechanism. We show that the upstream perturbations can decrease the critical neutrino luminosity for producing explosion by several per cent.

Optimal frequency-response sensitivity of compressible flow over roughness elements

NASA Astrophysics Data System (ADS)

Fosas de Pando, Miguel; Schmid, Peter J.

2017-04-01

Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

Passive propulsion in vortex wakes

NASA Astrophysics Data System (ADS)

Beal, D. N.; Hover, F. S.; Triantafyllou, M. S.; Liao, J. C.; Lauder, G. V.

A dead fish is propelled upstream when its flexible body resonates with oncoming vortices formed in the wake of a bluff cylinder, despite being well outside the suction region of the cylinder. Within this passive propulsion mode, the body of the fish extracts sufficient energy from the oncoming vortices to develop thrust to overcome its own drag. In a similar turbulent wake and at roughly the same distance behind a bluff cylinder, a passively mounted high-aspect-ratio foil is also shown to propel itself upstream employing a similar flow energy extraction mechanism. In this case, mechanical energy is extracted from the flow at the same time that thrust is produced. These results prove experimentally that, under proper conditions, a body can follow at a distance or even catch up to another upstream body without expending any energy of its own. This observation is also significant in the development of low-drag energy harvesting devices, and in the energetics of fish dwelling in flowing water and swimming behind wake-forming obstacles.

A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria

PubMed Central

Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.

2013-01-01

The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

Advancing Understanding of Emissions from Oil and Natural ...

EPA Pesticide Factsheets

Executive Summary Environmentally responsible development of oil and gas assets requires well-developed emissions inventories and measurement techniques to verify emissions and the effectiveness of control strategies. To accurately model the oil and gas sector impacts on air quality, it is critical to have accurate activity data, emission factors and chemical speciation profiles for volatile organic compounds (VOCs) and nitrogen oxides (NOx). This report describes a U.S. Environmental Protection Agency (EPA) Office of Research and Development (ORD) Region 8 Regional Applied Research Effort (RARE) effort executed in Fiscal Year (FY) 2014 to FY 2016 that aimed to improve information on upstream oil and production emissions and identify areas where future work is needed. The project involved both field activities and data analysis and synthesis work with emphasis on product-related VOC emissions from well pads. In oil and gas basins with significant condensate and oil production, VOC emissions from well pads primarily arise from the separation of gas and liquid products and the storage process, with the control of emissions usually accomplished by enclosed combustion devices (ECDs), such as flares. Fugitive emissions of VOCs can originate from leaks and from potentially ineffective control systems. In the case of ECDs, byproducts of incomplete combustion may produce more highly reactive ozone precursor species. For both compliance and scientific purposes, the abili

Hydrochemical processes regulating groundwater quality in the coastal plain of Al Musanaah, Sultanate of Oman

NASA Astrophysics Data System (ADS)

Askri, Brahim

2015-06-01

The Al Batinah coastal aquifer is the principal source of water in northwestern Oman. The rainfall in the Jabal Al Akhdar mountain region recharges the plain with freshwater that allowed agricultural and industrial activities to develop. The over-exploitation of this aquifer since the 1970s for municipal, agricultural and industrial purposes, excessive use of fertilizers in agriculture and leakage from septic tanks led to the deterioration of groundwater quality. The objective of this study was to investigate the hydrochemical processes regulating the groundwater quality in the southwestern section of Al Batinah. From available data collected during the spring of 2010 from 58 wells located in Al Musanaah wilayat, it was determined that the groundwater salinity increased in the direction from the south to the north following the regional flow direction. In addition to salinisation, the groundwater in the upstream and intermediate regions was contaminated with nitrate, while groundwater in the downstream region was affected by fluoride. Calculations of ionic ratios and seawater fraction indicated that seawater intrusion was not dominant in the study area. The primary factors controlling the groundwater chemistry in Al Musanaah appear to be halite dissolution, reverse ion exchange with clay material and anthropogenic pollutants.

Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

PubMed Central

Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

2000-01-01

The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression.

PubMed

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-03-07

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on-off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis.

The economic benefits of vegetation in the upstream area of Ciliwung watershed

NASA Astrophysics Data System (ADS)

Saridewi, T. R.; Nazaruddin

2018-04-01

Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

The Transcription Factors TBX2 and TBX3 Interact with Human Papillomavirus 16 (HPV16) L2 and Repress the Long Control Region of HPVs

PubMed Central

Schneider, Marc A.; Scheffer, Konstanze D.; Bund, Timo; Boukhallouk, Fatima; Lambert, Carsten; Cotarelo, Cristina; Pflugfelder, Gert O.

2013-01-01

The minor capsid protein L2 of human papillomaviruses (HPVs) has multiple functions during the viral life cycle. Although L2 is required for effective invasion and morphogenesis, only a few cellular interaction partners are known so far. Using yeast two-hybrid screening, we identified the transcription factor TBX2 as a novel interaction partner of HPV type 16 (HPV16) L2. Coimmunoprecipitations and immunofluorescence analyses confirmed the L2-TBX2 interaction and revealed that L2 also interacts with TBX3, another member of the T-box family. Transcription of the early genes during HPV infection is under the control of an upstream enhancer and early promoter region, the long control region (LCR). In promoter-reporter gene assays, we observed that TBX2 and TBX3 repress transcription from the LCR and that this effect is enhanced by L2. Repression of the HPV LCR by TBX2/3 seems to be a conserved mechanism, as it was also observed with the LCRs of different HPV types. Finally, interaction of TBX2 with the LCR was detected by chromatin immunoprecipitation, and we found a strong colocalization of L2 and TBX2 in HPV16-positive cervical intraepithelial neoplasia (CIN) I-II tissue sections. These results suggest that TBX2/3 might play a role in the regulation of HPV gene expression during the viral life cycle. PMID:23388722

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

PubMed Central

Haut, Donald D.; Pintel, D. J.

1998-01-01

Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.

PubMed Central

L'Homme, Y; Brown, G G

1993-01-01

Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Characterization of Cer-1 cis-regulatory region during early Xenopus development.

PubMed

Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

2011-05-01

Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

Present-day palynomorph deposits in an estuarine context: The case of the Loire Estuary

NASA Astrophysics Data System (ADS)

Ganne, A.; Leroyer, C.; Penaud, A.; Mojtahid, M.

2016-12-01

Estuaries are dynamic systems that collect terrestrial, aerial, fluvial, and marine inputs, including organic microfossils, which, when fossilized and observed on palynological slides, are also referred to as palynomorphs (pollen and non-pollen palynomorphs including dinoflagellate cysts or dinocysts). To understand these organic microfossil deposit arrangements across the Loire estuary, palynomorph counts were undertaken in 31 surface sediments collected across longitudinal and perpendicular transects of the Loire active riverbed, from the upper inner estuary to the river mouth. Main results suggest a large homogeneity of the pollen content throughout the entire upstream-downstream transect, with a dominance of arboreal taxa (Pinus, Quercus, Alnus) and Poaceae. Also, perpendicular transects across the channel show a great similarity between the muddy surface layers and the underlying consolidated clay layers. This is probably due to: i) homogeneity of the landscape at a regional scale (large catchment area of the Loire River), and ii) complex hydrodynamic processes involving strong mixing of the palynological signal. Furthermore, despite scarce woodlands in the regional landscape, arboreal pollen (especially Pinus and Quercus) represents > 60% of the total pollen percentages. This could be explained by several factors: i) generally higher arboreal pollen production and dispersion as compared to herbaceous taxa, ii) distant inputs from marine areas downstream and/or forested regions far upstream, and iii) differential selection or inheritance from underlying sediments. Differentiation between the outer and inner estuarine environments was furthermore possible using a ratio of terrestrial versus marine palynological indicators. Among the dinocyst assemblages (marine realm), the euryhaline species Lingulodinium machaerophorum predominates; this taxon being very sensitive to strong water column stratification. Also, total dinocyst concentration increased upstream, which may result from the tidal forcing pushing salinity upriver beneath outflowing river water, and thus signing the estuarine turbidity maximum influence within the Loire River.

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Are catchment-wide erosion rates really "Catchment-Wide"? Effects of grain size on erosion rates determined from 10Be

NASA Astrophysics Data System (ADS)

Reitz, M. A.; Seeber, L.; Schaefer, J. M.; Ferguson, E. K.

2012-12-01

Early studies pioneering the method for catchment wide erosion rates by measuring 10Be in alluvial sediment were taken at river mouths and used the sand size grain fraction from the riverbeds in order to average upstream erosion rates and measure erosion patterns. Finer particles (<0.0625 mm) were excluded to reduce the possibility of a wind-blown component of sediment and coarser particles (>2 mm) were excluded to better approximate erosion from the entire upstream catchment area (coarse grains are generally found near the source). Now that the sensitivity of 10Be measurements is rapidly increasing, we can precisely measure erosion rates from rivers eroding active tectonic regions. These active regions create higher energy drainage systems that erode faster and carry coarser sediment. In these settings, does the sand-sized fraction fully capture the average erosion of the upstream drainage area? Or does a different grain size fraction provide a more accurate measure of upstream erosion? During a study of the Neto River in Calabria, southern Italy, we took 8 samples along the length of the river, focusing on collecting samples just below confluences with major tributaries, in order to use the high-resolution erosion rate data to constrain tectonic motion. The samples we measured were sieved to either a 0.125 mm - 0.710 mm fraction or the 0.125 mm - 4 mm fraction (depending on how much of the former was available). After measuring these 8 samples for 10Be and determining erosion rates, we used the approach by Granger et al. [1996] to calculate the subcatchment erosion rates between each sample point. In the subcatchments of the river where we used grain sizes up to 4 mm, we measured very low 10Be concentrations (corresponding to high erosion rates) and calculated nonsensical subcatchment erosion rates (i.e. negative rates). We, therefore, hypothesize that the coarser grain sizes we included are preferentially sampling a smaller upstream area, and not the entire upstream catchment, which is assumed when measurements are based solely on the sand sized fraction. To test this hypothesis, we used samples with a variety of grain sizes from the Shillong Plateau. We sieved 5 samples into three grain size fractions: 0.125 mm - 710 mm, 710 mm - 4 mm, and >4 mm and measured 10Be concentrations in each fraction. Although there is some variation in the grain size fraction that yields the highest erosion rate, generally, the coarser grain size fractions have higher erosion rates. More significant are the results when calculating the subcatchment erosion rates, which suggest that even medium sized grains (710 mm - 4 mm) are sampling an area smaller than the entire upstream area; this finding is consistent with the nonsensical results from the Neto River study. This result has numerous implications for the interpretations of 10Be erosion rates: most importantly, an alluvial sample may not be averaging the entire upstream area, even when using the sand size fraction - resulting erosion rates more pertinent for that sample point rather than the entire catchment.

Field Observations and Modeling Results of the McMurdo Shear Zone, Antarctica: Implications on Shear Margin Dynamics and Long- Term Viability of the South Pole Traverse

NASA Astrophysics Data System (ADS)

Kaluzienski, L. M.; Koons, P. O.; Enderlin, E. M.; Courville, Z.; Campbell, S. W.; Arcone, S.; Jordan, M.; Ray, L.

2017-12-01

Antarctica's ice shelves modulate the flow of inland ice towards the ocean. Understanding the controls on ice-shelf stability are critical to predicting the future evolution of the Antarctic Ice Sheet. For the Ross Ice Shelf (RIS), an important region of lateral resistance is the McMurdo Shear Zone (MSZ), a 5-10 km wide strip of heavily crevassed ice. On a yearly basis the United States Antarctic Program (USAP) mitigates crevasse hazards along the South Pole Traverse (SPoT) route that crosses this region. However, as ice advects northward past the lateral buttress of White Island into a region of greater flow divergence, intensified crevassing has been observed which will continue to place a substantial burden on safety mitigation efforts. The route has advected down-glacier towards this complex region since 2002 so the USAP currently has plans to relocate the shear zone crossing upstream in the near future. Our work aims to assess the feasibility of moving the route to several potential locations based on results from an integrated project incorporating detailed field-based observations of crevasse distributions and orientation from ground-penetrating radar (GPR), GPS and remote sensing observations of the flow and stress field within the MSZ, and finite element numerical modeling of local and regional kinematics within the region. In addition, we assess plausible dynamic forcings both upstream and downstream of the MSZ that could influence shear zone stability. These include changes in mass flux across the grounding lines of tributary glaciers such as the observed increase in ice discharge from of Byrd Glacier (Stearns et al., 2008) as well as changes at the MIS front due to recent intensified rift propagation (Banwel et al., 2017). Results from this work will increase our understanding of ice shelf shear margin dynamics and provide a firm basis for predicting the long-term behavior of the MSZ and viability of the SPoT. Stearns, Leigh A., Benjamin E. Smith, and Gordon S. Hamilton. "Increased flow speed on a large East Antarctic outlet glacier caused by subglacial floods." Nature Geoscience 1.12 (2008): 827. Banwell, Alison F., et al. "Calving and rifting on the McMurdo Ice Shelf, Antarctica." Annals of Glaciology (2017): 1-10.

A study on the influence of different promoter and 5'UTR (URM) cassettes from Arabidopsis thaliana on the expression level of the reporter gene β glucuronidase in tobacco and cotton.

PubMed

Agarwal, Parul; Garg, Varsha; Gautam, Taru; Pillai, Beena; Kanoria, Shaveta; Burma, Pradeep Kumar

2014-04-01

Several reports of promoters from plants, viral and artificial origin that confer high constitutive expression are known. Among these the CaMV 35S promoter is used extensively for transgene expression in plants. We identified candidate promoters from Arabidopsis based on their transcript levels (meta-analysis of available microarray control datasets) to test their activity in comparison to the CaMV 35S promoter. A set of 11 candidate genes were identified which showed high transcript levels in the aerial tissue (i.e. leaf, shoot, flower and stem). In the initial part of the study binary vectors were developed wherein the promoter and 5'UTR region of these candidate genes (Upstream Regulatory Module, URM) were cloned upstream to the reporter gene β glucuronidase (gus). The promoter strengths were tested in transformed callus of Nicotiana tabacum and Gossypium hirsutum. On the basis of the results obtained from the callus, the influence of the URM cassettes on transgene expression was tested in transgenic tobacco. The URM regions of the genes encoding a subunit of photosystem I (PHOTO) and geranyl geranyl reductase (GGR) in A. thaliana genome showed significantly high levels of GUS activity in comparison to the CaMV 35S promoter. Further, when the 5'UTRs of both the genes were placed downstream to the CaMV 35S promoter it led to a substantial increase in GUS activity in transgenic tobacco lines and cotton callus. The enhancement observed was even higher to that observed with the viral leader sequences like Ω and AMV, known translational enhancers. Our results indicate that the two URM cassettes or the 5'UTR regions of PHOTO and GGR when placed downstream to the CaMV 35S promoter can be used to drive high levels of transgene expression in dicotyledons.

Active Heat Injection to Investigate Seepage Conditions Along the Interface Between a Concrete Diversion Sluiceway and Earthen Embankment Dam

NASA Astrophysics Data System (ADS)

Ringeri, A.; Butler, K. E.; MacQuarrie, K. T. B.

2016-12-01

The interface between embankment dams and adjoining hydraulic structures are regions which can give rise to seepage defects. A field experiment was conducted at the Mactaquac Generating Station in New Brunswick, Canada using active thermometry to investigate seepage conditions along the interface of a diversion sluiceway and earth embankment. The method involved monitoring the time evolution of temperature following the injection of a controlled heat pulse from a subsurface heat cable acting as a line source. Transient anomalies in the induced temperature field can result from the aberration of thermal properties and flow conditions which accompany defects. An industrial heat trace cable and distributed temperature sensing (DTS) fibre optic cable were installed in two parallel, 42 m deep, sub-vertical boreholes separated by 3 m and offset 0.5 m from the core-concrete interface. The heat and DTS cables were installed in the upstream and downstream boreholes respectively. Heat was injected as a box car function at a constant rate of 78.72 W/m for 51 d while the DTS cable, with a 20 cm sampling resolution, was averaged over 10 min at 30 min intervals for 300 d. The DTS cable successfully detected temperature changes induced by the upstream heat pulse. A coherent temperature response occurred along a 13 m section of deep fibre, where mean peak temperatures rose 1.59 ± 0.03 °C above ambient temperatures with an average time lag of 8.2 d following the end of the heating cycle. Two temperature anomalies above this region coincided with the position of the water table and the location of a previously detected fibre break. The method appears to be particularly useful in seepage surveillance of the deeper regions of the interface. Further analysis is required to remove the influence of seasonal temperatures on the heat pulse response at shallow depths.

Realtime speckle sensing and suppression with project 1640 at Palomar

NASA Astrophysics Data System (ADS)

Vasisht, Gautam; Cady, Eric; Zhai, Chengxing; Lockhart, Thomas; Oppenheimer, Ben

2014-08-01

Palomar's Project 1640 (P1640) is the first stellar coronagraph to regularly use active coronagraphic wavefront control (CWFC). For this it has a hierarchy of offset wavefront sensors (WFS), the most important of which is the higher-order WFS (called CAL), which tracks quasi-static modes between 2-35 cycles-per-aperture. The wavefront is measured in the coronagraph at 0.01 Hz rates, providing slope targets to the upstream Palm 3000 adaptive optics (AO) system. The CWFC handles all non-common path distortions up to the coronagraphic focal plane mask, but does not sense second order modes between the WFSs and the science integral field unit (IFU); these modes determine the system's current limit. We have two CWFC operating modes: (1) P-mode, where we only control phases, generating double-sided darkholes by correcting to the largest controllable spatial frequencies, and (2) E-mode, where we can control amplitudes and phases, generating single-sided dark-holes in specified regions-of-interest. We describe the performance and limitations of both these modes, and discuss the improvements we are considering going forward.

A small RNA activates CFA synthase by isoform-specific mRNA stabilization

PubMed Central

Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg

2013-01-01

Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5′ end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5′ untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability. PMID:24141880

A small RNA activates CFA synthase by isoform-specific mRNA stabilization.

PubMed

Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg

2013-11-13

Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.

Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.

PubMed

Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K

1989-01-01

The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.

Orientation and navigation relative to water flow, prey, conspecifics, and predators by the nudibranch mollusc Tritonia diomedea.

PubMed

Wyeth, Russell C; Woodward, Owen M; Willows, A O Dennis

2006-04-01

Progress in understanding sensory and locomotory systems in Tritonia diomedea has created the potential for the neuroethological study of animal navigation in this species. Our goal is to describe the navigational behaviors to guide further work on how the nervous system integrates information from multiple senses to produce oriented locomotion. Observation of T. diomedea in its habitat has suggested that it uses water flow to navigate relative to prey, predators, and conspecifics. We test these hypotheses in the field by comparing slug orientation in time-lapse videos to flow direction in circumstances with and without prey, predators, or conspecifics upstream. T. diomedea oriented upstream both while crawling and after turning. This trend was strongest before feeding or mating; after feeding or mating, the slugs did not orient significantly to flow. Slugs turned downstream away from an upstream predator but did not react in control situations without an upstream predator. These data support the hypothesis that T. diomedea uses a combination of odors (or some other cue transported downstream) and water flow to navigate relative to prey, predators, and conspecifics. Understanding the context-dependent choice between upstream and downstream crawling in T. diomedea provides an opportunity for further work on the sensory integration underlying navigation behavior.

Recent dynamic changes on Fleming Glacier after the disintegration of Wordie Ice Shelf, Antarctic Peninsula

NASA Astrophysics Data System (ADS)

Friedl, Peter; Seehaus, Thorsten C.; Wendt, Anja; Braun, Matthias H.; Höppner, Kathrin

2018-04-01

The Antarctic Peninsula is one of the world's regions most affected by climate change. Several ice shelves have retreated, thinned or completely disintegrated during recent decades, leading to acceleration and increased calving of their tributary glaciers. Wordie Ice Shelf, located in Marguerite Bay at the south-western side of the Antarctic Peninsula, completely disintegrated in a series of events between the 1960s and the late 1990s. We investigate the long-term dynamics (1994-2016) of Fleming Glacier after the disintegration of Wordie Ice Shelf by analysing various multi-sensor remote sensing data sets. We present a dense time series of synthetic aperture radar (SAR) surface velocities that reveals a rapid acceleration of Fleming Glacier in 2008 and a phase of further gradual acceleration and upstream propagation of high velocities in 2010-2011.The timing in acceleration correlates with strong upwelling events of warm circumpolar deep water (CDW) into Wordie Bay, most likely leading to increased submarine melt. This, together with continuous dynamic thinning and a deep subglacial trough with a retrograde bed slope close to the terminus probably, has induced unpinning of the glacier tongue in 2008 and gradual grounding line retreat between 2010 and 2011. Our data suggest that the glacier's grounding line had retreated by ˜ 6-9 km between 1996 and 2011, which caused ˜ 56 km2 of the glacier tongue to go afloat. The resulting reduction in buttressing explains a median speedup of ˜ 1.3 m d-1 ( ˜ 27 %) between 2008 and 2011, which we observed along a centre line extending between the grounding line in 1996 and ˜ 16 km upstream. Current median ice thinning rates (2011-2014) along profiles in areas below 1000 m altitude range between ˜ 2.6 to 3.2 m a-1 and are ˜ 70 % higher than between 2004 and 2008. Our study shows that Fleming Glacier is far away from approaching a new equilibrium and that the glacier dynamics are not primarily controlled by the loss of the former ice shelf anymore. Currently, the tongue of Fleming Glacier is grounded in a zone of bedrock elevation between ˜ -400 and -500 m. However, about 3-4 km upstream modelled bedrock topography indicates a retrograde bed which transitions into a deep trough of up to ˜ -1100 m at ˜ 10 km upstream. Hence, this endangers upstream ice masses, which can significantly increase the contribution of Fleming Glacier to sea level rise in the future.

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damiani, R.D. Jr.; Wessler, S.R.

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

Effects of grade control structures on fish passage, biological assemblages, and hydraulic environments in western Iowa streams: a multidisciplinary review

USGS Publications Warehouse

Thomas, J.T.; Culler, M.E.; Dermisis, D.C.; Pierce, Clay; Papanicolaou, A.N.; Stewart, T.W.; Larson, C.J.

2011-01-01

Land use changes and channelization of streams in the deep loess region of western Iowa have led to stream channel incision, altered flow regimes, increased sediment inputs, decreased habitat diversity and reduced lateral connectivity of streams and floodplains. Grade control structures (GCSs) are built in streams to prevent further erosion, protect infrastructure and reduce sediment loads. However, GCS can have a detrimental impact on fisheries and biological communities. We review three complementary biological and hydraulic studies on the effects of GCS in these streams. GCS with steep (≥1:4 rise : run) downstream slopes severely limited fish passage, but GCS with gentle slopes (≤1:15) allowed greater passage. Fish assemblages were dominated by species tolerant of degradation, and Index of Biotic Integrity (IBI) scores were indicative of fair or poor biotic integrity. More than 50% of fish species had truncated distributions. After modification of GCS to reduce slopes and permit increased passage, IBI scores increased and several species were detected further upstream than before modification. Total macroinvertebrate density, biomass and taxonomic diversity and abundance of ecologically sensitive taxa were greater at GCS than in reaches immediately upstream, downstream or ≥1 km from GCS. A hydraulic study confirmed results from fish passage studies; minimum depths and maximum current velocities at GCS with gentle slopes (≤1:15) were more likely to meet minimum criteria for catfish passage than GCS with steeper slopes. Multidisciplinary approaches such as ours will increase understanding of GCS-associated factors influencing fish passage, biological assemblage structure and other ecological relationships in streams.

Effects of grade control structures on the macroinvertebrate assemblage of an agriculturally impacted stream

USGS Publications Warehouse

Litvan, M.E.; Stewart, T.W.; Pierce, C.L.; Larson, C.J.

2008-01-01

Nearly 400 rock rip-rap grade control structures (hereafter GCS) were recently placed in streams of western Iowa, USA to reduce streambank erosion and protect bridge infrastructure and farmland. In this region, streams are characterized by channelized reaches, highly incised banks and silt and sand substrates that normally support low macroinvertebrate abundance and diversity. Therefore, GCS composed of rip-rap provide the majority of coarse substrate habitat for benthic macroinvertebrates in these streams. We sampled 20 sites on Walnut Creek, Montgomery County, Iowa to quantify macroinvertebrate assemblage characteristics (1) on GCS rip-rap and at sites located (2) 5-50 m upstream of GCS, (3) 5-50 m downstream of GCS and (4) at least 1 km from any GCS (five sites each). Macroinvertebrate biomass, numerical densities and diversity were greatest at sites with coarse substrates, including GCS sites and one natural riffle site and relatively low at remaining sites with soft substrates. Densities of macroinvertebrates in the orders Ephemeroptera, Trichoptera, Diptera, Coleoptera and Acariformes were abundant on GCS rip-rap. Increases in macroinvertebrate biomass, density and diversity at GCS may improve local efficiency of breakdown of organic matter and nutrient and energy flow, and provide enhanced food resources for aquatic vertebrates. However, lack of positive macroinvertebrate responses immediately upstream and downstream of GCS suggest that positive effects might be restricted to the small areas of streambed covered by GCS. Improved understanding of GCS effects at both local and ecosystem scales is essential for stream management when these structures are present. Copyright ?? 2007 John Wiley & Sons, Ltd.

Fish assemblages in a western Iowa stream modified by grade control structures

USGS Publications Warehouse

Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

2008-01-01

Over 400 riprap grade control structures (GCSs) have been built in streams of western Iowa to reduce erosion and protect bridges, roads, and farmland. In conjunction with a companion study evaluating fish passage over GCSs in Turkey Creek, we evaluated the differences in fish assemblage and habitat characteristics in reaches immediately downstream from GCSs (GCS sites) and reaches at least 1 km from any GCS (non-GCS sites). The GCS sites were characterized by greater proportions of pool habitat, maximum depths, fish biomass, and abundance of juvenile largemouth bass Micropterus salmoides than were non-GCS sites. Index of biotic integrity (IBI) scores were poor or fair (<43 on a 0-100 scale) and not significantly different between the GCS and non-GCS sites. Additionally, we investigated both the longitudinal changes in fish assemblages in this GCS-fragmented stream and the changes in fish assemblages after slope modifications of three GCSs to facilitate fish passage. Thirteen fish species were present throughout the study area, whereas another 15 species exhibited truncated distributions not extending to the most upstream sampling location. After modification of the GCSs, IBI scores increased at seven of nine sites (mean increase =4.6 points). Also, channel catfish Ictalurus punctatus were detected 7.3 km upstream at sites where, 2 years before GCS modification, they had been absent from collections. Given the number and distribution of GCSs in western Iowa streams, understanding the effects of these structures is vital to the conservation and management of fish assemblages in this and other regions where GCSs or similar structures are used. ?? Copyright by the American Fisheries Society 2008.

Analysis of the dynamic response of a supersonic inlet to flow-field perturbations upstream of the normal shock

NASA Technical Reports Server (NTRS)

Cole, G. L.; Willoh, R. G.

1975-01-01

A linearized mathematical analysis is presented for determining the response of normal shock position and subsonic duct pressures to flow-field perturbations upstream of the normal shock in mixed-compression supersonic inlets. The inlet duct cross-sectional area variation is approximated by constant-area sections; this approximation results in one-dimensional wave equations. A movable normal shock separates the supersonic and subsonic flow regions, and a choked exit is assumed for the inlet exit condition. The analysis leads to a closed-form matrix solution for the shock position and pressure transfer functions. Analytical frequency response results are compared with experimental data and a method of characteristics solution.

The Comet Giacobini-Zinner magnetotail: Axial stresses and inferred near-nucleus properties

NASA Technical Reports Server (NTRS)

Mccomas, D. J.; Gosling, J. T.; Bame, S. J.; Slavin, J. A.; Smith, E. J.; Steinberg, J. L.

1986-01-01

Utilizing the electron and magnetic field data from the ICE tail traversal of comet Giacobini-Zinner along with the MHD equations, a steady state, stress balance model of the cometary magnetotail was developed, and used to infer important but unmeasured ion properties within the magnetotail at ICE and upstream at the average point along each streamline where cometary ions are picked-up. The derived tailward ion flow speed at ICE is quite constant at approx. -20 to -30 km/sec across the entire tail. The flow velocity, ion temperature, density, and ion source rates upstream from the lobes (current sheet) at the average pick-up locations are approx. -75 km/sec (approx. -12), approx. 4 million K (approx. 100,000), approx. 20 cc (approx. 400), and approx. 15 cu cm/sec. Gradients in the plasma properties between the two regions are quite strong. Implications of inferred plasma properties for the near-nucleus region and for cometary magnetotail formation are examined.

The effect of varying Mach number on crossing, glancing shocks/turbulent boundary-layer interactions

NASA Technical Reports Server (NTRS)

Hingst, W. R.; Williams, K. E.

1991-01-01

Two crossing side-wall shocks interacting with a supersonic tunnel wall boundary layer have been investigated over a Mach number range of 2.5 to 4.0. The investigation included a range of equal shock strengths produced by shock generators at angles from 4.0 to 12.0 degrees. Results of flow visualization show that the interaction is unseparated at the low shock generator angles. With increasing shock strength, the flow begins to form a separated region that grows in size and moves forward and eventually the model unstarts. The wall static pressures show a symmetrical compression that merges on the centerline upstream of the inviscid shock locations and becomes more 1D downstream. The region of the 1D pressure gradient moves upstream with increasing shock strengths until it coincides with the leading edge of the shock generators at the limit before model unstart. At the limiting conditions the wall pressure gradients are primarily in the axial direction throughout.

A murC gene from coryneform bacteria.

PubMed

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Suppression of Rayleigh backscattering noise using cascaded-SOA and microwave photonic filter for 10 Gb/s loop-back WDM-PON.

PubMed

Feng, Hanlin; Ge, Jia; Xiao, Shilin; Fok, Mable P

2014-05-19

In this paper, we present a novel Rayleigh backscattering (RB) noise mitigation scheme based on central carrier suppression for 10 Gb/s loop-back wavelength division multiplexing passive optical network (WDM-PON). Microwave modulated multi-subcarrier optical signal is used as downstream seeding light, while cascaded semiconductor optical amplifier (SOA) are used in the optical network unit (ONU) for suppressing the central carrier of the multi-subcarrier upstream signal. With central carrier suppression, interference generated by carrier RB noise at low frequency region is eliminated successfully. Transmission performance over 45 km single mode fiber (SMF) is studied experimentally, and the optical-signal-to-Rayleigh-noise-ratio (OSRNR) can be reduced to 15 dB with central carrier suppression ratio (CCSR) of 21 dB. Receiver sensitivity is further improved by 6 dB with the use of microwave photonic filter (MPF) for suppressing residual upstream microwave signal and residual carrier RB at high frequency region.

Particle-in-cell simulation study of the scaling of asymmetric magnetic reconnection with in-plane flow shear

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doss, C. E.; Cassak, P. A., E-mail: Paul.Cassak@mail.wvu.edu; Swisdak, M.

2016-08-15

We investigate magnetic reconnection in systems simultaneously containing asymmetric (anti-parallel) magnetic fields, asymmetric plasma densities and temperatures, and arbitrary in-plane bulk flow of plasma in the upstream regions. Such configurations are common in the high-latitudes of Earth's magnetopause and in tokamaks. We investigate the convection speed of the X-line, the scaling of the reconnection rate, and the condition for which the flow suppresses reconnection as a function of upstream flow speeds. We use two-dimensional particle-in-cell simulations to capture the mixing of plasma in the outflow regions better than is possible in fluid modeling. We perform simulations with asymmetric magnetic fields,more » simulations with asymmetric densities, and simulations with magnetopause-like parameters where both are asymmetric. For flow speeds below the predicted cutoff velocity, we find good scaling agreement with the theory presented in Doss et al. [J. Geophys. Res. 120, 7748 (2015)]. Applications to planetary magnetospheres, tokamaks, and the solar wind are discussed.« less

Mediator-regulated transcription through the +1 nucleosome.

PubMed

Nock, Adam; Ascano, Janice M; Barrero, Maria J; Malik, Sohail

2012-12-28

Many genes are regulated at the level of a Pol II that is recruited to a nucleosome-free region upstream of the +1 nucleosome. How the Mediator coactivator complex, which functions at multiple steps, affects transcription through the promoter proximal region, including this nucleosome, remains largely unaddressed. We have established a fully defined in vitro assay system to delineate mechanisms for Pol II transit across the +1 nucleosome. Our results reveal cooperative functions of multiple cofactors, particularly of Mediator and elongation factor SII, in transcribing into this nucleosome. This is achieved, in part, through an unusual activity of SII that alters the intrinsic catalytic properties of promoter-proximal Pol II and, in concert with the Mediator, leads to enhancement in transcription of nucleosomal DNA. Our data provide additional mechanistic bases for Mediator function after recruitment of Pol II and, potentially, for regulation of genes controlled via nucleosome-mediated promoter-proximal pausing. Copyright © 2012 Elsevier Inc. All rights reserved.

Experimental investigation of wall shock cancellation and reduction of wall interference in transonic testing

NASA Technical Reports Server (NTRS)

Ferri, A.; Roffe, G.

1975-01-01

A series of experiments were performed to evaluate the effectiveness of a three-dimensional land and groove wall geometry and a variable permeability distribution to reduce the interference produced by the porous walls of a supercritical transonic test section. The three-dimensional wall geometry was found to diffuse the pressure perturbations caused by small local mismatches in wall porosity permitting the use of a relatively coarse wall porosity control to reduce or eliminate wall interference effects. The wall porosity distribution required was found to be a sensitive function of Mach number requiring that the Mach number repeatability characteristics of the test apparatus be quite good. The effectiveness of a variable porosity wall is greatest in the upstream region of the test section where the pressure differences across the wall are largest. An effective variable porosity wall in the down stream region of the test section requires the use of a slightly convergent test section geometry.

The complete mitochondrial genome of Gobiobotia filifer (Teleostei, Cypriniformes: Cyprinidae).

PubMed

Li, Qiang; Liu, Ya; Zhou, Jian; Gong, Quan; Li, Hua; Lai, Jiansheng; Li, Lianman

2016-09-01

The Gobiobotia filifer is a small economic fish which distributes in the upstream of Yangtze River and its distributaries. For the environmental pollution and overfishing, its population declined drastically in recent decades, so it is essential to protect its resource. In this study, the complete mitochondrial genome sequence of G. filifer was determined with PCR technology, which contains 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a non-coding control region with the total length of 16,613 bp. The order and composition of genes were similar to most of the other teleost fish. Most of the genes were encoded on heavy strand, except for ND6 genes and eight tRNAs. Just like most other vertebrates, the bias of G and C has been found in different genes/regions. The complete mitochondrial genome sequence of G. filifer would contribute to better understand evolution of this lineage, population genetics, and will help administrative department to make rules and laws to protect this lineage.

The complete mitochondrial genome of Liobagrus marginatus (Teleostei, Siluriformes: Amblycipitidae).

PubMed

Li, Qiang; Du, Jun; Liu, Ya; Zhou, Jian; Ke, Hongyu; Liu, Chao; Liu, Guangxun

2014-04-01

The Liobagrus marginatus is an economic fish which distribute in the upstream of Yangtze river and its distributary. For its taste fresh, environmental pollution and overfishing, its population declined drastically and body miniaturization in recent decades, so it is essential to protect its resource. In this study, the complete mitochondrial genome sequence of Liobagrus marginatus was sequenced, which contains 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes, and a non-coding control region with the total length of 16,497 bp. The gene arrangement and composition are similar to most of other fish. Most of the genes are encoded on heavy-strand, except for eight tRNA and ND6 genes. Just like most other vertebrates, the bias of G and C has been found in statistics results of different genes/regions. The complete mitochondrial genome sequence of Liobagrus marginatus would contribute to better understand population genetics, evolution of this lineage, and will help administrative departments to make rules and laws to protect it.

Upstream Structural Management Measures for an Urban Area Flooding in Turkey and their Consequences on Flood Risk Management

NASA Astrophysics Data System (ADS)

Akyurek, Z.; Bozoglu, B.; Girayhan, T.

2015-12-01

Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is done. MIKE21 with flexible grid is used in 2- dimensional shallow water flow modelling. 1/1000 scaled maps with the buildings for the urbanized area and 1/5000 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of Q5 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The effects of the available structures like bridges across the river on the flooding are presented. The upstream structural measures are studied on scenario basis. Four sub-catchments of Terme River are considered as contributing the downstream flooding. The existing circumstance of the Terme River states that the meanders of the river have a major effect on the flood situation and lead to approximately 35% reduction in the peak discharge between upstream and downstream of the river. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in at least two of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed. Flood risk is obtained by using the flood hazard maps and water depth-damage functions plotted for a variety of building types and occupancies. The estimated mean annual hazard for the area is calculated as $340 000 and it is estimated that the upstream structural management measures can decrease the direct economic risk 11% for the 500 return period flood.

Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

PubMed

Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

2015-01-01

High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

Movement of the saltwater interface in the surficial aquifer system in response to hydrologic stresses and water-management practices, Broward County, Florida

USGS Publications Warehouse

Dausman, Alyssa M.; Langevin, Christian D.

2005-01-01

A study was conducted to evaluate the relation between water-level fluctuations and saltwater intrusion in Broward County, Florida. The objective was achieved through data collection at selected wells in Broward County and through the development of a variable-density ground-water flow model. The numerical model is representative of many locations in Broward County that contain a well field, control structure, canal, the Intracoastal Waterway, and the Atlantic Ocean. The model was used to simulate short-term movement (from tidal fluctuations to monthly changes) and long-term movement (greater than 10 years) of the saltwater interface resulting from changes in rainfall, well-field withdrawals, sea-level rise, and upstream canal stage. The SEAWAT code, which is a combined version of the computer codes, MODFLOW and MT3D, was used to simulate the complex variable-density flow patterns. Model results indicated that the canal, control structure, and sea level have major effects on ground-water flow. For periods greater than 10 years, the upstream canal stage controls the movement and location of the saltwater interface. If upstream canal stage is decreased by 1 foot (0.3048 meter), the saltwater interface takes 50 years to move inland and stabilize. If the upstream canal stage is then increased by 1 foot (0.3048 meter), the saltwater interface takes 90 years to move seaward and stabilize. If sea level rises about 48 centimeters over the next 100 year as predicted, then inland movement of the saltwater interface may cause well-field contamination. For periods less than 10 years, simulation results indicated that a 3-year drought with increased well-field withdrawals probably will not have long-term effects on the position of the saltwater interface in the Biscayne aquifer. The saltwater interface returns to its original position in less than 10 years. Model results, however, indicated that the interface location in the lower part of the surficial aquifer system takes longer than 10 years to recover from a drought. Additionally, rainfall seems to have the greatest effect on saltwater interface movement in areas some distance from canals, but the upstream canal stage has the greatest effect on the movement of the saltwater interface near canals. Field data indicated that saltwater interface movement includes short-term fluctuations caused by tidal fluctuations and long-term seasonal fluctuations. Statistical analyses of daily-averaged data indicated that the saltwater interface moves in response to pumpage, rainfall, and upstream canal stage. In areas near the canal, the saltwater interface is most affected by canal stage because water-management structures control the stage in the upstream part of the canal and allow movement of the saltwater interface. In areas away from the canal, the saltwater interface is most affected by pumpage and rainfall, depending on the location of well fields. Data analyses also revealed that rainfall changes the vertical flow direction in the Biscayne aquifer. Results from the study indicated that upstream canal stage substantially affects the long-term position of the saltwater interface in the surficial aquifer system. The saltwater interface moves faster inland than seaward because of changes in upstream canal stage. For short-term problems, such as drought, the threat of saltwater intrusion in the Biscayne aquifer does not appear to be severe if the well-field withdrawal is increased; however, this conclusion is based on the assumption that well-field withdrawals will decrease once the drought is over. Sea-level rise may be a potential threat to the water supply in Broward County as the saltwater interface moves inland toward well fields.

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

Transcriptional activation of Mina by Sp1/3 factors.

PubMed

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Transcriptional Activation of Mina by Sp1/3 Factors

PubMed Central

Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Probable flood predictions in ungauged coastal basins of El Salvador

USGS Publications Warehouse

Friedel, M.J.; Smith, M.E.; Chica, A.M.E.; Litke, D.

2008-01-01

A regionalization procedure is presented and used to predict probable flooding in four ungauged coastal river basins of El Salvador: Paz, Jiboa, Grande de San Miguel, and Goascoran. The flood-prediction problem is sequentially solved for two regions: upstream mountains and downstream alluvial plains. In the upstream mountains, a set of rainfall-runoff parameter values and recurrent peak-flow discharge hydrographs are simultaneously estimated for 20 tributary-basin models. Application of dissimilarity equations among tributary basins (soft prior information) permitted development of a parsimonious parameter structure subject to information content in the recurrent peak-flow discharge values derived using regression equations based on measurements recorded outside the ungauged study basins. The estimated joint set of parameter values formed the basis from which probable minimum and maximum peak-flow discharge limits were then estimated revealing that prediction uncertainty increases with basin size. In the downstream alluvial plain, model application of the estimated minimum and maximum peak-flow hydrographs facilitated simulation of probable 100-year flood-flow depths in confined canyons and across unconfined coastal alluvial plains. The regionalization procedure provides a tool for hydrologic risk assessment and flood protection planning that is not restricted to the case presented herein. ?? 2008 ASCE.

Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

PubMed Central

Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

2011-01-01

Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

PubMed Central

Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

2006-01-01

The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

PubMed Central

1994-01-01

The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

A wind-tunnel investigation of wind-turbine wakes in yawed conditions

NASA Astrophysics Data System (ADS)

Bastankhah, Majid; Porté-Agel, Fernando

2015-06-01

Wind-tunnel experiments were performed to study the performance of a model wind turbine and its wake characteristics in a boundary layer under different operating conditions, including different yaw angles and tip speed ratios. High-resolution particle image- velocimetry (PIV) was used to measure the three velocity components in a horizontal plane at hub height covering a broad streamwise range from upstream of the turbine to the far- wake region. Additionally, thrust and power coefficients of the turbine were measured under different conditions. These power and thrust measurements, together with the highly-resolved flow measurements, enabled us to systematically study different wake properties. The near-wake region is found to have a highly complex structure influenced by different factors such as tip speed ratio and wake rotation. In particular, for higher tip speed ratios, a noticeable speed-up region is observed in the central part of near wake, which greatly affects the flow distribution in this region. In this regard, the behavior of the near wake for turbines with similar thrust coefficients but different tip speed ratios can vary widely. In contrast, it is shown that the mean streamwise velocity in the far wake of the turbine with zero yaw angle has a self-similar Gaussian distribution, and the strength of wake in this region is consistent with the magnitude of the thrust coefficient. With increasing yaw angle, as expected, the power and thrust coefficients decrease, and the wake deflection increases. The measurements also reveal that, in addition to turbulent momentum flux, lateral mean momentum flux boosts the flow entrainment in only one side of the wake, which results in a faster wake recovery in that side. It is also found that the induced velocity upstream of a yawed turbine has a non-symmetric distribution, and its distribution is in agreement with the available model in the literature. Moreover, the results suggest that in order to accurately predict the load distribution in yawed conditions, both normal and tangential (with respect to the rotor plane) components of the induced velocity upstream of the turbine should be taken into account.

8. DETAIL: GENERATOR FLOOR DIABLO POWERHOUSE SHOWING BUTTERFLY VALVE CONTROL, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8. DETAIL: GENERATOR FLOOR DIABLO POWERHOUSE SHOWING BUTTERFLY VALVE CONTROL, MOSAIC TILE FLOOR, AS SEEN FROM VISITORS GALLERY, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

9. BUTTERFLY VALVE CONTROL DIABLO POWERHOUSE. BUTTERFLY VALVES WERE MANUFACTURED ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. BUTTERFLY VALVE CONTROL DIABLO POWERHOUSE. BUTTERFLY VALVES WERE MANUFACTURED BY THE PELTON WATER WHEEL COMPANY IN 1931, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

PubMed

Yamasu, K; Wilt, F H

1999-02-01

The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

A test of flushing procedures to control salt-water intrusion at the W. P. Franklin Dam near Ft. Myers, Florida and The magnitude and extent of salt-water contamination in the Caloosahatchee River between La Belle and Olga, Florida

USGS Publications Warehouse

Boggess, Durward H.

1970-01-01

During low-flow periods, salty water from the tidal part of the Caloosahatchee River moves upstream during boat lockages at the W. P. Franklin Darn near Ft. Myers, Florida, as shown on figure L Salty water enters the lock chamber through openings of the downstream sector gates which separate tidal and fresh water; when the upstream gates open, some of the salty water moves into the upper pool, probably as a density current. Repeated injections of salty water cause a progressive increase in the salinity of the upstream water. The salty water moves upstream within the deeper parts of the river channel as far as 5 or more miles above the lock. Some mixing of the high-chloride deeper water and the fresher shallow water occurs in the affected reach above the lock, probably as a result of wind and waves, and turbulence created by boat traffic.

Upstream paths for Hippo signaling in Drosophila organ development.

PubMed

Choi, Kwang-Wook

2018-03-01

Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].

Effects of highway construction on stream water quality and macroinvertebrate condition in a mid-Atlantic highlands watershed, USA

USGS Publications Warehouse

Welsh, Stuart A.; Chen, Yushun; Viadero, Stuart C.; Wei, Xinchao; Hedrick, Lara B.; Anderson, James T.; Lin, Lian-Shin

2009-01-01

Refining best management practices (BMPs) for future highway construction depends on a comprehensive understanding of environmental impacts from current construction methods. Based on a before-after-control impact (BACI) experimental design, long-term stream monitoring (1997–2006) was conducted at upstream (as control, n = 3) and downstream (as impact, n = 6) sites in the Lost River watershed of the Mid-Atlantic Highlands region, West Virginia. Monitoring data were analyzed to assess impacts of during and after highway construction on 15 water quality parameters and macroinvertebrate condition using the West Virginia stream condition index (WVSCI). Principal components analysis (PCA) identified regional primary water quality variances, and paired t tests and time series analysis detected seven highway construction-impacted water quality parameters which were mainly associated with the second principal component. In particular, impacts on turbidity, total suspended solids, and total iron during construction, impacts on chloride and sulfate during and after construction, and impacts on acidity and nitrate after construction were observed at the downstream sites. The construction had statistically significant impacts on macroinvertebrate index scores (i.e., WVSCI) after construction, but did not change the overall good biological condition. Implementing BMPs that address those construction-impacted water quality parameters can be an effective mitigation strategy for future highway construction in this highlands region.

A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

PubMed

Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

2012-09-01

Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

Wall-based identification of coherent structures in wall-bounded turbulence

NASA Astrophysics Data System (ADS)

Sanmiguel Vila, C.; Flores, O.

2018-04-01

During the last decades, a number of reduced order models based on coherent structures have been proposed to describe wall-bounded turbulence. Many of these models emphasize the importance of coherent wall-normal velocity eddies (ν-eddies), which drive the generation of the very long streamwise velocity structures observed in the logarithmic and outer region. In order to use these models to improve our ability to control wall-bounded turbulence in realistic applications, these ν-eddies need to be identified from the wall in a non-intrusive way. In this paper, the possibility of using the pressure signal at the wall to identify these ν-eddies is explored, analyzing the cross-correlation between the wall-normal velocity component and the pressure fluctuations at the wall in a DNS of a turbulent channel flow at Reτ = 939. The results show that the cross-correlation has a region of negative correlation upstream, and a region of positive correlation backwards. In the spanwise direction the correlation decays monotonously, except very close to the wall where a change of sign of the correlation coefficient is observed. Moreover, filtering the pressure fluctuations at the wall in space results in an increase of the region where the cross-correlation is strong, both for the positively and the negatively correlated regions. The use of a time filter for the pressure fluctuations at the wall yields different results, displacing the regions of strong correlation without changing much their sizes. The results suggest that space-filtering the pressure at the wall is a feasible way to identify ν-eddies of different sizes, which could be used to trigger turbulent control strategies.

Control of Delta Avulsion by Downstream Sediment Sinks

NASA Astrophysics Data System (ADS)

Salter, Gerard; Paola, Chris; Voller, Vaughan R.

2018-01-01

Understanding how fluxes are partitioned at delta bifurcations is critical for predicting patterns of land loss and gain in deltas worldwide. Although the dynamics of river deltas are influenced from both upstream and downstream, previous studies of bifurcations have focused on upstream controls. Using a quasi-1-D bifurcation model, we show that flow switching in bifurcations is strongly influenced by downstream sediment sinks. We find that coupling between upstream and downstream feedbacks can lead to oscillations in water and sediment flux partitioning. The frequency and initial rate of growth/decay of the oscillations depend on both upstream and downstream conditions, with dimensionless bifurcate length and bypass fraction emerging as key downstream parameters. With a strong offshore sink, causing bypass in the bifurcate branches, we find that bifurcation dynamics become "frozen"; that is, the bifurcation settles on a permanent discharge ratio. In contrast, under depositional conditions, we identify three dynamical regimes: symmetric; soft avulsion, where both branches remain open but the dominant branch switches; and full avulsion. Finally, we show that differential subsidence alters these regimes, with the difference in average sediment supply to each branch exactly compensating for the difference in accommodation generation. Additionally, the model predicts that bifurcations with shorter branches are less asymmetric than bifurcations with longer branches, all else equal, providing a possible explanation for the difference between backwater length distributaries, which tend to be avulsive, and relatively stable mouth-bar-scale networks. We conclude that bifurcations are sensitive both quantitatively and qualitatively to downstream sinks.

Hydrogeological study of the aquifer system of the northern Sahara in the Algero-Tunisian border: A case study of Oued Souf region

NASA Astrophysics Data System (ADS)

Halassa, Younes; Zeddouri, Aziez; Mouhamadou, Ould Babasy; Kechiched, Rabah; Benhamida, Abdeldjebbar Slimane

2018-05-01

The aquifer system in The Algero-Tunisian border and Chotts region is mainly composed of two aquifers: The first is the Complex Terminal (CT) and the second is the Intercalary aquifer (CI). This study aims the identification and spatial evolution of factors that controlling the water quality in the Complex Terminal aquifer (CT) in the Chotts region (Oued Souf region - Southeastern of Algeria). The concentration of major elements, temperature, pH and salinity were monitored during 2015 in 34 wells from the CT aquifer. The geological, geophysical, hydrogeological and hydrochemical methods were applied in order to carried out a model for the investigated aquifer system and to characterize the hydrogeological and the geochemical behavior, as well as the geometrical and the lithological configuration. Multivariate statistical analyses such as Principal Component Analysis (PCA) were also used for the treatment of several data. Results show that the salinity follows the same regional distribution of Chloride, Sodium, Magnesium, Sulfate and Calcium. Note that the salinity shows low contents in the upstream part of investigated region suggesting restricted dissolution of salts. Hydro-chemical study and saturation indexes highlight the dominance of the dissolution and the precipitation of calcite, dolomite, anhydrite, gypsum and halite. The PCA analysis indicates that Na+, Cl-, Ca2+, Mg2+, SO42- and K+ variables that influence the water mineralization.

Analysis of Transcriptional Regulation of the Human miR-17-92 Cluster; Evidence for Involvement of Pim-1

PubMed Central

Thomas, Maren; Lange-Grünweller, Kerstin; Hartmann, Dorothee; Golde, Lara; Schlereth, Julia; Streng, Dennis; Aigner, Achim; Grünweller, Arnold; Hartmann, Roland K.

2013-01-01

The human polycistronic miRNA cluster miR-17-92 is frequently overexpressed in hematopoietic malignancies and cancers. Its transcription is in part controlled by an E2F-regulated host gene promoter. An intronic A/T-rich region directly upstream of the miRNA coding region also contributes to cluster expression. Our deletion analysis of the A/T-rich region revealed a strong dependence on c-Myc binding to the functional E3 site. Yet, constructs lacking the 5′-proximal ~1.3 kb or 3′-distal ~0.1 kb of the 1.5 kb A/T-rich region still retained residual specific promoter activity, suggesting multiple transcription start sites (TSS) in this region. Furthermore, the protooncogenic kinase, Pim-1, its phosphorylation target HP1γ and c-Myc colocalize to the E3 region, as inferred from chromatin immunoprecipitation. Analysis of pri-miR-17-92 expression levels in K562 and HeLa cells revealed that silencing of E2F3, c-Myc or Pim-1 negatively affects cluster expression, with a synergistic effect caused by c-Myc/Pim-1 double knockdown in HeLa cells. Thus, we show, for the first time, that the protooncogene Pim-1 is part of the network that regulates transcription of the human miR-17-92 cluster. PMID:23749113

Connections between meteorological and hydrological droughts in a semi-arid basin of the middle Yellow River

NASA Astrophysics Data System (ADS)

Li, Binquan; Zhu, Changchang; Liang, Zhongmin; Wang, Guoqing; Zhang, Yu

2018-06-01

Differences between meteorological and hydrological droughts could reflect the regional water consumption by both natural elements and human water-use. The connections between these two drought types were analyzed using the Standardized Precipitation Evapotranspiration Index (SPEI) and Standardized Streamflow Index (SSI), respectively. In a typical semi-arid basin of the middle Yellow River (Qingjianhe River basin), annual precipitation and air temperature showed significantly downward and upward trends, respectively, with the rates of -2.37 mm yr-1 and 0.03 °C yr-1 (1961-2007). Under their synthetic effects, water balance variable (represented by SPEI) showed obviously downward (drying) trend at both upstream and whole basin areas. For the spatial variability of precipitation, air temperature and the calculated SPEI, both upstream and downstream areas experienced very similar change characteristics. Results also suggested that the Qingjianhe River basin experienced near normal condition during the study period. As a whole, this semi-arid basin mainly had the meteorological drought episodes in the mid-1960s, late-1990s and the 2000s depicted by 12-month SPEI. The drying trend could also be depicted by the hydrological drought index (12-month SSI) at both upstream and downstream stations (Zichang and Yanchuan), but the decreasing trends were not significant. A correlation analysis showed that hydrological system responds rapidly to the change of meteorological conditions in this semi-arid region. This finding could be an useful implication to drought research for those semi-arid basins with intensive human activities.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Evidence that sea lampreys (Petromyzon marinus) complete their life cycle within a tributary of the Laurentian Great Lakes by parasitizing fishes in inland lakes

USGS Publications Warehouse

Johnson, Nicholas; Twohey, Michael B.; Miehls, Scott M.; Cwalinski, Tim A; Godby, Neal A; Lochet, Aude; Slade, Jeffrey W.; Jubar, Aaron K.; Siefkes, Michael J.

2016-01-01

The sea lamprey (Petromyzon marinus) invaded the upper Laurentian Great Lakes and feeds on valued fish. The Cheboygan River, Michigan, USA, is a large sea lamprey producing tributary to Lake Huron and despite having a renovated dam 2 km from the river mouth that presumably blocks sea lamprey spawning migrations, the watershed upstream of the dam remains infested with larval sea lamprey. A navigational lock near the dam has been hypothesized as the means of escapement of adult sea lampreys from Lake Huron and source of the upper river population (H1). However, an alternative hypothesis (H2) is that some sea lampreys complete their life cycle upstream of the dam, without entering Lake Huron. To evaluate the alternative hypothesis, we gathered angler reports of lamprey wounds on game fishes upstream of the dam, and captured adult sea lampreys downstream and upstream of the dam to contrast abundance, run timing, size, and statolith microchemistry. Results indicate that a small population of adult sea lampreys (n < 200) completed their life cycle upstream of the dam during 2013 and 2014. This is the most comprehensive evidence that sea lampreys complete their life history within a tributary of the upper Great Lakes, and indicates that similar landlocked populations could occur in other watersheds. Because the adult sea lamprey population upstream of the dam is small, complete elimination of the already low adult escapement from Lake Huron might allow multiple control tactics such as lampricides, trapping, and sterile male release to eradicate the population.

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Field Evaluation of Detection-Control System

DOT National Transportation Integrated Search

2015-04-01

In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

Spill Prevention, Control, and Countermeasure (SPCC) for the Upstream (Oil Exploration and Production) Sector

EPA Pesticide Factsheets

The SPCC rule requires facilities to develop, maintain, and implement an oil spill prevention plan, called an SPCC Plan. These plans help facilities prevent oil spill, as well as control a spill should one occur.

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Interaction of upstream flow distortions with high Mach number cascades

NASA Technical Reports Server (NTRS)

Englert, G. W.

1981-01-01

Features of the interaction of flow distortions, such as gusts and wakes with blade rows of advance type fans and compressors having high tip Mach numbers are modeled. A typical disturbance was assumed to have harmonic time dependence and was described, at a far upstream location, in three orthogonal spatial coordinates by a double Fourier series. It was convected at supersonic relative to a linear cascade described as an unrolled annulus. Conditions were selected so that the component of this velocity parallel to the axis of the turbomachine was subsonic, permitting interaction between blades through the upstream as well as downstream flow media. A strong, nearly normal shock was considered in the blade passages which was allowed curvature and displacement. The flows before and after the shock were linearized relative to uniform mean velocities in their respective regions. Solution of the descriptive equations was by adaption of the Wiener-Hopf technique, enabling a determination of distortion patterns through and downstream of the cascade as well as pressure distributions on the blade and surfaces. Details of interaction of the disturbance with the in-passage shock were discussed. Infuences of amplitude, wave length, and phase of the disturbance on lifts and moments of cascade configurations are presented. Numerical results are clarified by reference to an especially orderly pattern of upstream vertical motion in relation to the cascade parameters.

DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitňa, A.; Šafránková, J.; Němeček, Z.

2016-03-01

Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those inmore » the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.« less

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Observation of the effects of stronger magnetic fields on warm, higher energy electrons and ion beams transiting a double layer in a helicon plasma

NASA Astrophysics Data System (ADS)

Scharer, John; Sung, Yung-Ta; Li, Yan

2017-10-01

Fast, two-temperature electrons (>80 eV, Te =13 eV tail, 4 eV bulk) with substantial tail density fractions are created at low (< = 1.7 mtorr) Ar pressure @ 340 G in the antenna region with nozzle mirror ratio of 1.4 on MadHeX @ 900W. These distributions including a fast tail are observed upstream of a double layer. The fast, untrapped tail electrons measured downstream of the double layer have a higher temperature of 13 eV than the trapped, upstream electrons of 4 eV temperature. Upstream plasma potential fluctuations of + - 30 percent are observed. An RF-compensated Langmuir probe is used to measure the electron temperatures and densities and OES, mm wave IF and an RPA for the IEDF are also utilized. As the magnetic field is increased to 1020 G, an increase in the electron temperature and density upstream of the double layer is observed with Te= 15-25 eV with a primarily single temperature mode. Accelerated ion beam energies in the range of 65-120 eV are observed as the magnetic field is increased from 340 to 850 G. The role of the nozzle, plasma double layer and helicon wave coupling on the EEDF and ion acceleration will be discussed. Research supported in part by the University of Wisconsin.

Method and apparatus for in-cell vacuuming of radiologically contaminated materials

DOEpatents

Spadaro, Peter R.; Smith, Jay E.; Speer, Elmer L.; Cecconi, Arnold L.

1987-01-01

A vacuum air flow operated cyclone separator arrangement for collecting, handling and packaging loose contaminated material in accordance with acceptable radiological and criticality control requirements. The vacuum air flow system includes a specially designed fail-safe prefilter installed upstream of the vacuum air flow power supply. The fail-safe prefilter provides in-cell vacuum system flow visualization and automatically reduces or shuts off the vacuum air flow in the event of an upstream prefilter failure. The system is effective for collecting and handling highly contaminated radiological waste in the form of dust, dirt, fuel element fines, metal chips and similar loose material in accordance with radiological and criticality control requirements for disposal by means of shipment and burial.

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

PubMed

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

INTRINSIC REGULATION OF HEMOGLOBIN EXPRESSION BY VARIABLE SUBUNIT INTERFACE STRENGTHS

PubMed Central

Manning, James M.; Popowicz, Anthony M.; Padovan, Julio C.; Chait, Brian T.; Manning, Lois R.

2012-01-01

SUMMARY The expression of the six types of human hemoglobin subunits over time is currently considered to be regulated mainly by transcription factors that bind to upstream control regions of the gene (the “extrinsic” component of regulation). Here we describe how subunit pairing and further assembly to tetramers in the liganded state is influenced by the affinity of subunits for one another (the “intrinsic” component of regulation). The adult hemoglobin dimers have the strongest subunit interfaces and the embryonic hemoglobins are the weakest with fetal hemoglobins of intermediate strength, corresponding to the temporal order of their expression. These variable subunit binding strengths and the attenuating effects of acetylation contribute to the differences with which these hemoglobin types form functional O2-binding tetramers consistent with gene switching. PMID:22129306

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression

PubMed Central

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-01-01

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on–off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis. PMID:16505380

: Signal Decomposition of High Resolution Time Series River data to Separate Local and Regional Components of Conductivity

EPA Science Inventory

Signal processing techniques were applied to high-resolution time series data obtained from conductivity loggers placed upstream and downstream of a wastewater treatment facility along a river. Data was collected over 14-60 days, and several seasons. The power spectral densit...

Analysis and prediction of spatiotemporal impact of traffic incidents for better mobility and safety in transportation systems.

DOT National Transportation Integrated Search

2015-12-01

The goal of this research is to develop a machine learning framework to predict the spatiotemporal impact : of traffic accidents on the upstream traffic and surrounding region. The main objective of the framework : is, given a road accident, to forec...

The effects of upstream plasma properties on Titan's ionosphere

NASA Astrophysics Data System (ADS)

Ledvina, S. A.; Brecht, S. H.

2016-12-01

Cassini observations have found that the plasma and magnetic field conditions upstream of Titan are far more complex than they were thought to be after the Voyager encounter. Rymer et al., (2009) used the Cassini Plasma Spectrometer (CAPS) electron observations to classify the plasma conditions along Titan's orbit into 5 types (Plasma Sheet, Lobe, Mixed, Magnetosheath and Misc.). Nemeth et al., (2011) found that the CAPS ion observations could also be separated into the same plasma regions as defined by Rymer et al. Additionally the T-96 encounter found Titan in the solar wind adding a sixth classification. Understanding the effects of the variable upstream plasma conditions on Titan's plasma interaction and the evolution of Titan's ionosphere/atmosphere is one of the main objectives of the Cassini mission. To compliment the mission we perform hybrid simulations of Titan's plasma interaction to examine how the properties of the incident plasma (composition, density, temperature etc…) affect Titan's ionosphere. We examine how much ionospheric plasma is lost from Titan as well as the amount of mass and energy deposited into Titan's atmosphere.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Assessment and management of the performance risk of a pilot reclaimed water disinfection process.

PubMed

Zhou, Guangyu; Zhao, Xinhua; Zhang, Lei; Wu, Qing

2013-10-01

Chlorination disinfection has been widely used in reclaimed water treatment plants to ensure water quality. In order to assess the downstream quality risk of a running reclaimed water disinfection process, a set of dynamic equations was developed to simulate reactions in the disinfection process concerning variables of bacteria, chemical oxygen demand (COD), ammonia and monochloramine. The model was calibrated by the observations obtained from a pilot disinfection process which was designed to simulate the actual process in a reclaimed water treatment plant. A Monte Carlo algorithm was applied to calculate the predictive effluent quality distributions that were used in the established hierarchical assessment system for the downstream quality risk, and the key factors affecting the downstream quality risk were defined using the Regional Sensitivity Analysis method. The results showed that the seasonal upstream quality variation caused considerable downstream quality risk; the effluent ammonia was significantly influenced by its upstream concentration; the upstream COD was a key factor determining the process effluent risk of bacterial, COD and residual disinfectant indexes; and lower COD and ammonia concentrations in the influent would mean better downstream quality.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

PubMed

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Resolving the variability of CDOM fluorescence to differentiate the sources and fate of DOM in Lake Taihu and its tributaries.

PubMed

Yao, Xin; Zhang, Yunlin; Zhu, Guangwei; Qin, Boqiang; Feng, Longqing; Cai, Linlin; Gao, Guang

2011-01-01

Taihu Basin is the most developed area in China, which economic development has resulted in pollutants being produced and discharged into rivers and the lake. Lake Taihu is located in the center of the basin, which is characterized by a complex network of rivers and channels. To assess the sources and fate of dissolved organic matter (DOM) in surface waters, we determined the components and abundance of chromophoric dissolved organic matter (CDOM) within Lake Taihu and 66 of its tributaries, and 22 sites along transects from two main rivers. In Lake Taihu, there was a relative less spatial variation in CDOM absorption a(CDOM)(355) with a mean of 2.46 ± 0.69 m⁻¹ compared to the mean of 3.36 ± 1.77 m⁻¹ in the rivers. Two autochthonous tryptophan-like components (C1 and C5), two humic-like components (C2 and C3), and one autochthonous tyrosine-like component (C4) were identified using the parallel factor analysis (PARAFAC) model. The C2 and C3 had a direct relationship with a(CDOM)(355), dissolved organic carbon (DOC), and chemical oxygen demand (COD). The separation of lake samples from river samples, on both axes of the Principal Component Analysis (PCA), showed the difference in DOM fluorophores between these various environments. Components C1 and C5 concurrently showed positive factor 1 loadings, while C4 was close to the negative factor 1 axis. Components C2 and C3 showed positive second factor loadings. The major contribution of autochthonous tryptophan-like components to lake samples is due to the autochthonous production of CDOM in the lake ecosystems. The results also showed that the differences in geology and associated land use control CDOM dynamics, such as the high levels of CDOM with terrestrial characteristics in the northwestern upstream rivers and low levels of CDOM with increased microbial characteristics in the southwestern upstream rivers. Most of river samples from the downstream regions in the eastern and southeastern plains had a similar relative abundance of humic-like fluorescence, with less of the tryptophan-like and more of the tyrosine-like contributions than did samples from upstream regions. Copyright © 2010 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, R.; McKinstry, C.; Simmons, C.

Since 1995, the Confederated Tribes of the Colville Reservation (Colville Confederated Tribes) have managed the Chief Joseph Kokanee Enhancement Project as part of the Northwest Power Planning Council (NWPPC) Fish and Wildlife Program. Project objectives have focused on understanding natural production of kokanee (a land-locked sockeye salmon) and other fish stocks in the area above Grand Coulee and Chief Joseph Dams on the Columbia River. A 42-month investigation concluded that entrainment at Grand Coulee Dam ranged from 211,685 to 576,676 fish annually. Further analysis revealed that 85% of the total entrainment occurred at the dam's third powerplant. These numbers representmore » a significant loss to the tribal fisheries upstream of the dam. In response to a suggestion by the NWPPC Independent Scientific Review Panel, the scope of work for the Chief Joseph Kokanee Enhancement Project was expanded to include a multiyear pilot test of a strobe light system to help mitigate fish entrainment. This report details the work conducted during the second year of the study by researchers of the Colville Confederated Tribes in collaboration with the Pacific Northwest National Laboratory. The 2002 study period extended from May 18 through July 30. The objective of the study was to determine the efficacy of a prototype strobe light system to elicit a negative phototactic response in kokanee and rainbow trout. The prototype system consisted of six strobe lights affixed to an aluminum frame suspended vertically underwater from a barge secured in the center of the entrance to the third powerplant forebay. The lights, controlled by a computer, were aimed to illuminate a specific region directly upstream of the barge. Three light level treatments were used: 6 of 6 lights on, 3 of 6 lights on, and all lights off. These three treatment conditions were applied for an entire 24-hr day and were randomly assigned within a 3-day block throughout the study period. A seven-transducer splitbeam hydroacoustic system was used to evaluate the effectiveness of the strobe lights in eliciting a negative phototactic response in fish. The transducers were deployed so they tracked fish entering and within the region illuminated by the strobe lights. Two of the seven transducers were mounted to the frame containing the strobe lights and were oriented horizontally. The remaining five transducers were spaced approximately 4 m apart on individual floating frames upstream of the barge, with the transducers looking vertically downward.« less

MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

NASA Technical Reports Server (NTRS)

Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

2012-01-01

The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

Fuel combustion exhibiting low NO{sub x} and CO levels

DOEpatents

Keller, J.O.; Bramlette, T.T.; Barr, P.K.

1996-07-30

Method and apparatus are disclosed for safely combusting a fuel in such a manner that very low levels of NO{sub x} and CO are produced. The apparatus comprises an inlet line containing a fuel and an inlet line containing an oxidant. Coupled to the fuel line and to the oxidant line is a mixing means for thoroughly mixing the fuel and the oxidant without combusting them. Coupled to the mixing means is a means for injecting the mixed fuel and oxidant, in the form of a large-scale fluid dynamic structure, into a combustion region. Coupled to the combustion region is a means for producing a periodic flow field within the combustion region to mix the fuel and the oxidant with ambient gases in order to lower the temperature of combustion. The means for producing a periodic flow field can be a pulse combustor, a rotating band, or a rotating cylinder within an acoustic chamber positioned upstream or downstream of the region of combustion. The mixing means can be a one-way flapper valve; a rotating cylinder; a rotating band having slots that expose open ends of said fuel inlet line and said oxidant inlet line simultaneously; or a set of coaxial fuel annuli and oxidizer annuli. The means for producing a periodic flow field may or may not be in communication with an acoustic resonance. When employed, the acoustic resonance may be upstream or downstream of the region of combustion. 14 figs.

Flowfield measurements in a separated and reattached flat plate turbulent boundary layer

NASA Technical Reports Server (NTRS)

Patrick, William P.

1987-01-01

The separation and reattachment of a large-scale, two-dimensional turbulent boundary layer at low subsonic speed on a flat plate has been studied experimentally. The separation bubble was 55 cm long and had a maximum bubble thickness, measured to the height of the mean dividing streamline, of 17 cm, which was twice the thickness of the inlet boundary layer. A combination of laser velocimetry, hot-wire anemometry, pneumatic probing techniques, and flow visualization were used as diagnostics. Principal findings were that an outer inviscid rotational flow was defined which essentially convected over the blockage associated with the inner, viscously dominated bubble recirculation region. A strong backflow region in which the flow moved upstream 100 percent of the time was measured near the test surface over the central 35 percent of the bubble. A laminar backflow boundary layer having pseudo-turbulent characteristics including a log-linear velocity profile was generated under the highly turbulent backflow. Velocity profile shapes in the reversed flow region matched a previously developed universal backflow profile at the upstream edge of the separation region but not in the steady backflow region downstream. A smoke flow visualization movie and hot-film measurements revealed low frequency nonperiodic flapping at reattachment. However, forward flow fraction data at reattachment and mean velocity profiles in the redeveloping boundary layer downstream of reattachment correlated with backward-facing step data when the axial dimension was scaled by the distance from the maximum bubble thickness to reattachment.

Inductively heated particulate matter filter regeneration control system

DOEpatents

Gonze, Eugene V; Paratore Jr., Michael J; Kirby, Kevin W; Phelps, Amanda; Gregoire, Daniel J

2012-10-23

A system includes a particulate matter (PM) filter with an upstream end for receiving exhaust gas, a downstream end and zones. The system also includes a heating element. A control module selectively activates the heating element to inductively heat one of the zones.

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Observations of the magnetic fluctuation enhancement in the earth's foreshock region

NASA Technical Reports Server (NTRS)

Le, G.; Russell, C. T.

1990-01-01

Upstream waves have been postulated to be a major source of energy for the dayside magnetic pulsations within the magnetosphere. Thus, it is of interest to determine over what frequency range in the ion foreshock the power of fluctuations in the solar wind is enhanced. The magnetic field data from pairs of spacecraft, when they stay on either side of the ion foreshock boundary, were examined. It was found that the power of magnetic fluctuations is enhanced only at periods less than about two minutes, not at longer periods. Thus the upstream waves may contribute to Pc 3 and Pc 4 pulsations in the dayside magnetosphere, but they cannot be directly responsible for the longer-period waves.

The Interaction Between the Magnetosphere of Mars and that of Comet Siding Spring

NASA Astrophysics Data System (ADS)

Holmstrom, M.; Futaana, Y.; Barabash, S. V.

2015-12-01

On 19 October 2014 the comet Siding Spring flew by Mars. This was a unique opportunity to study the interaction between a cometary and a planetary magnetosphere. Here we model the magnetosphere of the comet using a hybrid plasma solver (ions as particles, electrons as a fluid). The undisturbed upstream solar wind ion conditions are estimated from observations by ASPERA-3/IMA on Mars Express during several orbits. It is found that Mars probably passed through a solar wind that was disturbed by the comet during the flyby. The uncertainty derives from that the size of the disturbed solar wind region in the comet simulation is sensitive to the assumed upstream solar wind conditions, especially the solar wind proton density.

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti

PubMed Central

Nordeste, Ricardo

2017-01-01

ABSTRACT Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti, we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis (phbA, phbB, phbAB, and phbC), PHB degradation (bdhA, phaZ, and acsA2), and glycogen synthesis (glgA1). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms. Author Video: An author video summary of this article is available. PMID:28905000

Earth's Bow Shock: Elapsed-Time Observations by Two Closely Spaced Satellites.

PubMed

Greenstadt, E W; Green, I M; Colburn, D S

1968-11-22

Coordinated observations of the earth's bow shock were made as Vela 3A and Explorer 33 passed within 6 earth radii of each other. Elapsed time measurements of shock motion give directly determined velocities in the range 1 to 10 kilometers per second and establish the existence of two regions, one of large amplitude magnetic "shock" oscillations and another of smaller, sunward, upstream oscillations. Each region is as thick as 1 earth radius, or more.

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

RESOLVING THE GEOMETRY OF THE INNERMOST RELATIVISTIC JETS IN ACTIVE GALACTIC NUCLEI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Algaba, J. C.; Lee, S. S.; Nakamura, M.

2017-01-01

In the current paradigm, it is believed that the compact VLBI radio core of radio-loud active galactic nuclei (AGNs) represents the innermost upstream regions of relativistic outflows. These regions of AGN jets have generally been modeled by a conical outflow with a roughly constant opening angle and flow speed. Nonetheless, some works suggest that a parabolic geometry would be more appropriate to fit the high energy spectral distribution properties and it has been recently found that, at least in some nearby radio galaxies, the geometry of the innermost regions of the jet is parabolic. We compile here multi-frequency core sizes of archivalmore » data to investigate the typically unresolved upstream regions of the jet geometry of a sample of 56 radio-loud AGNs. Data combined from the sources considered here are not consistent with the classic picture of a conical jet starting in the vicinity of the super-massive black hole (SMBH), and may exclude a pure parabolic outflow solution, but rather suggest an intermediate solution with quasi-parabolic streams, which are frequently seen in numerical simulations. Inspection of the large opening angles near the SMBH and the range of the Lorentz factors derived from our results support our analyses. Our result suggests that the conical jet paradigm in AGNs needs to be re-examined by millimeter/sub-millimeter VLBI observations.« less

A gastric acid secretion model.

PubMed Central

de Beus, A M; Fabry, T L; Lacker, H M

1993-01-01

A theory of gastric acid production and self-protection is formulated mathematically and examined for clinical and experimental correlations, implications, and predictions using analytic and numerical techniques. In our model, gastric acid secretion in the stomach, as represented by an archetypal gastron, consists of two chambers, circulatory and luminal, connected by two different regions of ion exchange. The capillary circulation of the gastric mucosa is arranged in arterial-venous arcades which pass from the gastric glands up to the surface epithelial lining of the lumen; therefore the upstream region of the capillary chamber communicates with oxyntic cells, while the downstream region communicates with epithelial cells. Both cell types abut the gastric lumen. Ion currents across the upstream region are calculated from a steady-state oxyntic cell model with active ion transport, while the downstream ion fluxes are (facilitated) diffusion driven or secondarily active. Water transport is considered iso-osmotic. The steady-state model is solved in closed form for low gastric lumen pH. A wide variety of previously performed static and dynamic experiments on ion and CO2 transport in the gastric lumen and gastric blood supply are for the first time correlated with each other for an (at least) semiquantitative test of current concepts of gastric acid secretion and for the purpose of model verification. Agreement with the data is reported with a few outstanding and instructive exceptions. Model predictions and implications are also discussed. Images FIGURE 1 PMID:8396457

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

A numerical study of the Magellan Plume

NASA Astrophysics Data System (ADS)

Palma, Elbio D.; Matano, Ricardo P.

2012-05-01

In this modeling study we investigate the dynamical mechanisms controlling the spreading of the Magellan Plume, which is a low-salinity tongue that extends along the Patagonian Shelf. Our results indicate that the overall characteristics of the plume (width, depth, spreading rate, etc.) are primarily influenced by tidal forcing, which manifests through tidal mixing and tidal residual currents. Tidal forcing produces a homogenization of the plume's waters and an offshore displacement of its salinity front. The interaction between tidal and wind-forcing reinforces the downstream and upstream buoyancy transports of the plume. The influence of the Malvinas Current on the Magellan Plume is more dominant north of 50°S, where it increases the along-shelf velocities and generates intrusions of saltier waters from the outer shelf, thus causing a reduction of the downstream buoyancy transport. Our experiments also indicate that the northern limit of the Magellan Plume is set by a high salinity discharge from the San Matias Gulf. Sensitivity experiments show that increments of the wind stress cause a decrease of the downstream buoyancy transport and an increase of the upstream buoyancy transport. Variations of the magnitude of the discharge produce substantial modifications in the downstream penetration of the plume and buoyancy transport. The Magellan discharge generates a northeastward current in the middle shelf, a recirculation gyre south of the inlet and a region of weak currents father north.

Pod-1/Capsulin shows a sex- and stage-dependent expression pattern in the mouse gonad development and represses expression of Ad4BP/SF-1.

PubMed

Tamura, M; Kanno, Y; Chuma, S; Saito, T; Nakatsuji, N

2001-04-01

Mammalian sex-determination and differentiation are controlled by several genes, such as Sry, Sox-9, Dax-1 and Mullerian inhibiting substance (MIS), but their upstream and downstream genes are largely unknown. Ad4BP/SF-1, encoding a zinc finger transcription factor, plays important roles in gonadogenesis. Disruption of this gene caused disappearance of the urogenital system including the gonad. Ad4BP/SF-1, however, is also involved in the sex differentiation of the gonad at later stages, such as the regulation of steroid hormones and MIS. Pod-1/Capsulin, a member of basic helix-loop-helix transcription factors, is expressed in a pattern closely related but mostly complimentary to that of the Ad4BP/SF-1 expression in the developing gonad. In the co-transfection experiment using cultured cells, overexpression of Pod-1/Capsulin repressed expression of a reporter gene that carried the upstream regulatory region of the Ad4BP/SF-1 gene. Furthermore, forced expression of Pod-1/Capsulin repressed expression of Ad4BP/SF-1 in the Leydig cell-derived I-10 cells. These results suggest that Pod-1/Capsulin may play important roles in the development and sex differentiation of the mammalian gonad via transcriptional regulation of Ad4BP/SF-1.

ASR5 is involved in the regulation of miRNA expression in rice.

PubMed

Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

2015-11-01

The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

PubMed Central

Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

2006-01-01

Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Design of the frame structure for a multiservice interactive system using ATM-PON

NASA Astrophysics Data System (ADS)

Nam, Jae-Hyun; Jang, Jongwook; Lee, Jung-Tae

1998-10-01

The MAC (Medium Access Control) protocol controls B-NT1s' (Optical Network Unit) access to the shared capacity on the PON, this protocol is very important if TDMA (Time Division Multiple Access) multiplexing is used on the upstream. To control the upstream traffic some kind of access protocol has to be implemented. There are roughly two different approaches to use request cells: in a collision free way or such that collisions in a request slot are allowed. It is the objective of this paper to describe a MAC-protocol structure that supports both approaches and hybrids of it. In our paper we grantee the QoS (Quality of Service) of each B-NT1 through LOC, LOV, LOA field that are the length field of the transmitted cell at each B-NT1. Each B-NT1 transmits its status of request on request cell.

[Prediction of Promoter Motifs in Virophages].

PubMed

Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie

2015-07-01

Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.

Evaluating the effects of check dams on channel geometry, bed sediment size and riparian vegetation in Mediterranean mountain torrents.

PubMed

Zema, Demetrio Antonio; Bombino, Giuseppe; Denisi, Pietro; Lucas-Borja, Manuel Esteban; Zimbone, Santo Marcello

2018-06-12

In mountain streams possible negative impacts of check dams on soil, water and riparian vegetation due to check dam installation can be noticed. In spite of the ample literature on the qualitative effects of engineering works on channel hydrology, morphology, sedimentary effects and riparian vegetation characteristics, quantitative evaluations of the changes induced by check dams on headwater characteristics are rare. In order to fill this gap, this study has evaluated the effects of check dams located in headwaters of Calabria (Southern Italy) on hydrological and geomorphological processes and on the response of riparian vegetation to these actions. The analysis has compared physical and vegetation indicators in transects identified around check dams (upstream and downstream) and far from their direct influence (control transects). Check dams were found to influence significantly unit discharge, surface and subsurface sediments (both upstream and downstream), channel shape and transverse distribution of riparian vegetation (upstream) as well as cover and structure of riparian complexes (downstream). The actions of the structures on torrent longitudinal slope and biodiversity of vegetation were less significant. The differences on bed profile slope were significant only between upstream and downstream transects. The results of the Agglomerative Hierarchical Cluster analysis confirmed the substantial similarity between upstream and control transects, thus highlighting that the construction of check dams, needed to mitigate the hydro-geological risks, has not strongly influenced the torrent functioning and ecology before check dam construction. Moreover, simple and quantitative linkages between torrent hydraulics, geomorphology and vegetation characteristics exist in the analysed headwaters; these relationships among physical adjustments of channels and most of the resulting characteristics of the riparian vegetation are specific for the transect locations with respect of check dams. Conversely, the biodiversity of the riparian vegetation basically eludes any quantitative relations with the physical and other vegetal characteristics of the torrent transects. Copyright © 2018 Elsevier B.V. All rights reserved.

Double air-fuel ratio sensor system having double-skip function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katsuno, T.

1988-01-26

A method for controlling the air-fuel ratio in an internal combustion engine is described having a catalyst converter for removing pollutants in the exhaust gas thereof, and upstream-side and downstream-side air-fuel ratio sensors disposed upstream and downstream, respectively, of the catalyst converter for detecting a concentration of a specific component in an exhaust gas, comprising the steps of: comparing the output of the upstream-side air-fuel ratio sensor with a first predetermined value; gradually changing a first air-fuel ratio correction amount in accordance with a result of the comparison of the output of the upstream-side air-fuel ratio sensor with the predeterminedmore » value; shifting the first air-fuel ratio correction amount by a first skip amount during a predetermined time period after the result of the comparison of the upstream-side air-fuel ratio sensor is changed; shifting the first air-fuel ratio correction amount by a second skip amount smaller than the first skip amount after the predetermined time period has passed; comparing the output of the downstream-side air-fuel ratio with a second predetermined value, calculating a second air-fuel ratio correction amount in accordance with the comparison result of the output of the downstream-side air-fuel ratio sensor with the second predetermined value; and adjusting the actual air-fuel ratio in accordance with the first and second air-fuel ratio correction amounts; wherein the gradually-changing step comprises the steps of: gradually decreasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the rich side with respect to the first predetermined value; and gradually increasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the lean side with respect to the first predetermined value.« less

Fundamentals of collisionless shocks for astrophysical application, 2. Relativistic shocks

NASA Astrophysics Data System (ADS)

Bykov, A. M.; Treumann, R. A.

2011-08-01

In this concise review of the recent developments in relativistic shock theory in the Universe we restrict ourselves to shocks that do not exhibit quantum effects. On the other hand, emphasis is given to the formation of shocks under both non-magnetised and magnetised conditions. We only briefly discuss particle acceleration in relativistic shocks where much of the results are still preliminary. Analytical theory is rather limited in predicting the real shock structure. Kinetic instability theory is briefed including its predictions and limitations. A recent self-similar relativistic shock theory is described which predicts the average long-term shock behaviour to be magnetised and to cause reasonable power-law distributions for energetic particles. The main focus in this review is on numerical experiments on highly relativistic shocks in (i) pair and (ii) electron-nucleon plasmas and their limitations. These simulations do not validate all predictions of analytic and self-similar theory and so far they do not solve the injection problem and the self-modification by self-generated cosmic rays. The main results of the numerical experiments discussed in this review are: (i) a confirmation of shock evolution in non-magnetised relativistic plasma in 3D due to either the lepton-Weibel instability (in pair plasmas) or to the ion-Weibel instability; (ii) the sensitive dependence of shock formation on upstream magnetisation which causes suppression of Weibel modes for large upstream magnetisation ratios σ>10-3; (iii) the sensitive dependence of particle dynamics on the upstream magnetic inclination angle θ Bn , where particles of θ Bn >34° cannot escape upstream, leading to the distinction between `subluminal' and `superluminal' shocks; (iv) particles in ultra-relativistic shocks can hardly overturn the shock and escape to upstream; they may oscillate around the shock ramp for a long time, so to speak `surfing it' and thereby becoming accelerated by a kind of SDA; (v) these particles form a power-law tail on the downstream distribution; their limitations are pointed out; (vi) recently developed methods permit the calculation of the radiation spectra emitted by the downstream high-energy particles; (vii) the Weibel-generated downstream magnetic fields form large-amplitude vortices which could be advected by the downstream flow to large distances from the shock and possibly contribute to an extended strong field region; (viii) if cosmic rays are included, Bell-like modes can generate upstream magnetic turbulence at short and, by diffusive re-coupling, also long wavelengths in nearly parallel magnetic field shocks; (ix) advection of such large-amplitude waves should cause periodic reformation of the quasi-parallel shock and eject large-amplitude magnetic field vortices downstream where they contribute to turbulence and to maintaining an extended region of large magnetic fields.

Modelling Stream-Fish Functional Traits in Reference Conditions: Regional and Local Environmental Correlates

PubMed Central

Oliveira, João M.; Segurado, Pedro; Santos, José M.; Teixeira, Amílcar; Ferreira, Maria T.; Cortes, Rui V.

2012-01-01

Identifying the environmental gradients that control the functional structure of biological assemblages in reference conditions is fundamental to help river management and predict the consequences of anthropogenic stressors. Fish metrics (density of ecological guilds, and species richness) from 117 least disturbed stream reaches in several western Iberia river basins were modelled with generalized linear models in order to investigate the importance of regional- and local-scale abiotic gradients to variation in functional structure of fish assemblages. Functional patterns were primarily associated with regional features, such as catchment elevation and slope, rainfall, and drainage area. Spatial variations of fish guilds were thus associated with broad geographic gradients, showing (1) pronounced latitudinal patterns, affected mainly by climatic factors and topography, or (2) at the basin level, strong upstream-downstream patterns related to stream position in the longitudinal gradient. Maximum native species richness was observed in midsize streams in accordance with the river continuum concept. The findings of our study emphasized the need to use a multi-scale approach in order to fully assess the factors that govern the functional organization of biotic assemblages in ‘natural’ streams, as well as to improve biomonitoring and restoration of fluvial ecosystems. PMID:23029242

Regulation of notochord-specific expression of Ci-Bra downstream genes in Ciona intestinalis embryos.

PubMed

Takahashi, Hiroki; Hotta, Kohji; Takagi, Chiyo; Ueno, Naoto; Satoh, Nori; Shoguchi, Eiichi

2010-02-01

Brachyury, a T-box transcription factor, is expressed in ascidian embryos exclusively in primordial notochord cells and plays a pivotal role in differentiation of notochord cells. Previously, we identified approximately 450 genes downstream of Ciona intestinalis Brachyury (Ci-Bra), and characterized the expression profiles of 45 of these in differentiating notochord cells. In this study, we looked for cisregulatory sequences in minimal enhancers of 20 Ci-Bra downstream genes by electroporating region within approximately 3 kb upstream of each gene fused with lacZ. Eight of the 20 reporters were expressed in notochord cells. The minimal enchancer for each of these eight genes was narrowed to a region approximately 0.5-1.0-kb long. We also explored the genome-wide and coordinate regulation of 43 Ci-Bra-downstream genes. When we determined their chromosomal localization, it became evident that they are not clustered in a given region of the genome, but rather distributed evenly over 13 of the 14 pairs of chromosomes, suggesting that gene clustering does not contribute to coordinate control of the Ci-Bra downstream gene expression. Our results might provide Insights Into the molecular mechanisms underlying notochord formation in chordates.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Stability of backwater-influenced river bifurcations: A study of the Mississippi-Atchafalaya system

NASA Astrophysics Data System (ADS)

Edmonds, D. A.

2012-04-01

In this paper I use numerical modeling to show that the hydraulic backwater profile creates a feedback that may stabilize river bifurcations. The numerical model simulates flow and sediment transport in the Mississippi-Atchafalaya River system without the Old River Control Structure. The results show that bifurcation evolution strongly depends on the discharge upstream of the bifurcation. At upstream discharges greater than 12600 m3 s-1 the Atchafalaya River discharge increases through time at the expense of the Mississippi River. Interestingly, at upstream discharges lower than 12600 m3 s-1 the opposite occurs and the Mississippi River discharge increases at the expense of the Atchafalaya River. The capture direction changes because the backwater profile of each river varies enough at high and low discharge to invert the water surface slope ratio. These results suggest that the capture direction would change at high and low flow, which would have a stabilizing effect by preventing the runaway growth of one channel. Accounting for this, I calculate that in the absence of the Old River Control Structure capture would not happen catastrophically, but rather the Atchafalaya River would capture the Mississippi River in ˜300 years from present day.

Differential transcriptome expression in human nucleus accumbens as a function of loneliness

PubMed Central

Canli, Turhan; Wen, Ruofeng; Wang, Xuefeng; Mikhailik, Anatoly; Yu, Lei; Fleischman, Debra; Wilson, Robert S.; Bennett, David A.

2017-01-01

Loneliness is associated with impaired mental and physical health. Studies of lonely individuals reported differential expression of inflammatory genes in peripheral leukocytes and diminished activation in brain reward regions such as nucleus accumbens, but could not address gene expression in the human brain. Here, we examined genome-wide RNA expression in postmortem nucleus accumbens from donors (N = 26) with known loneliness measures. Loneliness was associated with 1 710 differentially expressed transcripts from 1 599 genes (DEGs; FDR p < 0.05, fold-change ≥ |2|, controlling for confounds) previously associated with behavioral processes, neurological disease, psychological disorders, cancer, organismal injury, and skeletal and muscular disorders, as well as networks of upstream RNA regulators. Furthermore, a number of DEGs were associated with Alzheimer’s disease genes (which was correlated with loneliness in this sample, although gene expression analyses controlled for AD diagnosis). These results identify novel targets for future mechanistic studies of gene networks in nucleus accumbens and gene regulatory mechanisms across a variety of diseases exacerbated by loneliness. PMID:27801889

Control of 3-D Modes in a Boundary Layer Undergoing Subharmonic Transition.

NASA Astrophysics Data System (ADS)

Corke, T. C.; Peto, J.; Speer, A.; Paroozan, P.; Sciammarella, C.

1997-11-01

The effect of alternating standing patterns of wall displacements in the transition region of a Falkner-Skan boundary layer with an adverse pressure gradient is investigated. Transition is controlled by introducing disturbances to excite a pair of oblique modes along with a plane TS mode. The oblique modes are at the TS subharmonic frequency in order to promote subharmonic resonance. Measurements consist of a spanwise rake of hot-wire sensors placed near the wall below the critical layer, and a 2-D (15 x 15) array of optical pressure sensors. The space-time data series are processed using 2-D Fourier analysis to determine the spanwise wave number content of the flow. Of particular interest is the streamwise vortex mode which results from a difference interaction of the subharmonic oblique modes. We examine the effect of different patterns and amplitudes of upstream wall displacements on the development of the travelling and stationary modes in this case leading to transition. Supported by ARO Grant No. DAAH04-93-G-0212

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

PubMed

Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

2011-02-24

We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

Molecular and Physiological Logics of the Pyruvate-Induced Response of a Novel Transporter in Bacillus subtilis

PubMed Central

Charbonnier, Teddy; Le Coq, Dominique; McGovern, Stephen; Calabre, Magali; Delumeau, Olivier; Aymerich, Stéphane

2017-01-01

ABSTRACT At the heart of central carbon metabolism, pyruvate is a pivotal metabolite in all living cells. Bacillus subtilis is able to excrete pyruvate as well as to use it as the sole carbon source. We herein reveal that ysbAB (renamed pftAB), the only operon specifically induced in pyruvate-grown B. subtilis cells, encodes a hetero-oligomeric membrane complex which operates as a facilitated transport system specific for pyruvate, thereby defining a novel class of transporter. We demonstrate that the LytST two-component system is responsible for the induction of pftAB in the presence of pyruvate by binding of the LytT response regulator to a palindromic region upstream of pftAB. We show that both glucose and malate, the preferred carbon sources for B. subtilis, trigger the binding of CcpA upstream of pftAB, which results in its catabolite repression. However, an additional CcpA-independent mechanism represses pftAB in the presence of malate. Screening a genome-wide transposon mutant library, we find that an active malic enzyme replenishing the pyruvate pool is required for this repression. We next reveal that the higher the influx of pyruvate, the stronger the CcpA-independent repression of pftAB, which suggests that intracellular pyruvate retroinhibits pftAB induction via LytST. Such a retroinhibition challenges the rational design of novel nature-inspired sensors and synthetic switches but undoubtedly offers new possibilities for the development of integrated sensor/controller circuitry. Overall, we provide evidence for a complete system of sensors, feed-forward and feedback controllers that play a major role in environmental growth of B. subtilis. PMID:28974613

Chandra observations of Jupiter's X-ray Aurora during Juno upstream and apojove intervals

NASA Astrophysics Data System (ADS)

Dunn, W.; Jackman, C. M.; Kraft, R.; Gladstone, R.; Branduardi-Raymont, G.; Knigge, C.; Altamirano, D.; Elsner, R.; Kammer, J.

2017-12-01

The Chandra space telescope has recently conducted a number of campaigns to observe Jupiter's X-ray aurora. The first set of campaigns took place in summer 2016 while the Juno spacecraft was upstream of the planet sampling the solar wind. The second set of campaigns took place in February, June and August 2017 at times when the Juno spacecraft was at apojove. These campaigns were planned following the Juno orbit correction to capitalise on the opportunity to image the X-ray emission while Juno was orbiting close to the expected position of the magnetopause. Previous work has suggested that the auroral X-ray emissions map close to the magnetopause boundary [e.g. Vogt et al., 2015; Kimura et al., 2016; Dunn et al., 2016] and thus in situ spacecraft coverage in this region combined with remote observation of the X-rays afford the chance to constrain the drivers of these energetic emissions and determine if they originate on open or closed field lines. We aim to examine possible drivers of X-ray emission including reconnection and the Kelvin-Helmholtz instability and to explore the role of the solar wind in controlling the emissions. We report on these upstream and apojove campaigns including intensities and periodicities of auroral X-ray emissions. This new era of jovian X-ray astronomy means we have more data than ever before, long observing windows (up to 72 ks for this Chandra set), and successive observations relatively closely spaced in time. These features combine to allow us to pursue novel methods for examining periodicities in the X-ray emission. Our work will explore significance testing of emerging periodicities, and the search for coherence in X-ray pulsing over weeks and months, seeking to understand the robustness and regularity of previously reported hot spot X-ray emissions. The periods that emerge from our analysis will be compared against those which emerge from radio and UV wavelengths.

MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

PubMed Central

Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

2012-01-01

Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

Reducing Urban Greenhouse Gas Footprints.

PubMed

Pichler, Peter-Paul; Zwickel, Timm; Chavez, Abel; Kretschmer, Tino; Seddon, Jessica; Weisz, Helga

2017-11-07

Cities are economically open systems that depend on goods and services imported from national and global markets to satisfy their material and energy requirements. Greenhouse Gas (GHG) footprints are thus a highly relevant metric for urban climate change mitigation since they not only include direct emissions from urban consumption activities, but also upstream emissions, i.e. emissions that occur along the global production chain of the goods and services purchased by local consumers. This complementary approach to territorially-focused emission accounting has added critical nuance to the debate on climate change mitigation by highlighting the responsibility of consumers in a globalized economy. Yet, city officials are largely either unaware of their upstream emissions or doubtful about their ability to count and control them. This study provides the first internationally comparable GHG footprints for four cities (Berlin, Delhi NCT, Mexico City, and New York metropolitan area) applying a consistent method that can be extended to other global cities using available data. We show that upstream emissions from urban household consumption are in the same order of magnitude as cities' overall territorial emissions and that local policy leverage to reduce upstream emissions is larger than typically assumed.

The monitoring of organic waste pollution in the sibelis river

NASA Astrophysics Data System (ADS)

Huda, Thorikul; Jannah, Wirdatul

2017-03-01

Has conducted monitoring of organic waste pollution in the River Sibelis of Tegal City of Central Java. Organic wastes that pollute River Sibelis can degrade the quality of well water along the river. Monitoring carried out in the upstream and downstream by chemical oxygen demand (COD) and biochemical oxygen demand (BOD) parameters. COD test methods by titration and the results are used to determine the test sample comparison with the volume of diluent required for analysts BOD. COD test results on the upstream and downstream Sibelis River respectively 58.13 mg/L and 73.97 mg / L so that the ratio of the test sample with diluent volume for BOD analysis is 20: 280 (Sawyer, 1978). BOD test principle is based on the reduction of dissolved oxygen zero day (DO0) and five days (DO5). The result of observation BOD samples at upstream and downstream Sibelis Rivers are 10.7212 mg / L and 5.3792 mg / L respectively. Quality control of BOD testing conducted with measurement accuracy and precision and obtained result are 85.36% and 0.27% respectively. The result of uncertainty measurement for BOD testing at upstream and downstream are ±0.4469 mg/L and ±0.22188 mg/L.

Examining the freezing process of an intermediate bulk containing an industrially relevant protein

PubMed Central

Reinsch, Holger; Spadiut, Oliver; Heidingsfelder, Johannes; Herwig, Christoph

2015-01-01

Numerous biopharmaceuticals are produced in recombinant microorganisms in the controlled environment of a bioreactor, a process known as Upstream Process. To minimize product loss due to physico-chemical and enzymatic degradation, the Upstream Process should be directly followed by product purification, known as Downstream Process. However, the Downstream Process can be technologically complex and time-consuming which is why Upstream and Downstream Process usually have to be decoupled temporally and spatially. Consequently, the product obtained after the Upstream Process, known as intermediate bulk, has to be stored. In those circumstances, a freezing procedure is often performed to prevent product loss. However, the freezing process itself is inseparably linked to physico-chemical changes of the intermediate bulk which may in turn damage the product. The present study analysed the behaviour of a Tris-buffered intermediate bulk containing a biopharmaceutically relevant protein during a bottle freezing process. Major damaging mechanisms, like the spatiotemporal redistribution of ion concentrations and pH, and their influence on product stability were investigated. Summarizing, we show the complex events which happen in an intermediate bulk during freezing and explain the different causes for product loss. PMID:25765305

Effects of selenium supplementation in cattle on aquatic ecosystems in northern California

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norman, B.; Nader, G.; Oliver, M.

1992-09-15

The potential impact on aquatic ecosystems of supplementing the diets of beef cattle with selenium (Se) was studied on 4 northern California ranches. All study sites included an area of concentrated use by cattle that had diets supplemented with Se. In each case, a stream flowed through the site and provided a control sampling area upstream and a treated sampling area downstream. Specimens of water, sediment, algae, aquatic plants, aquatic invertebrates, and fish were analyzed fluorometrically for total Se content. Significant differences in Se concentration were not found between specimens from upstream control areas and those from downstream areas subjectedmore » to use by Se-treated cattle. Evidence was not found that Se supplementation in cattle at maximal permitted concentrations caused Se accumulation in associated aquatic ecosystems.« less

Signal Decomposition of High Resolution Time Series River Data to Separate Local and Regional Components of Conductivity

EPA Science Inventory

Signal processing techniques were applied to high-resolution time series data obtained from conductivity loggers placed upstream and downstream of an oil and gas wastewater treatment facility along a river. Data was collected over 14-60 days. The power spectral density was us...

Pressure Scalings and Influence Region Research

DTIC Science & Technology

2018-01-01

the results are briefly discussed. Additionally, updated experimental results are presented along with discussion of collaborative research efforts...with upstream and downstream influence, where the influence lengths are defined in terms of a-priori quantities (freestream conditions and...governing equations and the result is briefly discussed. Additionally, updated experimental results are presented along with discussion of

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

ERIC Educational Resources Information Center

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Spectral properties of Langmuir and beam-mode waves observed inside terrestrial foreshock by Cluster spacecraf

NASA Astrophysics Data System (ADS)

Pisa, D.; Soucek, J.; Santolik, O.

2016-12-01

Electrostatic plasma waves are commonly observed in the upstream regions of planetary shocks. Solar wind electrons accelerated at the shock front are reflected back into the solar wind and form electron beams. The electron distribution becomes unstable and electrostatic waves are generated inside the foreshock region. The processes of generation and evolution of electrostatic waves significantly depend on the solar wind plasma conditions and generally exhibit complex behavior. Langmuir waves can be identified as intense narrowband emission at the local plasma frequency and weaker broadband beam-mode waves below and above the plasma frequency deeper in the downstream region. We present a long-term survey of Langmuir and beam-mode waves in the vicinity of the plasma frequency observed upstream of the terrestrial bow shock by the Cluster spacecraft. Using solar wind data and bow shock positions from OMNI, as well as in-situ measurements of interplanetary magnetic field, we have mapped all available spacecraft positions into foreshock coordinates. For a study of plasma waves, we have used spectra and local plasma frequencies obtained from a passive and active mode of the WHISPER instrument. We show a spatial distribution of wave frequencies and spectral widths as a function of foreshock positions and solar wind conditions.

Dynamic interplay and function of multiple noncoding genes governing X chromosome inactivation

PubMed Central

Yue, Minghui; Richard, John Lalith Charles

2015-01-01

There is increasing evidence for the emergence of long noncoding RNAs (IncRNAs) as important components, especially in the regulation of gene expression. In the event of X chromosome inactivation, robust epigenetic marks are established in a long noncoding Xist RNA-dependent manner, giving rise to a distinct epigenetic landscape on the inactive X chromosome (Xi). The X inactivation center (Xic is essential for induction of X chromosome inactivation and harbors two topologically associated domains (TADs) to regulate monoallelic Xist expression: one at the noncoding Xist gene and its upstream region, and the other at the antisense Tsix and its upstream region. The monoallelic expression of Xist is tightly regulated by these two functionally distinct TADs as well as their constituting IncRNAs and proteins. In this review, we summarize recent updates in our knowledge of IncRNAs found at the Xic and discuss their overall mechanisms of action. We also discuss our current understanding of the molecular mechanism behind Xist RNA-mediated induction of the repressive epigenetic landscape at the Xi. PMID:26260844

Discharge rating equation and hydraulic characteristics of standard Denil fishways

USGS Publications Warehouse

Odeh, M.

2003-01-01

This paper introduces a new equation to predict discharge capacity in the commonly used Denil fishway using water surface elevation in the upstream reservoir and fishway width and slope as the independent variables. A dimensionless discharge coefficient based only on the physical slope of the fishway is introduced. The discharge equation is based on flow physics, dimensional analysis, and experiments with three full-scale fishways of different sizes. Hydraulic characteristics of flow inside these fishways are discussed. Water velocities decreased by more than 50% and remained relatively unchanged in the fully developed flow downstream of the vena contracta region, near the upstream baffle where fish exit the fishway. Engineers and biologists need to be aware of this fact and ensure that fish can negotiate the vena contracta velocities rather than velocities within the developed flow region only. Discharge capacity was directly proportional to the fishway width and slope. The new equation is a design tool for engineers and field biologists, especially when designing a fishway based on flow availability in conjunction with the swimming capabilities of target fish species.

Association of ADRB2 polymorphism with triglyceride levels in Tongans.

PubMed

Naka, Izumi; Ohashi, Jun; Kimura, Ryosuke; Inaoka, Tsukasa; Matsumura, Yasuhiro

2013-07-23

Our previous study demonstrated that the A-allele of the single nucleotide polymorphism (SNP) rs34623097 located in the upstream region of the β2 adrenergic receptor gene (ADRB2) is significantly associated with risk for obesity in Oceanic populations. To investigate whether the ADRB2 polymorphisms explain part of the individual differences in lipid mobilization, energy expenditure and glycogen breakdown, the associations of 10 ADRB2 SNPs with total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and triglyceride levels were examined in 128 adults in Tonga. A multiple linear regression analysis adjusted for age, sex, and body mass index revealed that rs34623097 was significantly associated with triglyceride levels (P-value = 0.037). A copy of the rs34623097-A allele increased serum triglyceride levels by 70.1 mg/dL (0.791 mmol/L). None of the ADRB2 SNPs showed a significant association with total-cholesterol, high-density lipoprotein cholesterol, or low-density lipoprotein cholesterol. In a Tongan population, a SNP located in the upstream region of ADRB2 is associated with triglyceride levels independent of body mass index.

Nozzle cavity impingement/area reduction insert

DOEpatents

Yu, Yufeng Phillip; Itzel, Gary Michael; Osgood, Sarah Jane

2002-01-01

A turbine vane segment is provided that has inner and outer walls spaced from one another, a vane extending between the inner and outer walls and having leading and trailing edges and pressure and suction sides, the vane including discrete leading edge, intermediate, aft and trailing edge cavities between the leading and trailing edges and extending lengthwise of the vane for flowing a cooling medium; and an insert sleeve within at least one of the cavities and spaced from interior wall surfaces thereof. The insert sleeve has an inlet for flowing the cooling medium into the insert sleeve and has impingement holes defined in first and second walls thereof that respectively face the pressure and suction sides of the vane. The impingement holes of at least one of those first and second walls are defined along substantially only a first, upstream portion thereof, whereby the cooling flow is predominantly impingement cooling along a first region of the insert wall corresponding to the first, upstream portion and the cooling flow is predominantly convective cooling along a second region corresponding to a second, downstream portion of the at least one wall of the insert sleeve.

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Numerical simulation of the effect of upstream swirling flow on swirl meter performance

NASA Astrophysics Data System (ADS)

Chen, Desheng; Cui, Baoling; Zhu, Zuchao

2018-04-01

Flow measurement is important in the fluid process and transmission system. For the need of accuracy measurement of fluid, stable flow is acquired. However, the elbows and devices as valves and rotary machines may produce swirling flow in the natural gas pipeline networks system and many other industry fields. In order to reveal the influence of upstream swirling flow on internal flow fields and the metrological characteristics, numerical simulations are carried out on the swirl meter. Using RNG k-ɛ turbulent model and SIMPLE algorithm, the flow field is numerically simulated under swirling flows generated from co-swirl and counter-swirl flow. Simulation results show fluctuation is enhanced or weakened depending on the rotating direction of swirling flow. A counter- swirl flow increases the entropy production rate at the inlet and outlet of the swirler, the junction region between throat and divergent section, and then the pressure loss is increased. The vortex precession dominates the static pressure distributions on the solid walls and in the channel, especially at the end region of the throat.

Differential regulation of hepatitis B virus core protein expression and genome replication by a small upstream open reading frame and naturally occurring mutations in the precore region.

PubMed

Zong, Li; Qin, Yanli; Jia, Haodi; Ye, Lei; Wang, Yongxiang; Zhang, Jiming; Wands, Jack R; Tong, Shuping; Li, Jisu

2017-05-01

Hepatitis B virus (HBV) transcribes two subsets of 3.5-kb RNAs: precore RNA for hepatitis B e antigen (HBeAg) expression, and pregenomic RNA for core and P protein translation as well as genome replication. HBeAg expression could be prevented by mutations in the precore region, while an upstream open reading frame (uORF) has been proposed as a negative regulator of core protein translation. We employed replication competent HBV DNA constructs and transient transfection experiments in Huh7 cells to verify the uORF effect and to explore the alternative function of precore RNA. Optimized Kozak sequence for the uORF or extra ATG codons as present in some HBV genotypes reduced core protein expression. G1896A nonsense mutation promoted more efficient core protein expression than mutated precore ATG, while a +1 frameshift mutation was ineffective. In conclusion, various HBeAg-negative precore mutations and mutations affecting uORF differentially regulate core protein expression and genome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

PubMed Central

Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

2002-01-01

The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

1988-01-01

Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

Nonlinear Wave-Particle Interaction: Implications for Newborn Planetary and Backstreaming Proton Velocity Distribution Functions

NASA Astrophysics Data System (ADS)

Romanelli, N.; Mazelle, C.; Meziane, K.

2018-02-01

Seen from the solar wind (SW) reference frame, the presence of newborn planetary protons upstream from the Martian and Venusian bow shocks and SW protons reflected from each of them constitutes two sources of nonthermal proton populations. In both cases, the resulting proton velocity distribution function is highly unstable and capable of giving rise to ultralow frequency quasi-monochromatic electromagnetic plasma waves. When these instabilities take place, the resulting nonlinear waves are convected by the SW and interact with nonthermal protons located downstream from the wave generation region (upstream from the bow shock), playing a predominant role in their dynamics. To improve our understanding of these phenomena, we study the interaction between a charged particle and a large-amplitude monochromatic circularly polarized electromagnetic wave propagating parallel to a background magnetic field, from first principles. We determine the number of fix points in velocity space, their stability, and their dependence on different wave-particle parameters. Particularly, we determine the temporal evolution of a charged particle in the pitch angle-gyrophase velocity plane under nominal conditions expected for backstreaming protons in planetary foreshocks and for newborn planetary protons in the upstream regions of Venus and Mars. In addition, the inclusion of wave ellipticity effects provides an explanation for pitch angle distributions of suprathermal protons observed at the Earth's foreshock, reported in previous studies. These analyses constitute a mean to evaluate if nonthermal proton velocity distribution functions observed at these plasma environments present signatures that can be understood in terms of nonlinear wave-particle processes.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

PubMed Central

Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

2012-01-01

NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

A model of water and sediment balance as determinants of relative sea level rise in contemporary and future deltas

NASA Astrophysics Data System (ADS)

Tessler, Zachary D.; Vörösmarty, Charles J.; Overeem, Irina; Syvitski, James P. M.

2018-03-01

Modern deltas are dependent on human-mediated freshwater and sediment fluxes. Changes to these fluxes impact delta biogeophysical functioning and affect the long-term sustainability of these landscapes for human and for natural systems. Here we present contemporary estimates of long-term mean sediment balance and relative sea level rise across 46 global deltas. We model scenarios of contemporary and future water resource management schemes and hydropower infrastructure in upstream river basins to explore how changing sediment fluxes impact relative sea level rise in delta systems. Model results show that contemporary sediment fluxes, anthropogenic drivers of land subsidence, and sea level rise result in delta relative sea level rise rates that average 6.8 mm/y. Assessment of impacts of planned and under-construction dams on relative sea level rise rates suggests increases on the order of 1 mm/y in deltas with new upstream construction. Sediment fluxes are estimated to decrease by up to 60% in the Danube and 21% in the Ganges-Brahmaputra-Meghna if all currently planned dams are constructed. Reduced sediment retention on deltas caused by increased river channelization and management has a larger impact, increasing relative sea level rise on average by nearly 2 mm/y. Long-term delta sustainability requires a more complete understanding of how geophysical and anthropogenic change impact delta geomorphology. Local and regional strategies for sustainable delta management that focus on local and regional drivers of change, especially groundwater and hydrocarbon extraction and upstream dam construction, can be highly impactful even in the context of global climate-induced sea level rise.

Transverse jet shear layer instabilities and their control

NASA Astrophysics Data System (ADS)

Karagozian, Ann

2013-11-01

The jet in crossflow, or transverse jet, is a canonical flowfield that has relevance to engineering systems ranging from dilution jets and film cooling for gas turbine engines to thrust vector control and fuel injection in high speed aerospace vehicles to environmental control of effluent from chimney and smokestack plumes. Over the years, our UCLA Energy and Propulsion Research Lab's studies on this flowfield have focused on the dynamics of the vorticity associated with equidensity and variable density jets in crossflow, including the stability characteristics of the jet's upstream shear layer. A range of different experimental diagnostics have been used to study the jet's upstream shear layer, whereby a transition from convectively unstable behavior at high jet-to-crossflow momentum flux ratios to absolutely unstable flow at low momentum flux and/or density ratios is identified. These differences in shear layer stability characteristics have a profound effect on how one employs external excitation to control jet penetration, spread, and mixing, depending on the flow regime and specific engineering application. These control strategies, and challenges for future research directions, will be identified in this presentation.